WO2005113791A2

WO2005113791A2 - Methods of identifying modulators of bacterial type iii protein secretion system

Info

Publication number: WO2005113791A2
Application number: PCT/US2005/015809
Authority: WO
Inventors: Raul Goldschmidt; Michael Loeloff
Original assignee: Johnson & Johnson Product Research And Development
Priority date: 2004-05-07
Filing date: 2005-05-06
Publication date: 2005-12-01
Also published as: WO2005113791A3

Abstract

The present invention provides methods to identify inhibitors or activators of bacterial type III protein secretion system using a recombinant β-lactamase that can be secreted by a type III protein secretion system. Such an assay can be easily adopted in a high thoroughput mode that allows the daily screening of several tens of thousands compounds. Inhibitors for the Salmonella typhimurium SPI-1 type III protein secretion system have been identified in applying methods of the invention. These inhibitors were shown to be active against the type III protein secretion system of other Gram-negative bacteria, such as Pseudomonas aeruginosa. The compounds identified by the methods of the invention can be used as new antimicrobial therapeutics.

Description

METHODS OF IDENTIFYING MODULATORS OF BACTERIAL TYPE III PROTEIN SECRETION SYSTEM

Field of the Invention The present invention relates to methods of identifying anti-microbial compounds. More particularly, the present invention relates to methods of identifying activators or inhibitors of bacterial type III protein secretion systems.

Background of the Invention For nearly seventy years antimicrobial agents have been the mainstay in our efforts to avert human infectious diseases. The selection and dissemination of drug- resistance among many species. of bacteria, however, threatens to limit the effectiveness of available antimicrobial agents to treat infectious diseases. The problem is largely due to strong selective pressures for drug-resistant mutants from widespread therapeutic and prophylactic use of broad-spectrum antibiotics, and to the relatively fast rate of multiplication of bacteria. Genetic transfer of drug-resistance determinants among bacteria has further contributed to the problem. This has resulted in increasing occurrence of bacteria with reduced susceptibility to one or more of the antibacterial agents most commonly used to treat infections, thus narrowing the available choices for therapy. It has become increasingly important to identify novel targets for antimicrobial agents that will convey weaker selective pressure for the dissemination of drug resistance determinants. One group of such targets are virulence determinants, which are present among pathogenic but are absent from commensal bacteria and whose expression or function during invasion is temporally delimited. But, most virulence determinants are only conserved among bacteria of closely related species and genera. Hence their usefulness as antibacterial targets is somewhat limited by their narrow spectrum. An exception is the type III protein secretion systems. Type III protein secretion systems are dedicated bacterial secretion systems that are essential to virulence (Hueck, 1998, Microbiol . Mol . Biol . Rev. 62: 379-433; Galan, 1999, Science 284:1322-28). They are encountered in many Gram-negative pathogenic bacteria, including, but not limited to, Salmonella, Shigella, Yersinia, enteropathogenic and enterohemorrhagic Escherichia coli , Bordetella , Chlamydia, Citrobacter, Pseudomonas , Burkholderia, Xanthomonas , Erwinia , and

Ralstonia . They allow pathogenic bacteria adhering at the surface of a eukaryotic cell to deliver bacterial proteins into eukaryotic cells, across the bacterial and eukaryotic cell membranes. The injected proteins interfere with normal cellular processes by subverting the signaling cascades of the aggressed cell , promoting the intracellular uptake of some bacterial pathogens, or the extracellular survival of others, thus furthering the various strategies used by different bacteria to invade their hosts. Type III protein secretion systems contribute to a number of different human, and animal infectious diseases with a variety of symptoms and severities, from fatal septicemia to mild diarrhea and from fulgurant diarrhea to infection of the lung. Type III protein secretion is also associated with producing disease in susceptible plant hosts and eliciting the so-called hypersensitive response in resistant plants. Type III protein secretion systems usually consist of more than 20 proteins. Some of the proteins form the secretion apparatus, which in several instances has been visualized to form a structure of a needle complex. Some protein components of the needle complex are also substrates 'of the secretion apparatus. Others of the 20 or so proteins are substrates of the secretion apparatus and are released outside of the bacterial cells. Some of the released proteins, so called "effectors", are delivered into the cytosol of target eukaryotic cells where they interfere with cellular signal transduction systems. Others of the released proteins, so called

"translocators" , help effectors to cross the membrane of eukaryotic cells. Type Til protein secretion systems are structurally conserved. Although there is little homology among substrates of the systems, certain components of the secretory apparatus are highly conserved among different bacteria. In addition, type III protein secretion systems are functionally conserved. A system of one particular bacterium could secret effectors from systems of different species or genus. There are no eukaryotic homologues for the bacterial type III protein secretion components. Type III protein secretion systems can be an excellent target for identifying novel antibacterial agents that convey weaker selective pressure for the dissemination of drug resistance determinants. The lack of eukaryotic homologues suggests that inhibitors of bacterial type III protein secretion will not interfere with the functions of human cells. On the other hand, the structural and functional conservation of type III protein secretion among bacteria suggests that an inhibitor of the type III protein secretion system of one particular bacterial pathogen could also inhibit type III protein secretion among many other pathogenic bacteria. Thus, compounds targeting type III protein secretion systems may represent a novel class of extended spectrum antibacterial agents that inhibit disease production in several virulent organisms . In contrast to previously known antimicrobial agents, inhibitors of type III secretion may not kill or inhibit growth of bacterial pathogens in a free-living environment. Although type III protein secretion systems are essential to virulence, they are not essential to bacterial growth in culture media under laboratory conditions, or in other free-living natural environments. The requirement of type III protein secretion system is temporally circumscribed to particular stages of host invasion. Indeed mutations that inactivate components of type III protein secretion result in avirulence or significantly attenuated virulence in animal infection models but do not affect the growth rate of bacteria grown in culture media. Therefore, inhibitors of type III secretion are expected to only block the secretion of virulence factors that are critical for the bacterial invasion of the host and infectious disease, without killing the bacteria. Thus, unlike regular antibacterial agents, type III protein secretion inhibitors may only minimally and transiently select for resistant mutants. Inhibitors of type III protein secretion would not exert selective pressure over the host commensal flora of nonpathogenic bacteria that do not possess type III protein secretion systems, . and should only exert a small and time-restricted selective pressure over bacteria that contain these dedicated virulence factor exporting systems. Because of the weaker selective pressure conveyed by a type III protein secretion inhibitor, the inhibitor can be used not only therapeutically but also prophylactically for the treatment or prevention of infectious diseases caused by pathogenic Gram-negative bacteria harboring type III protein secretion systems. The inhibitor will be greatly useful alone or in combination with a previously established antibacterial agent for the care of pre- and post-surgery patients. For example, the inhibitors can be used prophylactically in circumstances where there is risk of exposure to serious intestinal pathogenic bacteria, such as Salmonella, Shigella, Yersinia, and enteropathogenic or enterohemorrhagic Esch.exich.ia coli . The inhibitors can also be used prophylactically in the prevention of Pseudomonas caused ventilator-associated pneumonia (VAP) for patients on respirators in intensive care units'. Another potential use for inhibitors of type III protein secretion is against Chlamydia pneumoniae, which has been suggested to contribute to cardiovascular diseases (see Campbell et al . , Nat Rev Microbiol . 2004, 2(1) :23-32) . Elimination of Chlamydia pneumoniae from the bloodstream may require long courses of antimicrobial therapy. Such treatments would select both extensively and indiscriminately for resistant mutants among the indigenous flora. Therefore, use of type III protein secretion inhibitors would be a highly desirable alternative . The search for molecules capable of inhibiting type III protein secretion systems is technically challenging. First, the secretion system is only weakly active when bacteria are grown in standard laboratory conditions . Second, most proteins secreted naturally by the type III systems lack easily measurable enzymatic activities, and their secretion must be evaluated using ELISA, which is time consuming, expensive, and limits assay throughput. Some methods for identifying inhibitors of type III secretion system have been described, see for example, US6136542, US6586200, 09945136, and WO0248185.

Summary of the Invention The present invention provides a method of identifying activators or inhibitors of bacterial type III protein secretion systems. This method was easily adapted into a homogeneous high throughput assay that allowed the daily screening of several tens of thousands of compounds . In one aspect, the present invention provides a method of identifying an activator or inhibitor of a type III protein secretion system, comprising the steps of: a) exposing a Gram-negative bacterial cell to a candidate compound, wherein said bacterial cell contains a recombinant β-lactamase whose secretion is dependent on a type III protein secretion system; and b) detecting the amount of recombinant β-lactamase secreted outside the bacterial cell; wherein an inhibitor for the bacterial type III secretion system decreases the amount of recombinant β-lactamase secreted outside the bacterial cell as compared to a control bacterial cell not contacted with the inhibitor; and an activator for the^' bacterial type III secretion system increases the amount of recombinant β-lactamase secreted outside the bacterial cell as compared to a control bacterial cell not contacted with the activator. In a preferred embodiment of the invention, the Gram- negative bacterial cell is a Salmonella bacterial cell that contains a recombinant β-lactamase whose secretion is dependent on the SPI-1-encoded type III protein secretion system. Another aspect of the present invention is a method of monitoring the activity of a type III protein secretion system in a Gram-negative bacterial cell, comprising the steps of: ϊ) introducing a recombinant expression vector into the bacterial cell, wherein the vector is capable of expressing a recombinant β-lactamase whose secretion is dependent on the type III protein secretion system of the bacterial 'cell; 2) selecting the recombinant bacterial host cell that is capable of expressing the recombinant . β- lactamase; 3) detecting the amount of recombinant β- lactamase secreted outside the recombinant bacterial host cell . .The present invention further provides an isolated recombinant β-lactamase whose secretion is dependent on a type III protein secretion system. The present invention also provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a recombinant β-lactamase whose secretion is dependent on a type III protein secretion system. Also included in the present invention is a vector or a recombinant Gram-negative bacterial cell that comprises a nucleic acid molecule of the invention.

Brief Description of the Drawings Figure 1 illustrates the structure of plasmid pPRI449 that carries nucleotide sequence encoding a recombinant β-lactamase, the SopE'-'Bla chimera. The secretion of the recombinant β-lactamase is dependent on a SPI-1 encoded type III secretion system of Salmonella typhimurium.

Figure 2 graphically represents both the amount of the recombinant β-lactamase expressed by plasmid pPRI449 in Salmonella typhymurium inside cells and its secretion to the extracellular medium. The secreted recombinant protein is monitored colorimetrically by the associated β-lactamase activity using nitrocefin as substrate.

Detailed Description of the Invention All publications cited herein are hereby incorporated by reference. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention pertains. As used herein, the terms "comprising", "containing", "having" and "including" are used in their open, non- limiting sense. The following are abbreviations that are at times used in this specification: bp = base pair Bla = β-lactamase gene cDNA = complementary DNA ELISA = enzyme-linked immunoabsorbent assay kb = kilobase; 1000 base pairs nt = nucleotide PAGE = polyacrylamide gel electrophoresis PCR = polymerase chain reaction RT-PCR = Reverse transcription polymerase chain reaction SDS = sodium dodecyl sulfate SSC = sodium chloride/sodium citrate TJTR = untranslated region "An activity", "a biological activity", or "a functional activity" of a type III protein secretion system as used herein refers to the protein secretion activity exerted by a type III protein secretion system as determined in vivo, or in vi tro, according to standard techniques. Such activities can be quantified by the amount of proteins secreted by the type III protein secretion system. An "activator" or "inhibitor" of a type III protein secretion system refer to an activating or inhibitory molecule identified using in vitro and in vivo assays for activity of type III protein secretion systems. In particular, an "inhibitor" refers to a compound that decreases, blocks, prevents, delays activation, inactivates, desensitizes or down regulates the activity of a type III protein secretion system, or speeds or enhances deactivation of a type III protein secretion system. An "activator" is a compound that increases, activates, facilitates, enhances activation of, sensitizes or up regulates the activity of a type III protein secretion system, or delays or slows inactivation of the type III protein secretion system. "Modulators" include both the "inhibitors" and "activators" . A "β-lactamase protein" or "β-lactamase" refers to an enzyme that brings about the hydrolysis of a beta-lactam, such as the hydrolysis of penicillin to penicilloic acid. For example, a "β-lactamase protein" can be either one of the more than 400 β-lactamase protein that have been found in Gram-negative bacteria resistant to penicillin and cephalosporins and Gram-positive bacteria, such as staphylococci . Another example of a "β-lactamase protein" can be any mutational derivative of the naturally occurring enzymes that is still capable of hydrolyzing a beta-lactam. A naturally occurring β-lactamase protein is first synthesized in the bacterial cytoplasm as a precursor protein with a cleavable amino-terminal signal peptide. The signal peptide is proteolytically removed by signal peptidases during or shortly after translocation or secretion of the mature protein to the periplasm of Gram- negative bacteria or the extracellular medium of Gram- positive bacteria. A "mature β-lactamase" refers to a protein that lacks the signal sequence recognizable by a protein secretion system but is still capable of hydrolyzing a beta-lactam. A mature β-lactamase alone cannot be translocated or secreted. As shown by the present invention, operably linking a secretory signal recognizable by a type III secretion system to the N-terminal end of the mature β- lactamase protein, results in secretion of the recombinant β-lactamase protein outside of the bacterium by the type III secretion system. A "mature β-lactamase" protein can be derived from any naturally occurring β-lactamase found in any bacterium, or the mutational derivatives thereof. For example, a "mature β-lactamase" can be derived from β- lactamase found in sources include, but are not limited to, S. typhimurium (GenBank protein accession No: AAM28884) , Yersinia enterocolitica (GenBank protein accession No: CAA44850) , E. coli K12 (GenBank protein accession No: NP_418574) , Pseudomonas aeruginosa (GenBank protein accession No: AAK26253), Shigella flexneri 2a (GenBank protein accession No: AAL08436) , Xanthomonas axonopodis pv. ci tri str. 306 (GenBank protein accession No: NP_643664) , the TEM-1 β-lactamase (GenBank protein accession No: AAB59737) encoded within the cloning vector pBR322 (GenBank accession number J01749) , and so forth. A "recombinant β-lactamase" as used herein refers to a polypeptide produced by recombinant DNA techniques and capable of hydrolyzing a beta-lactam such as nitrocefin.

For example, the recombinant β-lactamase of the invention can comprise a secretory signal recognizable by a type III secretion system operably linked to the N-terminal end of a mature β-lactamase. Within a recombinant β-lactamase protein, the term "operably linked" is intended to indicate that a polypeptide comprising the secretory signal recognizable by a type III secretion system is added to the N- terminal end of the mature β-lactamase protein. Within a recombinant nucleic acid molecule, "operably linked" is intended to mean that a nucleotide sequence encoding a polypeptide comprising the secretory signal recognizable by a type III secretion system is linked in-frame to the 5' -end of the nucleotide sequence encoding the mature β-lactamase protein. Within a recombinant expression vector, "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence (s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the recombinant nucleic acid molecule is introduced into the host cell) . As used herein, "a colorimetric detection method" refers to a method comprising the step of detecting a colored agent in a test sample. Methods of the present invention can utilize any of the "colorimetric detection methods" that have been used or yet to be developed to determine the enzymatic activity of β-lactamase. As used herein, the term "eukaryotic host" refers to organisms that are infected by the bacterial pathogens. The eukaryotic host may be a human, animal, or plant. A "gene" is a segment of DNA involved in producing a peptide, polypeptide, or protein, and the mRNA encoding such protein species, including the coding region, non- coding regions, for example, regulatory sequence, preceding ("5'UTR") or following ("3'TJTR") the coding region. A "gene" may also include intervening non-coding sequences ("introns") between individual coding segments ("exons") . A "coding region" refers to the portion of a gene that encodes amino acids and the start and stop signals for the translation of the corresponding polypeptide via triplet-base codons . A "regulatory sequence" refers to the portion of a gene that can control the expression of the gene. A "regulatory sequence" can include promoters, enhancers and other expression^' control elements such as ribosome binding site, and/or, an operator. "Promoter" means a regulatory sequence of DNA that is involved in the binding of RNA polymerase to initiate transcription of a gene. Promoters are often upstream ("5' to") the transcription initiation site of the gene . "Gram-negative bacteria" as used herein refers to a diverse group of bacteria that decolorize upon treatment with alcohol or acetone when stained by Gram' s method using crystal violet. The property of being colored dark violet or not, by the staining procedure developed by Gram in 1884 is an important taxonomic feature which correlates with many properties of bacteria. A typical Gram's staining method begins with the addition of the basic dye crystal violet, such as methyl violet, to the fixed bacteria. This is followed by treatment with an iodine solution, such as 3% iodine/potassium iodide solution. The cells are then treated with alcohol. The Gram-positive bacteria retain the dye-iodine complex and hence remain deep blue-purple, whereas the Gram-negative cells are destained by the alcohol. A counterstain such as fuchsin allows the latter to be visualized. The Gram-negative bacteria as used herein, include, but are not limited to Salmonella, Shigella, Yersinia, enteropathogenic and enterohemorrhagic Escherichia coli , Bordetella, Chlamydia, Ci trobacter, Pseudomonas, Burkholderia, Xanthomonas, Erwinia , and Ralstonia . The term "high throughput" refers to an assay design that allows easy screening of multiple samples simultaneously, and provides a capacity for robotic manipulation. Another desired feature of high throughput assays is an assay design that is optimized to reduce reagent usage, or- minimize the number of manipulations in order to achieve the analysis desired. Examples of high throughput assay formats include 96- well or 384-well plates, levitating droplets, and "lab on a chip" microchannel chips used for liquid handling experiments . A "homogenous assay system" refers to an assay system in which a product of the assay can be directly detected without isolating it from the assay mixture. As used herein, "in vitro laboratory conditions" refers to conditions suitable to promote the growth or maintain the existence of a bacterial cell in the absence of its eukaryotic host cell in the laboratory. "Nucleic acid molecule" or "nucleotide sequence" refers to a polymer with the arrangement of either deoxyribonucleotide or ribonucleotide residues in either single- or double-stranded form. Nucleic acid molecules can be composed of natural nucleotides of the following bases: thymidine, adenine, cytosine, guanine, and uracil; abbreviated T, A, C, G, and U, respectively, and/or synthetic analogs. An "isolated" nucleic acid molecule is one that is separated from other nucleic acid molecules present in the natural source of the nucleic acid. An "isolated" nucleic acid molecule can be, for example, a nucleic acid molecule that is free of at least one of the nucleotide sequences that naturally flank the nucleic acid molecule at its 5 ' and 3 ' ends in the genomic DNA of the organism from which the nucleic acid is derived. Isolated nucleic acid molecules include, without limitation, separate nucleic acid molecules (e.g., cDNA or genomic DNA fragments produced by PCR or restriction endonuclease treatment) independent of other sequences, as well as nucleic acid molecules that are incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, adenovirus, or herpes virus) , or into the genomic DNA of a prokaryote or eukaryote. In addition, an isolated nucleic acid molecule can include a nucleic acid molecule that is part of a hybrid or fusion nucleic acid molecule . An isolated nucleic acid molecule can be a nucleic acid sequence that is: (i) amplified in vitro by, for example, polymerase chain reaction (PCR); (ii) synthesized by, for example, chemical synthesis; (iii) recombinantly produced by cloning; or (iv) purified, as by cleavage and electrophoretic or chromatographic separation. The term "oligonucleotide" refers to a single- stranded DNA or RNA sequence of a relatively short length, for example, less than 100 residues long. For many methods, oligonucleotides of about 12-25 nucleotides in length are useful, although longer oligonucleotides of greater than about 25 nucleotides may sometimes be utilized. Some oligonucleotides can be used as "primers" for the synthesis of complimentary nucleic acid strands. For example, DNA primers can hybridize to a complimentary nucleic acid sequence to prime the synthesis of a complimentary DNA strand in reactions using DNA polymerases. Oligonucleotides are also useful for hybridization in several methods of nucleic acid detection_/ for example, in Northern blotting or in situ hybridization. A "polypeptide" or "protein" refers to a polymer with the arrangement of amino acid residues, normally in a single chain form. Polypeptide can be composed of the standard 20 naturally occurring amino acids, in addition to rare amino acids and synthetic amino acid analogs. Shorter polypeptides are generally referred to as peptides . An "isolated" or "purified" protein, or polypeptide, or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the protein is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized. The language "substantially free of cellular material" includes preparations of protein in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly produced. Thus, protein that is substantially free of cellular material includes preparations of protein having less than about 30%, 20%, 10%, or 5% (by dry weight) of heterologous protein (also referred to herein as a "contaminating protein") . When the protein or biologically active portion thereof is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 30%, 20%, 10%, or 5 % of the volume of the protein preparation. When the protein is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals that are involved in the synthesis of the protein. Accordingly such preparations of the protein have less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or compounds other than the polypeptide of interest. Isolated biologically active polypeptide can have several different physical forms. The isolated polypeptide can exist as a full-length nascent or unprocessed polypeptide, or as a partially processed polypeptide or as a combination of processed polypeptides. The full-length nascent polypeptide can be postranslationally modified by specific proteolytic cleavage events that result in the formation of fragments of the full-length nascent polypeptide. A fragment, or physical association of fragments can have the biological activity associated with the full-length polypeptide; however, the degree of biological activity associated with individual fragments can vary. An isolated or substantially purified polypeptide, can be a polypeptide encoded by an isolated nucleic acid sequence, as well as a polypeptide synthesized by, for example, chemical synthetic methods, and a polypeptide separated from biological materials, and then purified, using conventional protein analytical or preparatory procedures, to an extent that permits it to be used according to the methods described herein. A "recombinant host cell" is a cell that has had introduced into it a recombinant DNA sequence. For example, recombinant cells can contain nucleotide sequence that is not found within the native (non-recombinant) form of the cell or can express native genes that are otherwise abnormally expressed, under- expressed, or not expressed at all. Recombinant cells can also contain genes found in the native 'form of the cell wherein the genes are modified and re-introduced into the cell by artificial means. The term also encompasses cells that contain an endogenous nucleic acid that has been modified without removing the nucleic acid from the cell; such modifications include those obtained, for example, by gene replacement, and site-specific mutation. Recombinant DNA sequence can be introduced into host cells using any suitable method including, for example, electroporation, calcium phosphate precipitation, microinj ection, transformation, biolistics and viral infection. Recombinant DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell. For example, the recombinant DNA can be maintained on an episomal element, such as a plasmid. Alternatively, with respect to a stably transformed or transfected cell, the recombinant DNA has become integrated into the chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the stably transformed or transfected cell to establish cell lines or clones comprised of a population of daughter cells containing the exogenous DNA. It is further understood that the term "recombinant host cell" refers not only to the particular subject cell, but also to the progeny or potential progeny of such a cell. Because certain modifications can occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein. A "Salmonella bacterial cell" as used herein refers to a bacterial cell that belongs to the genus Salmonella . For example, the "Salmonella bacterial cell" as used herein is a serovar of Salmonella enterica, which includes Salmonella typhimurium. A "secretory signal" as used herein refers to a signal present either at the N-terminus of a protein or at the 5 ' -terminus of the mRNA encoding the protein, which is recognizable by a protein secretion system and is essential for the secretion of the protein. The secretory signal ensures the proper recognition of the protein by the secretion system and the initiation of translocation. As used herein, a "secretory signal recognizable by a type III secretion system" includes either type of secretory signals, the N-terminal amino acid sequence or the structure of the 5' mRNA. For example, the secretory signal recognizable by a type III secretion system can comprise the 15 to 17 N-terminal amino acids of the secreted protein, or it can comprise the mRNA region corresponding to the codons coding for the 15 to 17 N- terminal amino acids of the secreted protein. A "secretory signal recognizable by a type III secretion system" can be derived from any protein secreted by a type III secretion system from any Gram-negative bacterium. For example, it can be derived from proteins including, but not limited to, SopE, SipB, SipA, and SptP from S . typhimurium; YopE, YopH, YpkA/YopO, YopP/YopJ, YopM, YopT, YopB, YopD, and LcrV from Yersinia spp . ; Tir from E. coli ; ExoS, ExoT, ExoY from P. aeruginosa; IpaA, IpaB, and IpgD from Shigella spp.; AvrPto from P. syringae pv. Tomato; AvrBs2 from Xanthomonas campestris pv. Vesicatoria; and AvrBs3 from X. campestris pv. Vesicatoria (Galan, 1999, supra) . "Sequence" means the linear order in which monomers occur in a polymer, for example, the order of amino acids in a polypeptide or the order of nucleotides in a polynucleotide . "SPI-1-encoded type III protein secretion system", or "SPIl-encoded type III protein secretion system" as used herein refers to a Salmonella type III secretion system encoded by DNA within the pathogenicity island 1 located at centisome 63 of the chromosome. The SPI-1-encoded type III secretion system is expressed by Salmonella within the intestinal lumen. It is required for the uptake of Salmonella by intestinal epithelial cells. At least 19 proteins are secreted by the SPI-1 type III secretion system. The system was most likely acquired by horizontal gene transfer as suggested by its G + C content, which significantly deviates from that of the rest of the bacterial chromosome . A "type III protein secretion system",, "type III secretion system", and "type III secretion pathway" all refer to a specialized cellular machinery used by a bacterial cell to transfer proteins from its cytoplasm across the cell's inner and outer membranes into the extracellular environment, and such a specialized machinery is found among pathogenic Gram-negative bacteria, which couples protein secretion with pathogenesis . Type III protein secretion systems are dedicated bacterial secretion systems that are essential to virulence. Besides the type III protein secretion system, a bacterial cell can secrete a protein by three other major types of protein secretion systems. Type I, exemplified by the hemolysin secretion system of Escherichia coli , is a rather simple protein exporting system that is used to secret a small family of toxins. Type II is the major secretion pathway used to export many protein molecules, including some virulence factors. Type IV is another complex secretion system that is involved in the extracellular transport of pertussis toxin in Bordetella and is related to the secretion apparatus used by Agrobacterium spp. to transfer DNA into plant cells. A "transcriptional regulator" is a DNA-binding protein that binds to the regulatory region of a gene and regulates the transcription of the gene. A transcriptional regulator can be either an activator, which enhances the transcription, or a repressor, which inhibits the transcription. "Vector" or "construct" refers to a nucleic acid molecule into which a heterologous nucleic acid can be or is inserted. Some vectors can be introduced into a host cell allowing for replication of the vector or for expression of a protein that is encoded by the ■ vector or construct. Vectors typically have selectable markers, for example, genes that encode proteins allowing for drug resistance, origins of replication sequences, and multiple cloning sites that allow for insertion of a heterologous sequence. Vectors are typically plasmid-based and are designated by a lower case "p" followed by a combination of letters and/or numbers. Starting plasmids disclosed herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids by application of procedures known in the art. Many plasmids and other cloning and expression vectors that can be used in accordance with the present invention are well-known and readily available to those of skill in the art. Moreover, those of skill readily may construct any number of other plasmids suitable for use in the invention. The properties, construction and use of such plasmids, as well as other vectors, in the present invention will be readily apparent to those of skill from the present disclosure.

Isolated Polypeptide Comprising a Recombinant β-lactamase In one aspect, the present invention provides an isolated polypeptide comprising a recombinant β-lactamase whose secretion is dependent on a type III protein secretion system. Such a polypeptide can be useful, for example, for making antibodies specific to the recombinant β-lactamase. In one embodiment, the isolated polypeptide of the invention comprises a secretory signal recognizable by a type III secretion system operably linked to a mature β- lactamase protein lacking its native signal sequence. No consensus cleavable amino acid sequence has been identified as secretary signal among proteins secreted by type III systems. Instead, the secretory signal recognizable by a type III secretion system seems to reside either in a noncleavable N-terminal peptide or in its associated codons on the 5 '-terminus of the mRNA (Cornells etal., 2000, Armu. .Rev. Microbiol . 54:735-774) . The secretory signal recognized by a type III secretion system was first identified as encompassing the 70 to 78 N-terminal amino acids of the secreted' proteins . The minimal region shown to be sufficient for secretion was gradually reduced to approximately the first 15 to 20 N-terminal amino acids. Moreover, mutation analysis has suggested that for at least some effectors of particular type III protein secretion systems, the secretory signal may not be determined by the amino acid sequence, but rather by the structure of the corresponding mRNA that specifies the first 15 to 17 N-terminal amino acids of the secreted protein. Native β-lactamase proteins are secreted by the ubiquitous type II protein secretion system, wherein a secretory protein is synthesized as precursors with a cleavable amino-terminal signal peptide that is proteolytically removed by signal peptidases during or shortly after translocation (see for example, van Wely et al., 2001, FEMS Microbiol Rev, 25(4): 437-54). In a preferred embodiment, the isolated polypeptide of the invention comprises a secretory signal recognizable by a SPI-1 type III secretion system from Salmonella spp. operably linked to a mature β-lactamase protein lacking its native signal sequence. The secretory signal can be derived from any protein secreted by the SPI-1 type III secretion system. Such proteins include, but are not limited to, InvJ, SpaO, Prgl , PrgJ, SipA, SipB, SipC,

SipD, SptP, AvrA, SopE, SopE2, SopA, SopB, SopD, SlrP, and SspHl (Galan, (2001), Annu . Rev. Cell Dev. Biol . , 17:53- 86) . The mature β-lactamase protein can be derived from any source of β-lactamase described supra . Particularly, the mature β-lactamase protein can be corresponding to amino acid 24 to 286 of the TEM-1 β-lactamase precursor protein (GenBank protein accession No: AAB59737) . In constructing a polypeptide comprising a recombinant β-lactamase, various lengths of a polypeptide comprising a secretory signal recognizable by a type III secretion system can be added to the N-terminal end of a mature β-lactamase. In one embodiment, the polypeptide consists essentially of the secretory signal recognizable by a type III secretion system can be used. Preferably, the polypeptide comprises an amino acid sequence in addition to the secretory signal. For example, the polypeptide can consist of about the first N-terminal 15, 50, 80, 150 amino acid residues, or the entire length of amino acid residues of a protein secreted by the type III secretion system. Methods are known to those skilled in the art to 'determine the secretory signal recognizable by a type III secretion system. See, for example, Sory et al. (1995, Proc. Natl . Acad. Sci . USA 92:11998-2002); and Anderson et al . , (1997, Science 278:1140-43). In a 'preferred embodiment, the isolated polypeptide of the invention comprises the 78 N-terminal amino acid, ^• residues of SopE from S . typhimurium and the mature β- lactamase protein derived from the TEM-1 β-lactamase (GenBank protein_accession number AAB59737) encoded by the cloning vector pBR322. Particularly, the isolated recombinant β-lactamase includes a peptide linker that joins the SopE peptide with the mature TEM-1 β-lactamase. Such a peptide linker can be useful in avoiding steric hindrance problems. The amino acid sequence of this recombinant β-lactamase is depicted in SEQ ID No : 1. The invention also provides methods of expressing or isolating a polypeptide comprising a recombinant β- lactamase . In one embodiment, the polypeptide comprising a recombinant β-lactamase can be recombinantly expressed by cloning DNA molecules of the invention described infra into an expression vector described infra, introducing such a vector into bacterial host cells described infra , and growing the host cells under conditions suitable for production of the recombinant β- lactamase. The expression vector-containing cells are clonally propagated and individually analyzed to determine whether they produce the recombinant β- lactamase. Identification of recombinant β-lactamase expressing host cells can be accomplished by several means, including, but not limited to, measuring immunological reactivity with anti-β-lactamase antibodies, and monitoring the presence of host cell- associated β-lactamase activity. The selection of the appropriate growth conditions and recovery methods are within the skill of the art. Techniques for recombinantly expressing a polypeptide are fully described in Maniatis, et al . , Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor

Laboratory, Cold Spring Harbor, New York, 1989) , and are well known in the art. Polypeptides of the invention can also be produced using an in vi tro translation and/or transcription system. Such methods are known to those skilled in the art. For example, the DNA molecules of the invention described infra can be cloned under the control of a T7 promoter. Then, using this construct as the template, the recombinant β-lactamase protein can be produced in an in vitro transcription and translation system, for example using a TNT^® T7 Quick for PCR DNA coupled transcription/translation system such as that commercially available from Promega (Madison, WI) . The polypeptide comprising a recombinant β- lactamase can also be produced by chemical synthesis, such as solid phase peptide synthesis on an automated peptide synthesizer, using known amino acid sequences. Such methods are known to those skilled in the art. Following expression of the polypeptide comprising a recombinant β-lactamase in a recombinant host cell, the recombinant protein can be recovered to provide purified enzymes in active form. Such methods are known to those skilled in the art. For example, the recombinant protein can be purified from cell lysates and extracts, or from conditioned culture medium, by various combinations of, or individual application of salt fractionation, ion exchange chromatography, size exclusion chromatography, hydroxylapatite adsorption chromatography and hydrophobic interaction chromatography, lectin chromatography, HPLC, and FPLC, and antibody/ligand affinity chromatography. The polypeptide comprising a recombinant β-lactamase ^• can be separated from other cellular proteins by use of an immunoaffinity column made with monoclonal or polyclonal antibodies specific for full-length β-lactamase, or fragments thereof. The antibody affinity columns are made by adding the antibodies to a gel support such that the antibodies form covalent linkages with the gel bead support. Prefered covalent linkages are made through amine, aldehyde, or sulfhydryl residues contained on the antibody. Methods to generate aldehydes or free sulfydryl groups on antibodies are well known in the art; amine groups are reactive with, for example, N- hydroxysuccinimide esters. The affinity resin is then equilibrated in a suitable buffer, for example phosphate buffered saline (pH 7.3), and the cell culture supernatants or cell extracts containing the recombinant protein are slowly passed through the column. The column is then washed with the buffer until the optical density (A₂go) falls to background, then the protein is eluted by changing the buffer condition, such as by lowering the pH using a buffer such as 0.23 M glycine-HCl (pH 2.6) . The purified protein is then dialyzed against a suitable buffer such as phosphate buffered saline. The affinity column purification can also be performed using other proteins or compounds that -bind to the recombinant β-lactamase, such as an antibody specific to the secretory signal sequence included in the recombinant β-lactamase.

Isolated nucleic acid molecules of the invention In another aspect, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence that encodes a recombinant β-lactamase whose secretion is dependent on a type III secretion system. Such a nucleic acid molecule can be used to express a recombinant β-lactamase of the invention. The nucleic acid molecule of the invention comprises a nucleotide sequence encoding a secretory signal recognizable by a type III secretion system. For example, the nucleic acid molecule of the invention includes a nucleotide sequence encoding a polypeptide comprising a secretory signal recognizable by a type III secretion system operably linked to a nucleotide sequence encoding a mature β-lactamase protein lacking its native signal sequence. The secretory signal can be derived from any protein secreted by a type III secretion system from any Gram-negative- cell, examples of which are described supra . The mature β-lactamase protein can be derived from any β- lactamase found in any bacterium, examples of which are described supra . In a preferred embodiment, the nucleic acid molecule of the invention comprises a nucleotide sequence encoding a polypeptide comprising a secretory signal recognizable by a SPI-1 type III secretion system from Salmonella spp. operably linked to a nucleotide sequence encoding a mature β-lactamase protein lacking its native signal sequence. The secretory signal can be derived from any protein secreted by a SPI-1 type III secretion system, examples of which are described supra . Preferably, the mature β- lactamase protein is derived from the TEM-1 β-lactamase as described supra . In a most preferred embodiment, the nucleic acid molecule of the invention comprising a nucleotide sequence encoding a recombinant β-lactamase with an amino acid sequence of SEQ ID No: 1. it is known that more than one genetic codon can be used to encode a particular amino acid. Therefore, a recombinant β-lactamase with a given amino acid sequence can be encoded by any of a set of similar DNA molecules . For example, a nucleic acid molecule with a nucleotide sequence as set forth in SEQ ID NO: 2 is only one member of the set of similar DNA molecules that encodes a recombinant β-lactamase of SEQ ID No : 1. The scope of this invention contemplates all DNA molecules bearing one or more alternative codons encoding a recombinant β- lactamase that can be secreted by a type III secretion system. The nucleic acid molecule of the invention is a recombinant nucleic acid molecule. Methods of constructing and isolating recombinant DNAs are well known to those skilled in the art, and are described in numerous publications (see for example, Maniatis, et al . supra). For example, to construct a nucleic acid molecule of the invention, DNA molecules encoding a polypeptide comprising a secretory signal recognizable by a type III secretion system, and DNA molecules encoding a mature β-lactamase protein are first obtained individually by polymerase chain reaction (PCR) amplification. Bacterial colonies, isolated bacterial chromosomal DNAs, or plasmids can be used as templates for the PCR. Primers specific for a given DNA molecule can be synthesized and used in PCR. The two PCR amplified DNA fragments are then operably linked by DNA ligase, cloned onto a plasmid, and propagated in a host cell transformed with the plasmid. The nucleic acid molecule of the invention can be isolated from recombinant host cells by plasmid purification followed by restriction digestion and gel purification, or by PCR amplification directly. A specific example of how to construct and isolate a nucleic acid molecule of the invention is illustrated in Example 1.

Recombinant expression vectors and host cells Another aspect of the invention pertains to vectors, preferably expression vectors, containing a nucleic acid molecule of the invention. The recombinant expression vectors of the invention comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell . This means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operably linked to the nucleic acid sequence to be expressed. It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. The expression vectors of the invention can be introduced into host cells to thereby produce recombinant β-lactamase that can be secreted by a type III secretion system. The recombinant expression vectors of the invention can be designed for expression of the recombinant β- lactamase of the invention in many Gram-negative bacteria containing a type III secretion system. Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory 'sequences and T7 polymerase. Suitable vectors for a given host bacterial cell are known to those skilled in the art. The vectors include plasmids that can be maintained in the host cell,, or bacterial phage that can mediate specific transduction to the host cell. For example, both plasmid pBR322 and bacteriophage are suitable vectors for E. coli , whereas plasmid pBR322 and bacteriophage P22 are suitable vectors for S . typhimurium. When the vector is a plasmid, it generally contains a variety of components including promoters, phenotypic selection genes, origins of replication sites, and other necessary components that are known to those of skill in the art . Typical phenotypic selection genes are those encoding proteins that confer antibiotic resistance phenotypes to the host cell, which provides easy means to select the host cells from other non-host cells. For example, chloramphenicol resistance gene {cam) and the tetracycline resistance gene (tet) are readily employed for this purpose. Origins of replication sites are required for the replication of the plasmid inside host cells. Construction of suitable vectors containing a nucleic acid molecule of the invention are prepared using standard recombinant DNA procedures well known to those of skill in the art. An example of how to construct an expression plasmid is given in Example 1 and 3. In one embodiment, the recombinant expression vector of the invention is a plasmid containing a constitutive promoter directing the expression of recombinant β-lactamase of the invention. Independent of growth conditions, a constitutive promoter allows continuous transcription of its controlled gene(s). Suitable constitutive promoters for a given host bacterial cell are known to those skilled in the art. For example, a consensus -10 and -35 TATA box DNA sequence or derivatives thereof, serves as a constitutive promoter in many bacterial species. In preferred embodiment, the recombinant expression vector of the invention is a plasmid containing an inducible promoter directing the expression of recombinant β-lactamase of the invention. An inducible promoter allows increased transcription of its controlled gene only under inducible conditions. Suitable inducible promoter for a given host bacterial cell are known to those skilled in the art. . An inducible promoter is often under the control of a transcription regulator. For example, promoter P_ara is repressed by transcription regulator AraC in the absence of the inducer L-arabinose, and is activated by AraC in the presence of L-arabinose. Promoter Pι_ac# Ptet, or Pλ, on the other hand, is repressed by transcription represser Lacl, TetR, or λCI, respectively. Growing host cells in the presence of the inducer, lactose or IPTG for Pι_ac and anhydrotetracycline for Ptet# or other conditions (such as at higher temperature to inactivate a temperature sensitive λCI) , inactivates the repressor. Inactivated repressor is released from the regulatory region and results in derepression, and thus increased gene transcription from the corresponding promoter is provided. Another aspect of the invention pertains to recombinant bacterial host cells into which a recombinant expression vector of the invention has been introduced. The scope of the invention contemplates any Gram-negative bacterial host cells with a type III secretion dystem into which a recombinant expression vector of the invention has been introduced. Suitable methods for introducing a recombinant expression vector into a bacterial host cell can be found, in Maniatis et al . (supra), and other laboratory manuals. Such methods, include, but are not limited to, bacterial transformation, electroporation, bacterial transduction, and bacterial conjugation. For example, transformation of a host cell with recombinant DNA may be carried out by conventional techniques that are well known to those skilled in the art. Competent E. coli , S. typhimurium, or other bacterial cells that are capable of DNA uptake can be prepared from cells harvested after exponential growth phase and subsequently treated with CaCl2, .using procedures well known in the art. Alternatively, MgCl₂ or RbCl can be used. Transformation can also be performed after forming a protoplast of the host cell if desired. In some case, transformation can also be performed using naturally competent bacterial cells. Electroporation is the uptake of DNA by bacteria upon being subjected to a high voltage electrical discharge. For another example, triparental conjugation may be used to genetically introduce vector into a bacterial host cell, such as an E. coli , Salmonella, or Pseudomonas . The host cells are selected by growth on antibiotic (s) to which they are rendered resistant due to the presence of resistance conferring genes on the vector. Methods are .described supra for identifying recombinant host cells expressing the recombinant β- lactamase of the invention. The confirmed recombinant bacterial host cells can be grown in laboratory conditions using growth media for the corresponding bacterial cells, for example, Luria-Bertani (LB) and Vogel-Bonner media (described infra) for E. coli , Salmonella , and Pseudomonaβ . If the expression of the recombinant β-lactamase is under the control of an inducible promoter, host cells need to be grown under induction conditions to obtain increased expression of the recombinant protein, for example by adding an inducer to the growth medium. Once inside the host cell, the recombinant DNA encoding a recombinant β-lactamase of the invention can either remain on the expression vector or integrate onto the bacterial chromosome.

Methods of the inventions The present invention provides methods of identifying an activator or inhibitor for a type III protein secretion system, as well as methods of monitoring the activity of a type III protein secretion system in a Gram-negative bacterial cell. The compound identification methods can be in conventional laboratory format or adapted for high throughput. It is well known by those in the art that as miniaturization of plastic molds and liquid handling devices are advanced, or as improved assay devices are designed, that greater numbers of samples may be performed using the design of the present invention. Candidate compounds encompass numerous chemical classes, although typically they are organic compounds. Preferably, they are small organic compounds, i.e., those having a molecular weight of more than 50 yet less than about 2500. Candidate compounds comprise functional chemical groups necessary for structural interactions with polypeptide's, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, prefera-bly at least two of the functional chemical groups and more preferably at least three of the functional chemical groups. The candidate _'compounds can comprise cyclic carbon or heterocyclic structure and/or aromatic or polyaromatic structures substituted with one or more of the above- identified functional groups. Candidate compounds also can be biomolecules such as peptides, saccharides, fatty acids, sterols, isoprenoids, purines, pyrimidines, derivatives or structural analogs of the above, or combinations thereof and the like. Where the compound is a nucleic acid, the compound typically is a DNA or RNA molecule, although modified nucleic acids having non- natural bonds or subunits are also contemplated. Candidate compounds are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides, synthetic organic combinatorial libraries, phage display libraries of random peptides, and the like. Candidate compounds can also be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries: synthetic library methods requiring deconvolution; the "one-bead one- compound" library method; and synthetic library methods using affinity chromatography selection (Lam (1997) Anticancer Drug Des . 12:145) . Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural and synthetically produced libraries and compounds can be readily modified through conventional chemical, physical, and biochemical means . Further, known pharmacological agents can be subjected to directed or random chemical modifications such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs of the agents . Candidate compounds can be selected randomly or can be based on existing compounds that bind to and/or modulate the function of a type III protein secretion system. Therefore, sources of candidate agents are libraries of molecules based on the known activators or inhibitors for type III protein secretion system, in which the structure of the compound is changed at one or more positions of the molecule to contain more or fewer chemical moieties or different chemical moieties. The structural changes made, to the molecules in creating the libraries of analog activators/inhibitors can be directed, random, or a combination of both directed and random substitutions and/or additions. One of ordinary skill in the art in the preparation of combinatorial libraries can readily prepare such libraries based on the existing activators/inhibitors . A variety of other reagents also can be included in the mixture. These include reagents such as salts, buffers, neutral proteins (e.g., albumin), detergents, etc. that may be used to facilitate optimal protein- protein and/or protein-nucleic acid binding. Such a reagent may also reduce non-specific or background interactions of the reaction components. Other reagents that improve the efficiency of the assay such as protease inhibitors, nuclease inhibitors, antimicrobial agents, and the like may also be used. In one aspect, the present invention provides a method of identifying an activator or inhibitor of a type III protein secretion systems, comprising the steps of: a) exposing a Gram-negative bacterial cell to a candidate compound, wherein said bacterial cell contains a recombinant β-lactamase whose secretion is dependent on a type III protein secretion system; and b) detecting ' the amount of recombinant β-lactamase secreted outside the bacterial cell; wherein an inhibitor for the bacterial type III secretion system decreases the amount of recombinant β-lactamase secreted outside the bacterial cell as compared to a control bacterial cell not contacted with the inhibitor; and an activator for the bacterial type III secretion system increases the amount of recombinant β-lactamase secreted outside the bacterial cell as compared to a control bacterial cell not contacted with the activator. In one embodiment, in the method of identifying an. activator or inhibitor of a type III protein secretion systems described supra, the Gram-negative bacterial cell is a Salmonella bacterial cell that contains a recombinant β-lactamase whose secretion is dependent on a SPI-1 type III secretion system. In another embodiment, the methods of the invention further comprise the step of testing the effect of the compound in another Gram-negative bacterial cell that contains a type III protein secretion system. For example, the other Gram-negative bacterial cell can be a Salmonella bacterial cell that does not contain the recombinant β-lactamase. Also, the other Gram-negative bacterial cell can be selected from the group of cells including Shigella, Yersinia, Escherichia, Pseudomonas, Xanthomonas, Ralstonia, Chlamydia and Erwinia . The effect of the compound on the other Gram-negative bacterial cell can be tested by measuring the amount of proteins secreted outside the Gram-negative cell via the type III protein secretion system, using techniques known to those skilled in the art. For example, after incubating the compound with the cell, cell supernatant is separated from the intact cell by centrifugation. The amount of type III secreted proteins in the supernatant can be quantified by electrophoresis followed by protein staining. The amount of type III secreted proteins in the supernatant can also be detected by an immunology method using antibodies directed to one or more of the secreted proteins. Such method includes, but is not limited to,

Western Blot, Immunodot Blot, and so forth. The effect of the compound can be analyzed by comparing the measured amount with that of a control where the cell has not been exposed to the compound. Often, full activation of a type III protein secretion system requires contacting the bacterial cell with its host cell. Under standard in vitro laboratory conditions, expression of components of a type III protein secretion system is low. Preferably, the methods of identifying an activator or inhibitor for a type III protein secretion system further comprises the step of activating the type III protein secretion system prior to the step of detecting the amount of recombinant β- lactamase secreted outside the bacterial cell. The step of activating the type III protein secretion system can be performed either before or after exposing the host cell to a test compound. Methods are known to those skilled in the art to increase the activity of a type III protein secretion system in a given bacterial cell. In one embodiment, the type III protein secretion system can 'be activated by directly contacting a bacterial cell with its eukaryotic host cell. In other embodiments, the type III protein secretion system can be activated by special in vitro laboratory conditions. The activity can be regulated by a variety of environmental cues, such as temperature, osmolarity, availability of nutrients, divalent cations (such as Ca²⁺) , pH, and growth phase (Hueck, supra) . For example, to trigger Yop secretion in vitro, Yersinia is generally grown at 28°C in a medium depleted of Ca²⁺ and then transferred to 37°C. (Cornells et al . , 1998. Microbiol . Mol . Biol . Rev. 62:1315-52). As in Yersinia spp., expression of P. aeruginosa secreted proteins is also activated under low-Ca²⁺ conditions^' (Frank, 1991 , Mol Microbiol , 26 (4) : 621-9) . Growing Shigella, or enteropathogenic E. coli at 37 °C activates its type III protein secretion system (Hromockyj et al . , 1989, Infect Immun 57 (10) : 2963-70) . For S . typhimurium, the SPI-1 type III protein secretion system is activated in vitro under low-oxygen, high-osmolarity, and slightly alkaline (pH 8) conditions (Bajaj, 1996, Mol . Microbiol . 22:703- 714) . To lower the assay background, the expression of the recombinant β-lactamase can be under the control of an inducible promoter. Preferably, the expression of the recombinant β-lactamase is induced immediately before exposing the recombinant host cell to a test compound. More preferably, the expression of the recombinant β-lactamase is induced shortly after exposing the recombinant host cell to a test compound. Methods have been described supra and are illustrated in Examples described infra to obtain inducible expression of a recombinant β-lactamase. The methods of the compound identification assay described herein can be easily adapted into the high throughput format. An exemplary high throughput screen is illustrated in Example 4. One other aspect of the invention is a method of monitoring the activity of a type III protein secretion system in a Gram-negative bacterial cell, comprising the step of: 1) introducing a recombinant expression vector into the bacterial cell, wherein the vector is capable of expressing a recombinant β-lactamase whose secretion is dependent on the type III protein secretion system of the bacterial cell; 2) selecting the recombinant bacterial host cell that is capable of expressing the recombinant β-lactamase; 3) detecting the amount of recombinant β-lactamase secreted outside the recombinant bacterial host cell. Methods on how to construct a recombinant expression vector, how to introduce the vector into a bacterial cell, and how to select such a recombinant bacterial cell, are all described supra , and are illustrated in Examples described infra . Other reporter proteins, such as a β-galactosidase (LacZ) , a luciferase (Lux) , a green fluorescent protein (GFP), proteins for antibiotic resistance (i.e., chloramphenicol acetyltransferase (Cat) ) , and an alkaline phosphatase, were proposed as useful in fusion proteins for the detection of polypeptide secretion • (W09945136) . In practice when used as fusions some reporter proteins may not be folded properly or may fail to be secreted by bacterial type III protein secretion systems. For example, it has been reported that in E. coli green fluorescent protein (GFP) becomes folded improperly when secreted outside of the cytoplasm, and thus is not fluorescent (Feilmeier et al . , 2000, J Bacteriol , 182(14): 4068-76). In addition, our experience indicated that the same signal sequence that successfully directed the secretion of a recombinant β- lactamase 'by the SPI-1 type III protein secretion system, failed to direct the secretion of another reporter protein, the enzymatically active recombinant XylE protein (see example 3) . Therefore, experimentation is needed to evaluate individually each reporter protein for its utilization in protein secretion analysis. Methods are known to those skilled in the art for detecting the amount of recombinant β-lactamase secreted outside the recombinant bacterial host cell. In one embodiment, the secreted recombinant β-lactamase can be measured as the amount of recombinant β-lactamase protein in the culture supernatant. Culture supernatant can be separated from bacterial cells by centrifugation. The amount of recombinant proteins can be measured using antibodies specific to the recombinant protein using methods such as Western blot, or ELISA. When adapting a screening assay into a high throughput format, the step of separating cells from cell supernatants is time consuming, cumbersome, expensive, and often introduces unacceptable variability in the results. Therefore, in a preferred embodiment, the amount of secreted recombinant β-lactamase can be measured through the level of secreted β-lactamase activity. The step of separation of cells from cell supernatants can be omitted when proper substrates for β-lactamase are used. A preferred substrate is one that is unable to penetrate through bacterial cell membranes . Another preferred substrate is one that is unable to penetrate through bacterial cell membranes within the time constraints of the reaction, such as nitrocefin (Calbiochem, Cat No. 484400) . Colorimetric reactions can be used to easily monitor the secreted β-lactamase activity. Preferred substrates that can be used in the colorimetric reactions include, but are not limited to, nitrocefin { supra) , a chromogenic cephalosporin, pyridinium-2-azo-p-dimethylaniline chromophore (PADAC) (Kobayashi et al . , Antimicrob . Agents Chemother, (1988), 32:1040-5), and CENTA (Brebone,C, et al . ; Antimicrobial Agents and Chemotherapy, 2001, 45: 1868-1871) . In addition, β-lactamase activity can also be assayed by the Iodometric reaction of penicillin or cephalosporin degradation (Sng et al . , British J. of Venereal Diseases (1980), 56:311-3). An exemplary colorimetric assay for the secrete, β- lactamase activity is illustrated in Example 2. Floremetric Inhibitors of type III protein secretion system identified through their ability to inhibit the secretion of a recombinant β-lactamase, the SopE"-"Bla chimeric protein, in a high throughput assay displayed broad specificity. Not only they inhibit the secretion of another effector of the SPI-1 system from Salmonella (Example 5) , but also they inhibited secretion of effectors of a type III protein secretion system in P. aeruginosa (Example 6) . Inhibitors of type III protein secretion identified by the methods of the invention showed broad specificity and therefore, have potential as new antibacterial therapeutic agents. The following examples illustrate the present invention without, however, limiting the same thereto.

Example 1 Construction of a recombinant plasmid and bacterial host cells A recombinant plasmid capable of encoding a recombinant β-lactamase whose -secretion is dependent on the SPI-1 type III protein secretion system of Salmonella typhimurium was constructed using standard molecular biology techniques . The TEM-1 β-lactamase protein expressed in bacteria by plasmid pBR322 contains a signal sequence that is recognized by the ubiquitous type II protein secretion system resulting in the translocation of the protein to the periplasm. During translocation from the bacterial cytoplasm to the periplasm, passing through the bacterial inner membrane the signal sequence is cleaved to give rise to a mature polypeptide. Mature TEM-1 β-lactamase protein is not recognized by the type II protein secretion system because it lacks a signal sequence. SopE is an effector of the S. typhimurium SPI-1 type III protein secretion system that does not require chaperones for secretion. A SopE'-"Bla chimera was constructed that lacks the signal sequence recognized by type II protein secretion, but contains, instead, a secretion signal that is recognizable by the type III protein secretion system. As shown infra , in the absence of a functional type III protein secretion system the SopE"-"Bla chimera is constrained to the bacterial cytoplasm. However, in the presence of a functional type III protein secretion system, the SopE^{^}-'Bla chimera is secreted by the type III protein secretion system to the extracellular medium. Therefore, the SopE'-^{^}Bla chimera is a recombinant β- lactamase protein as defined supra, whose secretion is dependent on a type III protein secretion system. Construction of the recombinant plasmid Figure 1 shows the structure of plasmid pPRI449, which encodes for the SopE"- Bla chimera. The plasmid contains 6217 base pairs and is a derivative of pACΫC184, a commercially available plasmid that encodes for resistance determinants to tetracycline (tet gene) and chloramphenicol (cat gene) . pPRI449 encodes for the 345 amino acid chimeric protein, SopE'-"Bla, which consists of the N-terminal 78 amino acids of the SopE protein, followed successively by a separator tetrapeptide (proline-glycine-arginine-serine) , and a 263 amino acid peptide sequence corresponding to the mature TEM-1 β-lactamase. This chimeric protein is expressed from the Para promoter whose expression is regulated by the AraC protein. Hence, expression of the SopE'-"Bla chimera is activated in presence of the sugar L-arabinose. The TEM-1 β-lactamase part of the SopE"-"Bla chimeric polypeptide is used as a reporter enzyme. It is capable of hydrolyzing the compound nitrocefin resulting in a product whose accumulation can be monitored by colorimetric detection. Therefore the presence of the SopE'-^{^}Bla chimeric polypeptide can be measured by this colorimetric detection. Plasmid pPRI449 was constructed by replacing the 1 kb Eag I to Xba I restriction endonuclease fragment of the pACYC184 plasmid with a polynucleotide molecule comprising three spliced DNA fragments. The 1 kb DNA sequence from pACYC184 includes most of the tet gene. The three spliced DNA fragments were obtained by PCR amplification with DNA polymerase "Turbo Pfu" (Stratagene, Cat. No 600250) following standard protocol provided by the manufacturer with appropriate primers described in table 1. The first DNA fragment was amplified from template plasmid pSB1136 (received from Dr. Jorge Galan, then at SUNY, Stony Brook, NY) . pSB1136, a derivative of the expression cloning vector pBAD24, carries a sopE gene under the inducible promoter P_ara promoter, and an araC gene which encodes the transcription regulator for the P_ara. Using PCR primers P1136F2, SEQ ID NO: 3, 5' CAACGTTGTGCCTGTCAAATGGACGAAG 3' (containing an Acl I restriction site) and P1136B2, SEQ ID NO: 4, 5' TAGATCTACCAGGCAACACTGCCCGGCCCTCAGA 3' (containing a Bgl II restriction site and next to it two codons whose reverse complement specify the amino acids glycine and proline) , a 1.5 kb DNA fragment was amplified from plasmid pSB1136.

The fragment included the full-length araC gene, and a P_ara controlled nucleotide segment encoding the 78 N-terminal amino acids of SopE and a tetrapeptide separator proline- glycine-arginine-serine . This fragment specified the secretion signal for the secretion of SopE. It was placed by blunt-end ligation into vector pCR^®-Blunt (Invitrogen, Zero Blunt PCR cloning kit, K2700-20) , and a particular orientation of the insert was selected. This recombinant plasmid was cut with restriction enzymes Apa I and Bgl II. The resulting largest Apa I - Bgl II fragment, which comprises the origin of replication of the plasmid and the first DNA fragment, was purified, via electrophoretic separation in an agarose gel. The second DNA fragment was PCR amplified using as template plasmid pBR322, and as DNA primers BlaF (with a Bgl II restriction site) , SEQ ID NO : 5, 5' TAGATCTCACCCAGAAACGCTGGTGAAAG 3' and BlaB, SEQ ID NO: 6, 5 ' TTACCAATGCTTAATCAGTGAGGCACC 3'. The amplified DNA fragment of approximately 800 bp encoding the mature TEM-1 β-lactamase lacking the signal sequence was also cloned into pCR^®-Blunt. This recombinant plasmid was then cut with restriction enzymes Apa I and Bgl II. The resulting small DNA fragment, was isolated, purified, and ligated to the previously described largest Apa I- Bgl II fragment. This placed the sopE' gene fragment (encoding the type III protein secretion signal) in frame at the 5' -end of the bla gene fragment^' (encoding the mature β-lactamase), resulting in a first plasmid encoding for the SopE^''-"Bla chimera. The two coding sequences, sopE' and ^λbla, were separated by a 12 nucleotide linker encoding for a tetrapeptide proline-glycine-arginine-serine . The proline-glycine dipeptide was inserted to produce a turn in the polypeptide structure that might favor sterical independence between the SopE and Bla domains of the protein. The arginine-serine peptide amino acids are encoded by the codons associated with the Bgl II restriction endonuclease recognition site incorporated into the BlaF primer. Thus, PCR primers P1136B2 and BlaF were designed to both contain adequately located Bgl II restriction endonuclease recognition DNA sequences AGATCT allowing the two PCR amplified fragments to be linked in frame upon cutting with the restriction endonuclease Bgl II and subsequent ligation in tandem. This ensured that the recombinant protein, SopE' -'Bla, consisting of the first 78 N-terminal amino acid sequence of SopE, the tetrapeptide separator, and the mature TEM-1 β-lactamase could be expressed under the control of the P_ara promoter. At the same time the tetrapeptide separator furthered the sterical independence between the functional elements of the recombinant protein. The first plasmid encoding for the SopE -~^"Bla chimera was then cleaved with restriction enzymes Spe I and Xho I, recognition sites for both enzymes having been gained from pCR^®-Blunt. The large fragment containing araC linked to the sopE' - bla was isolated and purified. The third DNA fragment was amplified from template plasmid pBAD24 using PCR primers, PBAD24F2, SEQ ID NO : 7, 5' GGATCCTCTAGAGTCGACCT 3' (containing a Bam HI restriction site) and PBAD24B2, SEQ ID NO: 8, 5' ACGGCCGTTGTCTCATGAGCGGATACA 3' (containing an Eag I restriction site) . The approximately 430 bp DNA amplified fragment contained the strong transcription terminator from the rrnB gene, a gene involved in Escherichia coli ribosomal RNA synthesis. This third fragment was also placed into plasmid pCR^®-Blunt. This new recombinant plasmid was cleaved with both BamH I and Eag I, and the insert was purified and ligated using T4 DNA ligase into plasmid pACYC184 (New England BioLabs) that had been similarly cleaved with both BamH I and Eag I . The new recombinant plasmid was cut with both Sal I (into a site originating from the pBAD 24 amplified fragment) and Xba I. The larger fragment, which contains the origin of replication of pACYC184 and the rrnB gene, was isolated^' and purified. The Sal I - Xba I fragment containing the rrnB gene was ligated with the Spe I - Xho I fragment containing araC linked to the sopE' - bla, using T4 DNA ligase. The overhanging ends generated by restriction digestion with Sal I and Xho I, or by Spe I and Xba I, are compatible. The ligation product placed a strong transcription terminator downstream from the sopE' - ^{^}bla chimera to prevent propagation of RNA synthesis from the chimeric gene into regions of the plasmid that might compromise its maintenance in bacterial host cells. This final construct was named pPRI449. Construction of the recombinant cells Plasmid pPRI449 was electroporated (Bio-Rad, Gene Pulser™) into strains of S. typhimurium to create host cells for the recombinant β-lactamase. Electroporation was performed according to protocols provided by the manufacturer. Electroporants of the S. typhimurium host cells containing the plasmid were selected on L-agar (per L, lOg Tryptone, 5g Yeast Extracts, 0.5g NaCl , Bacto Agar 15g) and 10 μg/ml chloramphenicol . Plasmid pPRI449 was electroporated into the following strains of S . typhimurium (provided by Dr. Jorge Galan, then at SUNY, Stony Brook, NY) : (1) SB300 -Wild type Salmonella typhimurium, streptomycin resistant (2) SB161 - SB300 AinvG, streptomycin resistant (3) SB241 - SB300 sipD : : aphT, streptomycin and kanamycin resistant (4) SB245 - fIa::TnlO ΔsipABCDE, kanamycin and tetracycline resistant Note that strain SB161 is a derivative of the wild type strain containing a deletion mutation that results in the absence of the InvG protein of the secretory apparatus of the SPI1 type III protein secretion system and abolishes secretion of any effector. Strains SB241 and SB245 contain mutations of type III protein secretion that increase the level of SopE secreted.

Example 2 A colorimetrical assay for type III protein secretion The SopE'-"Bla chimera is a recombinant β-lactamase that contains the entire sequence of the mature TEM-1 β- lactamase and is predicted to have β-lactamase activity as well. TEM-1 β-lactamase is capable of hydrolyzing the compound nitrocefin resulting in a product whose accumulation can be monitored by colorimetric detection. Thus, the presence of the SopE'-"Bla chimeric polypeptide should be measurable by its ability to hydrolyze nitrocefin.' Nitrocefin can be used to directly monitor enzyme secretion in a homogeneous system in the presence of cells, because cells take it up poorly and slowly. Figure 2 shows that the SopE'-"Bla chimeric protein expressed^;'by plasmid pPRI449 in S . typhymurium was secreted to the extracellular medium. Furthermore, Figure 2 shows that this secretion of the SopE'-"Bla protein was dependent on the presence of an intact SPI-1 type III protein secretion system. In the experiment shown in Figure 2 the SopE'-"Bla chimeric protein expressed by pPRI449 was secreted to the extracellular medium when expressed in wild type S . typhimurium SB300 (diamonds) , but failed to do so when expressed in strain SB161 which contains a deletion of the invG gene that inactivates one of the components of the type III secretory apparatus (triangles) . In addition, Figure 2 also shows that nitrocefin was not taken up by bacterial cells within the time constraints of the reaction (squares and triangles) . Cell cultures of Salmonella strains SB300 and SB161 containing pPRI449 were grown with shaking for 16 hours at 37C in L-broth { supra without the Agar) containing 10 μg of chloramphenicol per mL and 0.3 M NaCl , the latter to activate the SPI-1 type III protein secretion system. The cell cultures were diluted 1:40 into fresh medium containing the same components plus 0.02% L (+) -arabinose to induce expression of the SopE'-"Bla chimeric protein. After growing with shaking for three hours the cells were sedimented and the supernatants were kept on ice. The cells were washed once and then resuspended in the same volume of fresh medium with the same components. The presence of the SopE'-"Bla chimeric protein expressed by pPRI449 was monitored colorimetrically through the enzymatic activity of the associated β-lactamase (Bla) . Nitrocefin was used to measure the activity of the secreted' recombinant β-lactamase enzyme. To this effect 50 μL of each of the resuspended pellets or supernatants were separately mixed in microtiter plates with 25 μL of a stock of 250 μg nitrocefin per mL in 50 mM phosphate buffer at pH 7.0. Progress of the reaction was followed colorimetrically by monitoring the optical density at 490 nm in a microtiter plate reader. Wild type and invG Salmonella contained similar amounts of SopE' -"Bla chimeric protein in the cytoplasm, as determined from lysed cells. The poor uptake of nitrocefin into intact cells allows to establish a homogeneous high throughput system for the detection of inhibitors of type III protein secretion based on the secretion of the SopE'-"Bla chimeric protein { vide infra) Example 3 A recombinant XylE was not secreted by SPI-1 type III protein secretion system In principle, a large variety of reporter genes can be used to monitor type III protein secretion. Those genes encoding for polypeptides with enzymatic activity are highly desirable. However, the number of reporter genes encoding for polypeptides with enzymatic activity that will allow to set up homogeneous detection systems is much more limited. It includes genes encoding for polypeptides that are enzymatically inactive when inside the cell, but are active upon or after secretion. They also include genes that encode for polypeptides with enzymatic activity for which cognate substrates exist that are not taken up (or are taken up poorly) by bacterial cells, and which are endowed with chromophores (or other detectable moieties) that exhibit quantifiable changes in absorbance wavelengths profiles (or other measurable properties) upon hydrolysis of the molecule. An arrrrile assortment of reporter genes encoding for polypeptides with enzymatic activity is available to monitor type III protein secretion in nonhomogeneous detection system. However, a combination of a type III protein secretion signal sequence and a reporter gene does not necessarily yield a chimeric protein that can be used to monitor type III protein secretion. For example, when we constructed a protein fusion of the 78 N-terminal amino acids of SopE with the reporter XylE, a cytoplasmic protein from P. aeruginosa, the resulting chimeric protein was not secreted by the SPI-1 type III system of S . typhimurium. XylE was originally identified as an enzyme with catechol : oxygen 2 , 3-oxidoreductase activity encoded by the Pseudomonas putida Tol plasmid (Inouye, 1981, J^" Bacteriol 145(3) : 1137-43) . The enzyme catalyzes the conversion of the colorless substrate catechol into the yellow product 2-hydroxymuconic semialdehyde . The gene has been cloned and its product is often used as a reporter. A chimeric sopE" - "xylE was constucted along similar steps and using most of the same PCR primers as for the sopE'-"bla chimera. Synthesis of the second fragment was different . The second DNA fragment was PCR amplified using as template plasmid pSB383 (obtained from Jorge Galan, and as DNA primers XylEF (with a Bgl II restriction site) , SEQ ID NO: 9, 5' CAGATCTATGAACAAAGGTGTAATGCGACC 3' and XylEB, SEQ ID NO: 10, 5' TCAGGTCAGCACGGTCATGAAT 3'. The approximately 900 bp amplified DNA fragment encoded XylE and was also cloned into pCR^®-Blunt. This recombinant plasmid was then cut with Apa I and Bgl II, and the insert was isolated and purified and inserted by DNA ligation using T4 DNA ligase into the first of the recombinant plasmids that had been cut with the same enzymes (vide supra) . This generated an in-frame fusion between the sopE' and xylE, separated by a 12 nucleotide linker encoding for the tetrapeptide proline-glycine-arginine- serine. PCR primers for P1136B2 and XylEF were designed such that not only they both contained the DNA sequence AGATCT that allowed restriction digestion by Bgl II and ligation thereafter, but also ensuring that the second fragment was ligated to the first one in frame so that a recombinant protein, SopE' -'XylE, consisting of the first 78 N-terminal amino acid sequence of SopE, the tetrapeptide separator, and XylE, could be expressed under the control of P_ra- This recombinant plasmid was then cleaved with both Spe I and Xho I, both sites having been gained- from pCR^®- Blunt . The large fragment containing araC linked to the sopE and xylE fragments was isolated and purified The final ligation product of the three fragments of DNA was cloned on plasmid pACYC184 in replacing an approximate 1 kb Eag I to Xba I restriction endonuclease fragment that includes most of the tet gene on pACYC184. The resulting recombinant expression plasmid was named pPRI470. pPRI470 contains 6,346 base pairs and as pPRI449, it is also a derivative of pACYC184. pPRI470 encodes for the expression of a 385 amino acid chimeric protein, SopE'- "XylE, that consists of the N-terminal 78 amino acids of the SopE protein, followed successively by a proline- glycine-arginine-serine tetrapeptide separator, and a 307 amino acid XylE peptide sequence. This chimeric protein, as defined herein, is expressed from the P_ara promoter whose expression is regulated by the AraC protein. Hence, expression of the SopE'-"XylE chimera is activated in presence of the sugar L-arabinose. Unlike the nitrocefin substrate for the SopE' -"Bla, catechol diffuses readily into Escherichia coli or Salmonella typhimurium cells. Therefore, to measure the activity of the secreted recombinant XylE, cells and supernatants were separated by methods such sedimentation by centrifugation, or by filtration. It is not possible to design a homogeneous system to measure enzymaticallythe translocation of SopE'-"XylE using catechol as a substrate . pPRI470 was introduced by electroporation into strains of- S . typhimurium SB300, SB161, SB241 and SB245, as described for pPRI449. High levels of intracellular XylE activity were reached upon induction with L-arabinose in all of these backgrounds. However, no extracellular XylE activity was observed for any of the strains. The results showed that, although the same fragment of SopE that directed the secretion of the SopE'-"BlaE was used, the active SopE' -"XylE was not secreted by type III protein secretion system. This demonstrated that the secretory functionality of the constructs is not always predictable when using a reporter for measuring protein secretion activity of a type III protein secretion system.

Example 4 High throughput screen A homogeneous high throughput assay was established to detect inhibitors of type III protein secretion. This assay was a modification of that described in Example 2. It used a strain of S . typhimurium containing the SopE'- "Bla chimeric protein and made use of nitrocefin, a substrate for β-lactamase that is only poorly or slowly taken up by the bacterial cells. This system allows daily screening of at least 30,000 to 60,000 samples using a Zymark Allegro™ robotics system. Strains SB300, SB241 and SB245 containing pPRI449 could all be used for this screen. Preference was given to SB245 (pPRI449) because of its higher level of secretion of the SopE'-"Bla chimera. In the example, SB245 (pPRI449) bacteria were grown in bulk as follows. A culture of SB245 (pPRI449) grown with shaking for 16 hours at 37C in LB medium containing 0.3 M NaCl and 10 μg of chloramphenicol per mL was diluted 1:40 into several flasks containing a total of approximately three liters of fresh medium with the same components. After growing with shaking at 170 rpm for 4.5 hours at 37C, bacterial cells were sedimented by centrifugation and the pellets washed once and resuspended in the same volume of 10 mM MgS0₄ and stored at 4C for a maximum of 24 hours. For the high throughput homogeneous assay the cell density was adjusted with 10 mM MgS0₄ to give an absorbance reading of 0.47 at 600 nm as determined by a spectrophotometer. The procedure described below was done using robotics. To wells of microtiter plates the following components were added successively: 165 μL of LB broth with 0.3 M NaCl, 20 μL of bacterial cells, and 5 μL of tested compounds at 1 mM. Plates were incubated for 20 minutes at 37C. Then, 22 μL of 1% L-arabinose were added to every well and the plates were further incubated at 37C for an additional 70 minutes. At the end of this period 50 μL from a stock of 250 μg of nitrocefin per mL in 50 mM phosphate buffer at ph 7.0 were added to each microtiter well. The plates were incubated at room temperature for 20 minutes and the absorbance at 490 nm of each well was determined in a microtiter plate reader. Each plate contained several control wells. Positive inhibitor controls included wells with clavulanic acid, an inhibitor of β-lactamase, at final concentrations of 1000 and 62.5 nM. A negative inhibitor control included a well without inhibitor. ' A background control included a well with uninduced cells to which water was added instead of L- arabinose . Inhibitors identified by the high troughput assay were retested to confirm their activity. Inhibitors whose effect could be traced to either growth or β-lactamase inhibition were eliminated upfront . The remaining inhibitors were characterized further { vide infra) . Table 2 describes the properties of six potent inhibitors. Their inhibitory potency is expressed in terms of IC₅₀, the concentrations of inhibitor necessary to reduce the secretion of the SopE'-"Bla chimeric protein to the extracellular medium by 50%.

Table 2

Example 5 Inhibition of protein secretion of other effectors of the SPI-1 protein secretion system Inhibitors identified through their ability to interfere with secretion of the SopE'- "Bla chimeric protein were also tested for their ability to inhibit the type III protein secretion of other effectors encoded by the SPI-1 system besides the SopE protein. It was found that inhibitors I-l to 1-6 were also capable of inhibiting in a dose-dependent manner the secretion of the SipB protein expressed by either wild type Salmonella typhimurium strain SB300 or by a derivative of SB300 overexpressing SipB from a recombinant expression plasmid. In the experiment, Salmonella SB300 cells containing an expression plasmid p667 [SB300 (p667) ] which overexpresses sipB from the P_ara promoter (obtained from Jorge Galan, then at SUNY, Stony Brook, NY) were grown with shaking for 16 hours at 37C in LB medium with 0.3 M NaCl. The cells were diluted 1:40 into seven subcultures containing fresh medium with the same components and 0, 3.1, 6.2, 12.5, 25, 50, and 100 μM of compound 1-6, respectively. After 20 minutes growth at 37C a tenth of volume of 1% L-arabinose was added to each culture and growth was continued for three more hours. No difference in growth was observed among the subcultures. Cells were sedimented by centrifugation and 25 μL of the seven supernatants were loaded onto an SDS-polyacrylamide gel to resolve the various proteins present in the extracellular medium by electrophoresis. Upon completion proteins were transferred by migration through an electric field from the polyacrylamide gel onto a 0.45 μM Nytran™ membrane. The SipB polypeptides that had been secreted into the extracellular medium were then detected by first treating the Nytran™ membrane with a mouse monoclonal antibody raised against SipB (obtained from Jorge Galan, the at SUNY, Stony Brook, NY) and then with commercially available sheep anti-mouse polyclonal antibody conjugated with horseradish peroxidase, adding a chemiluminescent substrate of the latter and exposing the membrane to film for an appropriate amount of time. The results for one of such experiments showed that the presence of SipB in extracellular media of subcultures of Salmonella decreased in a dose-dependent manner when the cells had been treated with inhibitor 1-6 at concentrations of 0, 100, 50, 25, 12.5, 6.25, and 3.1 μM, respectively. Nearly complete inhibition of SipB secretion was obtained when cells were treated with 25 μM of inhibitor 1-6.

Example 6 Inhibition of type III protein secretion of effectors from a Pseudomonas aeruginosa system Inhibitors of type III protein secretion identified through their ability to inhibit SopE'-"Bla chimeric protein secretion in the high throughput assay displayed broad specificity. It was found that not only do they inhibit the secretion of various effectors of the SPI-1 system from Salmonella, but also they are capable to inhibit secretion of effectors of a type III protein secretion system in P. aeruginosa . Type III protein secretion is used by P. aeruginosa to secrete several essential virulence determinants. Two effectors of the type III protein secretion system of P. aeruginosa PA103 are the virulence determinants ExoU and ExoT. In the experiment described in this example, 1-6 inhibited the secretion of both ExoU and ExoT proteins by P. aeruginosa PA103 in a dose-dependent manner. Confluent bacterial growth from P. aeruginosa PA103 grown on Vogel Bonner agar plates (0.5% D-Glucose, 57 mM K2HP04 , 17 mM

NaNH4HP04, 10 mM citric acid, 0.8 mM MgS04 and 1.5 % agar) at 37C was resuspended in E medium (57 mM K2HP04 , 17 mM NaNH4HP04, 10 mM citric acid and 0.8 mM MgS04) with 0.5% D-glucose and the absorbance of the cells read at 600 nm in a spectrophotometer was adjusted to 1.35. Bacteria were diluted 80-fold into a series of five flasks containing 90% trypticase soy broth dialysate, 1% glycerol, lOOmM glutamic acid, and 10 mM of nitrilotriacetic acid (an activator of the type III protein secretion system of the P. aeruginosa) , and inhibitor 1-6 at concentrations of 0 (control), 100, 50, 25, and 12.5 μM, and grown for 8 hours at 32C with 200 rpm shaking. At the end of this period all cultures had grown to similar density. Equal volumes from each culture were removed and the cells were sedimented by centrifugation. Equal volumes of the supernatants were removed into microcentrifuge tubes containing 340 mg of ammonium sulfate for each 0.6 mL of liquid added, mixed until dissolved and kept at 4C for at least eight hours to precipitate the proteins . At the end of this period, precipitated proteins were sedimented by centrifugation, and the liquid removed carefully. Pellets were then resuspend in 1:20 of the original volume, and 20 μL samples loaded onto an SDS polyacrylamide gel for electrophoretic separation of the extracellular proteins. Upon completion of electrophoresis the gel was stained with Colloidal Blue™ stain (Invitrogen, Cat NO. LC6025) to visualize the proteins. The electrophoretic profile of the proteins secreted into the extracellular medium by P. aeruginosa PA103 showed that the secretion of both ExoU and ExoT by P. aeruginosa PA103 was inhibited by 1-6 in a dose-dependent manner and with an IC₅₀ (concentration of inhibitor that reduces the secretion of a given effector by 50%) of approximately 25 μM for ExoU secretion. Example 7 Inhibition of type III protein secretion and accumulation of effectors in bacterial cytoplasm If the' inhibitors of type III protein secretion prevent the export of the effectors of the system, then the latter would be expected to accumulate within the bacterial cytoplasm. In this example it was shown that the inhibition of the type III protein secretion of the effector SipB by 1-6 was accompanied by a dose-dependent accumulation of the protein within the cytoplasm of Salmonella . SB300 cells containing plasmid p667 [SB300 (p667) ] that overexpresses the sipB gene from the P_ara promoter (obtained from Jorge Galan, then at SUNY, Stony Brook, NY) grown with shaking for 16 hours at 37C in LB medium with 0.3 M NaCl were diluted 1:40 into seven subcultures containing fresh medium with the same components and 0, 3.-1, 6.2, 12.5, 25, 50, and 100 μM of compound 1-6, respectively. After 20 minutes growth at 37C, a tenth of a volume of 1% L-arabinose was added to each culture and growth with shaking was continued for three more hours. No difference in growth was observed among the subcultures. After these. three hours cells were sedimented by centrifugation, the supernatants removed for further analysis and the pellets washed once with buffer, and resuspended in a tenth of original volume of lysis buffer. Upon lysis of the seven cell supensions, a fifth of the volume of each was loaded onto an SDS- polyacrylamide gel to resolve proteins by electrophoresis. In parallel, 10 μL of the seven supernatants were loaded onto a separate SDS-polyacrylamide gel to resolve by electrophoresis the various proteins present in the extracellular medium. Upon completion of electrophoresis, proteins were transferred by migration through an electric field from the two polyacrylamide gels onto two separate 0.45 μM Nytran™ membranes. SipB polypeptide secreted into the extracellular medium obtained from the supernatant and SipB polypeptide accumulated inside the cells were then detected by first treating the Nytran™ membranes with a mouse monoclonal antibody raised against SipB (obtained from Jorge Galan, then at SUNY, Stony Brook, NY) and then with commercially available sheep anti-mouse polyclonal antibody conjugated with horseradish peroxidase, adding a chemiluminescent substrate of the latter and exposing the membrane to film for an appropriate amount of time. The results of this experiment showed that when Salmonella was treated with different concentrations of I- 6 inhibitor, type III protein secretion of SipB polypeptide into culture supernatants was inhibited in a dose-dependent manner, and that this inhibition was paralleled by a dose-dependent accumulation of SipB polypeptides inside bacterial cells.. In addition, multiple bands of SipB were observed in the bacterial cytoplasm upon inhibition of secretion by 1-6 suggests that accumulation of SipB in the cytoplasm may be accompanied by proteolytic degradation.

Claims

What is claimed is:

1. A method of identifying an activator or inhibitor of a type III 'protein secretion system, comprising the steps of : a) exposing a Gram-negative bacterial cell to a candidate compound, wherein said bacterial cell ■contains a recombinant β-lactamase whose secretion is dependent on a type III protein secretion system; and b) detecting the amount of recombinant β-lactamase secreted outside the bacterial cell; wherein an inhibitor for the bacterial type III secretion system decreases the amount of recombinant β- lactamase secreted outside the bacterial cell as compared to a control wherein the bacterial cell is not contacted with the inhibitor; and an activator for the bacterial type III secretion system increases the amount of recombinant β-lactamase secreted outside the bacterial cell as compared to a control wherein the bacterial cell is not contacted with the activator.

2. The method according to claim 1, wherein said recombinant β-lactamase comprises a secretory signal recognizable by a type III secretion system operably linked to the N-terminal end of a mature β-lactamase.

3. The method according to claim 1 further comprising a step of activating the type III protein secretion system prior to the step of detecting the amount of recombinant β-lactamase secreted outside the cell.

4. The method according to claim 1, wherein the expression of the recombinant β-lactamase protein is under the control of an inducible promoter.

5. The method according to claim 4, wherein the inducible promoter is regulated by a transcriptional regulator selected from the group consisting of AraC, Lad, TetR, and Lambda cl .

6. The method according to claim 4 further comprising the step of inducing the expression of the recombinant β- lactamase immediately before exposing the host cell to the candidate compound.

7. The method according to claim 4 further comprising the step of inducing the expression of the recombinant β- lactamase shortly after exposing the recombinant host cell to the candidate compound.

8. The method according to claim 1, wherein the expression of the recombinant β-lactamase is constitutive.

9. The method according to claim 1, wherein the Gram- negative bacterial cell is selected from the group consisting of cells of Shigella, Salmonella, Yersinia, Escherichia, Pseudomonas, Xanthomonas, Ralstonia, and Erwinia .

10. The method according to claim 9, wherein the Salmonella bacterial cell is a serovar of Salmonella ent erica .

11. The method according to claim 10, wherein the Salmonella bacterial cell is Salmonella typhimurium .

12. The method according to claim 1 further comprising the step of testing the effect of the candidate compound in another Gram-negative bacterial cell that contains a type III protein secretion system.

13. The method according to claim 12, wherein the other Gram-negative bacterial cell is a Salmonella bacterial cell .

14. The method according to claim 12, wherein the other Gram-negative bacterial cell is selected from the group consisting of Shigella, Yersinia, Escherichia,

Pseudomonas, Xanthomonas, Ralstonia, Chlamydia and Erwinia .

•15. The method according to claim 2, wherein the recombinant β-lactamase comprises an amino acid sequence of SEQ ID No: 1.

16. A method of monitoring the activity of a type III protein secretion system in a Gram-negative bacterial cell, comprising the steps of: 1) introducing a recombinant expression vector into the bacterial cell, wherein the vector is capable of expressing a recombinant β-lactamase whose secretion is dependent on the type III protein secretion system of the bacterial cell; 2) selecting the recombinant bacterial host cell that is capable of expressing the recombinant β-lactamase; 3) detecting the amount of recombinant β-lactamase secreted outside the recombinant bacterial host cell.

17. The method according to claim 16, wherein the Gram- negative bacterial cell is selected from the group consisting of cells of Shigella, Salmonella, Yersinia, Escherichia, Pseudomonas, Xanthomonas, Ralstonia, and Erwinia .

18. The method according to claim 1, wherein the amount of recombinant β-lactamase secreted outside the cell is detected by measuring β-lactamase activity using a colorimetric reaction.

19. The method according to claim 18, wherein a β- lactamase substrate that is unable to penetrate through bacterial cell membranes is used for the Colorimetric reaction.

20. The method according to claim 18, wherein a β- lactamase substrate that is unable to penetrate through bacterial cell membranes within the time constraints of the reaction is used for the colorimetric reaction.

21. The method according to claim 20, wherein the β- lactamase substrate is nitrocefin

22. An isolated polypeptide comprising a recombinant β- lactamase whose secretion is dependent on a type III protein secretion system.

23. The isolated polypeptide according to claim 22, wherein the secretion of said recombinant β-lactamase is dependent on a SPI-1 type III protein secretion system.

24. The isolated polypeptide according to claim 22, comprising a secretory signal recognizable by a type III secretion system operably linked to the N-terminal end of a mature β-lactamase.

25. The isolated polypeptide according to claim 24 comprising an amino acid sequence of SEQ ID NO: 1.

26. An isolated nucleic acid molecule comprising a ^' nucleotide sequence that encodes a recombinant β-lactamase whose secretion is dependent on a type III protein secretion system.

27. The isolated nucleic acid molecule according to claim 26 comprising a nucleotide sequence that encodes a recombinant β-lactamase whose secretion is dependent on a SPI-1 type III secretion system.

28. The isolated nucleic acid molecule according to claim 27 comprising a nucleotide sequence that encodes a recombinant β-lactamase having an amino acid sequence of SEQ ID NO: 1.

29. The isolated nucleic acid molecule according to claim 28 comprising a nucleotide sequence of SEQ ID NO: 2.

30. A recombinant vector comprising a nucleic acid molecule that encodes a recombinant β-lactamase whose secretion is dependent on a type III secretion system.

31. The recombinant vector of claim 30 wherein the vector is a recombinant expression plasmid.

32. The recombinant vector according to claim 31 wherein said recombinant expression plasmid is pPRI449.

33. A recombinant Gram-negative bacterial cell comprising a nucleic acid molecule that encodes a recombinant β- lactamase whose secretion is dependent on a type III protein secretion system.

34. The recombinant Gram-negative bacterial cell according to claim 33 comprising a recombinant vector pPRI449.

35. The recombinant Gram-negative bacterial cell according to claim 33 wherein the nucleic acid molecule is integrated onto the bacterial chromosome.

36. The recombinant Gram-negative bacterial cell according to claim 33 wherein the nucleic acid molecule is on an expression vector.

37. The recombinant Gram-negative bacterial cell according to claim 33 that is a Salmonella typhimurium.