WO2005111217A2

WO2005111217A2 - Nicotiana nucleic acid molecules and uses thereof

Info

Publication number: WO2005111217A2
Application number: PCT/US2005/014803
Authority: WO
Inventors: Dongmei Xu; Mark T. Nielsen
Original assignee: U.S. Smokeless Tobacco Company
Priority date: 2004-04-29
Filing date: 2005-04-27
Publication date: 2005-11-24
Also published as: EP2295549A1; AU2005243214B2; AU2005243214A1; WO2005111217A3; PL1751278T3; PL2295549T3; EP2295549B1; EP1751278B1; EP1751278A2

Abstract

The present invention features Nicotiana nucleic acid sequences such as sequences encoding constitutive, or ethylene or senescence induced polypeptides, in particular cytochrome p450 enzymes, in Nicotiana plants and methods for using these nucleic acid sequences and plants to alter desirable traits, for example by using breeding protocols.

Description

NICOTIANA NUCLEIC ACID MOLECULES AND USES THEREOF

The present invention relates to Nicotiana nucleic acid sequences such as sequences encoding constitutive, or ethylene or senescence induced polypeptides, in particular cytochrome p450 enzymes (hereinafter referred to as p450 and p450 enzymes), in Nicotiana plants and methods for using these nucleic acid sequences to alter plant phenotypes.

Background During tobacco ripening or curing the expression of various genes is altered. Such genes may affect metabolic pathways involved in the formation of numerous secondary metabolites including terpenoids, polyphenols, and alkaloids that affect end-product quality traits. For example, the bioconversion of nicotine to form nornicotine during plant senescence and in the post-harvest or leaf curing phase occurs in many Nicotiana species. Nicotine is the predominant source of nornicotine. The nornicotine alkaloid, is a substrate for microbe-mediated nitrosation to form the tobacco specific nitrosamine (TSNA) iV-nitrosonornicotine (NNN) during leaf curing or subsequent leaf storage and processing. Genes expressed during tobacco ripening or curing may be constitutively expressed, ethylene-induced or senescence-related genes, for instance, genes encoding a cytochrome p450. Cytochrome p450s, for example, catalyze enzymatic reactions for a diverse range of chemically dissimilar substrates that include the oxidative, peroxidative, and reductive metabolism of endogenous and xenobiotic substrates. In plants, p450s participate in biochemical pathways that include the synthesis of plant products such as phenylpropanoids, alkaloids, terpenoids, lipids, cyanogenic glycosides, and glucosinolates studied (Chappell, Annu. Rev. Plant Physiol. Plant Mol. Biol. 46:521-547, 1995). Cytochrome p450s, also known as p450 heme-thiolate proteins, usually act as terminal oxidases in multi-component electron transfer chains, called p450- containing monooxygenase systems. Specific reactions catalyzed by these enzyme systems include demethylation, hydroxylation, epoxidation, N- oxidation, sulfooxidation, N-, S-, and O- dealkylations, desulfation, deamination, and reduction of azo, nitro, and N-oxide groups. The diverse role of icotiana plant p450 enzymes has been implicated in effecting a variety of plant metabolites such as phenylpropanoids, alkaloids, terpenoids, lipids, cyanogenic glycosides, glucosinolates, and a host of other chemical entities. Some p450 enzymes can impact the composition of plant metabolites. For example, it has been long desired to improve the flavor and aroma of certain plants by altering a plant's profile of selected fatty acids through breeding; however very little is known about mechanisms involved in controlling the levels of these leaf constituents. The down regulation or up regulation of p450 enzymes associated with the modification of fatty acids may facilitate accumulation of desired fatty acids that provide more preferred leaf phenotypic qualities. The function of p450 enzymes and their broadening roles in plant constituents is still being discovered. For instance, a special class of p450 enzymes was found to catalyze the breakdown of fatty acid into volatile C6- and C9-aldehydes and β- alcohols that are major contributors of "fresh green" odor of fruits and vegetables. The level of other novel targeted p450s may be altered to enhance the qualities of leaf constituents by modifying lipid composition and related breakdown metabolites in Nicotiana leaf. Several of these constituents in leaf are affected by senescence that stimulates the maturation of leaf quality properties. Still other reports have shown that p450s enzymes are play a functional role in altering fatty acids that are involved in plant-pathogen interactions and disease resistance. The large multiplicity of p450 enzyme forms, their differing structure and function have made their research on Nicotiana p450 enzymes very difficult before the present invention. In addition, cloning of p450 enzymes has been hampered at least in part because these membrane-localized proteins are typically present in low abundance and often unstable during purification. Hence, a need exists for the identification of p450 enzymes in plants and the nucleic acid sequences associated with those p450 enzymes, fn particular, only a few cytochrome p450 proteins have been reported in Nicotiana. The inventions described herein entail the discovery of cytochrome 450s and cytochrome p450 fragments that correspond to several groups of p450 species based on their sequence identity. In addition to the p450 sequences, the present invention encompasses the discovery of other constitutive and ethylene or senescence induced sequences that address the need for regulating metabolic pathways involved in the formation of secondary metabolites that affect the quality of a tobacco product. These sequences are also useful in the development of plant germplasms that have desirable traits for use in breeding programs to develop more desirable germplasms, and especially non- GMO (genetically modified organism) type germplasms.

Summary ofthe Invention The present inventors have identified and characterized constitutive, and ethylene and senescene induced sequences, including a genomic clone of nicotine demethylase, from tobacco. Also described herein is the use of these sequences in breeding methods and in methods to create a plant (e.g., a transgenic plant) having desirable traits, such as altered levels of nornicotine or N'-nitrosonornicotine ("NNN") or both relative to a control plant. In one aspect, the invention features a breeding method for producing a tobacco plant having decreased expression of a nicotine demethylase gene, the method including the steps of: (a) providing a first tobacco plant having variant nicotine demethylase gene expression; (b) providing a second tobacco plant that contains at least one phenotypic trait; (c) crossing the first tobacco plant with the second tobacco plant to produce an FI progeny plant; (d) collecting seed ofthe FI progeny for the variant nicotine demethylase gene expression; and (e) germinating the seed to produce a tobacco plant having decreased expression ofthe nicotine demethylase gene. In one embodiment, a tobacco plant is identified as variant for nicotine demethylase gene expression (e.g., at the transcriptional, post transcriptional, or translational levels or at the level of enzymatic activity) using the sequences described herein and standard methods known in the art. In another embodiment of this breeding method, the first tobacco plant includes an endogenous nicotine demethylase gene having a mutation (e.g., a deletion, substitution, point mutation, translocation, inversion, duplication, or an insertion). In another embodiment, the first tobacco plant includes a nicotine demethylase gene having a null mutation, includes a recombinant gene that silences an endogenous nicotine demethylase gene, or includes a nicotine demethylase having reduced or altered enzymatic activity. In yet another embodiment, the nicotine demethylase gene ofthe first tobacco plant is absent. In still another embodiment, the first tobacco plant is a transgenic plant. Exemplary first tobacco plants useful in the breeding methods disclosed herein include Nicotiana africana, Nicotiana amplexicaulis, Nicotiana arentsii, Nicotiana benthamiana, Nicotiana bigelovii, Nicotiana corymbosa, Nicotiana debneyi, Nicotiana excelsior, Nicotiana exigua, Nicotiana glutinosa, Nicotiana goodspeedii, Nicotiana gossei, Nicotiana hesperis, Nicotiana ingulba, Nicotiana knightiana, Nicotiana maritima, Nicotiana megalosiphon, Nicotiana miersii, Nicotiana nesophila, Nicotiana noctiflora, Nicotiana nudicaulis, Nicotiana otophora, Nicotiana palmeri, Nicotiana paniculata, Nicotiana petunioides, Nicotiana plumbaginifolia, Nicotiana repanda, Nicotiana rosulata, Nicotiana rotundifolia, Nicotiana rustica, Nicotiana setchelli, Nicotiana stocktonii, Nicotiana eastii, Nicotiana suaveolens or Nicotiana trigonophylla. Desirably the first tobacco plant is Nicotiana amplexicaulis, Nicotiana benthamiana, Nicotiana bigelovii, Nicotiana debneyi, Nicotiana excelsior, Nicotiana glutinosa, Nicotiana goodspeedii, Nicotiana gossei, Nicotiana hesperis, Nicotiana knightiana, Nicotiana maritima, Nicotiana megalosiphon, Nicotiana nudicaulis, Nicotiana paniculata, Nicotiana plumbaginifolia, Nicotiana repanda, Nicotiana rustica, Nicotiana suaveolens or Nicotiana trigonophylla. Other first tobacco plants include varieties of Nicotiana tabacum (or Nicotiana rustica) or transgenic lines associated therewith that have been engineered to have decreased levels of nicotine demethylase. Other exemplary first tobacco plants include an Oriental, a dark tobacco, flue or air-cured tobacco, Virginia, or a Burley tobacco plant. In another embodiment ofthe above-described breeding method, the second tobacco plant is Nicotiana tabacum. Exemplary varieties of Nicotiana tabacum include commercial varieties such as BU 64, CC 101, CC 200, CC 27, CC 301, CC 400, CC 500, CC 600, CC 700, CC 800, CC 900, Coker 176, Coker 319, Coker 371 Gold, Coker 48, CU 263, DF911, Galpao tobacco, GL 26H, GL 350, GL 737, GL 939, GL 973, HB 04P, K 149, K 326, K 346, K 358, K 394, K 399, K 730, KT 200, KY 10, KY 14, KY 160, KY 17, KY 171, KY 907, KY 160, Little Crittenden, McNair 373, McNair 944, msKY 14 x L8, Narrow Leaf Madole, NC 100, NC 102, NC 2000, NC 291, NC 297, NC 299, NC 3, NC 4, NC 5, NC 6, NC 606, NC 71, NC 72, NC 810, NC BH 129, OXFORD 207, 'Perique' tobacco, PVH03, PVH09, PVH19, PVH50, PVH51, R 610, R 630, R 7-11, R 7-12, RG 17, RG 81, RG H4, RG H51, RGH 4, RGH 51, RS 1410, SP 168, SP 172, SP 179, SP 210, SP 220, SP G-28, SP G-70, SP H20, SP NF3, TN 86, TN 90, TN 97, TN D94, TN D950, TR (Tom Rosson) Madole, VA 309, VA 309, or VA 359. hi still other embodiments, the phenotypic trait ofthe second tobacco plant includes disease resistance; high yield; high grade index; curability; curing quality; mechanical harvestability; holding ability; leaf quality; height, plant maturation (e.g., early maturing, early to medium maturing, medium maturing, medium to late maturing, or late maturing); stalk size (e.g., a small, medium, or a large stalk); or leaf number per plant (e.g., a small (e.g., 5-10 leaves), medium (e.g., 11-15 leaves), or large (e.g., 16-21) number of leaves). In still other embodiments, the method further includes self-pollinating or pollinating a male sterile pollen acceptor, a pollen donor capable of being used in production of a hybrid or a male sterile hybrid with the plant of step (b) or backcrossing or self-pollinating plants produced from germinated seed of step (e). In another aspect, the invention features a method of breeding a nicotine demethylase deficiency trait into a tobacco plant, the method including the steps of: a) crossing a first tobacco plant having variant nicotine demethylase gene expression with a second tobacco plant; b) producing progeny tobacco plants ofthe cross; c) extracting a DNA sample from progeny tobacco plants; d) contacting the DNA sample with a marker nucleic acid molecule that hybridizes to a nicotine demethylase gene or fragment thereof; and e) performing a marker assisted breeding method for the variant nicotine demethylase gene expression trait. For example, plants are identified as having variant gene expression of a nicotine demethylase and, if desired, are further tested for nicotine demethylase gene expression or tested using standard alkaloid profiling or immunoblotting analysis. Typically such a marker assisted breeding method includes utilizing an amplified fragment length polymorphism, restriction fragment length polymorphism, random amplified polymorphism display, single nucleotide polymorphism, a microsatellite marker, or a targeted induced local lesion in a tobacco genome. In yet another aspect, the invention features a method of producing tobacco seed, including crossing any one ofthe tobacco plants selected from the group consisting of Nicotiana africana, Nicotiana amplexicaulis, Nicotiana arentsii, Nicotiana benthamiana, Nicotiana bigelovii, Nicotiana corymbosa, Nicotiana debneyi, Nicotiana excelsior, Nicotiana exigua, Nicotiana glutinosa, Nicotiana goodspeedii, Nicotiana gossei, Nicotiana hesperis, Nicotiana ingulba, Nicotiana hnghtiana, Nicotiana maritima, Nicotiana megalosiphon, Nicotiana miersii, Nicotiana nesophila, Nicotiana noctiflora, Nicotiana nudicaulis, Nicotiana otophora, Nicotiana palmeri, Nicotiana paniculata, Nicotiana petunioides, Nicotiana plumbaginifolia, Nicotiana repanda, Nicotiana rosulata, Nicotiana rotundifolia, Nicotiana rustica, Nicotiana setchelli, Nicotiana stocktonii, Nicotiana eastii,

Nicotiana suaveolens, and Nicotiana trigonophylla with itself. In one embodiment, the method further includes a method of preparing hybrid tobacco seed, including crossing a tobacco plant having variant nicotine demethylase gene expression to a second, distinct tobacco plant. In still another embodiment of this method, the crossing includes the steps of: (a) planting a seed ofthe cross resulting from the tobacco plant having variant nicotine demethylase gene expression and a second, distinct tobacco plant; (b) growing tobacco plants from the seed until the plants bear flowers; (c) pollinating a flower ofthe tobacco plant having variant nicotine demethylase gene expression with pollen from the second tobacco plant or pollinating a flower ofthe second tobacco plant with pollen from the flower ofthe tobacco plant having variant nicotine demethylase gene expression; and (d) harvesting seed resulting from the pollinating. In still another aspect, the invention features a method for developing a tobacco plant in a tobacco breeding program including: (a) providing a tobacco plant, or its components, having variant nicotine demethylase gene expression; and (b) employing the plant or plant components as a source of breeding material using tobacco plant breeding techniques. Exemplary plant breeding techniques useful for practicing this method include bulk selection, backcrossing, self-pollination, introgression, pedigree selection, pureline selection, haploid/doubled haploid breeding, or single seed descent. In another aspect, the invention features a breeding method for producing a tobacco plant having a modified attribute, the method including the steps of: (a) providing a first tobacco plant having a modified attribute including variant gene expression of a nucleic acid molecule selected from the group consisting of the nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294; (b) providing a second tobacco plant that contains at least one phenotypic trait; (c) crossing the first tobacco plant with the second tobacco plant to produce an FI progeny plant; (d) collecting seed ofthe FI progeny for the modified attribute; and (e) germinating the seed to produce a tobacco plant having the modified attribute. In one embodiment, the first tobacco plant includes an endogenous nucleic acid molecule selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294, wherein the nucleic acid includes a mutation. Exemplary mutations include deletion, substitution, point mutation, translocation, inversion, duplication, or an insertion. In still another embodiment, the first tobacco plant ofthe above-described method includes an endogenous nucleic acid molecule selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294, wherein the nucleic acid includes a null mutation. In still yet another embodiment, the first tobacco plant includes a recombinant gene that silences expression of endogenous nucleic acid molecule an endogenous nucleic acid molecule selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294. The first tobacco plant includes, if desired, an endogenous nucleic acid molecule selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172- 19, and Figures 173-1 to 173-294, wherein the nucleic acid molecule encodes a polypeptide having reduced or altered enzymatic activity, hi still other embodiments, the first tobacco plant is a transgenic plant. Exemplary first tobacco plants useful in the breeding methods disclosed herein include Nicotiana africana, Nicotiana amplexicaulis, Nicotiana arentsii, Nicotiana benthamiana, Nicotiana bigelovii, Nicotiana corymbosa, Nicotiana debneyi, Nicotiana excelsior, Nicotiana exigua, Nicotiana glutinosa, Nicotiana goodspeedii, Nicotiana gossei, Nicotiana hesperis, Nicotiana ingulba, Nicotiana knightiana, Nicotiana maritima, Nicotiana megalosiphon, Nicotiana miersii, Nicotiana nesophila, Nicotiana noctiflora, Nicotiana nudicaulis, Nicotiana otophora, Nicotiana palmeri, Nicotiana paniculata, Nicotiana petunioides, Nicotiana plumbaginifolia, Nicotiana repanda, Nicotiana rosulata, Nicotiana rotundifolia, Nicotiana rustica, Nicotiana setchelli, Nicotiana stocktonii, Nicotiana eastii, Nicotiana suaveolens or Nicotiana trigonophylla. Other first tobacco plants include varieties of Nicotiana tabacum or Nicotiana rustica. Still other first tobacco plant is an Oriental, a dark tobacco, flue or air-cured tobacco, Virginia, or a Burley tobacco plant. In another embodiment ofthe above-described breeding method, the second tobacco plant is Nicotiana tabacum. Exemplary varieties of Nicotiana tabacum include commercial varieties such as BU 64, CC 101, CC 200, CC 27, CC 301, CC 400, CC 500, CC 600, CC 700, CC 800, CC 900, Coker 176, Coker 319, Coker 371 Gold, Coker 48, CU 263, DF911, Galpao tobacco, GL 26H, GL 350, GL 737, GL 939, GL 973, HB 04P, K 149, K 326, K 346, K 358, K 394, K 399, K 730, KT 200, KY 10, KY 14, KY 160, KY 17, KY 171, KY 907, KY 160, Little Crittenden, McNair 373, McNair 944, msKY 14 x L8, Narrow Leaf Madole, NC 100, NC 102, NC 2000, NC 291, NC 297, NC 299, NC 3, NC 4, NC 5, NC 6, NC 606, NC 71, NC 72, NC 810, NC BH 129, OXFORD 207, 'Perique' tobacco, PVH03, PVH09, PVH19, PVH50, PVH51, R 610, R 630, R 7-11, R 7-12, RG 17, RG 81, RG H4, RG H51, RGH 4, RGH 51, RS 1410, SP 168, SP 172, SP 179, SP 210, SP 220, SP G-28, SP G-70, SP H20, SP NF3, TN 86, TN 90, TN 97, TN D94, TN D950, TR (Tom Rosson) Madole, VA 309, VA 309, or VA 359. In still other embodiments, the phenotypic trait ofthe second tobacco plant includes disease resistance; high yield; high grade index; curability; curing quality; mechanical harvestability; holding ability; leaf quality; height, plant maturation (e.g., early maturing, early to medium maturing, medium maturing, medium to late maturing, or late maturing); stalk size (e.g., a small, medium, or a large stalk); or leaf number per plant (e.g., a small (e.g., 5-10 leaves), medium (e.g., 11-15 leaves), or large (e.g., 16-21) number of leaves). In still further embodiments, the method includes pollinating a male sterile or a male sterile hybrid with the plant of step (b) or backcrossing or pollinating plants produced from germinated seed of step (e). In another aspect, the invention features a method of breeding an attribute into a tobacco plant, the method including the steps of: a) crossing a first tobacco plant having a modified attribute including variant gene expression of a nucleic acid molecule selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294 with a second tobacco plant; b) producing progeny tobacco plants ofthe cross; c) extracting a DNA sample from progeny tobacco plants; d) contacting the DNA sample with a marker nucleic acid molecule that hybridizes to a nucleic acid molecule selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294 or a fragment thereof; and e) performing a marker assisted breeding method for the modified attribute. Typically such a marker assisted breeding method includes utilizing an amplified fragment length polymorphism, restriction fragment length polymorphism, random amplified polymorphism display, single nucleotide polymorphism, a microsatellite marker, or a targeted induced local lesion in a tobacco genome. In yet another aspect, the invention features a method of producing tobacco seed, including crossing any one ofthe tobacco plants selected from the group consisting of Nicotiana africana, Nicotiana amplexicaulis, Nicotiana arentsii, Nicotiana benthamiana, Nicotiana bigelovii, Nicotiana corymbosa, Nicotiana debneyi, Nicotiana excelsior, Nicotiana exigua, Nicotiana glutinosa, Nicotiana goodspeedii, Nicotiana gossei, Nicotiana hesperis, Nicotiana ingulba, Nicotiana knightiana, Nicotiana maritima, Nicotiana megalosiphon, Nicotiana miersii,

Nicotiana nesophila, Nicotiana noctiflora, Nicotiana nudicaulis, Nicotiana otophora, Nicotiana palmeri, Nicotiana paniculata, Nicotiana petunioides, Nicotiana plumbaginifolia, Nicotiana repanda, Nicotiana rosulata, Nicotiana rotundifolia, Nicotiana rustica, Nicotiana setchelli, Nicotiana stocktonii, Nicotiana eastii, Nicotiana suaveolens and Nicotiana trigonophylla with a tobacco plant having a modified attribute including variant gene expression of a nucleic acid molecule selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294 to a second, distinct tobacco plant. In still another embodiment, crossing includes the steps of: (a) planting a seed ofthe cross resulting from the tobacco plant having the modified attribute and a second, distinct tobacco plant; (b) growing tobacco plants from the seed until the plants bear flowers; (c) pollinating a flower ofthe tobacco plant having a modified attribute with pollen from the second tobacco plant or pollinating a flower ofthe second tobacco plant with pollen from the plant of the tobacco plant having the modified attribute; and (d) harvesting seed resulting from the pollinating. In still another aspect, the invention features a method for developing a tobacco plant in a tobacco breeding program including: (a) providing a tobacco plant, or its components, having a modified attribute including variant gene expression of a nucleic acid molecule selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172- 1 to 172-19, and Figures 173-1 to 173-294; and (b) employing the plant or plant components as a source of breeding material using tobacco plant breeding techniques. Exemplary plant breeding techniques include bulk selection, backcrossing, self- pollination, introgression, pedigree selection, pureline selection, haploid/doubled haploid breeding, or single seed descent. In related aspects the invention features a tobacco plant or components thereof, produced according to any one ofthe aforementioned breeding methods. In still a further related aspect, the invention features a tissue culture of regenerable tobacco cells obtained from any one ofthe plants bred or produced according to the methods described herein. Such tissue cultures regenerate tobacco plants capable of expressing all the physiological and morphological characteristics ofthe tobacco plant having variant nicotine demethylase gene expression or a modified attribute. Exemplary regenerable cells are embryos, meristematic cells, seeds, pollen, leaves, roots, root tips, or flowers or are protoplasts or callus derived therefrom. In still related aspects, the invention features a method of producing a tobacco product involving: (a) providing a tobacco plant produced according to any one ofthe aforementioned breeding methods; and (b) preparing a tobacco product from the tobacco plant. Exemplary tobacco products include leaves or stems or both; a smokeless tobacco product; a moist or dry snuff; a chewing tobaccos; cigarette products; cigar products; cigarillos; pipe tobaccos; or bidis. An aspect ofthe invention features an isolated genetic marker including a nucleic acid sequence that is substantially identical, desirably at least 70% identical, to a nucleic acid sequence shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294. In a desirable embodiment of this aspect ofthe invention, the nucleic acid sequence includes a sequence that hybridizes under stringent conditions to the complement of a nucleic acid sequence shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294. Tn other desirable embodiments, the nucleic acid sequence is constitutive, or ethylene or senescence induced. In addition, the nucleic acid sequence desirably encodes a polypeptide that is substantially identical to an amino acid sequence shown in Figure 1, Figures 3 and 4, Figures 10 to 158, Figures 160 A to 160E, Figures 162 to 170, and Figures 172-1 to 172-19. In other desirable embodiments ofthe invention, the nucleic acid sequence is operably linked to a heterologous gene or the nucleic acid sequence is operably linked to an inducible, constitutive, pathogen- or wound-induced, environmentally- or developmentally-regulated, or cell- or tissue-specific promoter. In another aspect, the invention features an expression vector containing a nucleic acid sequence shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172- 1 to 172- 19, and Figures 173 - 1 to 173-294, where the vector is capable of directing expression ofthe polypeptide encoded by the nucleic acid sequence. Further aspects ofthe invention features a substantially pure polypeptide containing the amino acid sequence of a polypeptide shown in Figure 1, Figures 3 and 4, Figures 10 to 158, Figures 160A to 160E, Figures 162 to 170, or Figures 172-1 to 172-19, as well as antibodies that specifically recognize the polypeptide. An additional aspect ofthe invention features a plant or plant component containing an isolated nucleic acid sequence shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294, where the nucleic acid sequence is expressed in the plant or the plant component, or a nucleic acid sequence that encodes a polypeptide that is substantially identical to an amino acid sequence shown in Figure 1, Figures 3 and 4, Figures 10 to 158, Figures 160A to 160E, Figures 162 to 170, and Figures 172-1 to 172-19, where the nucleic acid sequence is expressed in the plant or the plant component. Desirably, the plant or plant component is a species of Nicotiana, for example, a Nicotiana species shown in Table 8. hi other desirable embodiments, the plant component is a leaf, e.g., a cured tobacco leaf, a stem, or a seed. A desirable embodiment features a plant from the germinated seed. In a further aspect, the invention features a tobacco product containing a plant or plant component containing an isolated nucleic acid sequence shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294, where the nucleic acid sequence is expressed in the plant or the plant component. Desirably, the expression of an endogenous gene in the cured tobacco plant or plant component is silenced. In other desirable embodiments, the tobacco product is a smokeless tobacco product, moist or dry snuff, a chewing tobaccos, cigarette products, cigar products, cigarillos, pipe tobaccos, or bidis. In particular, the tobacco product of this aspect ofthe invention may contain dark tobacco, milled tobacco, or include a flavoring component. An additional aspect ofthe invention features a method for reducing the expression or enzymatic activity of a constitutive, or an ethylene induced or senescence induced tobacco polypeptide in a plant cell. This method involves reducing the level or enzymatic activity of an endogenous constitutive, or ethylene or senescence induced tobacco polypeptide in the plant cell. In a desirable embodiment, the tobacco polypeptide is a p450. hi other desirable embodiments, the plant cell is from a species of Nicotiana, e.g., one of the Nicotiana species shown in Table 8. In further desirable embodiments, reducing the level ofthe endogenous constitutive, or ethylene or senescence induced tobacco polypeptide involves expressing a transgene encoding an antisense nucleic acid molecule of a nucleic acid sequence shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294 or a nucleic acid sequence that encodes a polypeptide containing an amino acid sequence shown in Figure 1, Figures 3 and 4, Figures 10 to 158, Figures 160A to 160E, Figures 162 to 170, and Figures 172-1 to 172-19 in the plant cell, hi another desirable embodiment, the transgene encodes a double-stranded RNA molecule of a constitutive, or an ethylene or senescence induced tobacco nucleic acid or amino acid sequence in the plant cell, fh other desirable embodiments, the transgene is expressed, for example, in a tissue- specific, cell-specific, or organ-specific manner. In addition, reducing the level ofthe endogenous constitutive, or ethylene or senescence induced tobacco polypeptide desirably involves co-suppression ofthe constitutive, or ethylene or senescence induced tobacco polypeptide in the plant cell. In another desirable embodiment, reducing the level ofthe endogenous constitutive, or ethylene or senescence induced tobacco polypeptide involves expressing a dominant negative gene product in the plant cell. Desirably, the endogenous constitutive, or ethylene or senescence induced tobacco polypeptide includes a mutation in a gene that encodes an amino acid sequence shown in Figure 1, Figures 3 and 4, Figures 10 to 158, Figures 160 A to 160E, Figures 162 to 170, and Figures 172-1 to 172-19. In further desirable embodiments, reduced expression occurs at the transcriptional level, at the translational level, or at the post-translational level. An additional aspect the invention features a method for increasing the expression or enzymatic activity of a constitutive, or an ethylene or senescence induced tobacco polypeptide in a plant cell. This method involves increasing the level or enzymatic activity of an endogenous constitutive, or ethylene or senescence induced tobacco polypeptide in the plant cell, hi a desirable embodiment of this aspect ofthe invention, the plant cell is from a species of Nicotiana, for example, a Nicotiana species shown in Table 8. In another desirable embodiment, increasing the level ofthe constitutive, or ethylene or senescence induced tobacco polypeptide involves expressing a transgene including a nucleic acid sequence shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294 or a nucleic acid sequence that encodes a polypeptide containing an amino acid sequence shown in Figure 1, Figures 3 and 4, Figures 10 to 158, Figures 160A to 160E, Figures 162 to 170, and Figures 172-1 to 172-19 in the plant cell. Desirably, increased expression occurs at the transcriptional level, at the translational level, or at the post-translational level. A further aspect ofthe invention features a method of producing a constitutive, or an ethylene or senescence induced tobacco polypeptide. This method involves the steps of: (a) providing a cell transformed with an isolated nucleic acid molecule containing a nucleic acid sequence shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294; (b) culturing the transformed cell under conditions for expressing the isolated nucleic acid molecule; and (c) recovering the constitutive, or ethylene or senescence induced tobacco polypeptide. Desirably, the constitutive, or ethylene or senescence induced tobacco polypeptide is a p450. In another desirable embodiment, the invention features a recombinant constitutive, or ethylene or senescence induced tobacco polypeptide produced according to the method of this aspect ofthe invention. In another aspect, the mvention features a method of isolating a constitutive, or an ethylene or senescence induced tobacco polypeptide or fragment thereof. This method involves the steps of: (a) contacting a nucleic acid sequence shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294 or a portion thereof with a nucleic acid preparation from a plant cell under hybridization conditions providing detection of nucleic acid sequences having at least 70% or greater sequence identity to a nucleic acid sequence shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172- 1 to 172-19, and Figures 173-1 to 173-294; and (b) isolating the hybridizing nucleic acid sequences. Desirably, the constitutive, or ethylene or senescence induced tobacco polypeptide is a p450. A further aspect ofthe invention features an isolated nucleic acid molecule, for example, a DNA sequence, containing a nucleotide sequence encoding a nicotine demethylase. In desirable embodiments, the nucleotide sequence ofthe first aspect is substantially identical to a nucleotide sequence encoding a tobacco nicotine demethylase, such as a tobacco nicotine demethylase containing a nucleotide sequence that is at least 70% identical to the nucleotide sequence of SEQ ID NO:4 or SEQ ID NO:5, or that contains nucleotides 2010-2949 and/or 3947-4562 of SEQ ID NO:4, or that contains the sequence of SEQ ID NO:4 or SEQ ID NO:5. The isolated nucleic acid molecule ofthe first aspect ofthe invention, for example, is operably linked to a promoter functional in a plant cell and desirably is contained in an expression vector, hi other desirable embodiments, the expression vector is contained in a cell, e.g., a plant cell. Desirably, the plant cell, such as a tobacco plant cell, is included in a plant, hi another desirable embodiment, the mvention features a seed, e.g., a tobacco seed, from a plant containing the expression vector, where the seed includes an isolated nucleic acid molecule that hybridizes under stringent conditions to the sequence of SEQ ID NO: 4 operably linked to a heterologous promoter sequence. Furthermore, the invention features a plant derived from a germinated seed containing the expression vector, a leaf, either green or cured, from the plant, and an article of manufacture made from the leaf. hi another desirable embodiment, the nucleotide sequence contains a sequence that hybridizes under stringent conditions to the complement of he nucleotide sequence of SEQ ID NO:4 and/or SEQ ID NO:5, or to a fragment of SEQ ID NO:4 or SEQ ID NO:5. Desirably, the nucleotide sequence encodes a nicotine demethylase that is substantially identical to the amino acid sequence of SEQ ID NO:3. hi a further desirable embodiment ofthe first aspect ofthe invention, the nicotine demethylase has at least 70% amino acid sequence identity to the nicotine demethylase amino acid sequence of SEQ ID NO:3 or to a fragment of a nicotine demethylase having altered (e.g., reduced) enzymatic activity as compared to the full- length polypeptide. Desirably, the nicotine demethylase includes the amino acid sequence of SEQ ID NO:3. In another aspect, the invention features an isolated nucleic acid molecule containing a promoter that hybridizes under stringent conditions to the sequence of SEQ ID NO: 8, or a fragment thereof that drives transcription. Desirably, the promoter (i) is induced following treatment with ethylene or during senescence; and (ii) includes (a) base pairs 1-2009 of SEQ ID NO:4, or (b) at least 200 consecutive base pairs identical to 200 consecutive base pairs ofthe sequence defined by base pairs 1- 2009 of SEQ ID NO:4, or (c) a 20 base pair nucleotide portion identical in sequence to a 20 consecutive base pair portion ofthe sequence set forth in base pairs 1-2009 of SEQ ID NO:4. A further aspect ofthe invention features an isolated nucleic acid promoter containing a nucleotide sequence having 50% or more sequence identity with the sequence of SEQ ID NO: 8. Desirably, this isolated nucleic acid promoter is induced following treatment with ethylene or during senescence and, for example, includes the sequence of SEQ ID NO: 8. Alternatively, the promoter may include a fragment obtainable from SEQ ID NO:8, where the fragment drives transcription of a heterologous gene or reduces or alters nicotine demethylase enzymatic activity (for example, silences gene expression), hi a desirable embodiment the promoter sequence is operably linked to a heterologous nucleic acid sequence, and may, for example be contained in an expression vector, h other desirable embodiments the expression vector is contained in a cell, e.g., a plant cell. Desirably, the plant cell, such as a tobacco plant cell, is included in a plant, hi another desirable embodiment, the invention features a seed, e.g., a tobacco seed, from a plant containing the expression vector, where the seed includes an isolated nucleic acid molecule that hybridizes under stringent conditions to the sequence of SEQ ID NO: 8 operably linked to a heterologous nucleic acid sequence. Furthermore, the invention features a plant derived from a germinated seed containing the promoter of this aspect ofthe invention, a leaf, either green or cured, from the plant, and an article of manufacture made from the leaf. Another aspect ofthe invention features a method of expressing a heterologous gene in a plant. This method involves (i) introducing into a plant cell a vector containing a promoter sequence having 50% or more sequence identity with the sequence of SEQ ID NO : 8 operably linked to a heterologous nucleic acid sequence; and (ii) regenerating a plant from the cell, hi addition, this method may involve sexually transmitting the vector to progeny and, further, may include the step of collecting the seed produced by the progeny. hi yet another aspect, the invention features a method of reducing expression of nicotine demethylase in a tobacco plant. This method includes the steps of (i) introducing into the tobacco plant a vector containing the sequence of SEQ ID NO: 8 or a fragment obtainable from SEQ ID NO:8 operably linked to a heterologous nucleic acid sequence and (ii) expressing the vector in the tobacco plant, hi a desirable embodiment of this method, expression ofthe nicotine demethylase is silenced, hi other desirable embodiment, the vector expresses RNA, such as antisense RNA or an RNA molecule capable of inducing RNA interference (RNAi). In a further desirable aspect, the invention features an isolated nucleic acid molecule containing an intron that hybridizes under stringent conditions to the sequence of SEQ ID NO:7, or a fragment thereof that reduces or alters nicotine demethylase enzymatic activity (for example, silences gene expression) or can serve as a molecular marker to identify nicotine demethylase nucleic acid sequences, i a desirable embodiment, the intron includes (a) base pairs 2950-3946 of SEQ ID NO:4, or (b) at least 200 consecutive base pairs identical to 200 consecutive base pairs ofthe sequence defined by base pairs 2950-3946 of SEQ ID NO:4, or (c) a 20 base pair nucleotide portion identical in sequence to a 20 consecutive base pair portion ofthe sequence set forth in base pairs 2950-3946 of SEQ ID NO:4. Another desirable aspect ofthe invention features an isolated nucleic acid intron including a nucleotide sequence having 50% or more sequence identity with the sequence of SEQ ID NO:7, or a fragment thereof that reduces or alters nicotine demethylase enzymatic activity (for example, silences gene expression) or can serve as a molecular marker to identify nicotine demethylase nucleic acid sequences. Silencing gene expression may, for example, involve homologous recombination (e.g., using the sequence of SEQ ID NO: 188, or a fragment thereof) or a mutation that results in a gene product that does not have nicotine demethylase activity. In particular, the intron may include the sequence of SEQ ID NO:7 or a fragment obtainable from SEQ ID NO:7. Desirably, an isolated nucleic acid molecule including an intron is operably linked to a heterologous nucleic acid sequence and this sequence desirably is included in an expression vector, hi another embodiment, the expression vector is contained in a cell, such as a plant cell. In particular, the cell may be a tobacco cell. A plant, e.g., a tobacco plant, including a plant cell plant containing the sequence of SEQ ID NO:7 or a fragment obtainable from SEQ ID NO:7 operably linked to a heterologous nucleic acid sequence in an expression vector is another desirable embodiment ofthe present invention. Further, a seed, for example, a tobacco seed, from a plant, where the seed contains an intron that hybridizes under stringent conditions to SEQ ID NO:7 operably linked to a heterologous nucleic acid sequence is also desirable. Furthermore, the invention features a plant derived from the germinated seed containing the intron of this aspect ofthe invention, a leaf, either green or cured, from the plant, and an article of manufacture made from the green or cured leaf. A further aspect ofthe invention features a method of expressing an intron in a plant. This method involves (i) introducing into a plant cell an expression vector containing the sequence of SEQ ID NO: 7 or a fragment obtainable from SEQ ID NO: 7 operably linked to a heterologous nucleic acid sequence; and (ii) regenerating a plant from the cell. In a desirable embodiment, this method also involves (iii) sexually transmitting the vector to progeny, and may include the additional step of collecting the seed produced by the progeny. The method desirably includes, for example, regenerating a plant from the germinated seed, a leaf, either green or cured, from the plant, and a method of making an article of manufacture from the leaf. hi yet another aspect, the invention features a method of reducing expression of nicotine demethylase in a tobacco plant. This method includes the steps of (i) introducing into the tobacco plant a vector containing the sequence of SEQ ID NO:7 or a fragment obtainable from SEQ ID NO: 7 operably linked to a heterologous nucleic acid sequence and (ii) expressing the vector in the tobacco plant, hi a desirable embodiment of this method, expression ofthe nicotine demethylase is silenced. In other desirable embodiment, the vector expresses RNA, such as antisense RNA or an RNA molecule capable of inducing RNA interference (RNAi). hi an additional aspect, the invention features an isolated nucleic acid molecule containing an untranslated region that hybridizes under stringent conditions to the sequence of SEQ ID NO:9 or a fragment thereof that can alter the expression pattern of a gene, reduces or alters nicotine demethylase enzymatic activity (for example, silences gene expression), or can be used as a marker to identify nicotine demethylase nucleic acid sequences. In a desirable embodiment of this aspect ofthe invention, the untranslated region includes (a) base pairs 4563-6347 of SEQ ID NO:4, or (b) at least 200 consecutive base pairs identical to 200 consecutive base pairs ofthe sequence defined by base pairs 4563-6347 of SEQ ID NO:4, or (c) a 20 base pair nucleotide portion identical in sequence to a 20 consecutive base pair portion ofthe sequence set forth in base pairs 4563-6347 of SEQ ID NO:4. An additional desirable aspect ofthe invention features an isolated nucleic acid untranslated region containing a nucleotide sequence having 50% or more sequence identity with the sequence of SEQ ID NO:9. Desirably, the untranslated region includes the sequence of SEQ ID NO:9 or the untranslated region includes a fragment obtainable from SEQ ID NO: 9 that can alter the expression pattern of a gene, reduces or alters nicotine demethylase enzymatic activity (for example, silences gene expression), or can be used as a marker to identify nicotine demethylase nucleic acid sequences. The untranslated region desirably is operably linked to a heterologous nucleic acid sequence and may be contained in an expression vector. Further, this expression vector is desirably contained in a cell, such as a plant cell, e.g., a tobacco cell. Another desirable embodiment ofthe invention features a plant, such as a tobacco plant, including a plant cell containing a vector that includes an isolated nucleic acid sequence that has 50% or more sequence identity with the sequence of SEQ ID NO:9 and is operably linked to a heterologous nucleic acid sequence. The invention also features a seed, for example, a tobacco seed, from a plant, where the seed includes an untranslated region that hybridizes under stringent conditions to SEQ ID NO:9 operably linked to a heterologous nucleic acid sequence. Furthermore, the invention features a plant derived from a germinated seed containing the untranslated region of this aspect ofthe invention, a leaf, either green or cured, from the plant, and an article of manufacture made from the green or cured leaf. hi a further aspect, the invention features a method of expressing an untranslated region in a plant. This method involves (i) introducing into a plant cell a vector containing an isolated nucleic acid sequence that has 50% or more sequence identity with the sequence of SEQ ID NO:9 and is operably linked to a heterologous nucleic acid sequence; and (ii) regenerating a plant from the cell, hi addition, this method may also involve (iii) sexually transmitting the vector to progeny, and desirably, includes the additional step of collecting the seed produced by the progeny. The method desirably includes regenerating a plant from the geπninated seed, a leaf, either green or cured, from the plant, and a method of making an article of manufacture made from the green or cured leaf. Furthermore, the invention features a method of reducing expression or altering the enzymatic activity of nicotine demethylase in a tobacco plant. This method includes the steps of (i) introducing into the tobacco plant a vector containing an isolated nucleic acid sequence that has 50% or more sequence identity with the sequence of SEQ ID NO:9 and is operably linked to a heterologous nucleic acid sequence and (ii) expressing the vector in the tobacco plant. Desirably, expression of the nicotine demethylase is silenced, other desirable embodiments the vector expresses RNA, e.g., antisense RNA or an RNA molecule capable of inducing RNA interference (RNAi). Another aspect ofthe invention features an expression vector including a nucleic acid molecule containing a nucleotide sequence encoding a nicotine demethylase, where the vector is capable of directing expression ofthe nicotine demethylase encoded by the isolated nucleic acid molecule. Desirably, the vector includes the sequence of SEQ ID NO:4 or SEQ ID NO:5. hi other desirable embodiments, the invention features a plant or plant component, e.g., a tobacco plant or plant component (e.g., a tobacco leaf or stem), that includes a nucleic acid molecule containing a nucleotide sequence encoding a polypeptide that demethylates nicotine. A further aspect ofthe invention features a cell containing an isolated nucleic acid molecule that includes a nucleotide sequence encoding a nicotine demethylase. Desirably this cell is a plant cell or a bacterial cell, such as an Agrobacterium. Another aspect of the invention features a plant or plant component (e.g., a tobacco leaf or stem) containing an isolated nucleic acid molecule that encodes a nicotine demethylase, where the nucleic acid molecule is expressed in the plant or the plant component. Desirably, the plant or plant component is an angiosperm, a dicot, a solanaceous plant, or a species of Nicotiana. Other desirable embodiments of this aspect are a seed or a cell from the plant or plant component, as well as a leaf, either green or cured, derived from the plant and an article of manufacture made therefrom. In an additional aspect, the invention features a tobacco plant having reduced expression of a nucleic acid sequence encoding a polypeptide, for example, one that includes the sequence of SEQ ID NO:3, and that demethylates nicotine, where the reduced expression (or a reduction in enzymatic activity) reduces the level of nornicotine in the plant, hi a desirable embodiment, the tobacco plant is a transgenic plant, such as one that includes a transgene that, when expressed in the transgenic plant, silences gene expression of an endogenous tobacco nicotine demethylase. In particular, the transgenic plant desirably includes one or more ofthe following: a transgene that expresses an antisense molecule of a tobacco nicotine demethylase or an RNA molecule capable of inducing RNA interference (RNAi); a transgene that, when expressed in the transgenic plant, co-suppresses expression of a tobacco nicotine demethylase; a transgene that encodes a dominant negative gene product, e.g., a mutated form the amino acid sequence of SEQ ID NO:3; a point mutation in a gene that encodes the amino acid sequence of SEQ ID NO:3; a deletion in a gene that encodes a tobacco nicotine demethylase; and an insertion in a gene that encodes a tobacco nicotine demethylase. In other desirable embodiments, reduced expression of a nucleic acid sequence encoding a polypeptide occurs at the transcriptional level, at the translational level, or at the post-translational level. Another aspect of the invention features a tobacco plant containing a recombinant expression cassette stably integrated into the genome thereof, where the cassette is capable of effecting a reduction in nicotine demethylase activity. Seeds of this tobacco plant are featured in a desirable embodiment. Other desirable embodiments include leaf, either green or cured, derived from this plant and an article of manufacture made therefrom. A further aspect ofthe invention features a method of expressing a tobacco nicotine demethylase in a plant. This method involves (i) introducing into a plant cell an expression vector including a nucleic acid molecule containing a nucleotide sequence encoding a nicotine demethylase; and (ii) regenerating a plant from the cell. hi a desirable embodiment, this method features sexually transmitting the vector to progeny, and desirably also includes the additional step of collecting the seed produced by the progeny. Additional desirable embodiments include a plant derived from the germinated seed, a leaf, either green or cured, from the plant, and an article of manufacture made from the green or cured leaf. An additional aspect ofthe invention features a substantially pure tobacco nicotine demethylase. Desirably, this tobacco nicotine demethylase includes an amino acid sequence having at least 70% identity to the amino acid sequence of SEQ ID NO:3 or includes the amino acid sequence of SEQ ID NO:3. i a desirable embodiment, the tobacco nicotine demethylase, upon expression in a plant cell, converts nicotine to nornicotine. In other desirable embodiments, the tobacco nicotine demethylase, upon expression in a plant cell, is predominantly localized in leaves, or the tobacco nicotine demethylase is induced by ethylene or is expressed during plant senescence. In a further aspect, the invention features a substantially pure antibody that specifically recognizes and binds to a tobacco nicotine demethylase. Desirably, the antibody recognizes and binds to a recombinant tobacco nicotine demethylase, e.g., one containing the sequence of SEQ ID NO:3 or a fragment thereof. Another aspect ofthe invention features a method of producing a tobacco nicotine demethylase. This method involves the steps of: (a) providing a cell transformed with an isolated nucleic acid molecule containing a nucleotide sequence encoding a polypeptide that demethylates nicotine; (b) culturing the transformed cell under conditions for expressing the isolated nucleic acid molecule; and (c) recovering the tobacco nicotine demethylase. The invention also features a recombinant tobacco nicotine demethylase produced according to this method. In an additional aspect, the invention features a method of isolating a tobacco nicotine demethylase or fragment thereof. This method involves the steps of: (a) contacting the nucleic acid molecule of SEQ ID NOS:4, 5, 7, 8, or 9 or a portion thereof with a nucleic acid preparation from a plant cell under hybridization conditions providing detection of nucleic acid sequences having at least 70% or greater sequence identity to the nucleic acid sequence of SEQ ID NOS. "4, 5, 7, 8, or 9; and (b) isolating the hybridizing nucleic acid sequences. hi a further aspect, the invention features another method of isolating a tobacco nicotine demethylase or fragment thereof. This method includes the steps of: (a) providing a sample of plant cell DNA; (b) providing a pair of oligonucleotides having sequence identity to a region of a nucleic acid molecule having the sequence of SEQ ID NOS:4, 5, 7, 8, or 9; (c) contacting the pair of oligonucleotides with the plant cell DNA under conditions suitable for polymerase chain reaction-mediated DNA amplification; and (d) isolating the amplified tobacco nicotine demethylase or fragment thereof. In a desirable embodiment of this aspect, the amplification step is carried out using a sample of cDNA prepared from a plant cell. In another desirable embodiment, the tobacco nicotine demethylase encodes a polypeptide which is at least 70%) identical to the amino acid sequence of SEQ ID NO:3. A further aspect ofthe invention features a method for reducing the expression of tobacco nicotine demethylase in a plant or plant component. This method involves the steps of: (a) introducing into plant cells a transgene encoding a tobacco nicotine demethylase operably linked to a promoter functional in the plant cells to yield transformed plant cells; and (b) regenerating a plant or plant component from the transformed plant cells, where the tobacco nicotine demethylase is expressed in the cells ofthe plant or plant component, thereby reducing the expression of tobacco nicotine demethylase in a plant or plant component. In particular embodiments of this aspect ofthe invention, the transgene encoding the tobacco nicotine demethylase is constitutively expressed or inducibly expressed, for example, in a tissue-specific, cell- specific, or organ-specific manner. In another embodiment of this aspect ofthe invention, expression ofthe transgene co-suppresses the expression of an endogenous tobacco mcotine demethylase or any other polypeptide described herein. A further aspect ofthe invention features another method for reducing the expression of tobacco nicotine demethylase or any ofthe other polypeptides described herein in a plant or plant component. This method includes the steps of: (a) introducing into plant cells a transgene encoding an antisense coding sequence of a tobacco nicotine demethylase or an RNA molecule capable of inducing RNA interference (RNAi) operably linked to a promoter functional in the plant cells to yield transformed plant cells; and (b) regenerating a plant or plant component from the transformed plant cells, where the antisense or an RNA molecule capable of inducing RNA interference (RNAi) ofthe coding sequence ofthe tobacco nicotine demethylase is expressed in the cells ofthe plant or plant component, thereby reducing the expression of tobacco nicotine demethylase in a plant or plant component. Desirably, the transgene encoding an antisense sequence or an RNA molecule capable of inducing RNA interference (RNAi) of a tobacco nicotine demethylase is constitutively expressed or is inducibly expressed, for instance in a tissue-specific, cell-specific, or organ-specific manner. In other desirable embodiments the antisense or RNA molecule capable of inducing RNAi ofthe coding sequence o the tobacco nicotine demethylase contains the complement of SEQ ID NO:l, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:61, SEQ LD NO: 188, or a fragment thereof. An additional aspect ofthe invention features yet another method for reducing the expression of tobacco nicotine demethylase in a plant or plant component. This method involving the steps of: (a) introducing into plant cells a transgene encoding a dominant negative gene product of a tobacco nicotine demethylase operably linked to a promoter functional in the plant cells to yield transformed plant cells; and (b) regenerating a plant or plant component from the transformed plant cells, where the dominant negative gene product ofthe tobacco nicotine demethylase is expressed in the cells ofthe plant or plant component, thereby reducing the expression of tobacco nicotine demethylase in a plant or plant component. In particular embodiments of this aspect ofthe invention, the transgene encoding the dominant negative gene product is constitutively expressed or is inducibly expressed, for example, in a tissue-specific, cell-specific, or organ-specific manner. A further aspect ofthe invention features an additional method for reducing the expression or the enzymatic activity of tobacco mcotine demethylase in plant cell. This method involves reducing the level of an endogenous tobacco nicotine demethylase, or its enzymatic activity, in the plant cell. Desirably, the plant cell is from a dicot, a solanaceous plant, or a species of Nicotiana. hi desirable embodiments of this aspect, reducing the level of endogenous tobacco nicotine demethylase involves expressing a transgene encoding an antisense nucleic acid molecule or an RNA molecule capable of inducing RNA interference (RNAi) of a tobacco nicotine demethylase in the plant cell, or involves expressing a transgene encoding a double- stranded RNA molecule of a tobacco nicotine demethylase in the plant cell. Desirably, the double-stranded RNA is an RNA sequence corresponding to the sequence of SEQ ID NO:l, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:61, SEQ ID NO: 188 or a fragment thereof, hi an additional embodiment, reducing the level of endogenous tobacco nicotine demethylase involves co-suppression ofthe endogenous tobacco nicotine demethylase in the plant cell or involves expressing a dominant negative gene product in the plant cell. In particular, the dominant negative gene product may include a gene that encodes a mutated form the amino acid sequence of SEQ ID NO:3 or any other amino acid sequence described herein. In other desirable embodiments of this aspect ofthe invention, the endogenous tobacco nicotine demethylase includes a point mutation in a gene that encodes the amino acid sequence of SEQ ID NO:3. In other desirable embodiments reducing the level of expression of an endogenous tobacco nicotine demethylase involves a deletion in a gene that encodes a tobacco nicotine demethylase or involves an insertion in a gene that encodes a tobacco nicotine demethylase. The reduced expression may occur at the transcriptional level, at the translational level, or at the post-translational level. A further aspect ofthe invention features a method for identifying a compound which alters the expression of a tobacco nicotine demethylase in a cell. This method involves the steps of: (a) providing a cell containing a gene encoding a tobacco nicotine demethylase; (b) applying a candidate compound to the cell; and (c) measuring expression ofthe gene encoding the tobacco nicotine demethylase, where an increase or decrease in expression relative to an untreated control sample is an indication that the compound alters expression ofthe tobacco nicotine demethylase. In a desirable embodiment of this method, the gene of part (a) encodes a tobacco nicotine demethylase having at least 70% identity to the amino acid sequence of SEQ ID NO:3. Desirably, the compound decreases or increases expression ofthe gene that encodes the tobacco nicotine demethylase. h another aspect, the invention features another method for identifying a compound which alters the activity of a tobacco nicotine demethylase in a cell. This method involves the steps of: (a) providing a cell expressing a gene encoding a tobacco nicotine demethylase; (b) applying a candidate compound to the cell; and (c) measuring the activity ofthe tobacco nicotine demethylase, where an increase or decrease in activity relative to an untreated control sample is an indication that the compound alters activity ofthe tobacco nicotine demethylase. In a desirable embodiment of this aspect ofthe invention, the gene of step (a) encodes a tobacco nicotine demethylase having at least 70% identity to the amino acid sequence of SEQ ID NO:3. Desirably, the compound decreases or increases the activity ofthe tobacco nicotine demethylase. A further aspect ofthe invention features a cured tobacco plant or plant component containing (i) a reduced levels of nicotine demethylase or (ii) a nicotine demthylase having an altered enzymatic activity and a reduced amount of a nitrosamine. Desirably, the plant component is a tobacco leaf or tobacco stem, hi a desirable embodiment, the nitrosamine is nornicotine, and the content of nornicotine desirably is less than 5 mg/g, 4.5 mg/g, 4.0 mg/g, 3.5 mg/g, 3.0 mg/g, more desirably less than 2.5 mg/g, 2.0 mg/g, 1.5 mg/g, 1.0 mg/g, more desirably less than 750 μg/g, 500 μg/g, 250 μg/g, 100 μg/g, even more desirably less than 75 μg/g, 50 μg/g, 25 μg/g, 10 μg/g, 7.0 μg/g, 5.0 μg/g, 4.0 μg/g, and even more desirably less than 2.0 μg/g, 1.0 μg/g, 0.5 μg/g, 0.4 μg/g, 0.2 μg/g, 0.1 μg/g, 0.05 μg/g, or 0.01 μg/g or wherein the percentage of secondary alkaloids relative to total alkaloid content therein is less than 90%, 70%, 50%, 30%, 10%, desirably less than 5%, 4%, 3%, 2%, 1.5%, 1%, and more desirably less than 0.75%, 0.5%, 0.25%, or 0.1 %. In another desirable embodiment, the nitrosamine is N'-nitrosonornicotine (NNN), and the content of N'- NNN desirably is less than 5 mg/g, 4.5 mg/g, 4.0 mg/g, 3.5 mg/g, 3.0 mg/g, more desirably less than 2.5 mg/g, 2.0 mg/g, 1.5 mg/g, 1.0 mg/g, more desirably less than 750 μg/g, 500 μg/g, 250 μg/g, 100 μg/g, even more desirably less than 75 μg/g, 50 μg/g, 25 μg/g, 10 μg/g, 7.0 μg/g, 5.0 μg/g, 4.0 μg/g, and even more desirably less than 2.0 μg/g, 1.0 μg/g, 0.5 μg/g, 0.4 μg/g, 0.2 μg/g, 0.1 μg/g, 0.05 μg/g, or 0.01 μg/g or wherein the percentage of secondary alkaloids relative to total alkaloid content contained therein is less than 90%, 70%, 50%, 30%, 10%, desirably less than 5%, 4%, 3%, 2%, 1.5%, 1 %, and more desirably less than 0.75%, 0.5%, 0.25%, or 0.1 %. hi additional desirable embodiments of this aspect ofthe invention, the cured tobacco plant or plant component is a dark tobacco, Burley tobacco, flue-cured tobacco, Virginia, air-cured tobacco, or Oriental tobacco. Further, the cured tobacco plant or plant component ofthe invention desirably includes a recombinant nicotine demethylase gene, e.g., one containing the sequence of SEQ ID NO:4 or SEQ ID NO:5, or a fragment thereof. Desirably, the expression of an endogenous nicotine demethylase gene, or of any other nucleic acid sequence described herein, in the cured tobacco plant or plant component is silenced. Another aspect ofthe invention features a tobacco product containing a cured tobacco plant or plant component that includes (i) reduced expression of a nicotine demethylase or any other polypeptide described herein or (ii) a nicotine demethylase or another polypeptide described herein having altered activity, and a reduced amount of a nitrosamine. Desirably, the tobacco product is smokeless tobacco, moist or dry snuff, a chewing tobaccos, cigarette products, cigar products, cigarillos, pipe tobaccos, or bidis. h particular, the tobacco product of this aspect ofthe invention may contain dark tobacco, milled tobacco, or include a flavoring component. The invention also features a method of making a tobacco product, e.g., a smokeless tobacco product, containing (i) reduced expression of a nicotine demethylase or (ii) a nicotine demethylase having altered (e.g., reduced) enzymatic activity, and a reduced amount of a nitrosamine. This method involves providing a cured tobacco plant or plant component containing (i) a reduced level of nicotine demethylase or (ii) a nicotine demethylase having an altered enzymatic activity and a reduced amount of a nitrosamine and preparing the tobacco product from the cured tobacco plant or plant component.

Definitions "Enzymatic activity" is meant to include but is not limited to demethylation, hydroxylation, epoxidation, N-oxidation, sulfooxidation, N-, S-, and O- dealkylations, desulfation, deamination, and reduction of azo, nitro, N-oxide, and other such enzymatically reactive chemical groups. Altered enzymatic activity refers to a decrease in enzymatic activity (for example, of a tobacco nicotine demethylase) by at least 10-20%, preferably by at least 25-50%, and more preferably by at least 55-95% or greater relative to the activity of a control enzyme (for example, a wild-type tobacco plant tobacco nicotine demethylase). The activity of an enzyme, such as a nicotine demethylase may be assayed using methods standard in the art, for example, using the yeast microsome assays described herein. The term "nucleic acid" refers to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, or sense or anti-sense, and unless otherwise limited, encompasses known analogues of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence includes the complementary sequence thereof. The terms "operably linked," "in operable combination," and "in operable order" refer to functional linkage between a nucleic acid expression control sequence (such as a promoter, signal sequence, or array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence affects transcription and/or translation ofthe nucleic acid corresponding to the second sequence. Desirably, an operably linked nucleic acid sequence refers to a fragment of a gene that is linked to other sequences ofthe same gene to form a full-length gene. The term "recombinant" when used with reference to a cell indicates that the cell replicates a heterologous nucleic acid, expresses the nucleic acid or expresses a peptide, heterologous peptide, or protein encoded by a heterologous nucleic acid. Recombinant cells can express genes or gene fragments in either the sense or antisense form or an RNA molecule capable of inducing RNA interference (RNAi) that are not found within the native (non- recombinant) form ofthe cell. Recombinant cells can also express genes that are found in the native form ofthe cell, but wherein the genes are modified and re-introduced into the cell by artificial means. A "structural gene" is that portion of a gene comprising a DNA segment encoding a protein, polypeptide or a portion thereof, and excluding, for example, the 5' sequence which drives the initiation of transcription or the 3'UTR. The structural gene may alternatively encode a nontranslatable product. The structural gene may be one which is normally found in the cell or one which is not normally found in the cell or cellular location wherein it is introduced, in which case it is termed a "heterologous gene." A heterologous gene may be derived in whole or in part from any source known to the art, including a bacterial genome or episome, eukaryotic, nuclear or plasmid DNA, cDNA, viral DNA or chemically synthesized DNA. A structural gene may contain one or more modifications that could affect biological activity or its characteristics, the biological activity or the chemical structure ofthe expression product, the rate of expression or the manner of expression control. Such modifications include, but are not limited to, mutations, insertions, deletions and substitutions of one or more nucleotides. The structural gene may constitute an uninterrupted coding sequence or it may include one or more introns, bounded by the appropriate splice junctions. The structural gene may be translatable or non-translatable, including an antisense or an RNA molecule capable of inducing RNA interference (RNAi). The structural gene may be a composite of segments derived from a plurality of sources and from a plurality of gene sequences (naturally occurring or synthetic, where synthetic refers to DNA that is chemically synthesized). An "exon" as used herein in reference to a nucleic acid sequence is meant a portion ofthe nucleic acid sequence of a gene, where the nucleic acid sequence ofthe exon encodes at least one amino acid ofthe gene product. An exon is typically adjacent to a noncoding DNA segment such as an intron. An "intron" as used herein in reference to a nucleic acid sequence is meant a non-coding region of a gene that is flanked by coding regions. An intron is typically a noncoding region of a gene that is transcribed into an RNA molecule but is then excised by RNA splicing during production ofthe messenger RNA or other functional structural RNA. A "3 'UTR" as used herein in reference to a nucleic acid sequence is meant a non-coding nucleic acid sequence proximal to a stop codon of an exon. "Derived from" is used to mean taken, obtained, received, traced, replicated or descended from a source (chemical and/or biological). A derivative may be produced by chemical or biological manipulation (including, but not limited to, substitution, addition, insertion, deletion, extraction, isolation, mutation, and replication) ofthe original source. "Chemically synthesized," as related to a sequence of DNA, means that portions ofthe component nucleotides were assembled in vitro. Manual chemical synthesis of DNA may be accomplished using well-established procedures (Caruthers, Methodology of DNA and RNA Sequencing, (1983), Weissman (ed.), Praeger Publishers, New York, Chapter 1); automated chemical synthesis can be performed using one of a number of commercially available machines. Optimal alignment of sequences for comparison maybe conducted, for example, by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson and Lipman Proc. Natl. Acad. Sci. (U.S.A.) 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by inspection. The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., 1990) is available from several sources, including the National Center for Biological Information (NCBI, Bethesda, Md.) and on the internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn, and tblastx. It can be accessed at http://www.ncbi.nlm.nih.gov/BLAST/. A description of how to determine sequence identity using this program is available at http://www.ncbi.nlm.nih.gov/BLAST/blast help.html. The terms "substantial amino acid identity" or "substantial amino acid sequence identity" as applied to amino acid sequences and as used herein denote a characteristic of a polypeptide, wherein the peptide comprises a sequence that has at least 70 percent sequence identity, preferably 80 percent amino acid sequence identity, more preferably 90 percent amino acid sequence identity, and most preferably at least 99 to 100 percent sequence identity as compared to the protein sequence shown in Figures 10 to 159, 160A to 160E, 162 to 170, and 172-1 to 172-19. Desirably, for a nicotine demethylase, sequence comparison is desirably compared for a region following the cytochrome p450 motif GXRXCX(G/A) (SEQ ID NO:2265) to the stop codon ofthe translated peptide. The terms "substantial nucleic acid identity" or "substantial nucleic acid sequence identity" as applied to nucleic acid sequences and as used herein denote a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence that has at least 50 percent, preferably 60, 65, 70, or 75 percent sequence identity, more preferably 81 or 91 percent nucleic acid sequence identity, and most preferably at least 95, 99, or even 100 percent sequence identity as compared to a reference group over region corresponding to the first nucleic acid following the region encoding the cytochrome p450 motif GXRXCX(G/A) (SEQ ID NO:2265) to the stop codon ofthe translated peptide. Another indication that nucleotide sequences are substantially identical is if two molecules hybridize to each other under stringent conditions. Stringent conditions are sequence-dependent and will be different in different circumstances. Generally, stringent conditions are selected to be about 5°C to about 20°C, usually about 10°C to about 15°C, lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% ofthe target sequence hybridizes to a matched probe. Typically, stringent conditions will be those in which the salt concentration is about 0.02 molar at pH 7 and the temperature is at least about 60°C. For instance in a standard Southern hybridization procedure, stringent conditions will include an initial wash in 6xSSC at 42°C followed by one or more additional washes in 0.2xSSC at a temperature of at least about 55°C, typically about 60°C, and often about 65°C. Nucleotide sequences are also substantially identical for purposes of this invention when said nucleotide sequences encode polypeptides and/or proteins which are substantially identical. Thus, where one nucleic acid sequence encodes essentially the same polypeptide as a second nucleic acid sequence, the two nucleic acid sequences are substantially identical even if they would not hybridize under stringent conditions due to degeneracy permitted by the genetic code (see, Darnell et al. (1990) Molecular Cell Biology, Second Edition Scientific American Books W. H. Freeman and Company New York for an explanation of codon degeneracy and the genetic code). Protein purity or homogeneity can be indicated by a number of means well known in the art, such as polyacrylamide gel electrophoresis of a protein sample, followed by visualization upon staining. For certain purposes high resolution may be needed and HPLC or a similar means for purification may be used. By an antibody that "specifically binds" or "specifically recognizes" a particular polypeptide, such as a tobacco nicotine demethylase, is meant an increased affinity ofthe antibody for the polypeptide relative to an equal amount of any other protein. Desirable antibodies are antibodies that specifically bind a polypeptide having an amino acid sequence shown in Figure 1, Figures 3 and 4, Figures 10 to 158, Figures 160A to 160E, Figures 162 to 170, or Figures 172-1 to 172-19. For example, an antibody that specifically binds to a tobacco nicotine demethylase containing the amino acid sequence of SEQ ID NO:3 desirably has an affinity for its antigen that is least 2-fold, 5 -fold, 10-fold, 30-fold, or 100-fold greater than for an equal amount of any other antigen, including related antigens. Binding of an antibody to an antigen, e.g., a tobacco nicotine demethylase, may be determined by any number of standard methods in the art, e.g., Western analysis, ELISA, or co-immunoprecipitation. Antibodies that specifically bind a polypepide, e.g., a nicotine demethylase, are also useful for purifying the polypeptide. As used herein, the term "vector" is used in reference to nucleic acid molecules that transfer DNA segment(s) into a cell. A vector may act to replicate DNA and may reproduce independently in a host cell. The term "vehicle" is sometimes used interchangeably with "vector." The term "expression vector" as used herein refers to a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for the expression ofthe operably linked coding sequence in a particular host organism. Nucleic acid sequences necessary for expression in prokaryotes usually include a promoter, an operator (optional), and a ribosome binding site, often along with other sequences. Desirably, the promoter includes the sequence of SEQ ID NO:8, or a fragment thereof that drives transcription. Also desirable are promoter sequences that have at least 50%, 60%, 75%, 80%, 90%, 95%, or even 99% sequence identity to the sequence of SEQ ID NO: 8 and that drive transcription. Eucaryotic cells are known to utilize promoters, enhancers, and termination and polyadenylation signals, such as the 3'UTR sequence of SEQ ID NO:9. hi some instances, it has been observed that plant expression vectors require the presence of plant derived introns, such as the intron having the sequence of SEQ ID NO:7, to have stable expression. As such, the sequence of SEQ ID NO:7, or any other intron having an appropriate RNA splice junction may be used as further described herein. Desirable vectors include a nucleic acid sequences shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, or 173-1 to 173-294. For the purpose of regenerating complete genetically engineered plants with roots, a nucleic acid may be inserted into plant cells, for example, by any technique such as in vivo inoculation or by any ofthe known in vitro tissue culture techniques to produce transformed plant cells that can be regenerated into complete plants. Thus, for example, the insertion into plant cells may be by in vitro inoculation by pathogenic or non-pathogenic A. tumefaciens. Other such tissue culture techniques may also be employed. "Plant tissue," "plant component" or "plant cell" includes differentiated and undifferentiated tissues of plants, including, but not limited to, roots, shoots, leaves, pollen, seeds, tumor tissue and various forms of cells in culture, such as single cells, protoplasts, embryos and callus tissue. The plant tissue may be in planta or in organ, tissue or cell culture. "Plant cell" as used herein includes plant cells in planta and plant cells and protoplasts in culture. "cDNA" or "complementary DNA" generally refers to a single stranded DNA molecule with a nucleotide sequence that is complementary to an unprocessed RNA molecule containing an intron, or a processed mRNA lacking introns. cDNA is formed by the action ofthe enzyme reverse transcriptase on an RNA template. "Tobacco" as used herein includes flue-cured, Virginia, Burley, dark, Oriental, and other types of plant within the genus Nicotiana. Seed ofthe genus Nicotiana is readily available commercially in the form of Nicotiana tabacum. "Articles of manufacture" or "tobacco products" include products such as moist and dry snuff, chewing tobaccos, cigarette products, cigar products, cigarillos, pipe tobaccos, bidis, and similar tobacco-derived products. By "gene silencing" is meant a decrease in the level of gene expression (for example, expression of a gene encoding a tobacco nicotine demethylase) by at least 30-50%, preferably by at least 50-80%, and more preferably by at least 80-95% or greater relative to the level in a control plant (for example, a wild-type tobacco plant). Reduction of such expression levels may be accomplished by employing standard methods which are known in the art including, without limitation, RNA interference, triple strand interference, ribozymes, homologous recombination, virus-induced gene silencing, antisense and co-suppression technologies, expression of a dominant negative gene product, or through the generation of mutated genes using standard mutagenesis techniques, such as those described herein. Levels of a tobacco nicotine demethylase polypeptide or transcript, or both, are monitored according to any standard technique including, but not limited to, Northern blotting, RNase protection, or immunoblotting. By a "fragment" or "portion" of an amino acid sequence is meant at least e.g.,

20, 15, 30, 50, 75, 100, 250, 300, 400, or 500 contiguous amino acids of any ofthe amino acid sequences shown in Figures 1, 3, 4, 10 to 158, 160A to 160E, 162 to 170, and 172-1 to 172-19. Exemplary desirable fragments are amino acids 1-313 ofthe sequence of SEQ ID NO:3 and amino acids 314-517 ofthe sequence of SEQ ID NO:3, as well as the sequence of SEQ ID NOS:2 and 63. In addition, with respect to a fragment or portion of a nucleic acid sequence, desirable fragments include at least 100, 250, 500, 750, 1000, or 1500 contiguous nucleic acids of any ofthe nucleic acid sequences shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173-1 to 173-294. Exemplary desirable fragments are nucleic acids 1-2009, 2010- 2949, 2950-3946, 3947-4562, 4563-6347, and 4731-6347 ofthe sequence of SEQ ID NO:4. By a "substantially pure polypeptide" is meant a polypeptide that has been separated from most components which naturally accompany it; however, other proteins found in the microsomal fraction associated with a preparation having an enzymatic activity of at least 8.3pKat/mg protein is also considered to be a substantially pure polypeptide. Typically, the polypeptide is substantially pure when it is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated. Preferably, the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight, the desirable polypeptide. A substantially pure polypeptide may be obtained, for example, by extraction from a natural source (for example, a tobacco plant cell); by expression of a recombinant nucleic acid encoding the polypeptide; or by chemically synthesizing the protein. Purity can be measured by any appropriate method, for example, column chromatography, polyacrylamide gel electrophoresis, or by HPLC analysis. By "isolated nucleic acid molecule" is meant a nucleic acid sequence free from the nucleic acid sequences that naturally flank the sequence ofthe nucleic acid molecule in the genome of an organism. By "transformed cell" is meant a cell into which (or into an ancestor of which) has been introduced, by means of recombinant DNA techniques, a DNA molecule, for example, a DNA molecule encoding a tobacco nicotine demethylase or any ofthe nucleic acid sequences disclosed herein (e.g., the nucleic acid sequences shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173-1 to 173-294). By a "tobacco nicotine demethylase" or "nicotine demethylase" as used herein, is meant a polypeptide that is substantially identical to the sequence of SEQ ID NO:3. Desirably, a tobacco nicotine demethylase is capable of converting nicotine (CιoH₁ N₂, also referred to as 3-(l-methyl-2-pyrrolidinyl)pyridine) to nornicotine (C₉H₁₂N₂). The activity of a tobacco nicotine demethylase may be assayed using methods standard in the art, such as by measuring the demethylation of radioactive nicotine by yeast-expressed microsomes, as described herein. As provided herein, the terms "cytochrome p450" and "p450" are used interchangeably. Other features and advantages ofthe invention will be apparent from the following Detailed Description, the drawings, and the claims.

Brief Description ofthe Drawings Figure 1 is the nucleic acid sequence of D35-BG11 (SEQ ID NO: 1) and its translation product (SEQ ID NO:2). Figure 2 is a schematic diagram ofthe genomic structure ofthe tobacco nicotine demethylase gene. Figure 3 is the genomic tobacco nicotine demethylase nucleic acid sequence (SEQ ID NO:4) and its translation product (SEQ ID NO:3) Figure 4 is the nucleic acid sequence ofthe coding region ofthe tobacco nicotine demethylase gene (SEQ ID NO:5), and its translation product (SEQ ID NO:6). Figure 5 is the nucleic acid sequence of an intron (SEQ ID NO:7) present in the tobacco nicotine demethylase genomic sequence. Figure 6 is the nucleic acid sequence ofthe tobacco demethylase gene promoter (SEQ ID NO:8). Figure 7 is the nucleic acid sequence ofthe 3'UTR ofthe tobacco nicotine demethylase gene (SEQ ID NO:9). Figure 8 is an electrophoresis image showing PCR products of tobacco lines with the Geno full-length ("FL") primer set. Figure 9 is an electrophoresis image showing PCR products of tobacco lines with primer sets (1), (2), (3), and (4) as stated in Example 17. The approximate sizes ofthe bands are 3,500 nucleotides (nt) for FL, 2,600 nt for (1), 1,400 nt for (2), 600 nt for (3), and 1 ,400 nt for (4). Figure 10 is the nucleic acid sequence of D58-BG7 (SEQ ID NO: 10), and the amino acid sequence of D58-BG7 (SEQ ID NO:l 1), which is the translation of D58- BG7 (SEQ ID NO: 10). Figure 11 is the nucleic acid sequence of D58-AB1 (SEQ ID NO: 12), and the amino acid sequence of D58-AB1 (SEQ ID NO: 13), which is the translation of D58- AB1 (SEQ ID NO: 12). Figure 12 is the nucleic acid sequence of D186-AH4 (SEQ ID NO:14), and the amino acid sequence of D186-AH4 (SEQ ID NO:15), which is the translation of D186-AH4 (SEQ ID NO: 14). Figure 13 is the nucleic acid sequence of D58-BE4 (SEQ ID NO:16), and the amino acid sequence of D58-BE4 (SEQ ID NO:17), which is the translation of D58- BE4 (SEQ ID NO: 16). Figure 14 is the nucleic acid sequence of D56-AH7 (SEQ ID NO: 18), and the amino acid sequence of D56-AH7 (SEQ ID NO:19), which is the translation of D56- AH7 (SEQ ID NO: 18). Figure 15 is the nucleic acid sequence of D13a-5 (SEQ ID NO:20), and the amino acid sequence of D13a-5 (SEQ ID NO:21), which is the translation of D13a-5 (SEQ ID NO:20). Figure 16 is the nucleic acid sequence of D56-AG10 (SEQ ID NO:22), and the amino acid sequence of D56-AG10 (SEQ ID NO:23), which is the translation of D56-AG10 (SEQ ID NO:22). Figure 17 is the nucleic acid sequence of D35-33 (SEQ ID NO:24), and the amino acid sequence of D35-33 (SEQ ID NO:25), which is the translation of D35-33 (SEQ ID NO:24). Figure 18 is the nucleic acid sequence of D34-62 (SEQ ID NO:26), and the amino acid sequence of D34-62 (SEQ ID NO:27), which is the translation of D34-62 (SEQ ID NO:26). Figure 19 is the nucleic acid sequence of D56-AA7 (SEQ ID NO:28), and the amino acid sequence of D56-AA7 (SEQ ID NO:29), which is the translation of D56- AA7 (SEQ ID NO:28). Figure 20 is the nucleic acid sequence of D56-AE1 (SEQ ID NO:30), and the amino acid sequence of D56-AE1 (SEQ ID NO:31), which is the translation of D56- AE1 (SEQ ID NO:30). Figure 21 is the nucleic acid sequence of D35-BB7 (SEQ ID NO:32), and the amino acid sequence of D35-BB7 (SEQ ID NO:33), which is the translation of D35- BB7 (SEQ ID NO:32). Figure 22 is the nucleic acid sequence of D177-BA7 (SEQ ID NO: 34), and the amino acid sequence of D177-BA7 (SEQ ID NO:35), which is the translation of D177-BA7 (SEQ ID NO:34). Figure 23 is the nucleic acid sequence of D56A-AB6 (SEQ ID NO:36), and the amino acid sequence of D56A-AB6 (SEQ ID NO:37), which is the translation of D56A-AB6 (SEQ ID NO:36). Figure 24 is the nucleic acid sequence of D144-AE2 (SEQ ID NO: 38), and the amino acid sequence of D144-AE2 (SEQ ID NO:39), which is the translation of D144-AE2 (SEQ ID NO:38). Figure 25 is the nucleic acid sequence of D56-AG11 (SEQ ID NO:40), and the amino acid sequence of D56-AG11 (SEQ ID NO:41), which is the translation of D56-AG11 (SEQ ID NO:40). Figure 26 is the nucleic acid sequence of D179-AA1 (SEQ ID NO:42), and the amino acid sequence of D179-AA1 (SEQ ID NO:43), which is the translation of D179-AA1 (SEQ ID NO:42). Figure 27 is the nucleic acid sequence of D56-AC7 (SEQ ID NO:44), and the amino acid sequence of D56-AC7 (SEQ ID NO:45), which is the translation of D56- AC7 (SEQ ID NO:44). Figure 28 is the nucleic acid sequence of D144-AD1 (SEQ ID NO:46), and the amino acid sequence of D144-AD1 (SEQ ID NO:47), which is the translation of D144-AD1 (SEQ ID NO:46). Figure 29 is the nucleic acid sequence of D144-AB5 (SEQ ID NO:48), and the amino acid sequence of D144-AB5 (SEQ ID NO:49), which is the translation of D144-AB5 (SEQ ID NO:48). Figure 30 is the nucleic acid sequence of D181-AB5 (SEQ ID NO:50), and the amino acid sequence of D181-AB5 (SEQ ID NO:51), which is the translation of D181-AB5 (SEQ ID NO:50). Figure 31 is the nucleic acid sequence of D73-AC9 (SEQ ID NO:52), and the amino acid sequence of D73-AC9 (SEQ ID NO:53), which is the translation of D73- AC9 (SEQ ID NO:52). Figure 32 is the nucleic acid sequence of D56-AC12 (SEQ ID NO: 54), and the amino acid sequence of D56-AC12 (SEQ ID NO:55), which is the translation of D56-AC12 (SEQ ID NO:54). Figure 33 is the nucleic acid sequence of D58-AB9 (SEQ ID NO:56), and the amino acid sequence of D58-AB9 (SEQ ID NO:57), which is the translation of D58- AB9 (SEQ ID NO:56). Figure 34 is the nucleic acid sequence of D56-AG9 (SEQ ID NO:58), and the amino acid sequence of D56-AG9 (SEQ ID NO:59), which is the translation of D56- AG9 (SEQ ID NO:58). Figure 35 is the nucleic acid sequence of D56-AG6 (SEQ ID NO:60), and the amino acid sequence of D56-AG6 (SEQ ID NO:61), which is the translation of D56- AG6 (SEQ ID NO:60). Figure 36 is the nucleic acid sequence of D35-BG11 (SEQ ID NO:62), and the amino acid sequence of D35-BG11 (SEQ ID NO:63), which is the translation of D35- BGll (SEQ LO NO:62). Figure 37 is the nucleic acid sequence of D35-42 (SEQ ID NO:64), and the amino acid sequence of D35-42 (SEQ ID NO:65), which is the translation of D35-42 (SEQ ID NO:64). Figure 38 is the nucleic acid sequence of D35-BA3 (SEQ ID NO:66), and the amino acid sequence of D35-BA3 (SEQ ID NO:67), which is the translation of D35- BA3 (SEQ ID NO:66). Figure 39 is the nucleic acid sequence of D34-57 (SEQ ID NO:68), and the amino acid sequence of D34-57 (SEQ ID NO:69), which is the translation of D34-57 (SEQ ID NO:68). Figure 40 is the nucleic acid sequence of D34-52 (SEQ ID NO:70), and the amino acid sequence of D34-52 (SEQ ID NO:71), which is the translation of D34-52 (SEQ ID NO:70). Figure 41 is the nucleic acid sequence of D34-25 (SEQ ID NO:72), and the amino acid sequence of D34-25 (SEQ ID NO:73), which is the translation of D34-25 (SEQ ID NO:72). Figure 42 is the nucleic acid sequence of D56AD10 (SEQ ID NO:74), and the amino acid sequence of D56AD10 (SEQ ID NO:75), which is the translation of D56AD10 (SEQ ID NO:74). Figure 43 is the nucleic acid sequence of D56-AA11 (SEQ ID NO:76), and the amino acid sequence of D56-AA11 (SEQ ID NO:77), which is the translation of D56-AA11 (SEQ ID NO:76). Figure 44 is the nucleic acid sequence of D177-BD5 (SEQ ID NO:78), and the amino acid sequence of D177-BD5 (SEQ ID NO:79), which is the translation of D177-BD5 (SEQ ID NO:78). Figure 45 is the nucleic acid sequence of D56A-AG10 (SEQ ID NO:80), and the amino acid sequence of D56A-AG10 (SEQ ID NO:81), which is the translation of D56A-AG10 (SEQ ID NO:80). Figure 46 is the nucleic acid sequence of D58-BC5 (SEQ ID NO:82), and the amino acid sequence of D58-BC5 (SEQ ID NO: 83), which is the translation of D58- BC5 (SEQ ID NO:82). Figure 47 is the nucleic acid sequence of D58-AD12 (SEQ ID NO:84), and the amino acid sequence of D58-AD12 (SEQ ID NO:85), which is the translation of D58-AD12 (SEQ ID NO:84). Figure 48 is the nucleic acid sequence of D56-AC11 (SEQ LD NO:86), and the amino acid sequence of D56-AC11 (SEQ ID NO:87), which is the translation of D56-AC11 (SEQ ID NO:86). Figure 49 is the nucleic acid sequence of D35-39 (SEQ ID NO:88), and the amino acid sequence of D35-39 (SEQ ID NO:89), which is the translation of D35-39 (SEQ ID NO:88). Figure 50 is the nucleic acid sequence of D58-BH4 (SEQ ID NO:90), and the amino acid sequence of D58-BH4 (SEQ ID NO:91), which is the translation of D58- BH4 (SEQ ID NO:90). Figure 51 is the nucleic acid sequence of D177-BD7 (SEQ ID NO:92), and the amino acid sequence of D 177-BD7 (SEQ ID NO : 93), which is the translation of D177-BD7 (SEQ LD NO:92). Figure 52 is the nucleic acid sequence of D176-BF2 (SEQ ID NO:94), and the amino acid sequence of D176-BF2 (SEQ ID NO: 95), which is the translation of D176-BF2 (SEQ ID NO:94). Figure 53 is the nucleic acid sequence of D56-AD6 (SEQ ID NO:96), and the amino acid sequence of D56-AD6 (SEQ ID NO:97), which is the translation of D56- AD6 (SEQ ID NO:96). Figure 54 is the nucleic acid sequence of D73A-AD6 (SEQ ID NO:98), and the amino acid sequence of D73A-AD6 (SEQ ID NO:99), which is the translation of D73A-AD6 (SEQ ID NO:98). Figure 55 is the nucleic acid sequence of D70A-BA11 (SEQ LD NO:100), and the amino acid sequence of D70A-BA11 (SEQ ID NO:101), which is the translation of D70A-BA11 (SEQ ID NO: 100). Figure 56 is the nucleic acid sequence of D70A-BB5 (SEQ ID NO: 102), and the amino acid sequence of D70A-BB5 (SEQ ID NO: 103), which is the translation of D70A-BB5 (SEQ ID NO: 102). Figure 57 is the nucleic acid sequence of D70A-AB5 (SEQ ID NO: 104), and the amino acid sequence of D70A-AB5 (SEQ ID NO: 105), which is the translation of D70A-AB5 (SEQ ID NO: 104). Figure 58 is the nucleic acid sequence of D70A-AA8 (SEQ ID NO: 106), and the amino acid sequence of D70A-AA8 (SEQ ID NO: 107), which is the translation of D70A-AA8 (SEQ ID NO: 106). Figure 59 is the nucleic acid sequence of D70A-AB8 (SEQ ID NO:108), and the amino acid sequence of D70A-AB8 (SEQ ID NO:109), which is the translation of D70A-AB8 (SEQ ID NO: 108). Figure 60 is the nucleic acid sequence of D70A-BH2 (SEQ ID NO: 110), and the amino acid sequence of D70A-BH2 (SEQ ID NO: 111), which is the translation of D70A-BH2 (SEQ ID NO: 110). Figure 61 is the nucleic acid sequence of D70A-AA4 (SEQ ID NO: 112), and the amino acid sequence of D70A-AA4 (SEQ ID NO: 113), which is the translation of D70A-AA4 (SEQ LD NO:l 12). Figure 62 is the nucleic acid sequence of D70A-BA1 (SEQ ID NO: 114), and the amino acid sequence of D70A-BA1 (SEQ ID NO: 115), which is the translation of D70A-BA1 (SEQ ID NO:l 14). Figure 63 is the nucleic acid sequence of D70A-BA9 (SEQ ID NO: 116), and the amino acid sequence of D70A-BA9 (SEQ ID NO:l 17), which is the translation of D70A-BA9 (SEQ LD NO: 116). Figure 64 is the nucleic acid sequence of D70A-BD4 (SEQ ID NO: 118), and the amino acid sequence of D70A-BD4 (SEQ ID NO: 119), which is the translation of D70A-BD4 (SEQ ID NO: 118). Figure 65 is the nucleic acid sequence of D181-AC5 (SEQ LD NO:120), and the amino acid sequence of D181-AC5 (SEQ ID NO: 121), which is the translation of D181-AC5 (SEQ ID NO:120). Figure 66 is the nucleic acid sequence of D144-AH1 (SEQ ID NO: 122), and the amino acid sequence of D144-AH1 (SEQ ID NO:123), which is the translation of D144-AH1 (SEQ ID NO: 122). Figure 67 is the nucleic acid sequence of D34-65 (SEQ ID NO: 124), and the amino acid sequence of D34-65 (SEQ ID NO: 125), which is the translation of D34-65 (SEQ ID NO: 124). Figure 68 is the nucleic acid sequence of D35-BG2 (SEQ ID NO:126), and the amino acid sequence of D35-BG2 (SEQ ID NO: 127), which is the translation of D35- BG2 (SEQ ID NO: 126). Figure 69 is the nucleic acid sequence of D73A-AH7 (SEQ ID NO: 128), and the amino acid sequence of D73A-AH7 (SEQ ID NO: 129), which is the translation of D73A-AH7 (SEQ ID NO: 128). Figure 70 is the nucleic acid sequence of D58-AA1 (SEQ ID NO:130), and the amino acid sequence of D58-AA1 (SEQ ID NO:131), which is the franslation of D58-AA1 (SEQ ID NO: 130). Figure 71 is the nucleic acid sequence of D73A-AE10 (SEQ ID NO: 132), and the amino acid sequence of D73A-AE10 (SEQ ID NO: 133), which is the translation of D73A-AE10 (SEQ ID NO: 132). Figure 72 is the nucleic acid sequence of D56A-AC12 (SEQ ID NO:134), and the amino acid sequence of D56A-AC12 (SEQ ID NO: 135), which is the translation of D56A-AC12 (SEQ ID NO: 134). Figure 73 is the nucleic acid sequence of D177-BF7 (SEQ ID NO:136), and the amino acid sequence of D177-BF7 (SEQ ID NO:137), which is the translation of D177-BF7 (SEQ ID NO: 136). Figure 74 is the nucleic acid sequence of D73A-AG3 (SEQ ID NO:138), and the amino acid sequence of D73A-AG3 (SEQ ID NO:139), which is the translation of D73 A-AG3 (SEQ ID NO: 138). Figure 75 is the nucleic acid sequence of D70A-AA12 (SEQ ID NO: 140), and the amino acid sequence of D70A-AA12 (SEQ ID NO: 141), which is the translation of D70A-AA12 (SEQ ID NO:140). Figure 76 is the nucleic acid sequence of D185-BC1 (SEQ ID NO: 142), and the amino acid sequence of Dl 85-BCl (SEQ ID NO: 143), which is the translation of D185-BC1 (SEQ ID NO: 142). Figure 77 is the nucleic acid sequence of D185-BG2 (SEQ ID NO: 144), and the amino acid sequence of D185-BG2 (SEQ ID NO: 145), which is the translation of D185-BG2 (SEQ ID NO: 144). Figure 78 is the nucleic acid sequence of D185-BE1 (SEQ ID NO:146), and the amino acid sequence of D185-BE1 (SEQ ID NO: 147), which is the translation of D185-BE1 (SEQ ID NO:146). Figure 79 is the nucleic acid sequence of D185-BD2 (SEQ ID NO:148), and the amino acid sequence of D185-BD2 (SEQ ID NO:149), which is the translation of D185-BD2 (SEQ ID NO:148). Figure 80 is the nucleic acid sequence of D176-BG2 (SEQ ED NO:150), and the amino acid sequence of D176-BG2 (SEQ ID NO:151), which is the translation of D176-BG2 (SEQ ID NO:150). Figure 81 is the nucleic acid sequence of D185-BD3 (SEQ ID NO: 152), and the amino acid sequence of D185-BD3 (SEQ ID NO:153), which is the translation of D185-BD3 (SEQ ID NO: 152). Figure 82 is the nucleic acid sequence of D176-BC3 (SEQ ID NO:154), and the amino acid sequence of D176-BC3 (SEQ ID NO: 155), which is the translation of D176-BC3 (SEQ ID NO: 154). Figure 83 is the nucleic acid sequence of D176-BB3 (SEQ ID NO: 156), and the amino acid sequence of D176-BB3 (SEQ ID NO: 157), which is the franslation of D176-BB3 (SEQ ID NO:156). Figure 84 is the nucleic acid sequence of D89-AB1 (SEQ ED NO:158), and the amino acid sequence of D89-AB1 (SEQ ED NO:159), which is the franslation of D89- AB1 (SEQ ID NO: 158). Figure 85 is the nucleic acid sequence of D89-AD2 (SEQ ID NO: 160), and the amino acid sequence of D89-AD2 (SEQ ED NO:161), which is the translation of D89-AD2 (SEQ ID NO: 160). Figure 86 is the nucleic acid sequence of D90A-BB3 (SEQ ID NO: 162), and the amino acid sequence of D90A-BB3 (SEQ ID NO: 163), which is the translation of D90A-BB3 (SEQ ID NO: 162). Figure 87 is the nucleic acid sequence of D95-AG1 (SEQ ID NO: 164), and the amino acid sequence of D95-AG1 (SEQ ID NO: 165), which is the translation of D95-AG1 (SEQ ID NO: 164). Figure 88 is the nucleic acid sequence of D96-AB6 (SEQ ID NO : 166), and the amino acid sequence of D96-AB6 (SEQ ED NO: 167), which is the translation of D96- AB6 (SEQ ID NO: 166). Figure 89 is the nucleic acid sequence of D96-AC2 (SEQ ID NO:168), and the amino acid sequence of D96-AC2 (SEQ ID NO:169), which is the translation of D96-AC2 (SEQ ID NO: 168). Figure 90 is the nucleic acid sequence of D98-AA1 (SEQ ID NO: 170), and the amino acid sequence of D98-AA1 (SEQ ED NO: 171), which is the translation of D98-AA1 (SEQ ID NO:170). Figure 91 is the nucleic acid sequence of D98-AG1 (SEQ ID NO: 172), and the amino acid sequence of D98-AG1 (SEQ ID NO: 173), which is the franslation of D98-AG1 (SEQ ID NO: 172). Figure 92 is the nucleic acid sequence of D100-BE2 (SEQ ID NO: 174), and the amino acid sequence of D100-BE2 (SEQ ED NO:175), which is the translation of D100-BE2 (SEQ ID NO: 174). Figure 93 is the nucleic acid sequence of D 100 A-AC3 (SEQ ID NO : 176), and the amino acid sequence of D100A-AC3 (SEQ ED NO:177), which is the translation of D100A-AC3 (SEQ ED NO:176). Figure 94 is the nucleic acid sequence of D104A-AE8 (69,1755) (SEQ ID NO:178), and the amino acid sequence of D104A-AE8 (69,1755) (SEQ ID NO:179), which is the translation of D104A-AE8 (69,1755) (SEQ ID NO:178). Figure 95 is the nucleic acid sequence of D105-AD6 (SEQ ID NO: 180), and the amino acid sequence of D105-AD6 (SEQ ID NO: 181), which is the translation of D105-AD6 (SEQ LD NO:180). Figure 96 is the nucleic acid sequence of D109-AH8 (14,1697) (SEQ ID NO:182), and the amino acid sequence of D109-AH8 (14,1697) (SEQ ID NO:183), which is the translation of D109-AH8 (14,1697) (SEQ LD NO: 182). Figure 97 is the nucleic acid sequence of D110-AF12 (166,1631) (SEQ ID NO:184), and the amino acid sequence of D110-AF12 (166,1631) (SEQ ID NO:185), which is the translation of Dl 10-AF12 (166,1631) (SEQ ID NO:184). Figure 98 is the nucleic acid sequence of D 112-AA5 (SEQ ID NO : 186), and the amino acid sequence of D112-AA5 (SEQ ID NO: 187), which is the translation of D112-AA5 (SEQ LD NO: 186). Figure 99 is the nucleic acid sequence of D120-AH4 (SEQ ID NO:188), and the amino acid sequence of D120-AH4 (SEQ ED NO: 189), which is the translation of D120-AH4 (SEQ ID NO:188). Figure 100 is the nucleic acid sequence of D121-AA8 (SEQ ID NO: 190), and the amino acid sequence of D121-AA8 (SEQ ED NO: 191), which is the translation of D121-AA8 (SEQ ED NO:190). Figure 101 is the nucleic acid sequence of D122-AF10 (SEQ ID NO:192), and the amino acid sequence of D122-AF10 (SEQ ID NO:193), which is the translation of D122-AF10 (SEQ ID NO:192). Figure 102 is the nucleic acid sequence of D128-AB7 (SEQ ID NO:194), and the amino acid sequence of D128-AB7 (SEQ ID NO: 195), which is the translation of D128-AB7 (SEQ ID NO: 194). Figure 103 is the nucleic acid sequence of D129-AD10 (SEQ ID NO:196), and the amino acid sequence of D129-AD10 (SEQ ID NO: 197), which is the translation of D129-AD10 (SEQ ED NO:196). Figure 104 is the nucleic acid sequence of D135-AE1 (SEQ ID NO:198), and the amino acid sequence of D135-AE1 (SEQ ID NO: 199), which is the translation of D135-AE1 (SEQ ED NO:198). Figure 105 is the nucleic acid sequence of D141-AD7 (SEQ ID NO:200), and the amino acid sequence of D141-AD7 (SEQ ID NO:201), which is the translation of D141-AD7 (SEQ ID NO:200). Figure 106 is the nucleic acid sequence of D147-AD3 (SEQ ID NO:202), and the amino acid sequence of D147-AD3 (SEQ ID NO:203), which is the translation of D147-AD3 (SEQ ID NO:202). Figure 107 is the nucleic acid sequence of D163-AF12 (SEQ ED NO:204), and the amino acid sequence of D163-AF12 (SEQ ID NO:205), which is the translation of D163-AF12 (SEQ ID NO:204). Figure 108 is the nucleic acid sequence of D163-AG11 (SEQ ID NO:206), and the amino acid sequence of D163-AG11 (SEQ ID NO:207), which is the translation of D163-AG11 (SEQ ID NO:206). Figure 109 is the nucleic acid sequence of D163-AG12 (SEQ ID NO:208), and the amino acid sequence of D163-AG12 (SEQ ID NO:209), which is the translation of D163-AG12 (SEQ ID NO:208). Figure 110 is the nucleic acid sequence of D205-BG9 (SEQ ED NO:210), and the amino acid sequence of D205-BG9 (SEQ ED NO:211), which is the translation of D205-BG9 (SEQ ID NO:210). Figure 111 is the nucleic acid sequence of D207-AA5 (SEQ ID NO:212), and the amino acid sequence of D207-AA5 (SEQ ID NO:213), which is the translation of D207-AA5 (SEQ ID NO:212). Figure 112 is the nucleic acid sequence of D207-AB4 (SEQ ID NO:214), and the amino acid sequence of D207-AB4 (SEQ ED NO:215), which is the translation of D207-AB4 (SEQ ID NO:214). Figure 113 is the nucleic acid sequence of D207-AC4 (SEQ ID NO:216), and the amino acid sequence of D207-AC4 (SEQ ID NO:217), which is the translation of D207-AC4 (SEQ ED NO:216). Figure 114 is the nucleic acid sequence of D209-AA10 (SEQ ID NO:218), and the amino acid sequence of D209-AA10 (SEQ ID NO:219), which is the translation of D209-AA10 (SEQ ID NO:218). Figure 115 is the nucleic acid sequence of D209-AA12 (SEQ ID NO:220), and the amino acid sequence of D209-AA12 (SEQ ID NO:221), which is the translation of D209-AA12 (SEQ ID NO:220). Figure 116 is the nucleic acid sequence of D209-AH10 (SEQ ID NO:222), and the amino acid sequence of D209-AH10 (SEQ ID NO:223), which is the translation of D209-AH10 (SEQ ID NO:222). Figure 117 is the nucleic acid sequence of D87A-AF3 (SEQ ID NO:224), and the amino acid sequence of D87A-AF3 (SEQ ED NO:225), which is the translation of D87A-AF3 (SEQ LD NO:224). Figure 118 is the nucleic acid sequence of D208-AC8 (SEQ ID NO:226), and the amino acid sequence of D208-AC8 (SEQ ID NO:227), which is the translation of D208-AC8 (SEQ ID NO:226). Figure 119 is the nucleic acid sequence of D215-AB5 (SEQ ID NO:228), and the amino acid sequence of D215-AB5 (SEQ ID NO:229), which is the translation of D215-AB5 (SEQ ID NO:228). Figure 120 is the nucleic acid sequence of D103-AH3 (SEQ ID NO:230), and the amino acid sequence of D103-AH3 (SEQ ID NO:231), which is the translation of D103-AH3 (SEQ LD NO:230). Figure 121 is the nucleic acid sequence of D208-AD9 (SEQ ED NO:232), and the amino acid sequence of D208-AD9 (SEQ ID NO:233), which is the translation of D208-AD9 (SEQ ID NO:232). Figure 122 is the nucleic acid sequence of D237-AD1 (SEQ ID NO:234), and the amino acid sequence of D237-AD1 (SEQ ED NO:235), which is the translation of D237-AD1 (SEQ ID NO:234). Figure 123 is the nucleic acid sequence of D125-AF11 (SEQ LD NO:236), and the amino acid sequence of D125-AF11 (SEQ ED NO:237), which is the translation of D125-AF11 (SEQ ID NO:236). Figure 124 is the nucleic acid sequence of D134-AE11 (SEQ ID NO:238), and the amino acid sequence of D134-AE11 (SEQ ID NO:239), which is the translation of D134-AE11 (SEQ ED NO:238). Figure 125 is the nucleic acid sequence of D209-AH12 (SEQ ID NO:240), and the amino acid sequence of D209-AH12 (SEQ ID NO:241), which is the translation of D209-AH12 (SEQ ID NO:240). Figure 126 is the nucleic acid sequence of D221-BB8 (SEQ ID NO:242), and the amino acid sequence of D221-BB8 (SEQ ID NO:243), which is the franslation of D221-BB8 (SEQ ID NO:242). Figure 127 is the nucleic acid sequence of D222-BH4 (SEQ ID NO:244), and the amino acid sequence of D222-BH4 (SEQ ID NO:245), which is the translation of D222-BH4 (SEQ ID NO:244). Figure 128 is the nucleic acid sequence of D224-AF10 (SEQ ID NO:246), and the amino acid sequence of D224-AF10 (SEQ ID NO:247), which is the translation of D224-AF10 (SEQ ID NO:246). Figure 129 is the nucleic acid sequence of D224-BD11 (SEQ ID NO:248), and the amino acid sequence of D224-BD11 (SEQ ID NO:249), which is the translation of D224-BD11 (SEQ ID NO:248). Figure 130 is the nucleic acid sequence of D228-AD7 (SEQ ID NO:250), and the amino acid sequence of D228-AD7 (SEQ ID NO:251), which is the translation of D228-AD7 (SEQ ID NO:250). Figure 131 is the nucleic acid sequence of D228-AH8 (SEQ ID NO:252), and the amino acid sequence of D228-AH8 (SEQ ID NO:253), which is the translation of D228-AH8 (SEQ ED NO:252). Figure 132 is the nucleic acid sequence of D235-AB1 (SEQ ID NO:254), and the amino acid sequence of D235-AB1 (SEQ ED NO:255), which is the franslation of D235-AB1 (SEQ LD NO:254). Figure 133 is the nucleic acid sequence of D243-AA2 (SEQ ID NO:256), and the amino acid sequence of D243-AA2 (SEQ ID NO:257), which is the translation of D243-AA2 (SEQ ID NO:256). Figure 134 is the nucleic acid sequence of D244-AD4 (SEQ ID NO:258), and the amino acid sequence of D244-AD4 (SEQ ID NO:259), which is the translation of D244-AD4 (SEQ ID NO:258). Figure 135 is the nucleic acid sequence of D247-AH1 (SEQ ID NO:260), and the amino acid sequence of D247-AH1 (SEQ ED NO:261), which is the translation of D247-AH1 (SEQ ID NO:260). Figure 136 is the nucleic acid sequence of D248-AA6 (SEQ ID NO:262), and the amino acid sequence of D248-AA6 (SEQ ED NO:263), which is the translation of D248-AA6 (SEQ ID NO:262). Figure 137 is the nucleic acid sequence of D249-AE8 (SEQ ED NO:264), and the amino acid sequence of D249-AE8 (SEQ ID NO:265), which is the franslation of D249-AE8 (SEQ ID NO:264). Figure 138 is the nucleic acid sequence of D250-AC11 (SEQ ID NO:266), and the amino acid sequence of D250-AC11 (SEQ ID NO:267), which is the translation of D250-AC11 (SEQ ID NO:266). Figure 139 is the nucleic acid sequence of D259-AB9 (SEQ ID NO:268), and the amino acid sequence of D259-AB9 (SEQ ED NO:269), which is the translation of D259-AB9 (SEQ ID NO:268). Figure 140 is the nucleic acid sequence of D218A-AC2 (SEQ ID NO:270), and the amino acid sequence of D218A-AC2 (SEQ ID NO:271), which is the translation of D218A-AC2 (SEQ ED NO:270). Figure 141 is the nucleic acid sequence of D210-BD4 (SEQ ID NO:272), and the amino acid sequence of D210-BD4 (SEQ ID NO:273), which is the translation of D210-BD4 (SEQ ID NO:272). Figure 142 is the nucleic acid sequence of D233-AG7 (SEQ ID NO:274), and the amino acid sequence of D233-AG7 (SEQ ID NO:275), which is the translation of D233-AG7 (SEQ ID NO:274). Figure 143 is the nucleic acid sequence of D257-AE4 (SEQ ED NO:276), and the amino acid sequence of D257-AE4 (SEQ ID NO:277), which is the translation of D257-AE4 (SEQ ID NO:276). Figure 144 is the nucleic acid sequence of D268-AE2 (SEQ ID NO:278), and the amino acid sequence of D268-AE2 (SEQ ID NO:279), which is the translation of D268-AE2 (SEQ ID NO:278). Figure 145 is the nucleic acid sequence of D283-AC1 (SEQ ED NO:280), and the amino acid sequence of D283-AC1 (SEQ ID NO:281), which is the translation of D283-AC1 (SEQ ED NO:280). Figure 146 is the nucleic acid sequence of D244-AB6 (SEQ ID NO:282), and the amino acid sequence of D244-AB6 (SEQ ID NO:283), which is the translation of D244-AB6 (SEQ ED NO:282). Figure 147 is the nucleic acid sequence of D205-BE9 (SEQ ID NO:284), and the amino acid sequence of D205-BE9 (SEQ ED NO:285), which is the translation of D205-BE9 (SEQ ID NO:284). Figure 148 is the nucleic acid sequence of D136-AF4 (SEQ ED NO:286), and the amino acid sequence of D136-AF4 (SEQ ID NO:287), which is the translation of D136-AF4 (SEQ ED NO:286). Figure 149 is the nucleic acid sequence of D101-BA2 (SEQ ID NO:288), and the amino acid sequence of D101-BA2 (SEQ ED NO:289), which is the translation of D101-BA2 (SEQ 1D NO:288). Figure 150 is the nucleic acid sequence of D130-AA1 (SEQ LD NO:290), and the amino acid sequence of D130-AA1 (SEQ ID NO:291), which is the translation of D130-AA1 (SEQ ID NO:290). Figure 151 is the nucleic acid sequence of D136-AD5 (SEQ ED NO:292), and the amino acid sequence of D136-AD5 (SEQ ED NO:293), which is the franslation of D136-AD5 (SEQ ED NO:292). Figure 152 is the nucleic acid sequence of D138-AD12 (SEQ ID NO:294), and the amino acid sequence of D138-AD12 (SEQ ID NO:295), which is the translation of D138-AD12 (SEQ ID NO:294). Figure 153 is the nucleic acid sequence of D216-AG8 (SEQ ID NO:296), and the amino acid sequence of D216-AG8 (SEQ ID NO:297), which is the translation of D216-AG8 (SEQ ID NO:296). Figure 154 is the nucleic acid sequence of D243-AB3 (SEQ ID NO:298), and the amino acid sequence of D243-AB3 (SEQ ED NO:299), which is the translation of D243-AB3 (SEQ ID NO:298). Figure 155 is the nucleic acid sequence of D250-AC11 (SEQ ED NO:300), and the amino acid sequence of D250-AC11 (SEQ ID NO:301), which is the translation of D250-AC11 (SEQ ID NO:300). Figure 156 is the nucleic acid sequence of D205-AH4 (SEQ ID NO:302), and the amino acid sequence of D205-AH4 (SEQ ED NO:303), which is the translation of D205-AH4 (SEQ ID NO:302). Figure 157 is the nucleic acid sequence of D267-AF10 (SEQ ID NO:304), and the amino acid sequence of D267-AF10 (SEQ ED NO:305), which is the translation of D267-AF10 (SEQ ID NO:304). Figure 158 is the nucleic acid sequence of D284-AH5 (SEQ ED NO:306), and the amino acid sequence of D284-AH5 (SEQ ED NO:307), which is the franslation of D284-AH5 (SEQ ID NO:306). Figure 159 A is a set of nucleic acid sequence alignments consisting ofthe alignment of D58-BG7 (SEQ ID NO:10), D58-AB1 (SEQ ID NO:12), and D58-BE4 (SEQ ID NO:16); and the alignment of D56-AH7 (SEQ ID NO:18) and D13a-5 (SEQ ID NO:20). Percent identity between the sequences of each alignment are shown below the respective alignments. Figure 159B is a set of nucleic acid sequence alignments consisting ofthe alignment of D56-AG10 (SEQ ID NO:22), D35-33 (SEQ ID NO:24), and D34-62 (SEQ ID NO:26); and the alignment of D56-AA7 (SEQ ID NO:28), D56-AE1 (SEQ ED NO:30), and D185-BD3 (SEQ ID NO:152). Percent identity between the sequences of each alignment are shown below the respective alignments. Figure 159C is a set of nucleic acid sequence alignments consisting ofthe alignment of D56A-AB6 (SEQ ED NO:36), D35-BB7 (SEQ ID NO:32), D177-BA7 (SEQ ID NO:34), and D144-AE2 (SEQ ID NO:38); and the alignment of D56-AG11 (SEQ ID NO:40) and D179-AA1 (SEQ ED NO:42). Percent identity between the sequences of each alignment are shown below the respective alignments. Figure 159D is a set of nucleic acid sequence alignments consisting ofthe alignment of D56-AC7 (SEQ ED NO:44) and D144-AD1 (SEQ ED NO:46); and the alignment of D181-AB5 (SEQ ID NO:50) and D73-AC9 (SEQ ED NO:52). Percent identity between the sequences of each alignment are shown below the respective alignments. Figure 159E is the alignment ofthe nucleic acid sequences D58-AB9 (SEQ ID NO:56), D56-AG9 (SEQ ED NO:58), D35-BG11 (SEQ DD NO:62), D34-25 (SEQ DD NO:72), D35-BA3 (SEQ DD NO:66), D34-52 (SEQ DD NO:70), D56-AG6 (SEQ DD NO:60), D35-42 (SEQ DD NO:64), and D34-57 (SEQ DD NO:68). Percent identity between the sequences ofthe alignment is shown below the alignment. Figure 159F is a set of nucleic acid sequence alignments consisting ofthe alignment of D177-BD7 (SEQ DD NO:92) and D177-BD5 (SEQ DD NO:78); and the alignment of D56A-AG10 (SEQ ED NO:80), D58-AD12 (SEQ ED NO:84), and D58- BC5 (SEQ ΩD NO:82). Percent identity between the sequences of each alignment are shown below the respective alignments. Figure 159G is a set of nucleic acid sequence alignments consisting ofthe alignment of D56-AD6 (SEQ DD NO:96), D56-AC11 (SEQ ID NO:86), D35-39 (SEQ YD NO:88), and D58-BH4 (SEQ ED NO:90); and the alignment of D73A-AD6 (SEQ DD NO:98) and D70A-BA11 (SEQ ED NO: 100). Percent identity between the sequences of each alignment are shown below the respective alignments. Figure 159H is a set of nucleic acid sequence alignments consisting ofthe alignment of D70A-AB5 (SEQ ID NO:104) and D70A-AA8 (SEQ ED NO:106); and the alignment of D70A-AB8 (SEQ DD NO: 108), D70A-BH2 (SEQ DD NO:110), D70A-AA4 (SEQ DD NO: 112). Percent identity between the sequences of each alignment are shown below the respective alignments. Figure 1591 is a set of nucleic acid sequence alignments consisting ofthe alignment of D70A-BA1 (SEQ ID NO:114) and D70A-BA9 (SEQ DD NO:116):and the alignment of D144-AH1 (SEQ ED NO:122), D34-65 (SEQ DD NO:124), and D 181 -AC5 (SEQ DD NO : 120) . Percent identity between the sequences of each alignment are shown below the respective alignments. Figure 159J is a set of nucleic acid sequence alignments consisting ofthe alignment of D58-AA1 (SEQ DD NO:130), D185-BC1 (SEQ ED NO:142), and D185- BG2 (SEQ DD NO:144); and the alignment of D177-BF7 (SEQ ED NO:136), D185- BD2 (SEQ JJD NO: 148), and D185-BE1 (SEQ ID NO: 146). Percent identity between the sequences of each alignment are shown below the respective alignments. Figure 159K is the alignment of nucleic acid sequences D70-AA12 (SEQ DD NO: 140) and D176-BF2 (SEQ ID NO:94). Percent identity between the sequences of the alignment is shown below the alignment. Figure 160A is a set of amino acid sequence alignments consisting ofthe sequence alignment of D208-AD9 (SEQ ID NO:2196), D120-AH4 (SEQ ID NO.-2197), D121-AA8 (SEQ ID NO:2198), D122-AF10 (SEQ ID NO:2199), D103- AH3 (SEQ ID NO:2200), D208-AC8 (SEQ ID NO:2201), and D235-AB1 (SEQ D3 NO.-2202); the sequence alignment of D244-AD4 (SEQ ID NO:2203), D244-AB6 (SEQ DD NO:2204), D285-AA8 (SEQ ID NO:2205), D285-AB9 (SEQ ED NO:2206), and D268-AE2 (SEQ DD NO:2207); and the sequence alignment of D100A-AC3 (SEQ ID NO:2208) and D100A-BE2 (SEQ LD NO:2209). Figure 160B is a set of amino acid sequence alignments consisting the sequence alignment ofthe sequence alignment of D205-BG9 (SEQ ED NO:2210), D205-BE9 (SEQ DD NO:2211), and D205-AH4 (SEQ DD NO:2212); the sequence alignment of D259-AB9 (SEQ DD NO:2213), D257-AE4 (SEQ ID NO:2214), and D147-AD3 (SEQ DD NO:2215); the sequence alignment of D249-AEB (SEQ DD NO:2216) and D248-AA6 (SEQ DD NO:2217); the sequence alignment of D233-AG7 (SEQ ED NO:2218), D224-BD11 (SEQ DD NO:2219), and D224-AF10 (SEQ DD

NO.-2220); and the sequence alignment of D105-AD6 (SEQ DD NO:2221), D215-AB5 (SEQ DD NO:2222), and D135-AE1 (SEQ DD NO:2223). Figure 160C is a set of amino acid sequence alignments consisting ofthe sequence alignment of D87A-AF3 (SEQ DD NO:2224) and D210-BD4 (SEQ DD NO:2225); the sequence alignment of D89-AB 1 (SEQ DD NO:2226), D89-AD2 (SEQ DD NO:2227), D163-AG12 (SEQ DD NO:2228), D163-AG11 (SEQ DD NO:2229), and D163-AF12 (SEQ DD NO:2230); the sequence alignment of D267-AF10 (SEQ DD NO:2231), D96-AC2 (SEQ DD NO:2232), D96-AB6 (SEQ ED NO:2233), D207-AA5 (SEQ DD NO:2234), D207-AB4 (SEQ DD NO:2235), and D207-AC4 (SEQ DD NO:2236); and the sequence alignment of D98-AG1 (SEQ ED NO:2237) and D98- AA1 (SEQ ED NO:2238). Figure 160D is a set of amino acid sequence alignments consisting ofthe sequence alignment of D209-AA10 (SEQ ID NO:2239), D209-AA12 (SEQ DD NO:2240), D209-AH10 (SEQ ID NO:2241), D209-AH12 (SEQ ED NO:2242), and D90a-BB3 (SEQ DD NO:2243); the sequence alignment of D129-AD10 (SEQ DD NO:2244) and D104A-AE8 (SEQ DD NO:2245); the sequence alignment of D228- AH8 (SEQ ID NO:2246), D228-AD7 (SEQ DD NO:2247), D250-AC11 (SEQ DD NO:2248), and D247-AH1 (SEQ DD NO:2249); and the sequence alignment of D128- AB7 (SEQ DD NO:2250), D243-AA2 (SEQ DD NO:2251), and D125-AF11 (SEQ DD NO:2252). Figure 160E is an amino acid sequence alignment of D284-AH5 (SEQ DD

NO:2253) and Dl 10-AF12 (SEQ DD NO:2254). Figure 161 is a diagram showing the cloning of cytochrome p450 cDNA fragments by PCR. Primers used for the cloning are listed: DM (SEQ ED NO:2255), DM4 (SEQ DD NO:2256), DM12 (SEQ DD NO:2257), DM13 (SEQ ED NO:2258), DM17 (SEQ JD NO:2259), OLIGO d(T) (SEQ ED NO:2260), T7 (SEQ DD NO:2261), and SP6 (SEQ DD NO:2262). Figure 162 is the nucleic acid sequence of D425-AB10 (SEQ DD NO:367), and the amino acid sequence of D425-AB10 (SEQ DD NO:368), which is the translation of D425-AB10 (SEQ DD NO:367). Figure 163 is the nucleic acid sequence of D425-AB11 (SEQ JD NO:369), and the amino acid sequence of D425-AB11 (SEQ ID NO:370), which is the translation of D425-AB11 (SEQ DD NO:369). Figure 164 is the nucleic acid sequence of D425-AC9 (SEQ DD NO:371), and the amino acid sequence of D425-AC9 (SEQ DD NO:372), which is the translation of D425-AC9 (SEQ ED NO:371). Figure 165 is the nucleic acid sequence of D425-AC10 (SEQ DD NO:373), and the amino acid sequence of D425-AC10 (SEQ DD NO:374), which is the translation of D425-AC10 (SEQ ED NO:373). Figure 166 is the nucleic acid sequence of D425-AC11 (SEQ DD NO:375), and the amino acid sequence of D425-AC11 (SEQ ED NO:376), which is the translation of D425-AC11 (SEQ DD NO:375). Figure 167 is the nucleic acid sequence of D425-AG11 (SEQ DD NO:377), and the amino acid sequence of D425-AG11 (SEQ JD NO:378), which is the translation of D425-AG11 (SEQ ED NO:377). Figure 168 is the nucleic acid sequence of D425-AH7 (SEQ ED NO:379), and the amino acid sequence of D425-AH7 (SEQ ED NO:380), which is the franslation of D425-AH7 (SEQ ID NO:379). Figure 169 is the nucleic acid sequence of D425-AH11 (SEQ ED NO:381), and the amino acid sequence of D425-AH11 (SEQ DD NO:382), which is the translation of D425-AH11 (SEQ DD NO:381). Figure 170 is the nucleic acid sequence of D427-AA5 (SEQ DD NO:383), and the amino acid sequence of D427-AA5 (SEQ JD NO:384), which is the franslation of D427-AA5 (SEQ ID NO:383). Figure 171 is a table listing the probe set sequences (SEQ ID NO:385 - SEQ ED NO:445) of clones on the GeneChip^® microarray. Figure 172-1 is a group of nucleic acid and amino acid sequences consisting ofthe nucleic acid sequence of D424-AA4 (SEQ ED NO:446); the nucleic acid sequence of D424-AF5 (SEQ DD NO:447) and the amino acid sequence of D424-AF5 (SEQ DD NO:448), which is the translation of D424-AF5 (SEQ DD NO:447); the nucleic acid sequence of D425-AA11 (SEQ DD NO:449) and the amino acid sequence of D425-AA11 (SEQ DD NO:450), which is the translation of D425-AA11 (SEQ ED NO:449); and the nucleic acid sequence of D425-AF11 (SEQ ID NO:451). Figure 172-2 is a group of nucleic acid and amino acid sequences consisting ofthe amino acid sequence of D425-AF11 (SEQ DD NO:452), which is the translation of D425-AF11 (SEQ DD NO:451); the nucleic acid sequence of D425-AH10 (SEQ DD NO:453) and the amino acid sequence of D425-AH10 (SEQ ED NO:454), which is the translation of D425-AH10 (SEQ ED NO:453); the nucleic acid sequence of D426-AA3 (SEQ DD NO:455) and the amino acid sequence of D426-AA3 (SEQ DD NO:456), which is the translation of D426-AA3 (SEQ DD NO:455); and the nucleic acid sequence of D426-AG1 (SEQ DD NO:457) and the amino acid sequence of D426-AG1 (SEQ JD NO-.458), which is the translation of D426-AG1 (SEQ DD NO:457). Figure 172-3 is a group of nucleic acid and amino acid sequences consisting ofthe nucleic acid sequence of D427-AA6 (SEQ DD NO:459) and the amino acid sequence of D427-AA6 (SEQ DD NO:460), which is the franslation of D427-AA6 (SEQ DD NO:459); the nucleic acid sequence of D427-AB6 (SEQ DD NO:461) and the amino acid sequence of D427-AB6 (SEQ DD NO:462), which is the translation of D427-AB6 (SEQ DD NO:461) the nucleic acid sequence of D428-AC9 (SEQ DD NO:463) and the amino acid sequence of D428-AC9 (SEQ DD NO:464), which is the translation of D428-AC9 (SEQ ID NO:463); and the nucleic acid sequence of D428- AH10 (SEQ ID NO:465). Figure 172-4 is a group of nucleic acid and amino acid sequences consisting ofthe amino acid sequence of D428-AH10 (SEQ ID NO:466), which is the translation of D428-AH10 (SEQ DD NO:465); the nucleic acid sequence of D429-AA1 (SEQ DD NO:467) and the amino acid sequence of D429-AA1 (SEQ DD NO:468), which is the translation of D429-AA1 (SEQ DD NO:467); the nucleic acid sequence of D430-AA3 (SEQ LD NO:469) and the amino acid sequence of D430-AA3 (SEQ DD NO:470), which is the translation of D430-AA3 (SEQ DD NO:469); and the nucleic acid sequence of D431-AE6 (SEQ DD NO:471) and the amino acid sequence of D431-AE6 (SEQ LD NO:472), which is the franslation of D431-AE6 (SEQ DD NO:471). Figure 172-5 is a group of nucleic acid and amino acid sequences consisting ofthe nucleic acid sequence of Dl 13-AE9 (SEQ DD NO:473) and the amino acid sequence of Dl 13-AE9 (SEQ DD NO:474), which is the translation of Dl 13-AE9 (SEQ DD NO:473); and the nucleic acid sequence of Dl 14-AE12 (SEQ DD NO:475). Figure 172-6 is a group of nucleic acid and amino acid sequences consisting ofthe amino acid sequence of Dl 14-AE12 (SEQ LD NO:476), which is the translation of Dl 14-AE12 (SEQ ED NO:475); the nucleic acid sequence of Dl 19-AC3 (SEQ DD NO:477) and the amino acid sequence of Dl 19-AC3 (SEQ DD NO:478), which is the translation of Dl 19-AC3 (SEQ DD NO:477); and the nucleic acid sequence of D132- AA5 (SEQ DD NO:479). Figure 172-7 is a group of nucleic acid and amino acid sequences consisting ofthe amino acid sequence of D132-AA5 (SEQ DD NO:480), which is the translation of D132-AA5 (SEQ DD NO:479); the nucleic acid sequence of D223-BB10 (SEQ DD NO:481) and the amino acid sequence of D223-BB10 (SEQ DD NO:482), which is the translation of D223-BB10 (SEQ DD NO:481); and the nucleic acid sequence of D245- AA8 (SEQ DD NO:483) and the amino acid sequence of D245-AA8 (SEQ DD NO:484), which is the translation of D245-AA8 (SEQ ID NO:483). Figure 172-8 is a group of nucleic acid and amino acid sequences consisting ofthe nucleic acid sequence of D246-AE12 (SEQ ED NO:485) and the amino acid sequence of D246-AE12 (SEQ DD NO:486), which is the translation of D246-AE12 (SEQ DD NO:485); and the nucleic acid sequence of D279-AD1 (SEQ DD NO:487) and the amino acid sequence of D279-AD1 (SEQ DD NO:488), which is the translation of D279-AD 1 (SEQ DD NO:487). Figure 172-9 is a group of nucleic acid and amino acid sequences consisting ofthe nucleic acid sequence of D282-AA10 (SEQ DD NO:489) and the amino acid sequence of D282-AA10 (SEQ DD NO:490), which is the translation of D282-AA10 (SEQ DD NO:489); and the nucleic acid sequence of D295-AA1 (SEQ DD NO:491). Figure 172-10 is a group of nucleic acid and amino acid sequences consisting ofthe amino acid sequence of D295-AA1 (SEQ DD NO:492), which is the translation of D295-AA1 (SEQ DD NO:491); the nucleic acid sequence of D101A-AE2 (SEQ DD NO:493) and the amino acid sequence of D101A-AE2 (SEQ DD NO:494), which is the translation of D101A-AE2 (SEQ DD NO:493); and the nucleic acid sequence of D108- AA4 (SEQ DD NO:495). Figure 172-11 is a group of nucleic acid and amino acid sequences consisting ofthe amino acid sequence of D108-AA4 (SEQ DD NO:496), which is the translation of D108-AA4 (SEQ DD NO:495); the nucleic acid sequence of D124-AC5(5') (SEQ ED NO:497) and the amino acid sequence of D124-AC5(5') (SEQ DD NO:498), which is the translation of D124-AC5(5') (SEQ ED NO:497); the nucleic acid sequence of D124-AC5(3') (SEQ DD NO:499) and the amino acid sequence of D124-AC5(3') (SEQ DD NO:500), which is the translation of D124-AC5(3') (SEQ DD NO:499); and the nucleic acid sequence of D141-AD7 (SEQ DD NO:501). Figure 172-12 is a group of nucleic acid and amino acid sequences consisting ofthe amino acid sequence of D141-AD7 (SEQ DD NO:502), which is the franslation of D141-AD7 (SEQ DD NO:501); and the nucleic acid sequence of D148-AD1 (SEQ DD NO:503) and the amino acid sequence of D148-AD1 (SEQ ID NO:504), which is the translation of D148-AD1 (SEQ DD NO:503). Figure 172-13 is a group of nucleic acid and amino acid sequences consisting ofthe nucleic acid sequence of D212-BC11 (SEQ ID NO: 505) and the amino acid sequence of D212-BC11 (SEQ ED NO:506), which is the translation of D212-BC11 (SEQ DD NO:505); and the nucleic acid sequence of D217-AB10 (SEQ DD NO:507) and the amino acid sequence of D217-AB10 (SEQ DD NO:508), which is the translation of D217-AB10 (SEQ ED NO:507). Figure 172-14 is a group of nucleic acid and amino acid sequences consisting ofthe nucleic acid sequence of D220-BC6 (SEQ DD NO:509) and the amino acid sequence of D220-BC6 (SEQ DD NO:510), which is the translation of D220-BC6 (SEQ DD NO:509); the nucleic acid sequence of D225-AG9 (SEQ DD NO:511) and the amino acid sequence of D225-AG9 (SEQ ED NO:512), which is the translation of D225-AG9 (SEQ DD NO:511); the nucleic acid sequence of D231-AF1 (SEQ DD

NO:513) and the amino acid sequence of D231-AF1 (SEQ DD NO:514), which is the translation of D231-AF1 (SEQ DD NO:513); and the nucleic acid sequence of D232- AH5 (SEQ DD NO:515). Figure 172-15 is a group of nucleic acid and amino acid sequences consisting ofthe amino acid sequence of D232-AH5 (SEQ DD NO:516), which is the translation of D232-AH5 (SEQ DD NO:515); the nucleic acid sequence of D240-BB8 (SEQ DD NO:517) and the amino acid sequence of D240-BB8 (SEQ DD NO:518), which is the translation of D240-BB8 (SEQ DD NO:517); the nucleic acid sequence of D280-AA6 (SEQ DD NO:519) and the amino acid sequence of D280-AA6 (SEQ DD NO:520), which is the translation of D280-AA6 (SEQ DD NO:519); and the nucleic acid sequence of D285-AD7 (SEQ DD NO:521) and the amino acid sequence of D285-AD7 (SEQ DD NO:522), which is the translation of D285-AD7 (SEQ DD NO.-521). Figure 172-16 is a group of nucleic acid and amino acid sequences consisting ofthe nucleic acid sequence of D285-AH9 (SEQ DD NO:523) and the amino acid sequence of D285-AH9 (SEQ DD NO:524), which is the franslation of D285-AH9 (SEQ DD NO:523); the nucleic acid sequence of D99-AB3 (SEQ DD NO:525) and the amino acid sequence of D99-AB3 (SEQ DD NO: 526), which is the translation of D99- AB3 (SEQ ID NO:525); and the nucleic acid sequence of D99-AC2 (SEQ ID NO:527) and the amino acid sequence of D99-AC2 (SEQ DD NO:528), which is the translation of D99-AC2 (SEQ DD NO:527). Figure 172-17 is a group of nucleic acid and amino acid sequences consisting ofthe nucleic acid sequence of D99-AF11 (SEQ DD NO:529) and the amino acid sequence of D99-AF11 (SEQ DD NO:530), which is the translation of D99-AF11 (SEQ ED NO:529); the nucleic acid sequence of D99-AH4 (SEQ DD NO:531) and the amino acid sequence of D99-AH4 (SEQ DD NO:532), which is the translation of D99- AH4 (SEQ ID NO:531); the nucleic acid sequence of D99-AH7 (SEQ DD NO:533) and the amino acid sequence of D99-AH7 (SEQ ID NO:534), which is the translation of D99-AH7 (SEQ DD NO:533); the nucleic acid sequence of D99-DB4 (SEQ ED NO:535) and the amino acid sequence of D99-DB4 (SEQ DD NO:536), which is the translation of D99-DB4 (SEQ DD NO:535). Figure 172-18 is a group of nucleic acid and amino acid sequences consisting ofthe nucleic acid sequence of D99-DG4 (SEQ DD NO:537) and the amino acid sequence of D99-DG4 (SEQ DD NO:538), which is the translation of D99-DG4 (SEQ DD NO:537); the nucleic acid sequence of D40-2 (SEQ DD NO:539) and the amino acid sequence of D40-2 (SEQ DD NO:540), which is the translation of D40-2 (SEQ DD NO:539); the nucleic acid sequence of D301-EE11 (SEQ ED NO:541) and the amino acid sequence of D301-EE11 (SEQ ED NO:542), which is the franslation of D301- EE11 (SEQ DD NO:541); and the nucleic acid sequence of D302-AE10 (SEQ ED NO:543). Figure 172-19 is a group of nucleic acid and amino acid sequences consisting ofthe amino acid sequence of D302-AE10 (SEQ DD NO:544), which is the franslation of D302-AE10 (SEQ DD NO:543); the nucleic acid sequence of D303-AC6 (SEQ DD NO:545) and the amino acid sequence of D303-AC6 (SEQ ED NO:546), which is the translation of D303-AC6 (SEQ DD NO:545); and the nucleic acid sequence of D303- AC11 (SEQ DD NO:547) and the amino acid sequence of D303-AC11 (SEQ DD NO:548), which is the translation of D303-AC11 (SEQ DD NO:547). Figure 173-1 is the nucleic acid sequence of 40-17 (SEQ DD NO:549), 40-20 (SEQ JD NO:550), 40-23 (SEQ ED NO:551), 40-26 (SEQ DD NO:552), D40-27 (SEQ ED NO:553), 40-28 (SEQ DD NO:554), and 40-78 (SEQ ED NO:555). Figure 173-2 is the nucleic acid sequence of 40-83 (SEQ ED NO:556), D40-86 (SEQ DD NO:557), D40-97 (SEQ DD NO:558), 40-100 (SEQ DD NO:559), 40-107 (SEQ DD NO:560), D41-41 (SEQ DD NO:561), and D41-60 (SEQ DD NO:562). Figure 173-3 is the nucleic acid sequence of D41-65 (SEQ ID NO:563), D41- 67 (SEQ ED NO:564), D41-69 (SEQ JD NO:565), D41-99 (SEQ JD NO:566), D42- AA3 (SEQ JD NO:567), D42-AA7 (SEQ ID NO:568), and D42-AC3 (SEQ DD NO:569). Figure 173-4 is the nucleic acid sequence of D42-AC7 (SEQ ID NO:570), D42-AC8 (SEQ ED NO:571), D42-AD3 (SEQ DD NO:572), D42-AD12 (SEQ DD NO:573), D42-AF3 (SEQ DD NO:574), and D42-AH3 (SEQ DD NO:575). Figure 173-5 is the nucleic acid sequence of D42-BA2 (SEQ JD NO:576), D42-BB11 (SEQ JD NO:577), D42-KC9 (SEQ DD NO:578), D42-KC10 (SEQ DD

NO:579), D42-LB2 (SEQ DD NO:580), D42-LC7 (SEQ ED NO:581), D42-TG7 (SEQ JD NO:582), and D42-UG8 (SEQ DD NO:583). Figure 173-6 is the nucleic acid sequence of D42-ZB1 (SEQ DD NO: 584), D300-AA7 (SEQ DD NO:585), D300-AB3 (SEQ DD NO:586), D300-AB7 (SEQ ED NO:587), D300-AB10 (SEQ DD NO:588), D300-AB11 (SEQ ID NO:589), andD300- AC2 (SEQ JD NO:590). Figure 173-7 is the nucleic acid sequence of D300-AC6 (SEQ DD NO:591), D300-AC7 (SEQ JD NO:592), D300-AD4 (SEQ JD NO:593), D300-AD6 (SEQ ED NO:594), D300-AD10 (SEQ JD NO:595), D300-AE3 (SEQ ED NO:596), and D300- AE9 (SEQ DD NO:597). Figure 173-8 is the nucleic acid sequence of D300-AE11 (SEQ DD NO:598), D300-AF4 (SEQ DD NO:599), D300-AF5 (SEQ JD NO:600), D300-AF7 (SEQ JD NO:601), D300-AF8 (SEQ ID NO:602), D300-AF9 (SEQ JD NO:603), and D300- AF11 (SEQ DD NO:604). Figure 173-9 is the nucleic acid sequence of D300-AG1 (SEQ DD NO:605), D300-AG2 (SEQ DD NO:606), D300-AG3 (SEQ JD NO:607), D300-AG10 (SEQ ED NO:608), D300-AH6 (SEQ DD NO:609), D300-AH9 (SEQ DD NO:610), D300-AH10 (SEQ H NO:611), and D300-AHll (SEQ D NO:612). Figure 173-10 is the nucleic acid sequence of D300-BA5 (SEQ DD NO:613),

D300-BA6 (SEQ DD NO:614), D300-BA7 (SEQ DD NO:615), D300-BA12 (SEQ DD NO:616), D300-BB6 (SEQ DD NO:617), D300-BB7 (SEQ DD NO:618), and D300- BCl (SEQ ID NO:619). Figure 173-11 is the nucleic acid sequence of D300-BC4 (SEQ JD NO:620), D300-BC7 (SEQ JD NO:621), D300-BC8 (SEQ JD NO:622), D300-BC9 (SEQ ED NO:623), D300-BD2 (SEQ JD NO:624), D300-BD7 (SEQ DD NO:625), and D300- BE1 (SEQ DD NO:626). Figure 173-12 is the nucleic acid sequence of D300-BE2 (SEQ DD NO:627), D300-BE7 (SEQ DD NO:628), D300-BE8 (SEQ DD NO:629), D300-BE9 (SEQ DD NO:630), D300-BE12 (SEQ DD NO:631), D300-BF7 (SEQ DD NO:632), D300-BF11 (SEQ DD NO:633), and D300-BG1 (SEQ DD NO:634). Figure 173-13 is the nucleic acid sequence of D300-BG2 (SEQ DD NO:635), D300-BG5 (SEQ LD NO:636), D300-BH6 (SEQ JD NO:637), D300-BH9 (SEQ DD NO:638), D300-CA1 (SEQ DD NO:639), D300-CA6 (SEQ DD NO:640), and D300- CBl (SEQ ID NO:641). Figure 173-14 is the nucleic acid sequence of D300-CB12 (SEQ JD NO:642), D300-CC2 (SEQ DD NO:643), D300-CD2 (SEQ DD NO:644), D300-CD3 (SEQ DD NO.-645), D300-CD4 (SEQ JD NO:646), D300-CD5 (SEQ DD NO:647), and D300- CE3 (SEQ DD NO:648). Figure 173-15 is the nucleic acid sequence of D300-CE7 (SEQ DD NO:649),

D300-CF1 (SEQ ED NO:650), D300-CF2 (SEQ DD NO:651), D300-CF11 (SEQ DD NO:652), D300-CG2 (SEQ DD NO:653), D300-CG7 (SEQ DD NO:654), D300-CH1 (SEQ DD NO:655), and D300-CH3 (SEQ ED NO:656). Figure 173-16 is the nucleic acid sequence of D300-CH5 (SEQ ID NO:657), D300-CH7 (SEQ JD NO:658), D300-DA1 (SEQ JD NO:659), D300-DA4 (SEQ DD NO:660), D300-DB2 (SEQ DD NO:661), D300-DB4 (SEQ DD NO:662), D300-DB6 (SEQ ED NO:663), and D300-DB7-C (SEQ DD NO:664). Figure 173-17 is the nucleic acid sequence of D300-DB8 (SEQ DD NO:665),

D300-DC2 (SEQ DD NO:666), D300-DC4 (SEQ ID NO:667), D300-DC7 (SEQ DD NO:668), D300-DC10 (SEQ DD NO:669), D300-DC11 (SEQ DD NO:670), and D300- DD5 (SEQ πD NO:671). Figure 173-18 is the nucleic acid sequence of D300-DD6 (SEQ JD NO:672), D300-DE2 (SEQ JD NO:673), D300-DE9 (SEQ ID NO:674), D300-DE10 (SEQ JD NO:675), D300-DF5 (SEQ ED NO:676), D300-DF6 (SEQ ED NO:677), D300-DF8 (SEQ πD NO:678), and D300-DF12 (SEQ DD NO:679). Figure 173-19 is the nucleic acid sequence of D300-DG1 (SEQ DD NO:680), D300-DG3 (SEQ DD NO:681), D300-DG9 (SEQ DD NO:682), D300-DG11 (SEQ DD NO:683), D300-DH10 (SEQ DD NO:684), D301-AB10 (SEQ DD NO:685), and D301- AC5 (SEQ DD NO:686). Figure 173-20 is the nucleic acid sequence of D301-AC7 (SEQ DD NO:687), D301-AC9 (SEQ DD NO:688), D301-AD1 (SEQ DD NO:689), D301-AD2 (SEQ DD NO:690), D301-AE4C (SEQ ED NO:691), D301-AF12 (SEQ DD NO:692), D301-AH6 (SEQ DD NO:693), and D301-AH12 (SEQ DD NO:694). Figure 173-21 is the nucleic acid sequence of D301-BB8 (SEQ DD NO:695), D301-BB9 (SEQ DD NO:696), D301-BC1 (SEQ ED NO:697), D301-BC8 (SEQ ED NO:698), D301-BD1 (SEQ DD NO:699), D301-BD2 (SEQ ID NO:700), and D301- BF3 (SEQ ED NO:701). Figure 173-22 is the nucleic acid sequence of D301-DA4 (SEQ ID NO:702),

D301-DA8 (SEQ ID NO:703), D301-DB5 (SEQ ED NO:704), D301-DC6 (SEQ ID NO:705), D301-DD4 (SEQ ED NO:706), D301-DG1 (SEQ DD NO:707), D301-DG4c (SEQ DD NO:708), and D301-EA5 (SEQ DD NO:709). Figure 173-23 is the nucleic acid sequence of D301-EA6 (SEQ DD NO:710), D301-EA7 (SEQ DD NO:711), D301-EC9 (SEQ DD NO:712), D301-EC10 (SEQ DD NO:713), D301-ED5 (SEQ DD NO:714), D301-ED7 (SEQ DD NO:715), and D301- EE7 (SEQ πD NO:716). Figure 173-24 is the nucleic acid sequence of D301-EF2 (SEQ JD NO:717),

D301-EF5 (SEQ ID NO:718), D301-EF10 (SEQ ID NO:719), D301-EG12 (SEQ JD NO:720), D302-AB8 (SEQ ID NO:721), D302-AB9 (SEQ ID NO:722), D302-AB12 (SEQ HD NO:723), and D302-AC1 (SEQ HD NO:724). Figure 173-25 is the nucleic acid sequence of D302-AC5 (SEQ DD NO:725), D302-AC6 (SEQ DD NO:726), D302-AC7 (SEQ DD NO:727), D302-AC12 (SEQ DD NO:728), D302-AD4 (SEQ DD NO:729), D302-AD7 (SEQ DD NO:730), and D302- AE7 (SEQ DD NO:731). Figure 173-26 is the nucleic acid sequence of D302-AF6 (SEQ DD NO:732), D302-AF8 (SEQ ID NO:733), D302-AG2 (SEQ DD NO:734), D302-AH10 (SEQ JD NO:735), D302-BA2 (SEQ JD NO:736), D302-BA6 (SEQ ID NO:737), D302-BC3 (SEQ ID NO:738), and D302-BC6 (SEQ ED NO:739). Figure 173-27 is the nucleic acid sequence of D302-BC9 (SEQ ED NO:740), D302-BD3 (SEQ ED NO:741), D302-BD7 (SEQ DD NO:742), D302-BD9 (SEQ JD NO:743), D302-BE1 (SEQ JD NO:744), and D302-BE2 (SEQ JD NO:745). Figure 173-28 is the nucleic acid sequence of D302-BE6 (SEQ ED NO:746),

D302-BE7 (SEQ JD NO:747), D302-BF1 (SEQ ED NO:748), D302-BF5 (SEQ ED NO:749), D302-BG1 (SEQ DD NO:750), D302-bg3 (SEQ DD NO:751), and D302- BG7 (SEQ DD NO:752). Figure 173-29 is the nucleic acid sequence of D302-Bg9 (SEQ DD NO:753), D302-BH1 (SEQ DD NO:754), D302-bh9 (SEQ JD NO:755), D302-CA5 (SEQ H NO:756), D302-CB7 (SEQ ID NO:757), D302-CC1 (SEQ ID NO:758), D302-CC3 (SEQ ED NO:759), and D302-CD2 (SEQ JD NO:760). Figure 173-30 is the nucleic acid sequence of D302-CE3 (SEQ ID NO:761), D302-CE9 (SEQ DD NO:762), D302-CF2 (SEQ ID NO:763), D302-CF5 (SEQ ID NO:764), D302-CF6 (SEQ ED NO:765), D302-CH1 (SEQ ED NO:766), and D302- CH4 (SEQ ED NO:767). Figure 173-31 is the nucleic acid sequence of D302-CH5 (SEQ DD NO:768), D302-CH6 (SEQ DD NO:769), D302-DA2 (SEQ DD NO:770), D302-DA5 (SEQ DD NO-.771), D302-DA9 (SEQ DD NO:772), D302-DC4 (SEQ DD NO:773), and D302- DC7 (SEQ DD NO:774). Figure 173-32 is the nucleic acid sequence of D302-DC8 (SEQ DD NO:775),

D302-DC11 (SEQ DD NO:776), D302-DD3 (SEQ DD NO:777), D302-DF5 (SEQ ED NO:778), D302-DF7 (SEQ ID NO:779), D302-DG9 (SEQ JD NO:780), and D302- DH8 (SEQ ED NO:781). Figure 173-33 is the nucleic acid sequence of D303-AA9 (SEQ DD NO:782), D303-AA10 (SEQ DD NO:783), D303-AB11 (SEQ ED NO:784), D303-AC4 (SEQ ED NO:785), D303-AD3 (SEQ DD NO:786), D303-AD11 (SEQ JD NO:787), D303-AE1 (SEQ ID NO:788), and D303-ae2 (SEQ JD NO:789). Figure 173-34 is the nucleic acid sequence of D303-ae6 (SEQ ED NO:790), D303-AF5 (SEQ HD NO:791), D303-AF12 (SEQ ID NO:792), D303-AG1 (SEQ ED NO:793), D303-AG8 (SEQ DD NO:794), D303-AG9 (SEQ DD NO:795), D303-AH5 (SEQ DD NO:796), and D303-BA1 (SEQ DD NO:797). Figure 173-35 is the nucleic acid sequence of D303-BA5 (SEQ DD NO:798), D303-BB6 (SEQ DD NO:799), D303-BC1 (SEQ DD NO:800), D303-BC2 (SEQ DD NO:801), D303-BC8 (SEQ DD NO:802), D303-BC11 (SEQ DD NO:803), D303-bd2 (SEQ DD NO:804), and D303-BD6 (SEQ DD NO:805). Figure 173-36 is the nucleic acid sequence of D303-BD9 (SEQ ED NO:806), D303-BE3 (SEQ ED NO:807), D303-BE4 (SEQ ID NO:808), D303-BE7 (SEQ ED NO:809), D303-BF1 (SEQ ED NO:810), D303-BF6 (SEQ JD NO:811), D303-BG2 (SEQ πD NO:812), and D303-BGll (SEQ DD NO:813). Figure 173-37 is the nucleic acid sequence of D303-BH1 (SEQ ID NO:814),

D303-BH6 (SEQ JD NO:815), D414-AG2 (SEQ ID NO:816), D35-33 (SEQ ID NO:817), D35-34 (SEQ JD NO:818), and D35-35 (SEQ DD NO:819). Figure 173-38 is the nucleic acid sequence of D35-41 (SEQ ID NO:820), D35-43 (SEQ ID NO:821), D35-51 (SEQ ED NO:822), and D35-AC4 (SEQ ED NO:823). Figure 173-39 is the nucleic acid sequence of D35-AC12 (SEQ ED NO:824), D35-AE2 (SEQ DD NO:825), D35-AE6 (SEQ DD NO:826), D35-AF1 (SEQ DD NO:827), D35-AF3 (SEQ DD NO:828), and D35-AG3 (SEQ DD NO:829). Figure 173-40 is the nucleic acid sequence of D35-BA5 (SEQ DD NO:830), D35-BA12 (SEQ ED NO:831), D35-BB1 (SEQ DD NO:832), D35-BB3 (SEQ DD NO:833), and D35-BB10 (SEQ DD NO:834). Figure 173-41 is the nucleic acid sequence of D35-BB12 (SEQ DD NO:835), D55-AA8 (SEQ DD NO:836), D55-AB1 (SEQ DD NO:837), D55-AB5 (SEQ DD NO:838), and D55-AB6 (SEQ ED NO:839). Figure 173-42 is the nucleic acid sequence of D55-AB7 (SEQ DD NO:840),

D55-AB10 (SEQ DD NO:841), D55-AA2 (SEQ DD NO:842), D55-AC2 (SEQ DD NO:843), and D55-AC5 (SEQ ED NO:844). Figure 173-43 is the nucleic acid sequence of D55-AC7 (SEQ DD NO:845), D55-BA7 (SEQ ED NO:846), D55-BA8 (SEQ ED NO:847), D55-BA10 (SEQ DD NO:848), D55-BA11 (SEQ DD NO:849), and D55-BB9 (SEQ DD NO:850). Figure 173-44 is the nucleic acid sequence of D55-BB10 (SEQ DD NO:851), D55-BB12 (SEQ DD NO:852), D55-BC4 (SEQ DD NO:853), D55-BC5 (SEQ ED NO:854), D55-AA6 (SEQ DD NO:855), and D56-AE5 (SEQ DD NO:856). Figure 173-45 is the nucleic acid sequence of D56-AA2 (SEQ DD NO:857), D56-AA4 (SEQ DD NO:858), D56-AA8 (SEQ DD NO:859), D56-AA9 (SEQ DD NO:860), D56-AB1 (SEQ DD NO:861), and D56-AB7 (SEQ DD NO:862). Figure 173-46 is the nucleic acid sequence of D56-AB9 (SEQ DD NO:863), D56-AC9 (SEQ ED NO:864), D56-AD3 (SEQ JD NO:865), D56-AG8 (SEQ JD NO:866), and D56-AH1 (SEQ HD NO:867). Figure 173-47 is the nucleic acid sequence of D56-AH10 (SEQ ED NO:868),

D56-AE2 (SEQ ED NO:869), D57-AB2 (SEQ DD NO:870), D57-AB5 (SEQ DD NO:871), and D57-AB6 (SEQ DD NO:872). Figure 173-48 is the nucleic acid sequence of D57-AB8 (SEQ DD NO:873), D57-AB11 (SEQ DD NO:874), D57-AB12 (SEQ DD NO:875), D57-AC1 (SEQ DD NO:876), D57-AC4 (SEQ ED NO:877), and D57-AC12 (SEQ DD NO:878). Figure 173-49 is the nucleic acid sequence of D57-AD5 (SEQ ID NO:879), D57-AD8 (SEQ DD NO:880), D57-AD9 (SEQ DD NO:881), D57-AE1 (SEQ DD NO:882), D57-AE2 (SEQ DD NO:883), and D57-AE7 (SEQ DD NO:884). Figure 173-50 is the nucleic acid sequence of D57-AF2 (SEQ ED NO:885), D57-AE12 (SEQ ED NO:886), D57-AF3 (SEQ DD NO:887), D57-AF5 (SEQ DD NO:888), and D57-AF9 (SEQ DD NO:889). Figure 173-51 is the nucleic acid sequence of D57-AG5 (SEQ DD NO:890), D57-AG7 (SEQ DD NO:891), D57-AG11 (SEQ DD NO:892), and D57-AH10 (SEQ DD NO:893). Figure 173-52 is the nucleic acid sequence of D58-AA3 (SEQ DD NO:894),

D58-AA5 (SEQ DD NO:895), D58-AB3 (SEQ DD NO:896), D58-AB5 (SEQ DD NO:897), and D58-AC1 (SEQ DD NO:898). Figure 173-53 is the nucleic acid sequence of D58-AC9 (SEQ DD NO:899), D58-AC11 (SEQ ID NO:900), D58-AD2 (SEQ ID NO:901), andD58-AD5 (SEQ DD NO:902). Figure 173-54 is the nucleic acid sequence of D58-AD7 (SEQ DD NO: 903), D58-AD8 (SEQ ED NO:904), D58-AD10 (SEQ JD NO:905), D58-AE1 (SEQ HD NO:906), and D58-AE2 (SEQ DD NO:907). Figure 173-55 is the nucleic acid sequence of D58-AE5 (SEQ DD NO:908), D58-AE9 (SEQ ID NO:909), D58-AE10 (SEQ JD NO:910), D58-AE11 (SEQ HD NO:911), and D58-AF3 (SEQ ED NO:912). Figure 173-56 is the nucleic acid sequence of D58-AF6 (SEQ DD NO:913), D58-AH4 (SEQ DD NO:914), D58-AH7 (SEQ DD NO:915), D58-AH9 (SEQ DD NO:916), and D58-AH10 (SEQ DD NO:917). Figure 173-57 is the nucleic acid sequence of D58-BA5 (SEQ DD NO:918),

D58-BA7 (SEQ DD NO:919), D58-BB7 (SEQ DD NO:920), D58-BC5 (SEQ ED NO:921), D58-BD3 (SEQ DD NO:922), and D58-BD7 (SEQ DD NO:923). Figure 173-58 is the nucleic acid sequence of D58-BD8 (SEQ DD NO:924), D58-BD10 (SEQ DD NO:925), D58-BE2 (SEQ DD NO:926), D58-BE11 (SEQ DD NO:927), and D58-BF1 (SEQ DD NO:928). Figure 173-59 is the nucleic acid sequence of D58-BF2 (SEQ DD NO:929), D58-BG3 (SEQ JD NO:930), D58-BG5 (SEQ DD NO:931), D58-BG8 (SEQ JD NO:932), D58-BG10 (SEQ JD NO:933), and D58-BG12 (SEQ ED NO:934). Figure 173-60 is the nucleic acid sequence of D58-BH10 (SEQ DD NO: 935), D58-BH8 (SEQ ID NO:936), D58-BH2 (SEQ ID NO:937), D60-AA1 (SEQ DD NO:938), D60-AA2 (SEQ DD NO:939), and D60-AA3 (SEQ DD NO:940). Figure 173-61 is the nucleic acid sequence of D60-AA5 (SEQ DD NO:941), D60-AA6 (SEQ DD NO:942), D60-AA7 (SEQ HD NO:943), D60-AA8 (SEQ JD NO:944), D60-AA10 (SEQ ED NO:945), and D60-AA11 (SEQ ED NO:946). Figure 173-62 is the nucleic acid sequence of D60-AA12 (SEQ ED NO:947),

D60-AB3 (SEQ ID NO:948), D60-AB5 (SEQ DD NO:949), D60-AB6 (SEQ DD NO:950), D60-AB7 (SEQ DD NO:951), and D60-AB8 (SEQ ED NO:952). Figure 173-63 is the nucleic acid sequence of D60-AB11 (SEQ DD NO:953), D60-AC3 (SEQ DD NO:954), D60-AC5 (SEQ DD NO:955), D60-AC7 (SEQ DD NO:956), D60-AC8 (SEQ DD NO:957), and D60-AC11 (SEQ DD NO:958). Figure 173-64 is the nucleic acid sequence of D60-AC12 (SEQ HD NO:959), D60-AD3 (SEQ ID NO:960), D60-AD4 (SEQ ED NO:961), D60-AD5 (SEQ HD NO:962), D60-AD7 (SEQ ED NO:963), and D60-AE1 (SEQ DD NO:964). Figure 173-65 is the nucleic acid sequence of D60-AE4 (SEQ ED NO:965), D60-AE6 (SEQ ID NO:966), D60-AE8 (SEQ DD NO:967), D60-AE12 (SEQ DD NO:968), D60-AF5 (SEQ JD NO:969), and D60-AF8 (SEQ JD NO:970). Figure 173-66 is the nucleic acid sequence of D60-AF11 (SEQ DD NO:971), D60-AG1 (SEQ DD NO:972), D60-AG10 (SEQ ED NO:973), D60-AG12 (SEQ DD NO:974), D60-AH1 (SEQ ED NO:975), and D60-AH5 (SEQ ED NO:976). Figure 173-67 is the nucleic acid sequence of D60-AH6 (SEQ DD NO:977),

D60-AH9 (SEQ DD NO:978), D60-AH10 (SEQ DD NO:979), D60-AH11 (SEQ DD NO:980), and D63-AA12 (SEQ DD NO:981). Figure 173-68 is the nucleic acid sequence of D64-4 (SEQ DD NO:982), D64- AB4 (SEQ DD NO:983), D64-AB10 (SEQ ED NO:984), D65-AA6 (SEQ DD NO:985), and D65-AA7 (SEQ DD NO:986). Figure 173-69 is the nucleic acid sequence of D65-AA9 (SEQ JD NO:987), D65-AB4 (SEQ ED NO:988), D65-AB5 (SEQ DD NO:989), D65-AB8 (SEQ HD NO:990), D65-AB9 (SEQ DD NO:991), and D65-AB11 (SEQ DD NO:992). Figure 173-70 is the nucleic acid sequence of D65-AC1 (SEQ DD NO:993), D65-AC6 (SEQ DD NO:994), D65-AC10 (SEQ DD NO:995), D65-AC11 (SEQ ED NO:996), D65-AD3 (SEQ DD NO:997), and D65-AE1 (SEQ DD NO:998). Figure 173-71 is the nucleic acid sequence of D65-AE2 (SEQ JD NO:999), D65-AE10 (SEQ ED NO: 1000), D65-AE11 (SEQ ID NO: 1001), D65-AE12 (SEQ DD NO: 1002), D65-AF1 (SEQ HD NO: 1003), and D65-AF5 (SEQ JD NO: 1004). Figure 173-72 is the nucleic acid sequence of D65-AF7 (SEQ DD NO: 1005),

D65-AG11 (SEQ DD NO:1006), D65-CE1 (SEQ ED NO:1007), D65-CE2 (SEQ DD NO: 1008), D65-CE7 (SEQ DD NO: 1009), and D65-CE9 (SEQ DD NO: 1010). Figure 173-73 is the nucleic acid sequence of D65-CE12 (SEQ DD NO: 1011), D65-CF3 (SEQ DD NO:1012), D65-CF10 (SEQ DD NO:1013), D65-CF12 (SEQ DD NO:1014), D65-CG2 (SEQ DD NO:1015), D65-CG5 (SEQ DD NO:1016), and D65- CH3 (SEQ πD NO:1017). Figure 173-74 is the nucleic acid sequence of D65-CH4 (SEQ DD NO: 1018), D65-CH6 (SEQ ED NO: 1019), D65-CH8 (SEQ DD NO: 1020), D65-CH9 (SEQ DD NO: 1021), D65-CH11 (SEQ DD NO: 1022), and D65-CH12 (SEQ DD NO: 1023). Figure 173-75 is the nucleic acid sequence of D66-AA4 (SEQ ED NO: 1024),

D66-AA5 (SEQ DD NO: 1025), D66-AA6 (SEQ DD NO: 1026), D66-AA9 (SEQ ED NO: 1027), and D66-AB5 (SEQ DD NO: 1028). Figure 173-76 is the nucleic acid sequence of D66-AB1 (SEQ DD NO:1029), D66-AB7 (SEQ DD NO:1030), D66-AC1 (SEQ DD NO:1031), D66-AC2 (SEQ ED NO:1032), and D66-AC4 (SEQ DD NO:1033). Figure 173-77 is the nucleic acid sequence of D66-AC7 (SEQ HD NO: 1034), D66-AD1 (SEQ DD NO:1035), D66-AD3 (SEQ DD NO:1036), and D66-AD6 (SEQ DD NO: 1037). Figure 173-78 is the nucleic acid sequence of D66-AD8 (SEQ DD NO: 1038), D66-AE1 (SEQ ED NO: 1039), D66-AE3 (SEQ ED NO: 1040), D66-AE6 (SEQ JD NO:1041), D66-AE8 (SEQ HD NO:1042), and D66-AF3 (SEQ DD NO:2263). Figure 173-79 is the nucleic acid sequence of D66-AF5 (SEQ DD NO: 1043), D66-AF8 (SEQ DD NO:1044), D66-AF9 (SEQ ED NO:1045), and D66-AG1 (SEQ DD NO: 1046). Figure 173-80 is the nucleic acid sequence of D66-AG4 (SEQ DD NO: 1047), D66-AG5 (SEQ ED NO:1048), D66-AH4 (SEQ ED NO:1049), D66-AH5 (SEQ DD NO: 1050), D66-AH7 (SEQ HD NO: 1051), and D66-AH8 (SEQ HD NO: 1052). Figure 173-81 is the nucleic acid sequence of D66-AH9 (SEQ HD NO: 1053), D66-BA3 (SEQ HD NO:1054), D66-BA8 (SEQ ID NO:1055), and D66-BB1 (SEQ ED NO:1056). Figure 173-82 is the nucleic acid sequence of D66-BB2 (SEQ ID NO:1057),

D66-BB3 (SEQ HD NO:1058), D66-BB5 (SEQ HD NO:1059), and D66-BB7 (SEQ DD NO: 1060). Figure 173-83 is the nucleic acid sequence of D66-BB9 (SEQ DD NO: 1061), D66-BB10 (SEQ DD NO: 1062), D66-BC6 (SEQ DD NO: 1063), D66-BD1 (SEQ JD NO: 1064), and D66-BD2 (SEQ DD NO:1065). Figure 173-84 is the nucleic acid sequence of D66-BD9 (SEQ DD NO: 1066), D67-AA2 (SEQ DD NO:1067), D67-AA3 (SEQ DD NO:1068), D67-AB1 (SEQ DD NO:1069), and D67-AC5 (SEQ DD NO:1070). Figure 173-85 is the nucleic acid sequence of D67-AD1 (SEQ DD NO:1071), D67-AD4 (SEQ DD NO:1072), D67-AD6 (SEQ ID NO:1073), D67-AE2 (SEQ ID NO:1074), and D67-AE6 (SEQ DD NO:1075). Figure 173-86 is the nucleic acid sequence of D67-AF6 (SEQ DD NO:1076), D67-AG1 (SEQ DD NO:1077), D67-AG3 (SEQ DD NO:1078), D67-AG5 (SEQ HD NO:1079), and D67-AG6 (SEQ JD NO:1080). Figure 173-87 is the nucleic acid sequence of D69-AA5 (SEQ DD NO: 1081),

D69-AB1 (SEQ DD NO:1082), D69-AB8 (SEQ DD NO:1083), D69-AB9 (SEQ DD NO:1084), and D69-AC4 (SEQ ID NO:1085). Figure 173-88 is the nucleic acid sequence of D70A-AB10 (SEQ ED NO:1086), D70A-AC2 (SEQ ED NO:1087), D70A-AC3 (SEQ DD NO:1088), D70A- AD3 (SEQ DD NO:1089), D70A-AD5 (SEQ DD NO:1090), and D70A-AD6 (SEQ DD NO:1091). Figure 173-89 is the nucleic acid sequence of D70A-AD11 (SEQ DD NO:1092), D70A-AE10 (SEQ JD NO:1093), D70A-AF6 (SEQ ED NO:1094), D70A- AF8 (SEQ DD NO:1095), D70A-AF10 (SEQ DD NO:1096), D70A-AH5 (SEQ DD NO: 1097), and D70A-AH8 (SEQ DD NO: 1098). Figure 173-90 is the nucleic acid sequence of D70A-BA3 (SEQ DD NO:1099),

D70A-BA6 (SEQ JD NO: 1100), D70A-BA10 (SEQ HD NO: 1101), D70A-BB8 (SEQ πD NO:1102), and D70A-BBl l (SEQ ID NO:1103). Figure 173-91 is the nucleic acid sequence of D70A-BC7 (SEQ ID NO: 1104), D70A-BD8 (SEQ ID NO: 1105), D70A-BE1 (SEQ JD NO: 1106), D70A-BE5 (SEQ ED NO:1107), D70A-BE6 (SEQ ID NO: 1108), and D70A-BE8 (SEQ HD NO: 1109). Figure 173-92 is the nucleic acid sequence of D70A-BF2 (SEQ ID NO: 1110), D70A-BF3 (SEQ ID NO:lll l), D70A-BF10 (SEQ ED NO:1112), D70A-BG9 (SEQ DD NO:1113), D70A-BH8 (SEQ DD NO:1114), and D70-AE2 (SEQ DD NO:1115). Figure 173-93 is the nucleic acid sequence of D70-AE6 (SEQ ED NO: 1116), D70-AF3 (SEQ JD NO:1117), D70-AG10 (SEQ DD NO:1118), D70-AH7 (SEQ DD NO:1119), D70-BE6 (SEQ ΠD NO: 1120), and D70-BE7 (SEQ ID NO:1121). Figure 173-94 is the nucleic acid sequence of D70A-BC12 (SEQ ED NO: 1122), D72-AB2 (SEQ DD NO: 1123), D72-AB6 (SEQ ED NO: 1124), D73A- AA12 (SEQ HD NO: 1125), and D73 A-AB4 (SEQ ID NO: 1126). Figure 173-95 is the nucleic acid sequence of D73A-AB9 (SEQ JD NO: 1127),

D73A-AB11 (SEQ ID NO:1128), D73A-ACl (SEQ ED NO: 1129), D73A-AC3 (SEQ ED NO: 1130), and D73A-AC8 (SEQ ED NO: 1131). Figure 173-96 is the nucleic acid sequence of D73A-AD3 (SEQ JD NO: 1132), D73A-AE1 (SEQ HD NO:l 133), D73A-AE3 (SEQ ID NO: 1134), D73A-AE4 (SEQ πD NO:1135), D73A-AE5 (SEQ DD NO: 1136), and D73A-AE9 (SEQ ID NO:1137). Figure 173-97 is the nucleic acid sequence of D73A-AE10 (SEQ DD NO:1138), D73A-AF3 (SEQ DD NO:1139), D73A-AF4 (SEQ DD NO:1140), D73A- AF7 (SEQ ED NO: 1141), D73 A-AF8 (SEQ ID NO: 1142), and D73 A-AG11 (SEQ DD NO: 1143). Figure 173-98 is the nucleic acid sequence of D73A-AH1 (SEQ DD NO: 1144), D73A-AH5 (SEQ ID NO: 1145), D73A-AH9 (SEQ DD NO: 1146), D73A-AH12 (SEQ DD NO:1147), D73A-BA9 (SEQ DD NO:1148), and D73A-BB3 (SEQ DD NO:1149). Figure 173-99 is the nucleic acid sequence of D73A-BB9 (SEQ DD NO: 1150), D73A-BE1 (SEQ DD NO: 1151), D73A-BF3 (SEQ DD NO: 1152), D73A-BG1 (SEQ DD NO: 1153), and D73 A-BG3 (SEQ DD NO: 1154). Figure 173-100 is the nucleic acid sequence of D73A-BG5 (SEQ DD NO:1155), D73A-BH1 (SEQ DD NO:1156), D73-AC1 (SEQ DD NO:1157), D73-AD8 (SEQ DD NO: 1158), and D73-AD12 (SEQ ID NO: 1159). Figure 173-101 is the nucleic acid sequence of D80-AB2 (SEQ DD NO:1160),

D81-AA5 (SEQ DD NO:l 161), D81-AB4 (SEQ DD NO:1162), D81-AB6 (SEQ ED NO:1163), and D81-AC5 (SEQ DD NO: 1164). Figure 173-102 is the nucleic acid sequence of D82-AA8 (SEQ DD NO:l 165), D82-AC9 (SEQ DD NO: 1166), D82-AH9 (SEQ DD NO: 1167), and D83-AD10 (SEQ DD NO: 1168). Figure 173-103 is the nucleic acid sequence of D83-AG10 (SEQ DD NO:1169), D84-AD3 (SEQ DD NO:1170), D84-AE1 (SEQ HD NO:1171), D84-AF4 (SEQ HD NO: 1172), D84-AG1 (SEQ ID NO: 1173), and D87-AA1 (SEQ HD NO: 1174). Figure 173-104 is the nucleic acid sequence of D87-AA3 (SEQ DD NO:l 175),

D87A-AA1 (SEQ ED NO:1176), D87A-AB1 (SEQ DD NO:1177), D87A-AB3 (SEQ DD NO:1178), D87A-AC1 (SEQ DD NO:1179), and D87A-AC3 (SEQ DD NO:1180). Figure 173-105 is the nucleic acid sequence of D87A-AF2 (SEQ DD NO: 1181), D87A-AG1 (SEQ DD NO: 1182), D87A-AH1 (SEQ ED NO: 1183), D87A- AH3 (SEQ DD NO:1184), D87-AB2 (SEQ ED NO: 1185), and D88-AA10 (SEQ DD NO: 1186). Figure 173-106 is the nucleic acid sequence of D88-AB3 (SEQ HD NO:1187), D88-AB6 (SEQ ID NO: 1188), D88-AB7 (SEQ JD NO: 1189), D88-AB8 (SEQ JD NO:l 190), D88-AC5 (SEQ ID NO:l 191), and D88-AC9 (SEQ ED NO:l 192). Figure 173-107 is the nucleic acid sequence of D88-AD8 (SEQ DD NO: 1193), D88-AE5 (SEQ DD NO: 1194), D88-AE6 (SEQ ED NO:1195), D88-AE8 (SEQ DD NO:l 196), and D91-AA4 (SEQ ED NO:l 197). Figure 173-108 is the nucleic acid sequence of D92-AD9 (SEQ ED NO: 1198), D92-AE9 (SEQ DD NO: 1199), D92-AF8 (SEQ DD NO: 1200), D92-AG10 (SEQ DD NO: 1201), D92-AH9 (SEQ HD NO: 1202), and D93-AA1 (SEQ DD NO: 1203). Figure 173-109 is the nucleic acid sequence of D93-AA2 (SEQ ED NO: 1204), D93-AB1 (SEQ ED NO:1205), D93-AC3 (SEQ DD NO:1206), D93-AC4 (SEQ DD NO:1207), and D93-ADl (SEQ DD NO:1208). Figure 173-110 is the nucleic acid sequence of D93-AE3 (SEQ ID NO: 1209),

D93-AE4 (SEQ ID NO: 1210), D93-AF3 (SEQ ID NO: 1211), D93-AG1 (SEQ JD NO:1212), D93-AH2 (SEQ E NO:1213), and D93-AH3 (SEQ DD NO:1214). Figure 173-111 is the nucleic acid sequence of D93-AH4 (SEQ ID NO: 1215), D93-BA10 (SEQ DD NO:1216), D93-BA12 (SEQ ED NO:1217), D93-BD11 (SEQ DD NO:1218), D93-BEl l (SEQ ID NO:1219), and D93-BF12 (SEQ HD NO: 1220). Figure 173-112 is the nucleic acid sequence of D94-AA2 (SEQ ED NO: 1221), D94-AA3 (SEQ ID NO: 1222), D94-AB1 (SEQ HD NO: 1223), D94-AB2 (SEQ ID NO: 1224), and D94-AC3 (SEQ DD NO: 1225). Figure 173-113 is the nucleic acid sequence of D94-AD1 (SEQ DD NO:1226), D94-AE1 (SEQ DD NO: 1227), D94-AE3 (SEQ DD NO: 1228), D94-AG2 (SEQ ID NO: 1229), and D94-AH1 (SEQ HD NO: 1230). Figure 173-114 is the nucleic acid sequence of D94-AH2 (SEQ DD NO: 1231), D94-AH3 (SEQ DD NO: 1232), D95-AC1 (SEQ DD NO: 1233), D95-AD2 (SEQ D NO: 1234), D96-AA3 (SEQ ED NO: 1235), and D96-AA4 (SEQ DD NO: 1236). Figure 173-115 is the nucleic acid sequence of D96-AA7 (SEQ DD NO:1237),

D96-AB7 (SEQ ED NO:2264), D96-AC5 (SEQ ED NO:1238), D96-AC6 (SEQ DD NO: 1239), and D96-AD6 (SEQ DD NO: 1240). Figure 173-116 is the nucleic acid sequence of D96-AE6 (SEQ DD NO:1241), D96-AG3 (SEQ DD NO: 1242), D96-AH8 (SEQ DD NO: 1243), D97-AA1 (SEQ DD NO:1244), D97-AB1 (SEQ DD NO:1245), and D97-AB3 (SEQ DD NO:1246). Figure 173-117 is the nucleic acid sequence of D97-AD1 (SEQ DD NO: 1247), D97-AD2 (SEQ DD NO: 1248), D97-AD4 (SEQ DD NO: 1249), D97-AE1 (SEQ DD NO: 1250), and D97-AE2 (SEQ DD NO: 1251). Figure 173-118 is the nucleic acid sequence of D97-AE4 (SEQ ED NO: 1252), D97-AF3 (SEQ ED NO: 1253), D97-AG2 (SEQ ID NO: 1254), D97-AG3 (SEQ HD NO: 1255), and D97-AH1 (SEQ HD NO: 1256). Figure 173-119 is the nucleic acid sequence of D97-AH2 (SEQ ED NO: 1257), D97-AH4 (SEQ HD NO: 1258), D98-AB2 (SEQ JD NO: 1259), D98-AE3 (SEQ ID NO:1260), and D98-AFl (SEQ ID NO: 1261). Figure 173-120 is the nucleic acid sequence of D98-AH2 (SEQ JD NO: 1262),

D99-AC5 (SEQ JD NO: 1263), D99-AC8 (SEQ DD NO: 1264), D99-AD2 (SEQ DD NO: 1265), D99-AD3 (SEQ DD NO: 1266), and D99-AD4 (SEQ ED NO: 1267). Figure 173-121 is the nucleic acid sequence of D99-AD6 (SEQ DD NO: 1268), D99-AE1 (SEQ DD NO: 1269), D99-AE5 (SEQ DD NO: 1270), D99-AE6 (SEQ DD NO:1271), D99-AE7 (SEQ DD NO:1272), and D99-AE8 (SEQ DD NO:1273). Figure 173-122 is the nucleic acid sequence of D99-AF1 (SEQ DD NO: 1274), D99-AF5 (SEQ ED NO: 1275), D99-AF7 (SEQ JD NO: 1276), D99-AG2 (SEQ ED NO: 1277), D99-AG4 (SEQ JD NO: 1278), D99-AG7 (SEQ ED NO: 1279), and D99- AH2 (SEQ ΠD NO: 1280). Figure 173-123 is the nucleic acid sequence of D99-AH10 (SEQ DD

NO:1281), D99-DA3 (SEQ DD NO:1282), D99-DB5 (SEQ DD NO:1283), D99-DC2 (SEQ DD NO: 1284), and D99-DC3 (SEQ DD NO: 1285). Figure 173-124 is the nucleic acid sequence of D99-DD5 (SEQ DD NO:1286), D99-DG4 (SEQ ED NO:1287), D100A-AA4 (SEQ DD NO:1288), and D101-BG2 (SEQ ED NO: 1289). Figure 173-125 is the nucleic acid sequence of D101A-AC2 (SEQ DD NO: 1290), D101A-AD1 (SEQ DD NO: 1291), D101A-AD2 (SEQ DD NO: 1292), D101A-AE1 (SEQ ED NO:1293), and D101A-AF1 (SEQ DD NO:1294). Figure 173-126 is the nucleic acid sequence of DIOIC-AAI (SEQ DD NO:1295), D101C-AB1 (SEQ ED NO: 1296), D101C-AC1 (SEQ DD NO: 1297), D101C-AD3 (SEQ DD NO:1298), and D101C-BD12 (SEQ ED NO:1299). Figure 173-127 is the nucleic acid sequence of D101C-BE12 (SEQ DD NO:1300), D101C-BF12 (SEQ ED NO:1301), D101C-BG12 (SEQ HD NO:1302), and D101D-AB6 (SEQ DD NO:1303). Figure 173-128 is the nucleic acid sequence of D101D-AC5 (SEQ DD NO:1304), D101D-AG5 (SEQ ED NO:1305), D101D-AG6 (SEQ DD NO:1306), D101D-AH4 (SEQ DD NO:1307), and D101D-AH6 (SEQ ED NO:1308). Figure 173-129 is the nucleic acid sequence of D101D-BB11 (SEQ DD NO:1309), D101D-BD11 (SEQ DD NO:1310), D107-AA3 (SEQ ΠD NO:1311), D107- AB2 (SEQ ED NO: 1312), D107-AC2 (SEQ ED NO: 1313), and D107-AC3 (SEQ DD NO: 1314). Figure 173-130 is the nucleic acid sequence of D107-AD2 (SEQ ED NO: 1315), D107-AD3 (SEQ ED NO:1316), D107-AF1 (SEQ ED NO:1317), D107- AH1 (SEQ ED NO: 1318), D108-AA6 (SEQ JD NO:1319), and D108-AB4 (SEQ HD NO: 1320). Figure 173-131 is the nucleic acid sequence of D108-AB5 (SEQ DD

NO:1321), D108-AC6 (SEQ ED NO:1322), D108-AD6 (SEQ ED NO:1323), D108- AF6 (SEQ HD NO:1324), D109=AA7 (SEQ JD NO:1325), and D109-AA8 (SEQ ED NO: 1326). — "^" Figure 173-132 is the nucleic acid sequence of D109-AA9 (SEQ ED NO: 1327), D109-AB8 (SEQ ED NO: 1328), D109-AC7 (SEQ ED NO: 1329), D109- AC8 (SEQ ED NO:1330), D109-AC9 (SEQ ED NO:1331), and D109-AE7 (SEQ ED NO: 1332). Figure 173-133 is the nucleic acid sequence of D109-AF9 (SEQ ID NO:1333), D109-AH7 (SEQ ED NO:1334), D110-AB11 (SEQ ED NO:1335), D110- AF10 (SEQ DD NO:1336), Dl ll-AA2 (SEQ DD NO:1337), and Dll l-ABl (SEQ DD NO:1338). Figure 173-134 is the nucleic acid sequence of D111-AB3 (SEQ ED NO: 1339), D111-AC3 (SEQ ED NO: 1340), D111-AD1 (SEQ ED NO: 1341), Dlll- AF1 (SEQ ED NO:1342), and D111-AG3 (SEQ DD NO:1343). Figure 173-135 is the nucleic acid sequence of Dl 11-AH1 (SEQ ED NO:1344), D111-AH2 (SEQ ED NO: 1345), D112-AD6 (SEQ ED NO: 1346), D112- AE6 (SEQ ED NO: 1347), and D112-AF5 (SEQ ED NO: 1348). Figure 173-136 is the nucleic acid sequence of Dl 12-AG5 (SEQ ED NO:1349), D112-AH4 (SEQ ED NO:1350), D113-AA9 (SEQ ED NO:1351), D113A- AC3 (SEQ ED NO: 1352), and D113A-ADl (SEQ ED NO: 1353). Figure 173-137 is the nucleic acid sequence of Dl 13A-AD3 (SEQ ED NO: 1354), D113A-AF3 (SEQ ED NO: 1355), D113A-AG2 (SEQ ED NO: 1356), Dl 13A-AH2 (SEQ JD NO:1357), Dl 13-AB9 (SEQ ED NO:1358), and Dl 13-AC7 (SEQ HD NO: 1359). Figure 173-138 is the nucleic acid sequence of Dl 13-AD8 (SEQ ED NO: 1360), D113-AD9 (SEQ ED NO: 1361), D113-AE7 (SEQ ΠD NO: 1362), D113- AF8 (SEQ HD NO:1363), and Dl 13-AF9 (SEQ ED NO:1364). Figure 173-139 is the nucleic acid sequence of Dl 13-AG7 (SEQ ID NO:1365), D113-AG9 (SEQ ED NO:1366), D114-AE10 (SEQ DD NO: 1367), D114- AF11 (SEQ ED NO: 1368), and D115-AA6 (SEQ ED NO: 1369). Figure 173-140 is the nucleic acid sequence of D133-AA7 (SEQ ID NO:1370), D133-AE8 (SEQ ID NO:1371), D133-AF9 (SEQ ED NO:1372), D133- AG8 (SEQ DD NO:1373), D138-AD10 (SEQ ED NO:1374), and D139-AD1 (SEQ DD NO: 1375). Figure 173-141 is the nucleic acid sequence of D140-AA4 (SEQ ED NO:1376), D140-AD4 (SEQ ED NO:1377), D140-AF4 (SEQ ED NO:1378), D141- AA7 (SEQ ED NO: 1379), D141-AB7 (SEQ ID NO: 1380), and D142-AB11 (SEQ DD NO:1381). Figure 173-142 is the nucleic acid sequence of D142-AC10 (SEQ ED

NO:1382), D142-AE10 (SEQ ED NO:1383), D142-AE11 (SEQ ED NO:1384), D142- AF10 (SEQ ED NO:1385), D144-AA1 (SEQ ED NO:1386), and D144A-AA9 (SEQ ED NO:1387). Figure 173-143 is the nucleic acid sequence of D144A-AB12 (SEQ ED NO:1388), D144A-AC9 (SEQ JD NO:1389), D144A-AC10 (SEQ DD NO:1390), D144A-AD12 (SEQ DD NO:1391), D144A-AE12 (SEQ ED NO:1392), and D144A- AF11 (SEQ ΠD NO:1393). Figure 173-144 is the nucleic acid sequence of D144A-AF12 (SEQ ED

NO:1394), D144A-AG11 (SEQ ED NO:1395), D144A-AH9 (SEQ DD NO:1396), D144A-AH11 (SEQ ED NO:1397), and D144-AE4 (SEQ DD NO:1398). Figure 173-145 is the nucleic acid sequence of D144-AH3 (SEQ ED NO:1399), D145-AA8 (SEQ ED NO:1400), D145-AC10 (SEQ ED NO:1401), D145- AD7 (SEQ ED NO:1402), D145-AD9 (SEQ ED NO:1403), and D145-AD10 (SEQ ED NO: 1404). Figure 173-146 is the nucleic acid sequence of D145-AE7 (SEQ ED NO:1405), D145-AF7 (SEQ ID NO:1406), D145-AF8 (SEQ ED NO:1407), D145- AG8 (SEQ DD NO:1408), D145-AG9 (SEQ ID NO:1409), and D145-AG10 (SEQ ED NO:1410). Figure 173-147 is the nucleic acid sequence of D145-AH9 (SEQ ED NO:1411), D146-BB2 (SEQ ED NO:1412), D146-BC1 (SEQ ED NO:1413), D146- BD1 (SEQ ED NO: 1414), and D146-BD2 (SEQ ED NO: 1415). Figure 173-148 is the nucleic acid sequence of D146-BF2 (SEQ ED NO: 1416), D147-AE2 (SEQ DD NO:1417), D150-AA2 (SEQ DD NO:1418), D150-AC2 (SEQ ED NO:1419), and D150-ADl (SEQ D NO:1420). Figure 173-149 is the nucleic acid sequence of D151-AA1 (SEQ ED NO: 1421), D152-AA2 (SEQ ED NO: 1422), D152-AB2 (SEQ ED NO: 1423), D152- AC1 (SEQ ED NO: 1424), D152-AD2 (SEQ ED NO: 1425), and D152-AG2 (SEQ ED NO: 1426). Figure 173-150 is the nucleic acid sequence of D152-AH2 (SEQ ED NO:1427), D153-AA7 (SEQ DD NO:1428), D153-AB2 (SEQ ED NO:1429), D153- AF2 (SEQ ED NO:1430), D153-AF7 (SEQ ID NO:1431), and D153-AF9 (SEQ ED NO: 1432). Figure 173-151 is the nucleic acid sequence of D153-AG6 (SEQ ED NO:1433), D153-AG7 (SEQ ED NO:1434), D153-AG9 (SEQ ED NO:1435), D153- AH6 (SEQ ED NO: 1436), and D153-AH9 (SEQ ED NO: 1437). Figure 173-152 is the nucleic acid sequence of D154-AC2 (SEQ ED NO:1438), D154-AE9 (SEQ ED NO:1439), D155-AB1 (SEQ ED NO:1440), D155- AC1 (SEQ ED NO:1441), and D155-AC2 (SEQ DD NO:1442). Figure 173-153 is the nucleic acid sequence of D155-AE1 (SEQ ED NO:1443), D155-AE2 (SEQ ED NO:1444), D155-AF1 (SEQ ED NO:1445), D155- AF2 (SEQ ED NO: 1446), and D155-AH2 (SEQ ED NO: 1447). Figure 173-154 is the nucleic acid sequence of D156-AB1 (SEQ ED

NO:1448), D156-AC3 (SEQ DD NO:1449), D156-AC4 (SEQ ED NO:1450), D156- AD3 (SEQ ED NO:1451), and D156-AF2 (SEQ ED NO:1452). Figure 173-155 is the nucleic acid sequence of D156-AF4 (SEQ ED NO:1453), D156-AG1 (SEQ HD NO:1454), D156-AG2 (SEQ ED NO:1455), D156- AG4 (SEQ ED NO:1456), and D156-AH1 (SEQ ED NO:1457). Figure 173-156 is the nucleic acid sequence of D157-AG4 (SEQ ED NO:1458), D158-AB8 (SEQ ED NO:1459), D158-AD5 (SEQ ED NO:1460), D158- AD6 (SEQ ED NO: 1461), and D158-AD8 (SEQ ED NO: 1462). Figure 173-157 is the nucleic acid sequence of D158-AE8 (SEQ ED NO:1463), D159-AD2 (SEQ ED NO:1464), D160-AB4 (SEQ ED NO:1465), D160- AC4 (SEQ HD NO: 1466), and D160-AE4 (SEQ ED NO: 1467). Figure 173-158 is the nucleic acid sequence of D160-AF4 (SEQ ED NO:1468), D160-AH4 (SEQ ED NO:1469), D161-AE5 (SEQ ED NO:1470), D161- AH5 (SEQ DD NO:1471), D164-AB1 (SEQ ED NO:1472), and D164-AB3 (SEQ DD NO: 1473). Figure 173-159 is the nucleic acid sequence of D164-AC1 (SEQ ED NO-.1474), D164-AC2 (SEQ ED NO:1475), D164-AC5 (SEQ ED NO:1476), D164- AE1 (SEQ ED NO: 1477), and D164-AFl (SEQ ED NO: 1478). Figure 173-160 is the nucleic acid sequence of D165-AH8 (SEQ ED NO:1479), D177-BB7 (SEQ ED NO:1480), D178-AA6 (SEQ ED NO:1481), D178- AD5 (SEQ ED NO:1482), and D180-AA9 (SEQ ED NO:1483). Figure 173-161 is the nucleic acid sequence of D181-AB6 (SEQ ED NO:1484), D181-AC6 (SEQ HD NO:1485), D181-AD7 (SEQ ED NO:1486), D181- AG7 (SEQ ED NO:1487), and D181-AH6 (SEQ ED NO:1488). Figure 173-162 is the nucleic acid sequence of D182-AA1 (SEQ ED NO:1489), D182-AA2 (SEQ ED NO:1490), D182-AA4 (SEQ ED NO:1491), D182- AB2 (SEQ ED NO: 1492), and D182-AC2 (SEQ ED NO: 1493). Figure 173-163 is the nucleic acid sequence of D182-AC4 (SEQ ED NO:1494), D182-AD1 (SEQ ED NO:1495), D182-AD3 (SEQ ED NO:1496), D182- AF1 (SEQ ED NO:1497), and D182-AF4 (SEQ ED NO:1498). Figure 173-164 is the nucleic acid sequence of D 182- AG1 (SEQ ED

NO:1499), D183-AC8 (SEQ ED NO:1500), D185-AB10 (SEQ JD NO:1501), D185- AC10 (SEQ ED NO:1502), D185-AF10 (SEQ ED NO:1503), and D185-BAl (SEQ ED NO: 1504). Figure 173-165 is the nucleic acid sequence of D185-BB3 (SEQ JD NO:1505), D186-AA3 (SEQ ED NO:1506), D186-AB4 (SEQ ED NO:1507), D186- AC2 (SEQ ED NO:1508), D186-AC3 (SEQ ED NO:1509), and D186-AD2 (SEQ JD NO: 1510). Figure 173-166 is the nucleic acid sequence of D186-AD3 (SEQ ED NO: 1511), D186-AE3 (SEQ ED NO:1512), D187-AB2 (SEQ ED NO:1513), D187- AB3 (SEQ ED NO:1514), D187-AC4 (SEQ ED NO:1515), D187-AE4 (SEQ ED NO:1516), and D187-AF4 (SEQ ED NO:1517). Figure 173-167 is the nucleic acid sequence of D187-AG1 (SEQ DD NO:1518), D187-AG2 (SEQ ED NO:1519), D187-AG3 (SEQ ED NO:1520), D187- AH2 (SEQ ED NO:1521), D184-AA1 (SEQ ED NO:1522), and D188-AC7 (SEQ DD NO: 1523). Figure 173-168 is the nucleic acid sequence of D188-AC8 (SEQ ED NO:1524), D188-AD8 (SEQ ED NO:1525), D188-AE8 (SEQ ED NO:1526), D188- AF6 (SEQ ED NO:1527), D188-AG5 (SEQ ED NO:1528), and D188-AG7 (SEQ ED NO: 1529). Figure 173-169 is the nucleic acid sequence of D188-AH7 (SEQ ED NO:1530), D189-AA12 (SEQ ED NO:1531), D189-AB10 (SEQ HD NO:1532), D189- AE9 (SEQ ED NO:1533), D189-AE12 (SEQ ED NO:1534), and D189-AF12 (SEQ DD NO: 1535). Figure 173-170 is the nucleic acid sequence of D 189- AG10 (SEQ ED

NO:1536), D190-BA6 (SEQ ED NO:1537), D190-BD6 (SEQ DD NO:1538), D190- BF6 (SEQ ED NO:1539), D190-BG6 (SEQ ED NO:1540), and D190-BH6 (SEQ ID NO:1541). Figure 173-171 is the nucleic acid sequence of D191-BC5 (SEQ ED NO:1542), D191-BD5 (SEQ ED NO:1543), D191-BF5 (SEQ ED NO:1544), D191- BG5 (SEQ ED NO:1545), and D194-AA1 (SEQ ED NO:1546). Figure 173-172 is the nucleic acid sequence of D194-AA2 (SEQ ED NO:1547), D194-AB1 (SEQ ED NO:1548), D194-AB2 (SEQ ID NO:1549), D194- AC1 (SEQ ED NO:1550), and D194-AC2 (SEQ ED NO:1551). Figure 173-173 is the nucleic acid sequence of D 194- AD 1 (SEQ ED

NO:1552), D194-AD2 (SEQ ED NO:1553), D194-AD3 (SEQ JD NO:1554), D194- AE1 (SEQ ED NO:1555), and D194-AE2 (SEQ ED NO:1556). Figure 173-174 is the nucleic acid sequence of D194-AE3 (SEQ DD NO:1557), D194-AF1 (SEQ ED NO:1558), D194-AF2 (SEQ ED NO:1559), D194- AG2 (SEQ ED NO:1560), and D194-AG3 (SEQ ED NO:1561). Figure 173-175 is the nucleic acid sequence of D194-AH1 (SEQ ED NO:1562), D194-AH2 (SEQ ED NO:1563), D194-AH3 (SEQ ED NO:1564), D195- AB6 (SEQ ED NO:1565), D195-AD5 (SEQ ED NO:1566), and D195-AE4 (SEQ ED NO: 1567). Figure 173-176 is the nucleic acid sequence of D195-AE5 (SEQ ED

NO:1568), D195-AG5 (SEQ ED NO:1569), D195-AH5 (SEQ ED NO: 1570), D196- AD7 (SEQ ED NO: 1571), and D196-AF7 (SEQ ED NO: 1572). Figure 173-177 is the nucleic acid sequence of D196-AG7 (SEQ ID NO:1573), D197-AE8 (SEQ ED NO:1574), D198-AB9 (SEQ ED NO:1575), D198- AC9 (SEQ DD NO:1576), and D198-AF9 (SEQ ED NO:1577). Figure 173-178 is the nucleic acid sequence of D199-AA10 (SEQ ED NO:1578), D199-AB10 (SEQ ED NO:1579), D199-AD10 (SEQ ED NO:1580), D199- AF10 (SEQ ED NO:1581), and D199-AG10 (SEQ DD NO:1582). Figure 173-179 is the nucleic acid sequence of D200-AB11 (SEQ ED NO:1583), D200-AC11 (SEQ ED NO:1584), D200-AD11 (SEQ ED NO:1585), D200- AE11 (SEQ ED NO: 1586), and D200-AGll (SEQ DD NO: 1587). Figure 173-180 is the nucleic acid sequence of D200-AH11 (SEQ DD NO:1588), D201-AD12 (SEQ ED NO: 1589), D201-AE12 (SEQ ED NO:1590), D201- AF12 (SEQ ED NO: 1591), D201-AG12 (SEQ ED NO: 1592), and D203-BE11 (SEQ ED NO: 1593). Figure 173-181 is the nucleic acid sequence of D203-BF11 (SEQ ED NO: 1594), D204-AA1 (SEQ ED NO: 1595), D204-AA2 (SEQ ED NO: 1596), D204- AA4 (SEQ DD NO:1597), and D204-AB1 (SEQ ED NO:1598). Figure 173-182 is the nucleic acid sequence of D204-AB3 (SEQ ED NO:1599), D204-AC1 (SEQ ED NO:1600), D204-AC2 (SEQ ED NO:1601), D204- AC4 (SEQ ED NO:1602), and D204-AD1 (SEQ ED NO:1603). Figure 173-183 is the nucleic acid sequence of D204-AD2 (SEQ ED NO:1604), D204-AD3 (SEQ ED NO:1605), D204-AD4 (SEQ ED NO:1606), D204- AE3 (SEQ ED NO:1607), and D204-AE4 (SEQ JD NO:1608). Figure 173-184 is the nucleic acid sequence of D204-AF1 (SEQ ED

NO:1609), D204-AF3 (SEQ ED NO:1610), D204-AF4 (SEQ ED NO:1611), D204- AG1 (SEQ ED NO: 1612), and D204-AG2 (SEQ ED NO: 1613). Figure 173-185 is the nucleic acid sequence of D204-AG3 (SEQ ED NO:1614), D203-BA11 (SEQ ED NO:1615), D204-AG4 (SEQ ED NO:1616), D204- AH2 (SEQ ED NO:1617), and D204-AH1 (SEQ ED NO:1618). Figure 173-186 is the nucleic acid sequence of D204-AH3 (SEQ ED NO: 1619), D205-BC9 (SEQ ED NO: 1620), D205-BD9 (SEQ ED NO: 1621), D206- CB3 (SEQ ED NO:1622), D206-CE3 (SEQ ED NO:1623), and D206-CF3 (SEQ ED NO: 1624). Figure 173-187 is the nucleic acid sequence of D206-CG1 (SEQ ED NO:1625), D206-CH1 (SEQ ED NO:1626), D210-BF4 (SEQ ED NO:1627), and D210- BF6 (SEQ HD NO:1628). Figure 173-188 is the nucleic acid sequence of D210-BH6 (SEQ ED NO:1629), D211-BA9 (SEQ ED NO:1630), D211-BB8 (SEQ ED NO: 1631), D211- BB9 (SEQ ED NO: 1632), D211-BC9 (SEQ HD NO: 1633), and D211-BD8 (SEQ ED NO: 1634). Figure 173-189 is the nucleic acid sequence of D211-BD9 (SEQ ED NO:1635), D211-BE7 (SEQ ED NO: 1636), D211-BE8 (SEQ ED NO: 1637), and D211- BF8 (SEQ ED NO: 1638). Figure 173-190 is the nucleic acid sequence of D211-BF9 (SEQ ED NO:1639), D211-BG8 (SEQ ED NO:1640), D211-BH7 (SEQ ED NO:1641), D212-BB11 (SEQ ED NO:1642), and D212-BB12 (SEQ ED NO:1643). Figure 173-191 is the nucleic acid sequence of D212-BD10 (SEQ ED NO:1644), D212-BD11 (SEQ ED NO:1645), D212-BE10 (SEQ ED NO:1646), D212- BE11 (SEQ ED NO:1647), D212-BF10 (SEQ ED NO:1648), and D212-BFll (SEQ ED NO: 1649). Figure 173-192 is the nucleic acid sequence of D213-BD1 (SEQ ED NO:1650), D213-BF2 (SEQ ED NO:1651), D214-AA1 (SEQ ED NO:1652), D214- AA3 (SEQ ED NO:1653), and D214-AC1 (SEQ ED NO:1654). Figure 173-193 is the nucleic acid sequence of D214-AE1 (SEQ ED NO:1655), D214-AE3 (SEQ ED NO:1656), D214-AG1 (SEQ ED NO:1657), D214- AH2 (SEQ HD NO: 1658), and D214-AH3 (SEQ ED NO: 1659). Figure 173-194 is the nucleic acid sequence of D216-AB7 (SEQ ED NO:1660), D216-AC8 (SEQ ED NO:1661), D216-AH9 (SEQ ED NO:1662), D219- BA1 (SEQ ED NO:1663), D219-BB1 (SEQ ED NO:1664), and D219-BB2 (SEQ ED NO: 1665). Figure 173-195 is the nucleic acid sequence of D219-BC1 (SEQ ED NO:1666), D219-BD1 (SEQ ED NO:1667), D219-BD2 (SEQ ED NO:1668), D219- BEl (SEQ ED NO:1669), D219-BE2 (SEQ ED NO:1670), and D219-BF2 (SEQ ED NO:1671). Figure 173-196 is the nucleic acid sequence of D219-BH1 (SEQ ED NO: 1672), D220-BF6 (SEQ ED NO: 1673), D220-BD6 (SEQ ED NO: 1674), D223- BC11 (SEQ ED NO:1675), and D221-BC7 (SEQ DD NO:1676). Figure 173-197 is the nucleic acid sequence of D227-AE3 (SEQ ED NO:1677), D223-BB10 (SEQ ED NO:1678), D221-BF9 (SEQ ED NO:1679), D229- AD2 (SEQ ED NO:1680), D229-AE2 (SEQ ED NO:1681), D229-AF2 (SEQ ED NO:1682), and D229-AG1 (SEQ ED NO:1683). Figure 173-198 is the nucleic acid sequence of D229-AH1 (SEQ ED NO:1684), D230-AB1 (SEQ ED NO:1685), D230-AC1 (SEQ ED NO:1686), D230- AC2 (SEQ ED NO:1687), D230-AF2 (SEQ ED NO:1688), and D230-AG1 (SEQ ED NO: 1689). Figure 173-199 is the nucleic acid sequence of D230-AG2 (SEQ ED NO:1690), D231-AA1 (SEQ DD NO:1691), D231-AA2 (SEQ ED NO:1692), D231- AA3 (SEQ ED NO: 1693), D231-AC1 (SEQ ED NO: 1694), and D231-AC2 (SEQ ED NO: 1695). Figure 173-200 is the nucleic acid sequence of D231-AD2 (SEQ ED NO:1696), D231-AE1 (SEQ ED NO:1697), D231-AG2 (SEQ ED NO:1698), D231- AH1 (SEQ ED NO:1699), D231-AH2 (SEQ ED NO:1700), and D231-AH3 (SEQ ED NO:1701). Figure 173-201 is the nucleic acid sequence of D232-AD4 (SEQ ED

NO:1702), D232-AE5 (SEQ ED NO:1703), D232-AE6 (SEQ ED NO:1704), and D232-AF5 (SEQ ED NO: 1705). Figure 173-202 is the nucleic acid sequence of D233-AA7 (SEQ ID NO: 1706), D233-AA8 (SEQ DD NO: 1707), D233-AB7 (SEQ ED NO: 1708), D233- AC7 (SEQ ED NO:1709), and D233-AC8 (SEQ ED NO:1710). Figure 173-203 is the nucleic acid sequence of D233-AH9 (SEQ ED NO:1711), D234-AA11 (SEQ ED NO:1712), D234-AC11 (SEQ ED NO:1713), D234- AD11 (SEQ ED NO: 1714), D238-AA2 (SEQ DD NO: 1715), and D239-BC3 (SEQ ED NO: 1716). Figure 173-204 is the nucleic acid sequence of D239-BD4 (SEQ ED NO:1717), D239-BD6 (SEQ ED NO:1718), D239-BE4 (SEQ ED NO:1719), D240- BB7 (SEQ ED NO:1720), and D241-BC9 (SEQ ED NO:1721). Figure 173-205 is the nucleic acid sequence of D241-BE9 (SEQ ED NO: 1722), D242-BA11 (SEQ ED NO: 1723), D242-BB11 (SEQ ED NO: 1724), D242- BB12 (SEQ ED NO: 1725), D242-BC12 (SEQ ED NO: 1726), and D242-BF12 (SEQ ED NO: 1727). Figure 173-206 is the nucleic acid sequence of D242-BG12 (SEQ ED NO:1728), D242-BH11 (SEQ ED NO:1729), D244-AA5 (SEQ ED NO:1730), D244- AA6 (SEQ ED NO:1731), D244-AF6 (SEQ ED NO:1732), and D245-AE7 (SEQ ED NO: 1733). Figure 173-207 is the nucleic acid sequence of D245-AE8 (SEQ ED NO:1734), D245-AF7 (SEQ ED NO:1735), D246-AA12 (SEQ ED NO:1736), D248- AG4 (SEQ ED NO:1737), and D249-AG9 (SEQ ED NO:1738). Figure 173-208 is the nucleic acid sequence of D250-AE10 (SEQ ED

NO:1739), D251-AF2 (SEQ ED NO:1740), D251-AG2 (SEQ DD NO:1741), D252- AA5 (SEQ ED NO: 1742), and D252-AB5 (SEQ DD NO: 1743). Figure 173-209 is the nucleic acid sequence of D252-AC5 (SEQ ED NO:1744), D252-AD5 (SEQ ED NO:1745), D252-AF4 (SEQ ED NO:1746), D252- AF5 (SEQ ED NO: 1747), D252-AG5 (SEQ ED NO: 1748), and D254-AE2 (SEQ ED NO: 1749). Figure 173-210 is the nucleic acid sequence of D254-AG2 (SEQ ED NO:1750), D255-AA5 (SEQ ED NO:1751), D255-AA6 (SEQ ED NO:1752), D255- AD5 (SEQ ED NO: 1753), and D255-AD6 (SEQ ED NO: 1754). Figure 173-211 is the nucleic acid sequence ofD255-AF5 (SEQ ED

NO: 1755), D255-AG5 (SEQ ED NO: 1756), D256-AA10 (SEQ ED NO: 1757), and D256-AB10 (SEQ ED NO:1758). Figure 173-212 is the nucleic acid sequence of D256-AC10 (SEQ ED NO: 1759), D256-AE10 (SEQ ED NO: 1760), D256-AF9 (SEQ ED NO: 1761), D256- AF10 (SEQ ED NO:1762), and D256-AG10 (SEQ ED NO:1763). Figure 173-213 is the nucleic acid sequence of D256-AH10 (SEQ ED NO: 1764), D258-AC5 (SEQ ED NO: 1765), D263-AE12 (SEQ ED NO: 1766), D263- AF12 (SEQ ED NO: 1767), and D263-AH12 (SEQ ED NO: 1768). Figure 173-214 is the nucleic acid sequence of D264-AA1 (SEQ DD NO:1769), D264-AA2 (SEQ ED NO:1770), D264-AA3 (SEQ ED NO:1771), D264- AB2 (SEQ ED NO: 1772), and D264-AC3 (SEQ ED NO: 1773). Figure 173-215 is the nucleic acid sequence of D264-AD3 (SEQ ED NO:1774), D264-AE1 (SEQ ED NO:1775), D264-AE2 (SEQ ED NO:1776), and D264-AE3 (SEQ ED NO: 1777). Figure 173-216 is the nucleic acid sequence of D264- AF2 (SEQ ED

NO:1778), D264-AG2 (SEQ ED NO:1779), D264-AH2 (SEQ ED NO:1780), and D265-AA4 (SEQ ID NO:1781). Figure 173-217 is the nucleic acid sequence of D265-AA6 (SEQ ED NO: 1782), D265-AC5 (SEQ ED NO: 1783), D265-AC6 (SEQ JD NO: 1784), and D265-AD4 (SEQ ED NO: 1785). Figure 173-218 is the nucleic acid sequence of D265-AD5 (SEQ ED NO:1786), D266-AB7 (SEQ ED NO:1787), D266-AB8 (SEQ ED NO:1788), D266- AC9 (SEQ ED NO:1789), and D266-AD7 (SEQ ED NO:1790). Figure 173-219 is the nucleic acid sequence of D267-AD10 (SEQ ED NO: 1791), D268-AA2 (SEQ ED NO: 1792), D268-AC3 (SEQ ED NO: 1793), D268- AD1 (SEQ ED NO: 1794), and D268-AD2 (SEQ ED NO: 1795). Figure 173-220 is the nucleic acid sequence of D268-AD3 (SEQ ED NO:1796), D268-AE3 (SEQ ED NO:1797), D268-AG2 (SEQ DD NO:1798), and D268-AG3 (SEQ ED NO: 1799). Figure 173-221 is the nucleic acid sequence of D269-AA5 (SEQ ED

NO: 1800), D269-AD4 (SEQ ED NO: 1801), D269-AE4 (SEQ ED NO: 1802), D269- AF5 (SEQ ED NO: 1803), D269-AF6 (SEQ ED NO: 1804), and D270-AA8 (SEQ ED NO: 1805). Figure 173-222 is the nucleic acid sequence of D270-AB9 (SEQ ED NO: 1806), D270-AD8 (SEQ ED NO: 1807), D270-AD9 (SEQ ED NO: 1808), D270- AE9 (SEQ ED NO:1809), and D270-AF8 (SEQ ED NO:1810). Figure 173-223 is the nucleic acid sequence of D271-AG11 (SEQ ED NO:1811), D271-AH11 (SEQ ED NO: 1812), D276-AD5 (SEQ DD NO:1813), and D276-AG6 (SEQ ED NO:1814). Figure 173-224 is the nucleic acid sequence of D276-AH4 (SEQ ED NO: 1815), D276-AH6 (SEQ ED NO: 1816), D277-AE8 (SEQ ED NO: 1817), D277- AF9 (SEQ ED NO: 1818), and D277-AH9 (SEQ ED NO: 1819). Figure 173-225 is the nucleic acid sequence of D278-AF10 (SEQ ED NO:1820), D279-AA3 (SEQ ED NO:1821), D279-AB2 (SEQ ED NO:1822), D279- AC1 (SEQ ED NO: 1823), and D279-AD2 (SEQ ED NO: 1824). Figure 173-226 is the nucleic acid sequence of D279-AE1 (SEQ ED

NO: 1825), D279-AE3 (SEQ ED NO: 1826), D279-AG3 (SEQ ED NO: 1827), D279- BA1 (SEQ ED NO: 1828), and D279-BA2 (SEQ ED NO: 1829). Figure 173-227 is the nucleic acid sequence of D279-BB3 (SEQ DD NO: 1830), D279-BC2 (SEQ DD NO: 1831), D279-BD2 (SEQ ED NO: 1832), D279- BE2 (SEQ ED NO:1833), and D279-BF3 (SEQ ID NO:1834). Figure 173-228 is the nucleic acid sequence of D279-BG1 (SEQ ED NO: 1835), D279-BH3 (SEQ ED NO: 1836), D280-AB5 (SEQ ED NO: 1837), D280- AB6 (SEQ ED NO:1838), and D280-AC4 (SEQ ED NO:1839). Figure 173-229 is the nucleic acid sequence of D280-AC6 (SEQ ED NO: 1840), D280-AD4 (SEQ ED NO: 1841), D280-AD5 (SEQ ED NO: 1842), D280- AD6 (SEQ ED NO: 1843), and D280-AE4 (SEQ JD NO: 1844). Figure 173-230 is the nucleic acid sequence of D280-AE5 (SEQ ED NO: 1845), D280-AE6 (SEQ ED NO: 1846), D280-AF5 (SEQ ED NO: 1847), D280- AF6 (SEQ ID NO: 1848), and D280-AG4 (SEQ ED NO: 1849). Figure 173-231 is the nucleic acid sequence of D280-AG5 (SEQ ED

NO: 1850), D280-AG6 (SEQ ED NO: 1851), D280-AH4 (SEQ ED NO: 1852), D280- AH5 (SEQ ED NO: 1853), and D280-BC4 (SEQ ID NO: 1854). Figure 173-232 is the nucleic acid sequence of D280-BD4 (SEQ ED NO: 1855), D280-BE4 (SEQ ED NO: 1856), D280-BE6 (SEQ ED NO: 1857), and D280- BF4 (SEQ ED NO: 1858). Figure 173-233 is the nucleic acid sequence of D280-BG4 (SEQ ED NO:1859), D280-BH4 (SEQ ED NO:1860), D280-BH6 (SEQ ED NO:1861), D281- AA8 (SEQ ED NO:1862), and D281-AD7 (SEQ ED NO:1863). Figure 173-234 is the nucleic acid sequence of D281-AD8 (SEQ ED NO:1864), D281-AE7 (SEQ ED NO:1865), D281-AE8 (SEQ ED NO:1866), D281- AE9 (SEQ ED NO:1867), D281-AG7 (SEQ ED NO:1868), and D282-AB10 (SEQ ED NO: 1869). Figure 173-235 is the nucleic acid sequence of D282-AB11 (SEQ ED NO:1870), D282-AD10 (SEQ ED NO:1871), D282-AH11 (SEQ ED NO:1872), D282- BA10 (SEQ ED NO:1873), D282-BB10 (SEQ ED NO:1874), and D282-BD10 (SEQ ED NO: 1875). Figure 173-236 is the nucleic acid sequence of D288-AB3 (SEQ ED NO: 1876), D289-AA4 (SEQ ED NO: 1877), D289-AA6 (SEQ ED NO: 1878), D289- AB4 (SEQ ED NO: 1879), and D289-AB6 (SEQ ED NO: 1880). Figure 173-237 is the nucleic acid sequence of D289-AD4 (SEQ ED

NO: 1881), D289-AE4 (SEQ ED NO: 1882), D289-AE6 (SEQ ED NO: 1883), D289- AF4 (SEQ ED NO: 1884), and D289-AF6 (SEQ ED NO: 1885). Figure 173-238 is the nucleic acid sequence of D289-AG4 (SEQ ED NO: 1886), D289-AG6 (SEQ ED NO: 1887), D289-AH4 (SEQ ED NO: 1888), D289- AH6 (SEQ ED NO: 1889), and D290-AA7 (SEQ ED NO: 1890). Figure 173-239 is the nucleic acid sequence of D290-AA8 (SEQ ED NO:1891), D290-AA9 (SEQ ED NO:1892), D290-AB7 (SEQ ED NO:1893), D290- AB9 (SEQ ED NO: 1894), and D290-AC8 (SEQ ED NO: 1895). Figure 173-240 is the nucleic acid sequence of D290-AC9 (SEQ ED NO: 1896), D290-AD7 (SEQ ED NO: 1897), D290-AD8 (SEQ ED NO: 1898), D290- AD9 (SEQ ED NO:1899), and D291-AA12 (SEQ ED NO:1900). Figure 173-241 is the nucleic acid sequence of D291-AB10 (SEQ ED NO:1901), D291-AB11 (SEQ ED NO:1902), D291-AC12 (SEQ DD NO:1903), D291- AD11 (SEQ ED NO:1904), and D291-AD12 (SEQ ED NO:1905). Figure 173-242 is the nucleic acid sequence of D291-AE10 (SEQ DD NO:1906), D291-AE12 (SEQ ED NO:1907), D291-AF10 (SEQ ED NO:1908), D291- AF12 (SEQ ED NO:1909), and D291-AGl l (SEQ DD NO:1910). Figure 173-243 is the nucleic acid sequence of D291-AG12 (SEQ ED NO:1911), D291-AH11 (SEQ ED NO:1912), D292-AA2 (SEQ ED NO:1913), D292- AA3 (SEQ DD NO: 1914), D292-AB2 (SEQ ED NO:1915), and D292-AC2 (SEQ ED NO:1916). Figure 173-244 is the nucleic acid sequence of D292-AD1 (SEQ ED NO:1917), D292-AD2 (SEQ DD NO:1918), D292-AE1 (SEQ DD NO:1919), D292- AE2 (SEQ DD NO: 1920), D292-AF1 (SEQ DD NO: 1921), D292-AF3 (SEQ ED NO: 1922), and D292-AH3 (SEQ ED NO: 1923). Figure 173-245 is the nucleic acid sequence of D291-AA10 (SEQ ED NO:1924), D294-AB7 (SEQ ED NO:1925), D294-AB8 (SEQ ED NO:1926), D294- AB9 (SEQ ED NO: 1927), and D294-AC7 (SEQ DD NO: 1928). Figure 173-246 is the nucleic acid sequence of D294- AC8 (SEQ ED

NO:1929), D294-AE9 (SEQ ED NO:1930), D294-AG8 (SEQ ED NO:1931), D294- AH7 (SEQ ED NO:1932), and D295-AA3 (SEQ ED NO:1933). Figure 173-247 is the nucleic acid sequence of D295-AB1 (SEQ ED NO: 1934), D295-AB2 (SEQ ED NO:1935), D295-AC2 (SEQ ED NO:1936), D295- AC3 (SEQ ED NO: 1937), and D295-AD1 (SEQ ED NO: 1938). Figure 173-248 is the nucleic acid sequence of D295-AD2 (SEQ ED NO:1939), D295-AE3 (SEQ ID NO:1940), D295-AF1 (SEQ ED NO:1941), D295- AF2 (SEQ ED NO: 1942), and D295-AG3 (SEQ ED NO: 1943). Figure 173-249 is the nucleic acid sequence of D295-AH1 (SEQ ID NO: 1944), D296-AA6 (SEQ ED NO: 1945), D296-AE5 (SEQ ED NO: 1946), D296- AF5 (SEQ ED NO:1947), and D296-AG4 (SEQ JD NO:1948). Figure 173-250 is the nucleic acid sequence of D296-AG5 (SEQ DD NO: 1949), D297-AA7 (SEQ DD NO:1950), D297-AA8 (SEQ ED NO:1951), D297- AB7 (SEQ ED NO: 1952), and D297-AE7 (SEQ ED NO: 1953). Figure 173-251 is the nucleic acid sequence of D297-AF7 (SEQ ED NO: 1954), D298-AA10 (SEQ ED NO: 1955), D298-AB11 (SEQ DD NO: 1956), D298- AF11 (SEQ DD NO: 1957), and D298-AG12 (SEQ ED NO: 1958). Figure 173-252 is the nucleic acid sequence of D35-40 (SEQ ED NO:1959), D35-AC6 (SEQ ED NO:1960), D35-BB2 (SEQ ED NO:1961), D55-AB9 (SEQ ED NO:1962), and D55-BB1 (SEQ ED NO:1963). Figure 173-253 is the nucleic acid sequence of D55-BB2 (SEQ ED NO: 1964), D55-BB3 (SEQ ED NO: 1965), D55-BB7 (SEQ ID NO: 1966), D56-AA1 (SEQ ED NO:1967), D56-AE4 (SEQ ED NO:1968), and D56-AE9 (SEQ ED NO:1969). Figure 173-254 is the nucleic acid sequence of D56-AD1 (SEQ HD NO: 1970),

D56-AG12 (SEQ ED NO:1971), D56-AH11 (SEQ ED NO:1972), D57-AA5 (SEQ ED NO:1973), and D57-AA7 (SEQ ED NO:1974). Figure 173-255 is the nucleic acid sequence of D57-AB10 (SEQ ED NO:1975), D57-AC2 (SEQ ED NO:1976), D57-AC3 (SEQ ED NO:1977), D57-AC6 (SEQ ED NO:1978), D57-AC9 (SEQ ED NO:1979), and D57-AC11 (SEQ ED NO: 1980). Figure 173-256 is the nucleic acid sequence of D57-AD3 (SEQ ED NO: 1981), D57-AE4 (SEQ ED NO:1982), D57-AE6 (SEQ ED NO:1983), D57-AE9 (SEQ ED NO:1984), and D57-AF4 (SEQ ED NO: 1985). Figure 173-257 is the nucleic acid sequence of D57-AF11 (SEQ ED

NO:1986), D57-AG3 (SEQ ED NO:1987), D57-AH11 (SEQ ED NO:1988), D58-AB2 (SEQ ED NO:1989), D58-AC8 (SEQ ED NO:1990), and D58-AG9 (SEQ ED NO:1991). Figure 173-258 is the nucleic acid sequence of D58-BA9 (SEQ ED NO:1992), D58-BB9 (SEQ ED NO:1993), D58-BC1 (SEQ ED NO:1994), D58-BC10 (SEQ ED NO:1995), D58-BCl l (SEQ ED NO: 1996), and D58-BD4 (SEQ ED NO: 1997). Figure 173-259 is the nucleic acid sequence of D58-BE8 (SEQ ED NO: 1998), D58-BF4 (SEQ ED NO: 1999), D60-AB4 (SEQ ED NO:2000), D60-AC4 (SEQ ED NO:2001), D60-AD11 (SEQ DD NO:2002), and D60-AF9 (SEQ ED NO:2003). Figure 173-260 is the nucleic acid sequence of D65-AB6 (SEQ ED NO:2004), D65-AC3 (SEQ ED NO:2005), D65-AC9 (SEQ ED NO:2006), D65-AC12 (SEQ ED NO:2007), D65-AE3 (SEQ ED NO:2008), and D65-AG1 (SEQ ED NO:2009). Figure 173-261 is the nucleic acid sequence of D65-CE10 (SEQ ED NO:2010), D65-CE11 (SEQ ED NO:2011), D65-CF11 (SEQ ED NO:2012), D65-CH5 (SEQ ED NO:2013), D66-AA1 (SEQ ED NO:2014), and D66-AA3 (SEQ ED NO:2015). Figure 173-262 is the nucleic acid sequence of D66-AE5 (SEQ ED NO:2016), D66-AF1 (SEQ ED NO:2017), D66-AG2 (SEQ ED NO:2018), D66-AG6 (SEQ ED NO:2019), and D66-AH3 (SEQ ED NO:2020). Figure 173-263 is the nucleic acid sequence of D66-BA11 (SEQ ED NO:2021), D66-BD6 (SEQ ED NO:2022), D66-BD8 (SEQ ED NO:2023), D67-AA5 (SEQ ED NO:2024), D67-AD3 (SEQ ED NO:2025), and D67-AE1 (SEQ ED NO:2026). Figure 173-264 is the nucleic acid sequence of D67-AE4 (SEQ ED NO:2027),

D67-AG4 (SEQ ED NO:2028), D68-AF3 (SEQ ED NO:2029), D70A-AE1 (SEQ ED NO:2030), D70A-AG7 (SEQ ED NO:2031), and D70A-BC6 (SEQ ED NO:2032). Figure 173-265 is the nucleic acid sequence of D70A-BF7 (SEQ ED NO.-2033), D70A-BF8 (SEQ ID NO:2034), D70A-BH1 (SEQ ED NO:2035), D70A- BH3 (SEQ ED NO:2036), and D73A-AA1 (SEQ ED NO:2037). Figure 173-266 is the nucleic acid sequence of D73A-AA3 (SEQ ED NO:2038), D73A-AA5 (SEQ ED NO:2039), D73A-AA6 (SEQ ED NO:2040), D73A- AA8 (SEQ ED NO:2041), D73A-AA9 (SEQ ED NO:2042), and D73A-AB1 (SEQ ED NO:2043). Figure 173-267 is the nucleic acid sequence of D73A-AB3 (SEQ ED

NO:2044), D73A-AB5 (SEQ ED NO:2045), D73A-AB10 (SEQ ED NO:2046), D73A- AC2 (SEQ ED NO:2047), and D73A-AC5 (SEQ ED NO:2048). Figure 173-268 is the nucleic acid sequence of D73A-AC11 (SEQ ED NO:2049), D73A-AC12 (SEQ ED NO:2050), D73A-AD7 (SEQ DD NO:2051), D73A- AD10 (SEQ ED NO:2052), D73A-AE6 (SEQ ED NO:2053), and D73A-AE7 (SEQ ED NO:2054). Figure 173-269 is the nucleic acid sequence of D73A-AE8 (SEQ ED NO:2055), D73A-AE12 (SEQ ID NO:2056), D73A-AF5 (SEQ ED NO:2057), D73A- AF6 (SEQ ED NO:2058), D73A-AF12 (SEQ ED NO:2059), and D73A-AG4 (SEQ ED NO:2060). Figure 173-270 is the nucleic acid sequence of D73 A- AG6 (SEQ ED

NO:2061), D73A-AG10 (SEQ ED NO:2062), D73A-AH2 (SEQ ED NO:2063), D73A- AH3 (SEQ ED NO:2064), and D73A-AH10 (SEQ ED NO:2065). Figure 173-271 is the nucleic acid sequence of D93-AD3 (SEQ DD NO:2066), D97-AD3 (SEQ ED NO:2067), D97-AE3 (SEQ ED NO:2068), D97-AF1 (SEQ ED NO:2069), and Dl 13-AH8 (SEQ ED NO:2070). Figure 173-272 is the nucleic acid sequence of Dl 14-AA10 (SEQ ED NO:2071), D114-AC11 (SEQ ED NO:2072), D131-AD1 (SEQ ED NO:2073), D133- AD7 (SEQ ED NO:2074), and D139-AD2 (SEQ ED NO:2075). Figure 173-273 is the nucleic acid sequence of D139-AF2 (SEQ ED NO:2076), D144A-AB10 (SEQ ED NO:2077), D144A-AE9 (SEQ ED NO:2078), D144A-AG12 (SEQ ED NO:2079), D145-AC7 (SEQ ED NO:2080), and D145-AH7 (SEQ ED NO:2081). Figure 173-274 is the nucleic acid sequence of D150-AA3 (SEQ ED NO:2082), D150-AG3 (SEQ ED NO:2083), D151-AG3 (SEQ ED NO:2084), D153- AA8 (SEQ ED NO:2085), D153-AB7 (SEQ ED NO:2086), and D153-AC9 (SEQ ED NO:2087). Figure 173-275 is the nucleic acid sequence of D153-AF8 (SEQ ED NO:2088), D155-AA2 (SEQ ED NO:2089), D155-AG2 (SEQ ED NO:2090), D156- AH3 (SEQ ED NO:2091), D159-AA2 (SEQ ED NO:2092), and D164-AD1 (SEQ ED NO:2093). Figure 173-276 is the nucleic acid sequence of D181-AG6 (SEQ ED NO:2094), D182-AB1 (SEQ ED NO:2095), D182-AF2 (SEQ ED NO:2096), D185- AE10 (SEQ ED NO:2097), D186-AH3 (SEQ ED NO:2098), and D188-AC6 (SEQ ED NO:2099). Figure 173-277 is the nucleic acid sequence of D188-AF5 (SEQ ED NO:2100), D189-AD12 (SEQ ED NO:2101), D258-AG6 (SEQ ED NO:2102), D194- AA3 (SEQ ED NO:2103), D194-AB3 (SEQ ED NO:2104), D198-AD9 (SEQ ED NO:2105), and D198-AE9 (SEQ DD NO:2106). Figure 173-278 is the nucleic acid sequence of D203-BB11 (SEQ ED

NO:2107), D203-BC11 (SEQ ED NO:2108), D204-AA3 (SEQ ED NO:2109), D204- AF2 (SEQ ED NO:2110), D206-CB1 (SEQ ED NO:2111), and D214-AB1 (SEQ ED NO:2112). Figure 173-279 is the nucleic acid sequence of D214-AE2 (SEQ ED NO:2113), D216-AA7 (SEQ ED NO:2114), D216-AD7 (SEQ ED NO:2115), D219- BA2 (SEQ ED NO:2116), D219-BF1 (SEQ ED NO:2117), and D229-AB2 (SEQ ED NO:2118). Figure 173-280 is the nucleic acid sequence of D230-AD2 (SEQ ED NO:2119), D230-AE2 (SEQ ED NO:2120), D234-AE12 (SEQ ED NO:2121), D241- BG10 (SEQ ED NO:2122), D249-AA9 (SEQ ED NO:2123), and D255-AC5 (SEQ ED NO:2124). Figure 173-281 is the nucleic acid sequence of D270-AE7 (SEQ ED NO:2125), D270-AE8 (SEQ ED NO:2126), D276-AH5 (SEQ ED NO:2127), D279- AA2 (SEQ ED NO:2128), and D279-AB3 (SEQ ED NO:2129). Figure 173-282 is the nucleic acid sequence of D279-AC2 (SEQ ED

NO:2130), D279-AC3 (SEQ ED NO:2131), D279-AD3 (SEQ ED NO:2132), and D279-AE2 (SEQ ED NO:2133). Figure 173-283 is the nucleic acid sequence of D279-AG2 (SEQ ED NO:2134), D279-AH3 (SEQ ED NO:2135), D280-BF6 (SEQ ED NO:2136), D281- AB8 (SEQ ED NO:2137), and D281-AC7 (SEQ ED NO:2138). Figure 173-284 is the nucleic acid sequence of D282-AG10 (SEQ ED NO:2139), D288-AC2 (SEQ ED NO:2140), D289-AC6 (SEQ ED NO:2141), D290- AB8 (SEQ ED NO:2142), and D291-AD10 (SEQ ED NO:2143). Figure 173-285 is the nucleic acid sequence of D291-AE11 (SEQ ED NO:2144), D291-AH12 (SEQ ED NO:2145), D292-AB3 (SEQ ED NO:2146), D292- AD3 (SEQ ED NO:2147), D292-AE3 (SEQ ED NO:2148), and D294-AE7 (SEQ ED NO:2149). Figure 173-286 is the nucleic acid sequence of D419-AH11 (SEQ ED

NO:2150), D295-AE2 (SEQ ED NO:2151), D295-AG2 (SEQ ED NO:2152), D295- AH2 (SEQ ED NO:2153), D295-AH3 (SEQ ED NO:2154), and D296-AD4 (SEQ ED NO:2155). Figure 173-287 is the nucleic acid sequence of D296-AF4 (SEQ ED NO:2156), D296-AG6 (SEQ ED NO:2157), D297-AD7 (SEQ ED NO:2158), D297- AG7 (SEQ ED NO:2159), and D298-ADl l (SEQ ED NO :2160). Figure 173-288 is the nucleic acid sequence of D418-AH9 (SEQ ED NO:2161), D418-AG10 (SEQ ED NO:2162), D416-AA6 (SEQ ED NO:2163), D414- AA2 (SEQ ED NO:2164), and D269-AD5 (SEQ ED NO:2165). Figure 173-289 is the nucleic acid sequence of D268-AE1 (SEQ ED

NO:2166), D258-AF6 (SEQ ED NO:2167), D256-AG9 (SEQ ED NO:2168), D255- AH6 (SEQ ED NO:2169), and D255-AE5 (SEQ ED NO:2170). Figure 173-290 is the nucleic acid sequence of D419-AE11 (SEQ ED NO:2171), D142-AA10 (SEQ ED NO:2172), D140-AH4 (SEQ ED NO:2173), D66- AF7 (SEQ ED NO:2174), and D66-AA7 (SEQ ED NO:2175). Figure 173-291 is the nucleic acid sequence of D65-AF9 (SEQ ED NO:2176), D65-AB3 (SEQ ED NO:2177), D65-AB2 (SEQ ED NO:2178), D144A-AA12 (SEQ ED NO:2179), and D64-7 (SEQ ED NO:2180). Figure 173-292 is the nucleic acid sequence of D109-BF9 (SEQ ED NO:2181), D109-BG9 (SEQ ED NO:2182), D118-AAll (SEQ ED O:2183), D142-ABll(5') (SEQ ED NO:2184), and D142-AE10(5') (SEQ ED NO:2185). Figure 173-293 is the nucleic acid sequence of D207-AH5 (SEQ ED NO:2186), D231-AA1(5') (SEQ DD NO:2187), D232-AD4(5') (SEQ ED NO:2188), D232-AE6(5') (SEQ ED NO:2189), and D288-AA3 (SEQ ED NO:2190). Figure 173-294 is the nucleic acid sequence of D289-AE6 (SEQ ED

NO:2191), D290-AC7 (SEQ ED NO:2192), D58-AA2 (SEQ ED NO:2193), Detailed Description Traditionally, numerous steps were involved in the development of any novel, desirable plant germplasm. Plant breeding begins with the analysis and definition of problems and weaknesses ofthe current germplasm, the establishment of program goals, and the definition of specific breeding objectives. The next step is selection of germplasm that possess the traits to meet the program goals. The goal is to combine in a single variety an improved combination of desirable traits from the parental germplasm. Desirable traits include, for example, higher seed yield, resistance to diseases and insects, tolerance to drought and heat, and better agronomic qualities. However, these processes, which lead to the final step of marketing and distribution, can take six to twelve years from the time the first cross is made. Accordingly, development of new varieties is a time-consuming process that requires precise forward planning, efficient use of resources, and a minimum of changes in direction. Improvement of plant varieties through genetic transformation has become increasingly important for modern plant breeding. Genes of potential commercial interest, such as genes conferring specific, desired plant traits of disease resistance, insect resistance, or improved quality, may be incorporated into crop species through various gene transfer technologies. The ability to manipulate gene expression provides a means of producing new characteristics in transformed plants. In some situations high or increased levels of gene expression maybe desired. For example, it is desirable to increase production of a protein that itself maximizes the disease resistance, yield, flavor, or any other commercially desirable attribute of a plant. Similarly, the regulation of endogenous gene expression by, for example, gene silencing may result in more valuable plants or plant products. During tobacco ripening or curing, the activation, up-regulation, or down- regulation of any ofthe genes identified as ethylene-induced or senescence-related (e.g., those having the sequence of SEQ ED NOS:4, 40, 44, 52, 54, 60, 70, 104, 138, 140, 158, 162, 188, 212, 226, 234, and 288) may affect those metabolic pathways involved in the formation of numerous secondary metabolites including terpenoids, polyphenols, alkaloids, etc. that affect end-product quality traits (e.g., disease resistance, insect resistance, improved quality, modified aroma, modified flavor, and the like). Similarly affected by the genes identified herein may be the metabolic pathways associated with the rate and type of dry matter accumulated during senescence or the partitioning of dry matter within the plant during senescence. Changes in the rate and type of starch accumulation, lignin formation, cellulose deposition, and sugar translocation could be demonstrated. The control of genes identified herein may also affect those metabolic pathways involved in determining senescence rates, the uniformity of senescence within a leaf and among leaves of a single plant, and the induction of senescence by artificial or natural means. The senescence inducing agents or activities that stimulate or activate the genes identified herein include, for example, chemicals such as dilute peroxides, pesticides, herbicides, growth regulators, heat treatments, wounding, or gases such as ozone and elevated concentrations of carbon dioxide. Identifying Tobacco Constitutively Expressed, or Ethylene or

Senescence Induced Sequences El accordance with the present invention, RNA was extracted from Nicotiana tissue of converter and non-converter Nicotiana lines. The extracted RNA was then used to create cDNA. Nucleic acid sequences ofthe present invention were then generated using two strategies. In the first strategy, the poly A enriched RNA was extracted from plant tissue and cDNA was made by reverse franscription PCR. The single strand cDNA was then used to create p450 specific PCR populations using degenerate primers plus a oligo d(T) reverse primer. The primer design was based on the highly conserved motifs of other plant cytochrome p450 gene sequences. Examples of specific degenerate primers are set forth in Figure 1 ofthe US 2004/0103449 Al, US 2004/0111759 Al, and US 2004/0117869 Al patent application publications, which are hereby incorporated by reference. The sequence of fragments from plasmids containing appropriate size inserts was further analyzed. These size inserts typically ranged from about 300 to about 800 nucleotides depending on which primers were used. hi a second strategy, a cDNA library was initially constructed. The cDNA in the plasmids was used to create p450 specific PCR populations using degenerate primers plus T7 primer on plasmid as reverse primer. As in the first strategy, the sequence of fragments from plasmids containing appropriate size inserts was further analyzed. Nicotiana plant lines known to produce high levels of nornicotine (converter) and plant lines having low levels of nornicotine maybe used as starting materials. Leaves can then be removed from plants and treated with ethylene to activate p450 enzymatic activities defined herein. Total RNA is extracted using techniques known in the art. cDNA fragments can then be generated using PCR (RT-PCR) with the oligo d(T) primer (SEQ DD NO:2260) as described in Figure 161. The cDNA library can then be constructed as more fully described in examples herein. The conserved region of p450 type enzymes was used as a template for degenerate primers, examples of which are shown in Figure 161. Using degenerate primers, p450 specific bands were amplified by PCR. Bands indicative for ρ450-like enzymes were identified by DNA sequencing. PCR fragments were characterized using BLAST search, alignment or other tools to identify appropriate candidates. Sequence information from identified fragments was used to develop PCR primers. These primers in combination with plasmid primers in cDNA library were used to clone full-length p450 genes. Large-scale Southern reverse analysis was conducted to examine the differential expression for all fragment clones obtained and in some cases full-length clones. In this aspect ofthe invention, these large-scale reverse Southern assays can be conducted using labeled total cDNAs from different tissues as a probe to hybridize with cloned DNA fragments in order to screen all cloned inserts. Nonradioactive and radioactive (P ) Northern blotting assays were also used to characterize cloned p450 fragments and full-length clones. Once plant cells expressing the desired level of p450 enzyme are obtained, plant tissues and whole plants can be regenerated therefrom using methods and techniques well-known in the art. The regenerated plants are then reproduced by conventional means and the introduced genes can be transferred to other strains and cultivars by conventional plant breeding techniques. Ethylene-induced or senescence-related genes, for example, those identified in SEQ ED NOS:4, 40, 44, 52, 54, 60, 70, 104, 138, 140, 158, 162, 188, 212, 226, 234, and 288, may encode enzymes that are important determinants of tobacco leaf quality parameters important for a variety of tobacco products. The tobacco products include moist or dry snuff, chewing tobaccos, cigarettes, cigars, cigarillos, pipe tobaccos, bidis, and similar smoking products. The leaf quality parameters may include: visual attributes such as color, surface uniformity, texture, or variegation; structural or physical characteristics as exemplified by lamina-to-stem ratio, oiliness, cigarette filling potential, bulk density, moisture retention, and pliability; chemical or biochemical traits related to flavor, aroma, fermentation capability, burn rates, burn temperatures, artificial flavor absorption and release; and generation of smoke constituents including tar or particulate matter, alkaloids, and other similar attributes. The enzymatic reactions resulting from these ethylene-induced or senescence-related genes may also produce secondary metabolites influencing pathogen or insect interactions that affect tobacco leaf yield and quality. For example, Wagner, et al. {Nature Biotechnology, 19:371-374, 2001) showed that suppression of a p450 hydroxylase gene greatly increases the accumulation of cembratiene-ol, a secondary metabolite influencing aphid resistance. Generation of Antibodies Peptide specific antibodies were made by deriving their amino acid sequence and selecting peptide regions that were antigenic and unique relative to other clones.

Rabbit antibodies were made to synthetic peptides conjugated to a carrier protein.

Western blotting analyses or other immunological methods were performed on plant tissue using these antibodies. In addition, peptide specific antibodies were made for several full-length clones by deriving their amino acid sequence and selecting peptide regions that were potentially antigenic and were unique relative to other clones.

Western blotting analyses were performed using these antibodies. Downresulatinε Gene Expression and Altering Enzymatic Activity Plants having decreased expression of a polypeptide are generated according to standard gene silencing methods. (For reviews, see Arndt and Rank, Genome 40:785- 797, 1997; Turner and Schuch, Journal of Chemical Technology and Biotechnology 75:869-882, 2000; and Klink and Wolniak, Journal of Plant Growth Regulation 19(4):371-384, 2000.) In particular, tobacco nicotine demethylase nucleic acid sequences (e.g., SEQ ED NOS:4, 5, 7, 8, and 9, or fragments thereof such as the sequence of SEQ ED NOS:l and 62), as well as substantially identical nucleic acid sequences (e.g., the sequence of SEQ DD NO.T88) can be used to alter tobacco phenotypes or tobacco metabolites, for example, nornicotine in any Nicotiana species. Decreased expression of a tobacco nicotine demethylase gene may be achieved using, for example, RNA interference (RNAi) (Smith et al, Nature 407:319-320, 2000; Fire et al, Nature 391:306-311, 1998; Waterhouse et al., PNAS 95:13959-13964, 1998; Stalberg et al., Plant Molecular Biology 23:671- 683, 1993; Brignetti et al., EMBOJ. 17:6739-6746, 1998; Allen et al., Nature Biotechnology 22: 1559-1566, 2004); virus- induced gene silencing ("VIGS") (Baulcombe, Current Opinions in Plant Biology, 2:109-113, 1999; Cogoni and Macino, Genes Dev 10: 638-643, 2000; Ngelbrecht et al., PNAS 91 :10502-10506, 1994); silencing the target gene by transferring a plant endogenous gene in the sense orientation (Jorgensen et al., Plant Mol Biol 31: 957- 973, 1996); expression of antisense gene; homologous recombination (Ohl et al., Homologous Recombination and Gene Silencing in Plants. Kluwer, Dordrecht, The Netherlands, 1994); Cre /lox systems (Qin et al, PNAS 91: 1706-1710, 1994; Koshinsky et al, Tlie Plant Journal 23: 715-722, 2000; Chou, et al., Plant and Animal Genome VII Conference Abstracts. San Diego, CA, 17-21 January, 1999); gene trapping and T-DNA tagging (Bums et al., Genes Dev. 8: 1087-1105, 1994; Spradling, et al., PNAS 92:10824-10830, 1995; Skarnes et al., Bio/Technology 8, 827-831, 1990; Sundaresan, et al, Genes Dev. 9: 1797-1810, 1995); and any ofthe other possible gene silencing systems that are available in the science areas that result in the downregulation of expression of a tobacco polypeptide or in a reduction in its enzymatic activity. As further provided herein, any ofthe nucleic acid sequences provided herein may be down regulated or up regulated using techniques described herein and other technologies found in the art. Exemplary methods are described in more detail below. RNA Interference RNA interference ("RNAi") is a generally applicable process for inducing potent and specific post-translational gene silencing in many organisms including plants (see, e.g., Bosher et al., Nat. Cell Biol. 2:E31-36, 2000; and Tavernarakis et al., Nat. Genetics 24:180-183, 2000). RNAi involves introduction of RNA with partial or fully double-stranded character into the cell or into the extracellular environment. Inhibition is specific in that a nucleotide sequence from a portion ofthe target gene (e.g., a tobacco nicotine demethylase) is chosen to produce inhibitory RNA. The chosen portion generally encompasses exons ofthe target gene, but the chosen portion may also include untranslated regions (UTRs), as well as introns (e.g., the sequence of SEQ ED NO: 7, or a nucleic acid sequence from a desired plant gene, such as any nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172- 19, and 173-1 to 173-294). For example, to construct transformation vectors that produce RNAs capable of duplex formation, two nucleic acid sequences, one in the sense and the other in the antisense orientation, may be operably linked, and placed under the control of a strong viral promoter, such as CaMV 35S or the promoter isolated from cassava brown streak virus (CBSV). However, use ofthe endogenous promoter, such as the nicotine demethylase promoter having the sequence of SEQ ED NO: 8, or a fragment thereof that drives transcription, may also be desirable. The length ofthe tobacco nicotine demethylase nucleic acid sequences included in such a construct is desirably at least 25 nucleotides, but may encompass a sequence that includes up to the full-length tobacco nicotine demethylase gene. Constructs that produce RNAs capable of duplex formation may be introduced into the genome of a plant, such as a tobacco plant, by Agrobacterium-mediated transformation (Chuang et al, Proc. Natl. Acad. Sci. USA 97:4985-4990, 2000), causing specific and heritable genetic interference in a tobacco nicotine demethylase. The double-stranded RNA may also be directly introduced into the cell (i.e., intracellularly) or introduced extracellularly, for example, by bathing a seed, seedling, or plant in a solution containing the double-stranded RNA. Depending on the dose of double-stranded RNA material delivered, the RNAi may provide partial or complete loss of function for the target gene. A reduction or loss of gene expression in at least 99% of targeted cells may be obtained. In general, lower doses of injected material and longer times after administration of dsRNA result in inhibition in a smaller fraction of cells. The RNA used in RNAi may comprise one or more strands of polymerized ribonucleotide; it may include modifications to either the phosphate-sugar backbone or the nucleoside. The double-stranded structure may be formed by a single self- complementary RNA strand or by two complementary RNA strands and RNA duplex formation may be initiated either inside or outside the cell. The RNA may be introduced in an amount which allows delivery of at least one copy per cell. However, higher doses (e.g., at least 5, 10, 100, 500 or 1000 copies per cell) of double-sfranded material may yield more effective inhibition. Inhibition is sequence-specific in that nucleotide sequences corresponding to the duplex region ofthe RNA are targeted for genetic inhibition. RNA containing a nucleotide sequences identical to a portion of the target gene is preferred for inhibition. RNA sequences with insertions, deletions, and single point mutations relative to the target sequence may also be effective for inhibition. Thus, sequence identity may be optimized by alignment algorithms known in the art and calculating the percent difference between the nucleotide sequences. Alternatively, the duplex region ofthe RNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion ofthe target gene transcript. hi addition, the RNA used for RNAi may be synthesized either in vivo or in vitro. For example, endogenous RNA polymerase in the cell may mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vivo or in vitro. For transcription from a transgene in vivo or an expression construct, a regulatory region may be used to transcribe the RNA strand (or strands). Triple Strand Interference Endogenous tobacco nicotine demethylase gene expression or expression of a nucleic acid fragment from a desired plant gene, such as any nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173-1 to 173- 294, may also be downregulated by targeting deoxyribonucleotide sequences complementary to the regulatory region of a tobacco gene (e.g., promoter or enhancer regions) to form triple helical structures that prevent franscription ofthe tobacco gene in target cells. (See generally, Helene, Anticancer Drug Des. 6:569-584, 1991; Helene et al., Ann. NY. Acad. Sci. 660:27-36, 1992; and Maher, Bioassays 14:807-815, 1992.) Nucleic acid molecules used in triple helix formation for the inhibition of transcription are preferably single stranded and composed of deoxyribonucleotides. The base composition of these oligonucleotides should promote triple helix formation via Hoogsteen base pairing rules, which generally require sizable stretches of either purines or pyrimidines to be present on one strand of a duplex. Nucleotide sequences may be pyrimidine-based, which will result in TAT and CGC triplets across the three associated strands ofthe resulting triple helix. The pyrimidine-rich molecules provide base complementarity to a purine-rich region of a single strand ofthe duplex in a parallel orientation to that strand, hi addition, nucleic acid molecules may be chosen that are purine-rich, for example, containing a stretch of G residues. These molecules will form a triple helix with a DNA duplex that is rich in GC pairs, in which the majority ofthe purine residues are located on a single strand ofthe targeted duplex, resulting in CGC triplets across the three strands in the triplex. Alternatively, the potential sequences that can be targeted for triple helix formation may be increased by creating a "switchback" nucleic acid molecule.

Switchback molecules are synthesized in an alternating 5 '-3', 3 '-5' manner, such that they base pair with first one strand of a duplex and then the other, eliminating the necessity for a sizable stretch of either purines or pyrimidines to be present on one strand of a duplex. Ribozymes Ribozymes are RNA molecules that act as enzymes and can be engineered to cleave other RNA molecules. A ribozyme may be designed to specifically pair with virtually any target RNA and cleave the phosphodiester backbone at a specific location, thereby functionally inactivating the target RNA. The ribozyme itself is not consumed in this process and can act catalytically to cleave multiple copies of mRNA target molecules. Accordingly, ribozymes may also be used as a means to downregulate expression of a tobacco nicotine demethylase. The design and use of target RNA-specific ribozymes is described in Haseloff et al. {Nature 334:585-591, 1988). Preferably, the ribozyme includes at least about 20 continuous nucleotides complementary to the target sequence (e.g., a tobacco nicotine demethylase or a nucleic acid fragment from a desired plant gene, such as any nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173-1 to 173- 294) on each side ofthe active site ofthe ribozyme. In addition, ribozyme sequences may also be included within an antisense

RNA to confer RNA-cleaving activity upon the antisense RNA and, thereby, increasing the effectiveness ofthe antisense construct.

Homologous Recombination Gene replacement technology is another desirable method for downregulating expression of a given gene. Gene replacement technology is based upon homologous recombination (see, Schnable et al, Curt: Opinions Plant Biol. 1:123-129, 1998). The nucleic acid sequence ofthe enzyme of interest such as a tobacco nicotine demethylase or a polypeptide encoded by any nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173-1 to 173-294 can be manipulated by mutagenesis (e.g., insertions, deletions, duplications or replacements) to decrease enzymatic function. The altered sequence can then be introduced into the genome to replace the existing, e.g., wild-type, gene via homologous recombination (Puchta et al., Proc. Natl. Acad. Sci. USA 93:5055-5060, 1996; and Kempin et al., Nature 389: 802-803, 1997). Alternatively, an endogenous tobacco nicotine demethylase gene may be replaced with a gene that does not have demethylase activity, for example, the sequence of SEQ ED NO: 188. Co-Suppression A further desirable method of silencing gene expression is co-suppression (also referred to as sense suppression). This technique, which involves introduction of a nucleic acid, e.g., a nucleic acid fragment from a desired plant gene, such as any nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172- 19, and 173-1 to 173-294, configured in the sense orientation, has been shown to effectively block the transcription of target genes (see, for example, Napoli et al., Plant Cell, 2:279-289, 1990 and Jorgensen et al., U.S. Patent No. 5,034,323). Generally, sense suppression involves transcription ofthe introduced sequence. However, co-suppression may also occur where the introduced sequence contains no coding sequence per se, but only intron or untranslated sequences or other such sequences substantially identical to sequences present in the primary transcript of the endogenous gene to be repressed. The introduced sequence generally will be substantially identical to the endogenous gene targeted for repression. Such identity is typically greater than about 50%, but higher identities (for example, 80% or even 95%) are preferred because they result in more effective repression. The effect of co- suppression may also be applied to other proteins within a similar family of genes exhibiting homology or substantial homology. Segments from a gene from one plant can be used directly, for example, to inhibit expression of homologous genes in different plant species. In sense suppression, the introduced sequence, requiring less than absolute identity, need not be full length, relative to either the primary franscription product or to fully processed mRNA. A higher degree of sequence identity in a shorter than full- length sequence compensates for a longer sequence of lesser identity. Furthermore, the introduced sequence need not have the same intron or exon pattern, and identity of non-coding segments may be equally effective. Sequences of at least 50 base pairs are preferred, with introduced sequences of greater length being more preferred (see, for example, those methods described by Jorgensen et al., U.S. Patent No. 5,034,323). Antisense Suppression In antisense technology, a nucleic acid segment from the desired plant gene, such as any nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173-1 to 173-294, is cloned and operably linked to an expression control region such that the antisense strand of RNA is synthesized. The construct is then transformed into plants and the antisense strand of RNA is produced, hi plant cells, it has been shown that antisense RNA inhibits gene expression. The nucleic acid segment to be introduced in antisense suppression is generally substantially identical to at least a portion ofthe endogenous gene or genes to be repressed, but need not be identical. The nucleic acid sequences ofthe tobacco nicotine demethylase disclosed herein may be included in vectors designed such that the inhibitory effect applies to other proteins within a family of genes exhibiting homology or substantial homology to the target gene. Segments from a gene from one plant can be used, for example, directly to inhibit expression of homologous genes in different tobacco varieties. The introduced sequence also need not be full length relative to either the primary transcription product or to fully processed mRNA. Generally, higher homology can be used to compensate for the use of a shorter sequence. Moreover, the introduced sequence need not have the same intron or exon pattern, and homology of non-coding segments will be equally effective. In general, such an antisense sequence will usually be at least 15 base pairs, preferably about 15-200 base pairs, and more preferably 200-2,000 base pairs in length or greater. The antisense sequence may be complementary to all or a portion ofthe gene to be suppressed, and, as appreciated by those skilled in the art, the particular site or sites to which the antisense sequence binds as well as the length ofthe antisense sequence will vary, depending upon the degree of inhibition desired and the uniqueness of the antisense sequence. A transcriptional construct expressing a plant negative regulator antisense nucleotide sequence includes, in the direction of transcription, a promoter, the sequence coding for the antisense RNA on the sense strand, and a transcriptional termination region. Antisense sequences may be constructed and expressed as described, for example, in van der Krol et al. {Gene 72: 45-50, 1988); Rodermel et al. {Cell 55: 673-681, 1988); Mol et al. {FEBS Lett. 268: 427-430, 1990); Weigel and Nilsson {Nature 377: 495- 500, 1995); Cheung et al., {Cell 82: 383-393, 1995); and Shewmaker et al. (U.S. Pat. No. 5,107,065).

Dominant Negatives Transgenic plants expressing a transgene encoding a dominant negative gene product of a tobacco gene product may be assayed in artificial environments or in the field to demonstrate that the transgene confers downregulates a tobacco gene product in the transgenic plant. Dominant negative transgenes are constructed according to methods known in the art. Typically, a dominant negative gene encodes a mutant negative regulator polypeptide of a tobacco gene product which, when overexpressed, disrupts the activity ofthe wild-type enzyme.

Mutants Plants having decreased expression or enzymatic activity of a tobacco gene product may also be generated using standard mutagenesis methodologies. Such mutagenesis methods include, without limitation, treatment of seeds with ethyl methylsulfate (Hildering and Verkerk, In, The use of induced mutations in plant breeding. Pergamon press, pp 317-320, 1965) or UV-irradiation, X-rays, and fast neutron irradiation (see, for example, Verkerk, Neth. J. Agric. Sci. 19:197-203, 1971; and Poeh nan, Breeding Field Crops, Van Nosfrand Reinhold, New York (3.sup.rd ed), 1987), use of transposons (Fedoroff et al., 1984; U.S. Pat. No. 4,732,856 and U.S. Pat. No. 5,013,658), as well as T-DNA insertion methodologies (Hoekema et al., 1983; U.S. Pat. No. 5,149,645). The types of mutations that may be present in a tobacco gene include, for example, point mutations, deletions, insertions, duplications, and inversions. Such mutations desirably are present in the coding region of a tobacco gene; however mutations in the promoter region, and intron, or an untranslated region of a tobacco gene may also be desirable. For instance, T-DNA insertional mutagenesis may be used to generate insertional mutations in a tobacco gene to downregulate the expression ofthe gene. Theoretically, about 100,000 independent T-DNA insertions are required for a 95% probability of getting an insertion in any given gene (McKinnet, Plant J. 8: 613-622, 1995; and Forsthoefel et ύ., Aust. J. Plant Physiol. 19:353-366, 1992). T-DNA tagged lines of plants maybe screened using polymerase chain reaction (PCR) analysis. For example, a primer can be designed for one end ofthe T-DNA and another primer can be designed for the gene of interest and both primers can be used in the PCR analysis. If no PCR product is obtained, then there is no insertion in the gene of interest. In contrast, if a PCR product is obtained, then there is an insertion in the gene of interest. Expression of a mutated tobacco gene product maybe evaluated according to standard procedures (for example, those described herein) and, optionally, may be compared to expression ofthe non-mutated enzyme. When compared to non-mutated plants, mutated plants having decreased expression of a gene encoding a tobacco gene product are desirable embodiments ofthe present invention. A plant having a mutation in any ofthe nucleic acid sequences described herein maybe used in a breeding program as described herein.

Overexpression of Constitutive, or Ethylene or Senescence Induced Sequences Overexpression of a nucleic acid sequence ofthe invention (e.g., a nucleic acid sequence shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294, or fragments thereof) can be used to increase desirable traits in the Nicotiana line or in a tobacco product made from a plant of that line. In particular, overexpression ofthe nucleic acid sequences of the invention, and/or their translation products, may be used to increase the biosynthesis of desirable flavor and aroma products that result from secondary metabolites. Further overexpression of a nucleic acid sequence that encodes a tobacco polypeptide may be used to increase expression ofthe polypeptide within Nicotiana lines Additional desirable traits that may be conferred to a Nicotiana line by overexpressing a nucleic acid sequence ofthe mvention include resistance to bacterial wilt, Granville wilt, Fusarium wilt, potato virus Y, tobacco mosaic virus, tobacco etch virus, tobacco vein mottling virus, alfalfa mosaic viruses, wildfire, root-knot nematode, Southern root knot nematode, cyst nematode, black root rot, blue mold, race 0 black shank fungus, and race 1 black shank fungus. Other desirable traits that may be enlianced in a Nicotiana plant by overxpressing a nucleic acid sequence of the invention include increased yield and/or grade, better curability, harvestability, holding ability, leaf quality, or curing quality, increased or reduced height, altered time of maturity (e.g., early maturing, early to medium maturing, medium maturing, medium to late maturing, or late maturing), increased or reduced stalk size, and an increase or reduction in the number of leaves per plant.

Plant Promoters A desirable promoter is a caulimovirus promoter, for instance, a cauliflower mosaic virus (CaMV) promoter or the cassava vein mosaic virus (CsVMV) promoter. These promoters confer high levels of expression in most plant tissues, and the activity of these promoters is not dependent on virally encoded proteins. CaMV is a source for both the 35S and 19S promoters. Examples of plant expression constructs using these promoters are known in the art. In most tissues of transgenic plants, the CaMV 35S promoter is a strong promoter. The CaMV promoter is also highly active in monocots. Moreover, activity of this promoter can be further increased (i.e., between 2-10 fold) by duplication ofthe CaMV 35S promoter. Other useful plant promoters include, without limitation, the nopaline synthase (NOS) promoter, the octopine synthase promoter, figwort mosiac virus (FMV) promoter, the rice actin promoter, and the ubiquitin promoter system. Exemplary monocot promoters include, without limitation, commelina yellow mottle virus promoter, sugar cane badna virus promoter, rice tungro bacilliform virus promoter, maize streak virus element, and wheat dwarf virus promoter. For certain applications, it may be desirable to produce a tobacco gene product, such as a dominant negative mutant gene product, in an appropriate tissue, at an appropriate level, or at an appropriate developmental time. For this purpose, there are assortments of gene promoters, each with its own distinct characteristics embodied in its regulatory sequences, shown to be regulated in response to inducible signals such as the environment, hormones, and/or developmental cues. These include, without limitation, gene promoters that are responsible for heat-regulated gene expression, light-regulated gene expression (for example, the pea rbcSSA; the maize rbcS promoter; the chlorophyll a b-binding protein gene found in pea; or the Arabssu promoter), hormone-regulated gene expression (for example, the abscisic acid (ABA) responsive sequences from the Em gene of wheat; the ABA-inducible HVA1 and HVA22, and rd29A promoters of barley and Arabidopsis; and wound-induced gene expression (for example, of wunl), organ-specific gene expression (for example, ofthe tuber-specific storage protein gene; the 23 -kDa zein gene from maize described by; or the French bean β-phaseolin gene), or pathogen-inducible promoters (for example, the PR-l,prp-l, or β-1,3 glucanase promoters, the fungal-inducible wirla promoter of wheat, and the nematode-inducible promoters, TobRB7-5A and Hmg-1, of tobacco and parsley, respectively).

Plant Expression Vectors Typically, plant expression vectors include (1) a cloned plant gene under the transcriptional control of 5' and 3' regulatory sequences and (2) a dominant selectable marker. Such plant expression vectors may also contain, if desired, a promoter regulatory region (for example, one conferring inducible or constitutive, pathogen- or wound-induced, environmentally- or developmentally-regulated, or cell- or tissue- specific expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a franscription termination site, and/or a polyadenylation signal. Plant expression vectors may also optionally include RNA processing signals, e.g, introns, which have been shown to be important for efficient RNA synthesis and accumulation. The location ofthe RNA splice sequences can dramatically influence the level of transgene expression in plants. In view of this fact, an intron maybe positioned upstream or downstream of a tobacco nicotine demethylase coding sequence in the transgene to alter levels of gene expression. In addition to the aforementioned 5' regulatory control sequences, the expression vectors may also include regulatory control regions which are generally present in the 3' regions of plant genes. For example, the 3 ' terminator region may be included in the expression vector to increase stability ofthe mRNA. One such terminator region may be derived from the PI-E terminator region of potato. In addition, other commonly used terminators are derived from the octopine or nopaline synthase signals. The plant expression vector also typically contains a dominant selectable marker gene used to identify those cells that have become transformed. Useful selectable genes for plant systems include the aminoglycoside phosphotransferase gene of transposon Tn5 (Aph II), genes encoding antibiotic resistance genes, for example, those encoding resistance to hygromycin, kanamycin, bleomycin, neomycin, G418, streptomycin, or spectinomycin. Genes required for photosynthesis may also be used as selectable markers in photosynthetic-deficient strains. Finally, genes encoding herbicide resistance may be used as selectable markers; useful herbicide resistance genes include the bar gene encoding the enzyme phosphinothricin acetyltransferase and conferring resistance to the broad-spectrum herbicide Basta^® (Bayer Cropscience Deutschland GmbH, Langenfeld, Germany). Other selectable markers include genes that provide resistance to other such herbicides such as glyphosate and the like, and imidazolinones, sulfonylureas, triazolopyrimidine herbicides, such as chlorosulfron, bromoxynil, dalapon, and the like. Furthermore, genes encoding dihydrofolate reductase may be used in combination with molecules such as methatrexate. Efficient use of selectable markers is facilitated by a determination ofthe susceptibility of a plant cell to a particular selectable agent and a determination ofthe concentration of this agent which effectively kills most, if not all, ofthe transformed cells. Some useful concentrations of antibiotics for tobacco transformation include, for example, 20-100 μg/ml (kanamycin), 20-50 μg/ml (hygromycin), or 5-10 μg/ml (bleomycin). A useful strategy for selection of transformants for herbicide resistance is described, for example, by Vasil {Cell Culture and Somatic Cell Genetics of Plants, Vol I, E, ffl Laboratory Procedures and Their Applications, Academic Press, New York, 1984). hi addition to a selectable marker, it may be desirable to use a reporter gene. In some instances a reporter gene may be used without a selectable marker. Reporter genes are genes which are typically not present or expressed in the recipient organism or tissue. The reporter gene typically encodes for a protein which provide for some phenotypic change or enzymatic property. Examples of such genes are provided in Weising et al. {Ann. Rev. Genetics 22:421, 1988), which is incorporated herein by reference. Preferred reporter genes include without limitation glucuronidase (GUS) gene and GFP genes. Upon construction ofthe plant expression vector, several standard methods are available for introduction ofthe vector into a plant host, thereby generating a transgenic plant. These methods include (1) Agrobacterium-mediated transformation {A. tumefaciens or A. rhizogenes) (see, for example, Lichtenstein and Fuller hi: Genetic Engineering, vol 6, PWJ Rigby, ed, London, Academic Press, 1987; and

Lichtenstein, C.P., and Draper, J., hi: DNA Cloning, Vol E, D.M. Glover, ed, Oxford, IRI Press, 1985; U.S. Patent Numbers, 4,693,976, 4,762,785, 4,940,838, 5,004,863, 5,104,310, 5,149,645, 5,159,135, 5,177,010, 5,231,019, 5,463,174, 5,469,976, and 5,464,763; and European Patent Numbers 0131624, 0159418, 0120516, 0176112, 0116718, 0290799, 0292435, 0320500, and 0627752, and European Patent

Application Numbers 0267159 and 0604622,), (2) the particle delivery system (see, for example, U.S. Patent Numbers 4,945,050 and 5,141,131), (3) microinjection protocols, (4) polyethylene glycol (PEG) procedures, (5) liposome-mediated DNA uptake, (6) electroporation protocols (see, for example, WO 87/06614 and U.S. Patent Numbers 5,384,253, 5,472,869, 5,641,664, 5,679,558, 5,712,135, 6,002,070, and

6,074,877, (7) the vortexing method, or (8) the so-called whiskers methodology (see, for example, Coffee et al, U.S. Patent Numbers 5,302,523 and 5,464,765). The type of plant tissue that may be transformed with an expression vector includes embryonic tissue, callus tissue type I and E, hypocotyls, meristem, and the like. Once introduced into the plant tissue, the expression ofthe structural gene may be assayed by any means known to the art, and expression may be measured as mRNA transcribed, protein synthesized, or the amount of gene silencing that occurs as determined by metabolite monitoring via chemical analysis of secondary alkaloids in tobacco (as described herein; see also U.S. Patent No. 5,583,021 which is hereby incorporated by reference). Techniques are known for the in vitro culture of plant tissue, and in a number of cases, for regeneration into whole plants (see, e.g., U.S.

Patent Numbers 5,595,733 and 5,766,900). Procedures for transferring the introduced expression complex to commercially useful cultivars are known to those skilled in the art. Once plant cells expressing the desired level of a desirable gene product are obtained, plant tissues and whole plants can be regenerated therefrom using methods and techniques well-known in the art. The regenerated plants are then reproduced by conventional means and the introduced genes can be transferred to other strains and cultivars by conventional plant breeding techniques. Transgenic tobacco plants may incorporate a nucleic acid of any portion ofthe genomic gene in different orientations for either down-regulation, for example, antisense orientation, or over-expression, for example, sense orientation. Over- expression ofthe nucleic acid sequence that encodes the entire or a functional part of an amino acid sequence of a full-length tobacco gene is desirable for increasing the expression ofthe gene product within Nicotiana lines.

Determination of Transcriptional or Translational Levels of a Tobacco Gene Gene expression may be measured, for example, by standard Northern blot analysis (Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY, (2001), and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y., (1989)) using a tobacco gene or gene fragment as a hybridization probe. Determination of RNA expression levels may also be aided by reverse transcription PCR (rtPCR), including quantitative rtPCR (see, e.g., Kawasaki et al., in PCR Technology: Principles and Applications of DNA Amplification (H. A. Erlich, Ed.) Stockton Press (1989); Wang et al. in PCR Protocols: A Guide to Methods and Applications (M. A. Innis, et al., Eds.) Academic Press (1990); and Freeman et al., Biotechniques 26:112-122 and 124-125, 1999). Additional well-known techniques for determining expression of a tobacco gene include in situ hybridization, and fluorescent in situ hybridization (see, e.g., Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY, (2001)). The above standard techniques are also useful to compare the expression level between plants, for example, between a plant having a mutation in a tobacco gene and a control plant. If desired, expression of a tobacco gene (e.g., a nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173-1 to 173-294, or a fragment thereof) may be measured at the level of protein production using the same general approach and standard protein analysis techniques including Bradford assays, spectrophotometric assays, and immunological detection techniques, such as Western blotting or immunoprecipitation with an antibody specific for the desirable polypeptide (Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY, (2001), and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, N. Y., (1989)). The activity of any polypeptide described herein may be assayed using standard methods in the art. For example, the activity of a p450 is typically assayed using fluorescent-based assays (see, e.g., Donato et al. DrugMetab Dispos. 32: 699- 706, 2004). In particular, the activity of a nicotine demethylase may be assayed as described herein using yeast microsome assays.

Identification of Modulators of a Tobacco Gene Product Isolation of a cDNA also facilitates the identification of molecules that increase or decrease expression the gene product. According to one approach, candidate molecules are added at varying concentrations to a culture medium of cells (for example, prokaryotic cells such as E. coli or eukaryotic cells such as yeast, mammalian, insect, or plant cells) expressing a tobacco mRNA. Gene product expression is then measured in the presence and absence of a candidate molecule using standard methods such as those set forth herein. Candidate modulators may be purified (or substantially purified) molecules or may be one component of a mixture of compounds. In a mixed compound assay, gene product expression is tested against progressively smaller subsets ofthe candidate compound pool (for example, produced by standard purification techniques, for example, HPLC) until a single compound or minimal compound mixture is demonstrated to alter tobacco nicotine demethylase gene expression, hi one embodiment ofthe invention, a molecule that promotes a decrease gene product expression is considered particularly desirable. Modulators found to be effective at the level of gene product expression or activity may be confirmed as useful in planta. For agricultural uses, the molecules, compounds, or agents identified using the methods disclosed herein may be used as chemicals applied as sprays or dusts on the foliage of plants. The molecules, compounds, or agents may also be applied to plants in combination with another molecule which affords some benefit to the plant.

Uses Regulation ofthe endogenous gene corresponding to any ofthe sequences described herein by, for example, gene silencing may result in more valuable plants or plant products. In particular, sequences identified herein as ethylene-induced or senescence-related (e.g., those having the sequence of SEQ ED NOS:4, 40, 44, 52, 54, 60, 70, 104, 138, 140, 158, 162, 188, 212, 226, 234, and 288 or a nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173- 1 to 173-294, or a fragment thereof) may be used to affect metabolic pathways involved in the formation of numerous secondary metabolites including terpenoids, polyphenols, alkaloids, etc. that affect end-product quality traits. Similarly the genes identified herein may be used to regulate metabolic pathways associated with the rate and type of dry matter accumulated during senescence or the partitioning of dry matter within the plant during senescence. Regulating the genes identified herein may also be used to affect metabolic pathways involved in determining senescence rates, the uniformity of senescence within a leaf and among leaves of a single plant, and the induction of senescence by agents or activities that stimulate or activate the genes identified herein, and, thereby, control the quality of a product or article of manufacture that includes a leaf or other plant component. The promoter region of a gene described herein may be used to drive expression of any desirable gene product to improve crop quality or enhance specific traits. A promoter that is inducible and expressed during a particular period ofthe plant's life cycle can be used in constructs for introduction into the plant to express unique genes involved in the biosynthesis of flavor and aroma products that result from secondary metabolites. A tobacco gene promoter may also be used to increase or modify the expression of structural carbohydrates or proteins that affect end-use properties. Further, a tobacco gene promoter could be combined with heterologous genes that include genes involved in the biosynthesis of nutritional products, pharmaceutical agents, or industrial materials. Regulation of a promoter sequence may also be used to downregulate endogenous tobacco genes, including genes involved in alkaloid biosynthesis and/or in other pathways. Desirably, a tobacco gene promoter region or other transcriptional regulatory region is used to alter chemical properties such as nornicotine content and nitrosamine levels in a plant. In addition, promoter motifs, which can readily be identified in a promoter sequence using standard methods in the art, may be used to identify factors that associate with or regulate the expression of a tobacco gene product, e.g., a p450. Moreover, any ofthe sequences ofthe present invention (e.g., the nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294, or fragments thereof) maybe used in methods that reduce gene expression or alter enzymatic activity of a gene product, such as a p450, using standard techniques described herein. Such techniques include, without limitation, RNA interference, triple strand interference, ribozymes, homologous recombination, virus-induced gene silencing, antisense and co- suppression technologies, expression of a dominant negative gene product, and the generation of mutated genes using standard mutagenesis techniques. For example, reducing p450 expression or altering p450 enzymatic activity may be used to alter fatty acids that are involved in plant-pathogen interactions and disease resistance or may be used to alter a plant's profile of selected fatty acids and thereby alter the flavor or aroma ofthe plant or plant component. Furthermore, using standard methods, any portion of a tobacco gene, including the promoter, the coding sequence, an intron, or a 3'UTR, or a fragment thereof, can be used as a genetic marker to isolate related genes, promoters or regulatory regions, for screening for the related gene in other tobacco or Nicotiana species, or for determining whether a plant has a mutation in a corresponding endogenous gene. A portion of a tobacco gene may also be used to monitor gene flow through a breeding effort to track intergression or loss of a particular gene. For example, Nicotiana tabacum is an allotetraploid, as are several ofthe other Nicotiana species, and the genetic markers could be used to identify homologous genes or related genes in the parental genome different from the genome in which the original gene resides. A marker for the related gene could be also be used to screen existing tobacco germplasm, segregating or synthetic populations created by hybridizations, populations created from mutagenic treatments or from various tissue culture methods. As such, the nucleic acid sequences described herein (e.g., the nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294, or fragments thereof) may be used to identify or affect genes involved in disease or insect resistance, flavor and aroma properties, herbicide tolerance, quality factors related to undesirable constituents, or that increase leaf yield, or affect leaf or plant components, such as lignins, cellulose, etc., related to structural traits or fiber content.

Products Tobacco products having a reduced amount of nitrosamine content are manufactured using any ofthe tobacco plant material described herein according to standard methods known in the art. In one embodiment, tobacco products are manufactured using tobacco plant material obtained from a cured tobacco plant. The cured tobacco plant may contain or have been bred to contain reduced nicotine demethylase activity. For example, the cured tobacco plant may be a tobacco plant resulting from a cross including a tobacco plant identified as having variant expression of nicotine demethylase. Desirably the tobacco product has a reduced amount of nornicotine or NNN of less than about 5 mg/g, 4.5 mg/g, 4.0 mg/g, 3.5 mg/g, 3.0 mg/g, 2.5 mg/g, 2.0 mg/g, 1.5 mg/g, 1.0 mg/g, 750 μg/g, 500 μg/g, 250 μg/g, 100 μg/g, 75 μg/g, 50 μg/g, 25 μg/g, 10 μg/g, 7.0 μg/g, 5.0 μg/g, 4.0 μg/g, 2.0 μg/g, 1.0 μg/g, 0.5 μg/g, 0.4 μg/g, 0.2 μg/g, 0.1 μg/g, 0.05 μg/g, or 0.01 μg/g or wherein the percentage of secondary alkaloids relative to total alkaloid content contained therein is less than 90%, 70%, 50%, 30%, 10%, 5%, 4%, 3%, 2%, 1.5%, 1%, 0.75%, 0.5%, 0.25%, or 0.1%. The phrase "a reduced amount" refers to an amount of nornicotine or NNN or both in a tobacco plant or plant component or a tobacco product that is less than what would be found in a wild-type tobacco plant or plant component or tobacco product from the same variety of tobacco, processed in the same manner, which was not made transgenic for reduced nornicotine or NNN. In one example, a wild-type tobacco plant ofthe same variety that has been processed in the same manner is used as a control to measure whether a reduction of nornicotine or NNN or both has been obtained by the methods described herein, hi another example, plants having a reduced amount of nitrosamine content are evaluated using standard methods, for instance, by monitoring the presence or absence of a gene or gene product, e.g., a nicotine demethylase, or a particular mutation in a gene. In still another example, nitrosamine content of plants resulting from a breeding program are compared to the nitrosamine content ofthe recipient line or donor line, or both, used to breed the plant having the reduced amount of nitrosamine. Other suitable controls known in the art are also used as needed. Levels of nornicotine and NNN or both are measured according to methods well known in the tobacco art. The following examples illustrate methods for carrying out the invention and should be understood to be illustrative of, but not limiting upon, the scope ofthe invention which is defined in the appended claims. Example 1 Development of Plant Tissue and Ethylene Treatment Plant Growth Plants were seeded in pots and grown in a greenhouse for 4 weeks. The 4- week old seedlings were transplanted into individual pots and grown in the greenhouse for 2 months. The plants were watered 2 times a day with water containing 150 ppm NPK fertilizer during growth. The expanded green leaves were detached from plants to do the ethylene treatment described below.

Cell Line 78379 Tobacco line 78379, which is a Burley tobacco line released by the University of Kentucky was used as a source of plant material. One hundred plants were cultured as standard in the art of growing tobacco, transplanted, and tagged with a distinctive number (1-100). Fertilization and field management were conducted as recommended. Three quarters ofthe 100 plants converted between 20 and 100% ofthe nicotine to nornicotine. One quarter ofthe 100 plants converted less than 5% ofthe nicotine to nornicotine. Plant number 87 had the least conversion (2%) while plant number 21 had 100% conversion. Plants converting less than 3% were classified as non-converters. Self-pollinated seed of plant number 87 and plant number 21, as well as crossed (21 x 87 and 87 x 21) seeds were made to study genetic and phenotypic differences. Plants from selfed 21 were converters, and 99% of selfs from 87 were non-converters. The other 1% ofthe plants from 87 showed low conversion (5-15%). Plants from reciprocal crosses were all converters.

Cell Line 4407 Nicotiana line 4407, which is a Burley line, was used as a source of plant material. Uniform and representative plants (100) were selected and tagged. Ofthe 100 plants 97 were non-converters and three were converters. Plant number 56 had the least amount of conversion (1.2%) and plant number 58 had the highest level of conversion (96%). Self-pollinated seeds and crossed seeds were made with these two plants. Plants from selfed-58 segregated with 3:1 converter to non-converter ratio. Plants 58-33 and 58-25 were identified as homozygous converter and nonconverter plant lines, respectively. The stable conversion of 58-33 was confirmed by analysis of its progeny.

Cell Line PBLB01 PBLB01 is a Burley line developed by ProfiGen, Inc. and was used as a source of plant material. The converter plant was selected from foundation seeds of PBLB01.

Ethylene Treatment Procedures Green leaves were detached from 2-3 month greenhouse grown plants and sprayed with 0.3% ethylene solution (Prep brand Ethephon (Rhone-Poulenc)). Each sprayed leaf was hung in a curing rack equipped with humidifier and covered with plastic. During the treatment, the sample leaves were periodically sprayed with the ethylene solution. Approximately 24-48 hour post ethylene treatment, leaves were collected for RNA extraction. Another sub-sample was taken for metabolic constituent analysis to determine the concentration of leaf metabolites and more specific constituents of interest such as a variety of alkaloids. As an example, alkaloids analysis could be performed as follows. Samples (0.1 g) were shaken at 150 rpm with 0.5 ml 2N NaOH, and a 5 ml extraction solution which contained quinoline as an internal standard and methyl t-butyl ether. Samples were analyzed on a HP 6890 GC equipped with a FED detector. A temperature of 250°C was used for the detector and injector. An HP column (30m-0.32nm-lmm) consisting of fused silica crosslinked with 5% phenol and 95% methyl silicon was used at a temperature gradient of 110-185°C at 10°C per minute. The column was operated at 100°C with a flow rate of 1 crrfrrάri¹ with a split ratio of 40:1 with a 2:1 injection volume using helium as the carrier gas. Example 2 RNA Isolation For RNA extractions, middle leaves from two-month old greenhouse grown plants were treated with ethylene as described above. The 0 and 24-48 hours samples were used for RNA extraction. In some cases, leaf samples under the senescence process were taken from the plants 10 days post flower-head removal. These samples were also used for extraction. Total RNA was isolated using Rneasy Plant Mini Kit^® (Qiagen, hie, Valencia, California) according to the manufacturer's protocol. The tissue sample was ground under liquid nitrogen to a fine powder using a

DEPC treated mortar and pestle. Approximately 100 milligrams of ground tissue were transferred to a sterile 1.5 ml Eppendorf tube. This sample tube was placed in liquid nitrogen until all samples were collected. Then, 450μl of Buffer RLT as provided in the kit (with the addition of Mercaptoethanol) was added to each individual tube. The sample was vortexed vigorously and incubated at 56°C for 3 minutes. The lysate was then applied to the QIAshredder^® spin column sitting in a 2 ml collection tube, and centrifuged for 2 minutes at maximum speed. The flow through was collected and 0.5 volume of ethanol was added to the cleared lysate. The sample was mixed well and transferred to an Rneasy^® mini spin column sitting in a 2 ml collection tube. The sample was centrifuged for 1 minute at 10,000rpm. Next, 700μl of buffer RW1 was pipetted onto the Rneasy^® column and centrifuged for 1 minute at 10,000rpm. Buffer RPE was pipetted onto the Rneasy^® column in a new collection tube and centrifuged for 1 minute at 10,000 rpm. Buffer RPE was again, added to the Rneasy^® spin column and centrifuged for 2 minutes at maximum speed to dry the membrane. To eliminate any ethanol carry over, the membrane was placed in a separate collection tube and centrifuged for an additional 1 minute at maximum speed. The Rneasy^® column was transferred into a new 1.5 ml collection tube, and 40 μl of Rnase-free water was pipetted directly onto the Rneasy^® membrane. This final elute tube was centrifuged for 1 minute at 10,000rpm. Quality and quantity of total RNA was analyzed by denatured formaldehyde gel and spectrophotometer. Poly(A)RNA was isolated using Oligotex^® poly A+ RNA purification kit (Qiagen Inc.) following the manufacturer's protocol. About 200 μg total RNA in 250 μl maximum volume was used. A volume of 250 μl of Buffer OBB and 15 μl of Oligotex^® suspension was added to the 250 μl of total RNA. The contents were mixed thoroughly by pipetting and incubated for 3 minutes at 70°C on a heating block. The sample was then placed at room temperature for approximately 20 minutes. The Oligotex^®: mRNA complex was pelleted by centrifugation for 2 minutes at maximum speed. All but 50 μl ofthe supernatant was removed from the microcentrifuge tube. The sample was treated further by OBB buffer. The Oligotex^®: mRNA pellet was resuspended in 400 μl of Buffer OW2 by vortexing. This mix was transferred onto a small spin column placed in a new tube and centrifuged for 1 minute at maximum speed. The spin column was transferred to a new tube and an additional 400 μl of Buffer OW2 was added to the column. The tube was then centrifuged for 1 minute at maximum speed. The spin column was transferred to a final 1.5 ml microcentrifuge tube. The sample was eluted with 60 μl of hot (70°C) Buffer OEB. Poly A product was analyzed by denatured formaldehyde gels and spectrophotometric analysis.

Example 3 Reverse-Transcription-PCR First strand cDNA was produced using Superscript reverse transcriptase following the manufacturer's protocol (Invitrogen, Carlsbad, California). The poly A+ enriched RNA/oligo dT primer mix consisted of less than 5 μg of total RNA, 1 μl of lOmM dNTP mix, 1 μl of Oligo d(T)_12-18 (0.5μg/μl), and up to 10 μl of DEPC- treated water. Each sample was incubated at 65°C for 5 minutes, then placed on ice for at least 1 minute. A reaction mixture was prepared by adding each ofthe following components in order: 2 μl 10X RT buffer, 4 μl of 25 mM MgCl₂, 2 μl of 0.1 M DTT, and 1 μl of RNase OUT Recombinant RNase Inhibitor. An addition of 9 μl of reaction mixture was pipetted to each RNA/primer mixture and gently mixed. It was incubated at 42°C for 2 minutes and 1 μl of Super Script H RT was added to each tube. The tube was incubated for 50 minutes at 42°C. The reaction was terminated at 70°C for 15 minutes and chilled on ice. The sample was collected by centrifugation and 1 μl of RNase H was added to each tube and incubated for 20 minutes at 37°C. The second PCR was carried out with 200 pmoles of forward primer and 100 pmoles reverse primer (mix of 18nt oligo d(T) followed by 1 random base). Reaction conditions were 94°C for 2 minutes and then 40 cycles of PCR at

94°C for 1 minute, 45°C to 60°C for 2 minutes, 72°C for 3 minutes, with a 72°C extension for an extra 10 min. Ten microliters ofthe amplified sample were analyzed by electrophoresis using a 1% agarose gel. The correct size fragments were purified from agarose gel.

Example 4 Generation of PCR Fragment Populations PCR fragments from Example 3 were ligated into a pGEM-T Easy Vector (Promega, Madison, Wisconsin) following the manufacturer's instructions. The ligated product was transformed into JM109 competent cells and plated on LB media plates for blue/white selection. Colonies were selected and grown in a 96 well plate with 1.2 ml of LB media overnight at 37°C. Frozen stock was generated for all selected colonies. Plasmid DNA was purified from plates using Beckman' s Biomeck 2000 miniprep robotics with Wizard SV Miniprep kit (Promega). Plasmid DNA was eluted with 100 μl water and stored in a 96 well plate. Plasmids were digested by

EcoRl and were analyzed using 1% agarose gel to confirm the DNA quantity and size of inserts. Plasmids containing a 400-600 bp insert were sequenced using a CEQ 2000 sequencer (Beckman, Fullerton, California). The sequences were aligned with GenBank database by BLAST search (see, e.g., Figures 159A to 159K). The p450 related fragments were identified and further analyzed. Alternatively, p450 fragments were isolated from subtraction libraries. These fragments were also analyzed as described above. Example 5 cDNA Library Construction A cDNA library was constructed by preparing total RNA from ethylene treated leaves as follows. First, total RNA was extracted from ethylene treated leaves of tobacco line 58-33 using a modified acid phenol and chloroform exfraction protocol. The protocol was modified to use one gram of tissue that was ground and subsequently vortexed in 5 ml of extraction buffer (100 mM Tris-HCl, pH 8.5; 200 mM NaCl; lOmM EDTA; 0.5% SDS) to which 5 ml phenol (pH 5.5) and 5 ml chloroform was added. The extracted sample was centrifuged and the supernatant was saved. This extraction step was repeated 2-3 times until the supernatant appeared clear. Approximately 5 ml of chloroform was added to remove trace amounts of phenol. RNA was precipitated from the combined supernatant fractions by adding a 3-fold volume of ethanol and 1/10 volume of 3M NaOAc (pH 5.2) and storing at - 20°C for 1 hour. After transfer to a Corex glass container the RNA fraction was centrifuged at 9,000 RPM for 45 minutes at 4°C. The pellet was washed with 70% ethanol and spun for 5 minutes at 9,000 RPM at 4°C. After drying the pellet, the pelleted RNA was dissolved in 0.5 ml RNase free water. The quality and quantity of total RNA was analyzed by denatured formaldehyde gel and specfrophotometer, respectively. The resultant total RNA was used to isolate poly A+ RNA using an Oligo(dT) cellulose protocol (Invitrogen) and microcentrifuge spin columns (Invitrogen) by the following protocol. Approximately twenty mg of total RNA was twice subjected to purification to obtain high quality poly A+ RNA. Poly A+ RNA product was analyzed by performing denatured formaldehyde gel and subsequent RT-PCR of known full-length genes to ensure high quality of mRNA. Next, poly A+ RNA was used as template to produce a cDNA library employing cDNA synthesis kit, ZAP-cDNA synthesis kit, and ZAP-cDNA Gigapack ET gold cloning kit (Sfratagene, La Jolla, California). The method involved following the manufacturer's protocol as specified. Approximately 8 μg of poly A+ RNA was used to construct cDNA library. Analysis ofthe primary library revealed about 2.5 x 10 - 1 x 10 pfu. A quality background test ofthe library was completed by complementation assays using EPTG and X-gal, where recombinant plaques was expressed at more than 100-fold above the background reaction. A more quantitative analysis ofthe library by random PCR showed that average size of insert cDNA was approximately 1.2 kb. The method used a two-step PCR method. For the first step, reverse primers were designed based on the preliminary sequence information obtained from p450 fragments. The designed reverse primers and T3 (forward) primers were used to amplify corresponding genes from the cDNA library. PCR reactions were subjected to agarose electrophoresis and the corresponding bands of high molecular weight were excised, purified, cloned and sequenced. In the second step, new primers designed from 5 'UTR or the start coding region of p450 as the forward primers together with the reverse primers (designed from 3'UTR of p450) were used in the subsequent PCR to obtain full-length p450 clones. The p450 fragments were generated by PCR amplification from the constructed cDNA library as described in Example 3 with the exception ofthe reverse primer. The T7 primer located on the plasmid downstream of cDNA inserts was used as a reverse primer. PCR fragments were isolated, cloned and sequenced as described in Example 4. Full-length p450 genes were isolated by this PCR method from constructed cDNA library. Gene specific reverse primers (designed from the downstream sequence of p450 fragments) and a forward primer (T3 on library plasmid) were used to clone the full-length genes. PCR fragments were isolated, cloned and sequenced. If necessary, a second PCR step was applied. In the second step, new forward primers designed from 5 'UTR of cloned p450s together with the reverse primers designed from 3'UTR of p450 clones were used in the subsequent PCR reactions to obtain full- length p450 clones. The clones were subsequently sequenced. Example 6 Characterization of Cloned Fragments - Reverse Southern Blotting Analysis Nonradioactive large-scale reverse Southern blotting assays were performed on all p450 clones identified in above examples to detect the differential expression. It was observed that the level of expression among different p450 clusters was very different. Further real time detection was conducted on those with high expression.

Nonradioactive Southern blotting procedures were conducted as follows. 1) Total RNA was extracted from ethylene treated and nontreated converter

(58-33) and nonconverter (58-25) leaves using the Qiagen Rnaeasy kit as described in Example 2. 2) A probe was produced by biotin-tail labeling a single strand cDNA derived from poly A+ enriched RNA generated in above step. This labeled single strand cDNA was generated by RT-PCR ofthe converter and nonconverter total RNA

(Invitrogen) as described in Example 3 with the exception of using biotinylated oligo dT as a primer (Promega). These were used as a probe to hybridize with cloned DNA. 3) Plasmid DNA was digested with restriction enzyme EcoRl and run on agarose gels. Gels were simultaneously dried and transferred to two nylon membranes (Biodyne B). One membrane was hybridized with converter probe and the other with nonconverter probe. Membranes were UV-crosslinked (auto crosslink setting, 254 nm, Stratagene, Sfratalinker) before hybridization. Alternatively, the inserts were PCR amplified from each plasmid using the sequences located on both arms of p-GEM plasmid, T3 and SP6, as primers. The PCR products were analyzed by running on a 96 well Ready-to-run agarose gels. The confirmed inserts were dotted on two nylon membranes. One membrane was hybridized with converter probe and the other with nonconverter probe. 4) The membranes were hybridized and washed following the manufacturer's instructions with the modification of washing stringency (Enzo MaxSence kit, Enzo Diagnostics, Ine, Farmingdale, NY). The membranes were prehybridized with hybridization buffer (2x SSC buffered formamide, containing detergent and hybridization enhancers) at 42°C for 30 min and hybridized with 10 μl denatured probe overnight at 42°C. The membranes then were washed in IX hybridization wash buffer 1 time at room temperature for 10 min and 4 times at 68°C for 15 min. The membranes were ready for the detection procedure. 5) The washed membranes were detected by alkaline phosphatase labeling followed by NBT/BCE? colometric detection as described in manufacturer's detection procedure (Enzo Diagnostics, Inc.). The membranes were blocked for one hour at room temperature with lx blocking solution, washed 3 times with IX detection reagents for 10 min, washed 2 times with lx predevelopment reaction buffer for 5 min and then developed the blots in developing solution for 30-45 min until the dots appear. All reagents were provided by the manufacturer (Enzo Diagnostics, fric). In addition, large-scale reverse Southern assay was also performed using KPL Southern hybridization and detection kit following the manufacturer's instructions (KPL, Gaithersburg, Maryland).

Example 7 Characterization of Clones - Northern Blot Analysis As an alternative to Southern blot analysis, some membranes were hybridized and detected as described in the example of Northern blotting assays. Northern hybridization was used to detect mRNA differentially expressed in Nicotiana as follows. A random priming method was used to prepare probes from cloned p450 (Megaprime DNA Labelling Systems, Amersham Biosciences). The following components were mixed: 25ng denatured DNA template; 4ul of each unlabeled dTTP, dGTP and dCTP; 5ul of reaction buffer; P³²-labelled dATP and 2ul of Klenow I; and H₂O, to bring the reaction to 50μl. The mixture was incubated in 37°C for 1-4 hours, and stopped with 2μl of 0.5 M EDTA. The probe was denatured by incubation at 95°C for 5 minutes before use. RNA samples were prepared from ethylene freated and non-treated fresh leaves of several pairs of tobacco lines. In some cases poly A+ enriched RNA was used. Approximately 15μg total RNA or 1.8μg mRNA (methods of RNA and mRNA extraction as described in Example 5) were brought to equal volume with DEPC H₂O (5-10 μl). The same volume of loading buffer (1 x MOPS; 18.5 % Formaldehyde; 50 % Formamide; 4 % Ficoll400; Bromophenolblue) and 0.5 μl EtBr (0.5 μg/μl) were added. The samples were subsequently denatured in preparation for separation ofthe RNA by electrophoresis. Samples were subjected to electrophoresis on a formaldehyde gel (1 % Agarose, 1 x MOPS, 0.6 M Formaldehyde) with 1XMOP buffer (0.4 M Morpholinopropanesulfonic acid; 0.1 M Na-acetate-3 x H2O; 10 mM EDTA; adjust to pH 7.2 with NaOH). RNA was transferred to a Hybond-N+ membrane (Nylon, Amersham Pharmacia Biotech) by capillary method in 10 X SSC buffer (1.5 M NaCl; 0.15 M Na-citrate) for 24 hours. Membranes with RNA samples were UV- crosslinked (auto crosslink setting, 254 nm, Stratagene, Sfratalinker) before hybridization. The membrane was prehybridized for 1-4 hours at 42°C with 5-10 ml prehybridization buffer (5 x SSC; 50 % Formamide; 5 x Denhardt's-solution; 1 % SDS; lOOμg/ml heat-denatured sheared non- homologous DNA). Old prehybridization buffer was discarded, and new prehybridization buffer and probe were added. The hybridization was carried out overnight at 42°C. The membrane was washed for 15 minutes with 2 x SSC at room temperature, followed by a wash with 2 x SSC. As illustrated in Table 1 below, Northern blots and reverse Southern Blot were useful in determining which genes were induced by ethylene treatment relative to non- induced plants. Interestingly, not all fragments were affected similarly in the converter and nonconverter. Some ofthe cytochrome p450 fragments were partially sequenced to determine their structural relatedness. This information was used to subsequently isolate and characterize full-length gene clones of interest. Table 1 : The Effect of Ethylene Treatment on mRNA Induction

Northern analysis was performed using full-length clones on tobacco tissue obtained from converter and nonconverter Burley lines that were induced by ethylene treatment. This analysis was used to identify full-length clones that showed elevated expression in ethylene induced converter lines relative- to ethylene induced converter lines relative to ethylene induced nonconverter Burley lines. By so doing, the functionality relationship of full-length clones may be determined by comparing biochemical differences in leaf constituents between converter and non-converter lines. As shown in Table 2 below, six clones showed significantly higher expression, as denoted by ++ and +++, in converter ethylene treated tissue in comparison to non- converter treated tissue, denoted by +. All of these clones showed little or no expression in converter and non-converter lines that were not ethylene freated.

Table 2: Clones with Elevated Expression in Converter Ethylene-Treated Tissue

Example 8 hnmunodetection of Polypeptides Encoded by the Cloned Genes Peptide regions corresponding to 20-22 amino acids in length from three p450 clones were selected for (1) having lower or no homology to other clones and (2) having good hydrophihcity and antigenicity. The amino acid sequences ofthe peptide regions selected from the respective p450 clones are listed below. The synthesized peptides were conjugated with KHL (keyhole limpet hemocyamn) and then injected into rabbits. Antisera were collected 2 and 4 weeks after the 4^th injection (Alpha Diagnostic Intl. hie. San Antonio, TX).

D234-AD1 DEDGSKSKLVKAHRKEDEILG (SEQ ED NO:2266) D90a-BB3 RDAFREKETFDENDVEELNY (SEQ ED NO: 163)

D89-AB 1 FKNNGDEDRHFSQKLGDLADKY (SEQ ED NO:2267)

Antisera were examined for crossreactivity to target proteins from tobacco plant tissue by Western Blot analysis. Crude protein extracts were obtained from ethylene freated (0 to 40 hours) middle leaves of converter and nonconverter lines. Protein concentrations ofthe extracts were determined using RC DC Protein Assay Kit (BIO-RAD) following the manufacturer's protocol. Two micrograms of protein were loaded onto each lane and the proteins were separated on 10% - 20% gradient gels using the Laemmli SDS-PAGE system. The proteins were transferred from gels to PROTRAN Nitrocellulose Transfer Membranes (Schleicher & Schuell) with the Trans-Blot Semi-Dry cell (BIO-RAD). Target ρ450 proteins were detected and visualized with the ECL Advance Western Blotting Detection Kit (Amersham Biosciences). Primary antibodies against the synthetic- KLH conjugates were made in rabbits. Secondary antibody against rabbit IgG, coupled with peroxidase, was purchased from Sigma. Both primary and secondary antibodies were used at 1:1000 dilutions. Antibodies showed strong reactivity to a single band on the Western Blots indicating that the antisera were monospecific to the target peptide of interest. Antisera were also crossreactive with synthetic peptides conjugated to KLH.

Example 9 Nucleic Acid Identity, Structure Relatedness of Isolated Nucleic Acid Fragments, and GeneChip^® Hybridization Over 100 cloned p450 fragments were sequenced in conjunction with Northern blot analysis to determine their structural relatedness. The approach used forward primers based either of two common p450 motifs located near the carboxyl-terminus ofthe p450 genes. The forward primers corresponded to cytochrome p450 motifs FXPERF (SEQ ED NO:2268) or GRRXCP(A/G) (SEQ ED NO:2269). The reverse primers used standard primers from either the plasmid, SP6 or T7 located on both arms of pGEM plasmid, or a poly A tail. The protocol used is described below. Spectrophotometry was used to estimate the concentration of starting double-sfranded DNA following the manufacturer's protocol (Beckman Coulter). The template was diluted with water to the appropriate concentration, denatured by heating at 95°C for 2 minutes, and subsequently placed on ice. The sequencing reaction was prepared on ice using 0.5 to lOμl of denatured DNA template, 2 μl of 1.6 pmole ofthe forward primer, 8 μl of DTCS Quick Start Master Mix and the total volume brought to 20 μl with water. The thermocycling program consisted of 30 cycles ofthe follow cycle: 96°C for 20 seconds, 50°C for 20 seconds, and 60°C for 4 minutes followed by holding at 4°C. The sequencing reaction was stopped by adding 5 μl of stop buffer (equal volume of 3M NaO Ac and 1 OOmM EDTA and 1 μl of 20 mg/ml glycogen). The sample was precipitated with 60 μl of cold 95% ethanol and centrifuged at 6000 x g for 6 minutes. Ethanol was discarded. The pellet was washed twice with 200 μl of cold 70% ethanol. After the pellet was dry, 40 μl of SLS solution were added and the pellet was resuspended. A layer of mineral oil was overlaid and the sample was placed on the CEQ 8000 Automated Sequencer for further analysis. To verify nucleic acid sequences, the nucleic acid sequence was re- sequenced in both directions using forward primers to the FXPERF (SEQ ED NO:2268) or GRRXCP(A/G)(SEQ ED NO:2269) region ofthe p450 gene or reverse primers to either the plasmid or poly A tail. All sequencing was performed at least twice in both directions. The nucleic acid sequences of cytochrome p450 fragments were compared to each other from the coding region corresponding to the first nucleic acid after the region encoding the GRRXCP(A/G) (SEQ ED NO:2269) motif through to the stop codon. This region was selected as an indicator of genetic diversity among p450 proteins. A large number of genetically distinct p450 genes, in excess of 70 genes, were observed, similar to that of other plant species. Upon comparison of nucleic acid sequences, it was found that the genes could be placed into distinct sequences groups based on their sequence identity. It was found that the best unique grouping of p450 members was determined to be those sequences with 75% nucleic acid identity or greater. (See e.g., Table 1 ofthe US 2004/0162420 patent application publication, which is incorporated herein by reference.) Reducing the percentage identity resulted in significantly larger groups. A preferred grouping was observed for those sequences with 81% nucleic acid identity or greater, a more preferred grouping 91% nucleic acid identity or greater, and a most preferred grouping for those sequences 99% nucleic acid identity of greater. Most ofthe groups contained at least two members and frequently three or more members. Others were not repeatedly discovered suggesting that approach taken was able to isolated both low and high expressing mRNA in the tissue used. Based on 75% nucleic acid identity or greater, two cytochrome p450 groups were found to contain nucleic acid sequence identity to previously tobacco cytochrome genes that are genetically distinct from those within the group. Group 23, showed nucleic acid identity, within the parameters used for Table 3A, to GenBank sequences G 1171579 (SEQ ED NO:2270) (CAA64635) and GL14423327 (SEQ ED NO:2271) (or AAK62346). GL1171579 (SEQ ED NO:2270) had nucleic acid identity to Group 23 members ranging 96.9% to 99.5% identity to members of Group 23 while GI: 14423327 (SEQ ED NO:2271) ranged 95.4% to 96.9% identity to this group. The members of Group 31 had nucleic acid identity ranging from 16.1% to 97.8% identity to the GenBank reported sequence of GI: 14423319 (SEQ ED NO:2272) (AAK62342). None ofthe other p450 identity groups of Table 3 A contained parameter identity, as used in Table 3A, to previously reported Nicotiana p450s genes. A consensus sequence with appropriate nucleic acid degenerate probes could be derived for a group to preferentially identify and isolate additional members of each group from Nicotiana plants.

Table 3A: Nicotiana p450 Nucleic Acid Sequence Identity Groups GROUP FRAGMENTS 1 D58-BG7 (SEQ ED NO: 10), D58-AB1 (SEQ ED NO: 12); D58-BE4 (SEQ ED NO: 16) 2 D56-AH7 (SEQ ED NO: 18); D13a-5 (SEQ ED NO:20) 3 D56-AG10 (SEQ ED NO:22); D35-33 (SEQ ED NO:24); D34-62 (SEQ ED NO:26) 4 D56-AA7 (SEQ ED NO:28); D56-AE1 (SEQ ED NO:30); 185-BD3 (SEQ ED NO:152) 5 D35-BB7 (SEQ ED NO:32); D177-BA7 (SEQ ED NO:34); D56A-AB6 (SEQ ED NO:36); D144-AE2 (SEQ ED NO:38) 6 D56-AG11 (SEQ HD NO:40); D179-AA1 (SEQ ED NO:42)

7 D56-AC7 (SEQ ED NO:44); D144-AD1 (SEQ ED NO:46)

8 D144-AB5 (SEQ ED NO:48)

9 D181-AB5 (SEQ ED NO:50); D73-AC9 (SEQ ED NO:52) 10 D56-AC12 (SEQ ED NO:54)

11 D58-AB9 (SEQ ED NO:56); D56-AG9 (SEQ DD NO:58); D56-AG6 (SEQ ED NO:60); D35-BG11 (SEQ ED NO:62); D35-42 (SEQ ED NO:64); D35-BA3 (SEQ ED NO:66); D34-57 (SEQ ED NO:68); D34-52 (SEQ ED NO:70); D34-25 (SEQ ED NO:72) 12 D56-AD10 (SEQ ED NO:74)

13 56-AA11 (SEQ ED NO:76)

14 D177-BD5 (SEQ ED NO:78); D177-BD7 (SEQ ED NO:92)

15 D56A-AG10 (SEQ DD NO:80); D58-BC5 (SEQ ED NO:82); D58- AD12 (SEQ ED NO:84) 16 D56-AC11 (SEQ ED NO:86); D35-39 (SEQ ED NO:88); D58-BH4

(SEQ ED NO:90); D56-AD6 (SEQ ED NO:96)

17 D73A-AD6 (SEQ ED NO:98); D70A-BA11 (SEQ ED NO: 100)

18 D70A-AB5 (SEQ ED NO: 104); D70A-AA8 (SEQ ED NO: 106)

19 D70A-AB8 (SEQ ED NO:108); D70A-BH2 (SEQ ED NO:l 10); D70A- AA4 (SEQ ED NO: 112)

20 D70A-BA1 (SEQ ED NO: 114); D70A-BA9 (SEQ ED NO: 116)

21 D70A-BD4 (SEQ ED NO:l 18)

22 D181-AC5 (SEQ ED NO:120); D144-AH1 (SEQ ED NO:122); D34-65 (SEQ ED NO: 124) 23 D35-BG2 (SEQ ID NO: 126)

24 D73A-AH7 (SEQ ED NO: 128)

25 D58-AA1 (SEQ ED NO:130); D185-BC1 (SEQ DD NO: 142); D185- BG2 (SEQ ED NO: 144)

26 D73-AE10 (SEQ ED NO:132) 27 D56-AC12 (SEQ ED NO:134)

28 D177-BF7 (SEQ ED NO:136); D185-BE1 (SEQ ED NO:146); D185- BD2 (SEQ ED NO: 148) 29 D73A-AG3 (SEQ ED NO: 138) 30 D70A-AA12 (SEQ ED NO:140); D176-BF2 (SEQ ED NO:94) 31 D176-BC3 (SEQ ED NO 154) 32 D176-BB3 (SEQ ED NO 156) 33 D186-AH4 (SEQ ED NO 14)

GeneChip microarray hybridization (Affymetrix Inc.; Santa Clara, CA) was used to identify genes with differential expression patterns between the converter and nonconverter near isogenic lines following ethylene activation. The chip size was 18 micron and the array format was 100-2187, accommodating 528 probe sets (11,628 probes). Seven pairs of hybridization were used to obtain independent verification of microarray results. These consisted of one pair (converter/nonconverter) of 4407- 33/4407-25 non-treated Burley tobacco samples, four pairs of ethylene treated 4407- 33/4407-25 samples, one pair of ethylene treated dark tobacco NL Madole/181 , another pair of lines near isogenic for nicotine conversion, and one pair of naturally senesced leaves of 4407=33/25 (Table 3B).

Table 3B. Converter onconverter normalized signal ratios from GeneChip hybridization Untreated Ethylene Treated Burley Ethylene Senescence Burley Treated Burley (4407-33/25) (4407-33/25) Dark (4407- (178/NL 33/25) Madole) Exp 1 Exp 2 Exp 3 Exp 4 Induced

D121-AA8 1.03 2.143 12.90 5.17 12.19 16.60 2.57 D120-AH4 1.44 1.90 12.74 2.87 7.55 8.17 1.69 D35-BG11 1.73 2.32 13.06 22.22 19.10 28.76 3.40 Control

Actin-Like I (5') 1.18 0.99 0.74 0.73 0.57 1.02 0.97 Actin-Like l (3') 1.09 1.12 0.81 1.08 0.79 0.93 0.85

All 14 sets of hybridizations were successful as evidenced by the Expression Report generated using detection instruments by Genome Explorations, hie. (Memphis, TN). The main reports included analyses of Noise, Scale factor, background, total probe sets, number and percentage of present and absent probe sets, signal intensity of housekeeping controls. The data were subsequently analyzed and presented using software GCOS in combination with other software. Signal comparisons between freatment pairs were made, and overall data for all respective probes for all hybridizations were compiled and the expression data were also analyzed. Results based on the signal intensities showed that only two genes, D121- AA8 and D120-AH4 and one fragment, D35-BG11, which is a partial fragment of D121-AA8, had reproducible induction in ethylene-freated converter lines when compared to non-converter lines. The signal of a gene in a converter line, for example, Burley tobacco variety 4407-33, was determined as the ratio to the signal of a gene in a related non-converter isogenic line, 4407-25. Without ethylene treatment, the ratio of converter to non-converter signals for all genes approached 1.00. To eliminate the influence of background differences, normalized signal ratios were also calculated. Normalized signal ratios are obtained by dividing the treated pair ratio with the corresponding non-pair ratio. Upon ethylene treatment and analysis, it was determined that two genes, D121-AA8 and D120-AH4, were induced in converter lines relative to non-converter lines as determined by four independent analyses. These two genes share 99.8% relative homology and their relative hybridization signals in converter varieties ranged from approximately 2 to 22 fold higher than the signals in their non-converter counterparts. Based on the normalized ratios, two actin- like, internal control clones, were not induced in converter lines. In addition, a fragment (D35-BG11), whose coding region is entirely contained in both the D121- AA8 and D120-AH4 genes, was highly induced in the same samples of paired isogenic converter and nonconverter lines. Furthermore, D121-AA8 and D120-AH4 genes were strongly induced in converter lines of isogenic dark tobacco pairs, NL Madole and 181 (8 to 28 fold), thus demonstrating that ethylene induction of these genes in converter lines was an in planta response. The same genes were identified in the comparisons made from hybridizations of naturally senesced samples of 4407- 33/25 as well. RT-PCR assays of these materials using primers specific for D121- AA8 verified the microarray results for this gene. Based on these results, the D121-AA8 gene (the cDNA sequence of which is the sequence of SEQ ED NO: 5; Figure 4) was identified as the tobacco nicotine demethylase gene of interest. In view ofthe p450 nomenclature rule, it was determined that D121-AA8 is most similar to the p450s in the CYP82E family (The Arabidopsis Genome Initiative (AGI) and The Arabidopsis Information Resource (TATR); Frank, Plant Physiol. 110:1035-1046, 1996; Whitbred et al., Plant Physiol. 124:47-58, 2000); Schopfer and Ebel, Mol. Gen. Genet. 258:315-322, 1998; and Takemoto et al., Plant Cell Physiol. 40: 1232-1242, 1999). Example 10 Biochemical Analysis of Enzymatic Activity Biochemical analysis, for example, as described in previously filed applications that are incorporated herein by reference, determined that the sequence of SEQ ED NO:5 encodes a tobacco nicotine demethylase (SEQ ED NO:3; Figures 3 and

4). hi particular, the function of candidate clone D121-AA8 was confirmed as the coding gene for nicotine demethylase, by assaying enzyme activity of heterologously expressed p450 in yeast cells as follows.

1. Construction of Yeast Expression Vector The putative protein-coding sequence ofthe tobacco nicotine demethylase- encoding cDNA (D121-AA8), D120-AH4, D121-AA8, 208-AC-8, and D208-AD9, were cloned into the yeast expression vector pYeDP60. Appropriate BamHI and Mfel sites (underlined below) were introduced via PCR primers containing these sequences either upstream ofthe translation start codon (ATG) or downstream ofthe stop codon (TAA). The Mfel on the amplified PCR product is compatible with the EcoRI site on the vector. The primers used to amplify the D121-AA8 cDNA were 5'- TAGCTACGCGGATCCATGCTTTCTCCCATAGAAGCC-3' (SEQ ED NO:2194) and 5'-

CTGGATCACAATTGTTAGTGATGGTGATGGTGATGCGATCCTCTATAAAG CTCAGGTGCCAGGC-3' (SEQ ED NO:2297). A segment of sequence coding nine extra amino acids at the C-terminus ofthe protein, including six histidines, was incorporated into the reverse primer to facilitate expression of 6-His tagged p450 upon induction. PCR products were ligated into p YeDP60 vector after enzyme digestions in the sense orientation with reference to the GALIO-CYCI promoter. Proper construction ofthe yeast expression vectors was verified by restriction enzyme analysis and DNA sequencing, hi addition, expression ofthe p450 proteins was visualized on SDS-PAGE gel electrophoresis for the detergent phase ofthe yeast micorsomes. The predicted size ofthe p450 proteins is 59 kD, based on the gene sequence; a result that was confirmed by the gel analysis. 2. Yeast Transformation The WAT11 yeast line, modified to express Arabidopsis NADPH-cytochrome p450 reductase ATR1, was transformed with the pYeDP60-p450 cDNA plasmids. Fifty micro-liters of WAT 11 yeast cell suspension was mixed with ~1 μg plasmid DNA in a cuvette with 0.2-cm electrode gap. One pulse at 2.0 kV was applied by an Eppendorf electroporator (Model 2510). Cells were spread onto SGI plates (5 g/L bactocasamino acids, 6.7 g/L yeast nitrogen base without amino acids, 20 g/L glucose, 40 mg/L DL-tryptophan, 20 g/L agar). Transformants were confirmed by PCR analysis performed directly on randomly selected colonies.

3. p450 Expression in Transformed Yeast Cells Single yeast colonies were used to inoculate 30 mL SGI media (5 g/L bactocasamino acids, 6.7 g/L yeast nitrogen base without amino acids, 20 g/L glucose, 40 mg/L DL-tryptophan) and grown at 30°C for about 24 hours. An aliquot of this culture was diluted 1 :50 into 1000 mL of YPGE media (10 g/L yeast extract, 20 g/L bacto peptone, 5 g/L glucose, 30 ml/L ethanol) and grown until glucose was completely consumed as indicated by the colorimetric change of a Diastix urinalysis reagent strip (Bayer, Elkhart, ESf). Induction of cloned P450 was initiated by adding DL-galactose to a final concentration of 2%. The cultures were grown for an additional 20 hours before used for in vivo activity assay or for microsome preparation. WAT11 yeast cells expressing pYeDP60-CYP71D20 (a p450 catalyzing the hydroxylation of 5-e_/?t-aristolochene and 1-deoxycapsidiol in Nicotiana tabacum) were used as confrol for the p450 expression and enzyme activity assays. To evaluate the effectiveness ofthe yeast expression ofthe p450 in great detail, reduced CO difference spectroscopy was performed. The reduced CO spectrum exhibited a peak at 450 nm proteins from all four p450 transformed yeast lines. No similar peaks were observed in control microsomes derived from control, untransformed yeast cells or the blank, vector control yeast cells. The results indicated that p450 proteins were expressed effectively in yeast lines harboring the pYeDP60-CYP 450. Concentrations of expressed p450 protein in yeast microsome ranged from 45 to 68 nmole/mg of total protein.

4. In Vivo Enzyme Assay The nicotine demethylase activity in the transformed yeast cells were assayed by feeding of yeast culture with DL-Nicotine (Pyrrolidine-2-¹⁴C). ¹⁴C labeled nicotine (54 mCi/mmol) was added to 75 μl ofthe galactose-induced culture for a final concentration of 55 μM. The assay culture was incubated with shaking in 14 ml polypropylene tubes for 6 hours and was extracted with 900 μl methanol. After spinning, 20 μl ofthe methanol extract was separated with an rp-HPLC and the nornicotine fraction was quantitated by LSC. The confrol culture of WAT 11 (pYeDP60-CYP71D20) did not convert nicotine to nornicotine, showing that the WAT11 yeast strain does not contain endogenous enzyme activities that can catalyze the step of nicotine bioconversion to nornicotine. In contrast, yeast expressing the tobacco nicotine demethylase gene produced detectable amount of nornicotine, indicating the nicotine demethylase activity ofthe translation product of SEQ ED NO:4 or SEQ ID NO:5.

5. Yeast Microsome Preparation After induction by galactose for 20 hours, yeast cells were collected by centrifugation and washed twice with TES-M buffer (50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 0.6 M sorbitol, 10 mM 2-mercaptoethanol). The pellet was resuspended in extraction buffer (50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 0.6 M sorbitol, 2 mM 2- mercaptoethanol, 1% bovine serum album, Protease Inhibitor Cocktail (Roche) at 1 tablet/50 ml). Cells were then broken with glass beads (0.5 mm in diameter, Sigma) and the cell extract was centrifuged for 20 min at 20,000 x g to remove cellular debris. The supernatant was subjected to ulfracentrifugation at 100,000 x g for 60 min and the resultant pellet contained the microsomal fraction. The microsomal fraction was suspended in TEG-M buffer (50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 20% glycerol and 1.5 mM 2-mercaptoethanol) at protein concentration of 1 mg/mL. Microsomal preparations were stored in a liquid nitrogen freezer until use.

6. Enzyme Activity Assay in Yeast Microsomal Preparations Nicotine demethylase activity assays with yeast microsomal preparations were performed. In particular, DL-Nicotine (Pyrrolidine-2-¹⁴C) was obtained from Moravek Biochemicals and had a specific activity of 54 mCi/mmol. Chlorpromazine (CPZ) and oxidized cytochrome c (cyt. C), both P450 inhibitors, were purchased from Sigma. The reduced form of nicotinamide adenine dinucleotide phosphate (NADPH) is the typical electron donor for cytochrome P450 via the NADPHxytochrome P450 reductase. NADPH was omitted for confrol incubation. The routine enzyme assay included microsomal proteins (around 1 mg/ml), 6 mM NADPH, and 55 μM ¹⁴C labeled nicotine. The concentration of CPZ and Cyt. C, when used, was 1 mM and 100 μM, respectively. The reaction was carried at 25°C for 1 hour and was stopped with the addition of 300 μl methanol to each 25 μl reaction mixture. After centrigugation, 20 μl ofthe methanol extract was separated with a reverse-phase High Performance Liquid Chromatography (HPLC) system (Agilent) using an friertsil ODS- 3 3 μ (150 x 4.6 mm) chromatography column from Varian. The isocratic mobile phase was the mixture of methanol and 50 mM potassium phosphate buffer, pH 6.25, with ratio of 60:40 (v/v) and the flow rate was 1 ml/min. The nornicotine peak, as detemiined by comparison with authentic non-labeled nornicotine, was collected and subjected to 2900 tri-carb Liquid Scintillation Counter (LSC) (Perkin Elmer) for quantification. The activity of nicotine demethylase is calculated based on the production of ¹⁴C labeled nornicotine over 1 hour incubation. p450-like activity was observed in microsomal preparations from confrol yeast cells expressing CYP71D20 and the three test p450 yeast cultures transformed with the genes D120-AH4, D208-AC8, and D208-AD9. However, the control and the three test p450s did not show any nornicotine conversion formation suggesting that they did not contain an endogenous or induced enzyme that can catalyze the demethylation of nicotine. In contrast, results from HPLC and LSC analyses showed detectable quantities of nornicotine produced from the demethylation of nicotine using microsomal samples obtained from yeast cells expressing the tobacco nicotine demethylase gene (D121-AA8). These results indicate that the nicotine demethylase activity results from the D121-AA8 gene product. The nicotine demethylase activity required NADPH and was shown to be inhibited by p450 specific inhibitors, consistent with tobacco nicotine demethylase being a p450. The enzyme activity for tobacco nicotine demethylase (D121-AA8) was approximately 10.8pKat/mg protein as calculated by radioactive intensity and protein concentrations. A typical set of enzyme assay results obtained for the yeast cells is shown in the following table (Table 4).

Table 4: DEMETHYLASE ACTIVITY TN MICROSOMES OF YEAST CELLS EXPRESSING D121-AA8 AND CONTROL P450 GENES

*n=12, others n=3

Omission of NADPH from the assay using microsomes derived from D121- AA8 yeast cells resulted in the abolishment of nicotine demethylase activity; hence no nornicotine was formed (Table 4). When two known P450 inhibitors, Chlorpromazine (CPZ, 1 mM) and oxidized cytochrome c (cyt C, 100 μM,) were added into the enzyme assay mixtures separately and incubated for 1 hour before adding the methanol stop solution, nicotine demethylase activities were decreased significantly (Table 4). Together these experiments demonstrated that D121-AA8 encodes a cytochrome p450 protein that catalyzes the conversion of nicotine to nornicotine when expressed in yeast. Example 11 Related Amino Acid Sequence Identity of Isolated Nucleic Acid Fragments The amino acid sequences of nucleic acid sequences obtained for cytochrome p450 fragments from Example 8 were deduced. The deduced region corresponded to the amino acid immediately after the GXRXCP(A G) (SEQ ED NO:2273) sequence motif to the end ofthe carboxyl-terminus, or stop codon. Upon comparison of sequence identity ofthe fragments, a unique grouping was observed for those sequences with 70% amino acid identity or greater. A preferred grouping was observed for those sequences with 80% amino acid identity or greater, more preferred with 90% amino acid identity or greater, and a most preferred grouping for those sequences 99% amino acid identity of greater. Several ofthe unique nucleic acid sequences were found to have complete amino acid identity to other fragments and therefore only one member with the identical amino acid was reported. The amino acid identity for Group 19 of Table 5 corresponded to three distinct groups based on their nucleic acid sequences. The amino acid sequence of group members and their identity is shown in Figure 159H. The amino acid differences are indicated. At least one member of each amino acid identity group was selected for gene cloning and functional studies using plants, hi addition, group members that are differentially affected by ethylene treatment or other biological differences as assessed by Northern and Southern analysis were selected for gene cloning and functional studies. To assist in gene cloning, expression studies and whole plant evaluations, peptide specific antibodies can be prepared based on sequence identity and differential sequence.

Table 5: Nicotiana p450 Amino Acid Sequence Identity Groups

GROUP FRAGMENTS

I D58-BG7(SEQEDNO:ll),D58-ABl (SEQEDNO:13) 2 D58-BE4(SEQEDNO:17)

3 D56-AH7 (SEQ ED NO: 19); D13a-5 (SEQ ED NO:21)

4 D56-AG10 (SEQ DD NO:23); D34-62 (SEQ ED NO:27)

5 D56-AA7 (SEQ ED NO:29); D56-AE1 (SEQ ED NO:31); 185-BD3 (SEQ ED NO: 153) 6 D35-BB7(SEQEDNO:33);D177-BA7(SEQEDNO:35);D56A-AB6(SEQ

ED NO:37); D144-AE2 (SEQ ED NO:39)

7 D56-AG11 (SEQ ED NO:41); D179-AA1 (SEQ ED NO:43)

8 D56-AC7 (SEQ ED NO:45); D144-AD1 (SEQ ED NO:47)

9 D144-AB5 (SEQ ED NO:49) 10 D181-AB5(SEQEDNO:51);D73-AC9(SEQEDNO:53)

I I D56-AC12 (SEQ ED NO:55)

12 D58-AB9 (SEQ ED NO:57); D56-AG9 (SEQ ED NO:59); D56-AG6 (SEQ ED NO:61); D35-BG11 (SEQ ED NO:63); D35-42 (SEQ ED NO:65); D35-BA3 (SEQ ED NO:67); D34-57 (SEQ ED NO:69); D34-52 (SEQ ED NO:71) 13 D56AD10(SEQEDNO:75)

14 D56-AA11 (SEQ ED NO:77)

15 D177-BD5 (SEQ ED NO:79); D177-BD7 (SEQ ED NO:93)

16 D56A-AG10 (SEQ ED NO:81); D58-BC5 (SEQ ED NO:83); D58-AD12 (SEQ ED NO:85) 17 D56-AC11 (SEQ ED NO:87); D56-AD6 (SEQ ED NO:97)

18 D73 A-AD6 (SEQ ED NO:99)

19 D70A-AB5 (SEQ ED NO: 105); D70A-AB8 (SEQ ED NO: 109); D70A-BH2 (SEQ ED NO: 111); D70A-AA4 (SEQ ED NO: 113); D70A-BA1 (SEQ ED NO: 115); D70A-BA9 (SEQ ED NO: 117) 20 D70A-BD4 (SEQ ED NO: 119) 21 D181-AC5 (SEQ ID NO:121); D144-AH1 (SEQ ED NO:123); D34-65 (SEQ ED NO: 125)

22 D35-BG2 (SEQ ED NO: 127)

23 D73 A-AH7 (SEQ ED NO: 129) 24 D58-AAl (SEQ ED NO:131); D185-BCl (SEQ ED NO:143); D185-BG2 (SEQ ED NO: 145)

25 D73-AE10 (SEQ ED NO:133)

26 D56-AC12 (SEQ ED NO:135)

27 D177-BF7 (SEQ ED NO: 137); 185-BD2 (SEQ ED NO: 149) 28 D73A-AG3 (SEQ ED NO:139)

29 D70A-AA12 (SEQ ED NO:141); D176-BF2 (SEQ ED NO:95)

30 D176-BC3 (SEQ JD NO: 155)

31 D176-BB3 (SEQ ED NO:157)

32 D186-AH4 (SEQ ED NO:15)

Example 12 Related Amino Acid Sequence Identity of Full-Length Clones The nucleic acid sequence of full-length Nicotiana genes cloned in Example 5 were deduced for their entire amino acid sequence. Cytochrome p450 genes were identified by the presence of three conserved p450 domain motifs, which corresponded to UXXRXXZ (SEQ ED NO:2274), PXRFXF (SEQ ED NO:2275) or GXRXC (SEQ ED NO:2276) at the carboxyl-terminus where U is E or K, X is any amino acid and Z is P, T, S or M. All p450 genes were characterized for amino acid identity using a BLAST program comparing their full-length sequences to each other and to known tobacco genes. The program used the NCBI special BLAST tool (Align two sequences (bl2seq), http://www.ncbi.nlm.nih.gov last/bl2seq/bl2.html). Two sequences were aligned under BLASTN without filter for nucleic acid sequences and BLASTP for amino acid sequences. Based on their percentage amino acid identity, each sequence was grouped into identity groups where the grouping contained members that shared at least 85% identity with another member. A preferred grouping was observed for those sequences with 90% amino acid identity or greater, a more preferred grouping had 95% amino acid identity or greater, and a most preferred grouping had those sequences 99% amino acid identity or greater. Using these criteria, 25 unique groups were identified and are depicted in Table 6. The amino acid sequence ofthe full-length nicotine demethylase gene was deduced to have the sequence provided in SEQ DD NO:5 (Figure 4). Within the parameters used for Table 6 for amino acid identity, three groups were found to contain greater than 85% or greater identity to known tobacco genes. Members of Group 5 had up to 96% amino acid identity for the full-length sequence to GenBank sequence GI: 14423327 (SEQ ED NO:2271) (or AAK62346). Group 23 had up to 93% amino acid identity to G 14423328 (SEQ ED NO:2277) (or

AAK62347) and Group 24 had 92% identity to GI: 14423318 (SEQ ED NO:2278) (or AAK62343).

Table 6: Amino Acid Sequence Identity Groups of FuU-Length Nicotiana p450 Genes 1 D208-AD9 (SEQ ED NO:233); D120-AH4 (SEQ E NO:189); D121-AA8

(SEQ ED NO: 191), D122-AF10 (SEQ ED NO: 193); D103-AH3 (SEQ ED NO:231); D208-AC8 (SEQ ED NO:227); D235-AB1 (SEQ ED NO:255) 2 D244-AD4 (SEQ ED NO:259); D244-AB6 (SEQ ED NO:283) ; D285-AA8

(SEQ ED NO:2205); D285-AB9 (SEQ ED NO:2206); D268-AE2 (SEQ ED NO:279) 3 D100A-AC3 (SEQ ED NO: 177); D100A-BE2 (SEQ ED NO:2209)

4 D205-BE9 (SEQ ED NO:285); D205-BG9 (SEQ ED NO:211); D205-AH4 (SEQ ED NO:303)

5 D259-AB9 (SEQ ED NO:269) ; D257-AE4 (SEQ ED NO:277); D147-AD3 (SEQ ED NO:203) 6 D249-AE8 (SEQ ED NO:265); D-248-AA6 (SEQ ED NO:263)

7 D233-AG7 (SEQ ED NO:275); D224-BD11 (SEQ ED NO:249); DAF10

8 D105-AD6 (SEQ ED NO:181); D215-AB5 (SEQ ED NO:229); D135-AE1 (SEQ ED NO:199)

9 D87A-AF3 (SEQ ED NO:225), D210-BD4 (SEQ ED NO:273) 10 D89-AB1 (SEQ ED NO:159); D89-AD2 (SEQ ED NO:161); D163-AG11 (SEQ ED NO:207); D163-AF12 (SEQ ED NO:205) 11 D267-AF10 (SEQ ED NO:305); D96-AC2 (SEQ ED NO: 169); D96-AB6 (SEQ ED NO:167); D207-AA5 (SEQ ED NO:213); D207-AB4 (SEQ ED NO:215); D207- AC4 (SEQ ED NO:217)

12 D98-AG1 (SEQ ED NO:173); D98-AA1 (SEQ ED NO:171) 13 D209-AA12 (SEQ ED NO:221); D209-AA11; D209-AH10 (SEQ ED NO:223); D209-AH12 (SEQ ED NO:241); D90A-BB3 (SEQ ED NO: 163)

14 D129-AD10 (SEQ ED NO: 197); D104A-AE8 (SEQ ED NO:179)

15 D228-AH8 (SEQ ED NO:253); D228-AD7 (SEQ ED NO:251), D250-AC11 (SEQ ED NO:267); D247-AH1 (SEQ ED NO:261) 16 D128-AB7 (SEQ ED NO:195) ; D243-AA2 (SEQ ED NO:257); D125-AFll (SEQ ED NO:237)

17 D284-AH5 (SEQ HD NO: 307); D110-AF12 (SEQ ED NO:185)

18 D221-BB8 (SEQ ED NO:243)

19 D222-BH4 (SEQ ED NO:245) 20 D134-AE11 (SEQ ED NO:239)

21 D109-AH8 (SEQ ED NO:183)

22 D136-AF4 (SEQ ED NO:287)

23 D237-AD1 (SEQ ED NO:235)

24 D112-AA5 (SEQ ED NO:187) 25 D283-AC1 (SEQ ED NO:281)

The full-length genes were further grouped based on the highly conserved amino acid homology between UXXRXXZ p450 domain (SEQ ED NO:2274) and GXRXC ρ450 domain (SEQ ED NO:2276) near the end the carboxyl-terminus. As shown in Figures 160A to 160E, individual clones were aligned based on the sequence homology between the conserved domains and placed in distinct identity groups, hi several cases, although the nucleic acid sequence ofthe clone was unique, the amino acid sequence for the region was identical. The preferred grouping was observed for those sequences with 90% amino acid identity or greater, a more preferred group had 95%o amino acid identity or greater, and a most preferred grouping had those sequences 99%> amino acid identity of greater. The final grouping was similar to that based on the percent identity for the entire ammo acid sequence ofthe clones except for Group 17 (of Table 6) which was divided into two distinct groups. Within the parameters used for amino acid identity in Table 7, three groups were found to contain 90%) or greater identity to known tobacco genes. Members of Group 5 had up to 93.4% amino acid identity for full length sequences to the

GenBank sequence of GI: 14423326 (SEQ ED NO:2279) (or AAK62346). Group 23 had up to 91.8% amino acid identity to GI: 14423328 (SEQ ED NO:2277) (or AAK62347) and Group 24 had 98.8% identity to GL14423318 (SEQ ED NO:2278) (or AAK62342).

Table 7: Amino Acid Sequence Identity Groups of Regions between Conserved Domains of Nicotiana p450 Genes

1 D208-AD9 (SEQ ED NO:233); D120-AH4 (SEQ ED NO:189); D121-AA8 (SEQ ED NO:191), D122-AF10 (SEQ ED NO:193); D103-AH3 (SEQ ED NO:231); D208-AC8 (SEQ ED NO:227); D235-AB1 (SEQ ED NO:255)

2 D244-AD4 (SEQ ED NO:259); D244-AB6 (SEQ ED NO:283) ; D285-AA8 (SEQ ED NO:2205); D285-AB9 (SEQ ED NO:2206); D268-AE2 (SEQ ED NO:279)

3 D100A-AC3 (SEQ ED NO: 177); D100A-BE2 (SEQ ED NO:2209)

4 D205-BE9 (SEQ ED NO:285); D205-BG9 (SEQ ED NO:211); D205-AH4 (SEQ ED NO:303)

5 D259-AB9 (SEQ ED NO:269) ; D257-AE4 (SEQ ED NO:277); D147-AD3 (SEQ ED NO:203)

6 D249-AE8 (SEQ ED NO:265); D-248-AA6 (SEQ ED NO:263)

7 D233-AG7 (SEQ ED NO:275); D224-BD11 (SEQ ED NO:249); DAF10 8 D105-AD6 (SEQ ED NO:181); D215-AB5 (SEQ ED NO:229); D135-AE1

(SEQ ED NO: 199)

9 D87A-AF3 (SEQ ED NO:225), D210-BD4 (SEQ ED NO:273)

10 D89-AB1 (SEQ ED NO:159); D89-AD2 (SEQ ED NO:161); D163-AG11 (SEQ ED NO:207); D163-AF12 (SEQ ED NO:205) 11 D267-AF10 (SEQ ED NO:305); D96-AC2 (SEQ ED NO:169); D96-AB6 (SEQ ED NO:167); D207-AA5 (SEQ ED NO:213); D207-AB4 (SEQ DD NO:215); D207- AC4 (SEQ ED NO:217)

12 D98-AG1 (SEQ ED NO:173); D98-AA1 (SEQ ED NO:171) 13 D209-AA12 (SEQ ED NO:221); D209-AA11; D209-AH10 (SEQ ED NO:223); D209-AH12 (SEQ ED NO:241); D90A-BB3 (SEQ ED NO:163)

14 D129-AD10 (SEQ ED NO: 197); D104A-AE8 (SEQ ED NO:179)

15 D228-AH8 (SEQ ED NO:253); D228-AD7 (SEQ E NO:251), D250-AC11 (SEQ ED NO:267); D247-AH1 (SEQ ED NO:261) 16 D128-AB7 (SEQ ED NO: 195) ; D243-AA2 (SEQ ED NO:257); D125-AF11 (SEQ ED NO:237)

17 D284-AH5 (SEQ ED NO: 307); D110-AF12 (SEQ ED NO:185)

18 D221-BB8 (SEQ ED NO:243)

19 D222-BH4 (SEQ ED NO:245) 20 D134-AE11 (SEQ ED NO:239)

21 D109-AH8 (SEQ ED NO:183)

22 D136-AF4 (SEQ ED NO:285)

23 D237-AD1 (SEQ ED NO:235)

24 D112-AA5 (SEQ ED NO:187) 25 D283-AC1 (SEQ ED NO:281)

26 D110-AF12 (SEQ ED NO:185)

Example 13 Nicotiana Cytochrome P450 Clones Lacking One or More ofthe Tobacco P450 Specific Domains Four clones had high nucleic acid homology, ranging 90% to 99%> nucleic acid homology, to other tobacco cytochrome genes reported in Table 6. The four clones included D136-AD5 (SEQ ED NO:292), D138-AD12 (SEQ ED NO:294), D243-AB3 (SEQ DD NO:298) and D250-AC11 (SEQ ED NO:300). However, due to a nucleotide frameshift, these genes did not contain one or more of three C-terminus cytochrome p450 domains and were excluded from identity groups presented in Table 6 or Table 7. The amino acid identity of one clone, D95-AG1, did not contain the third domain, GXRXC (SEQ ED NO:2276), used to group p450 tobacco genes in Table 6 or Table 7. The nucleic acid sequence of this clone had low homology to other tobacco cytochrome genes and, therefore, this clone represents a novel group of cytochrome p450 genes in Nicotiana.

Example 14 Use of Nicotiana Cytochrome P450 Fragments and Clones in Altered Regulation of Tobacco Qualities The use of tobacco p450 nucleic acid fragments or whole genes are useful in identifying and selecting those plants that have altered tobacco phenotypes or tobacco constituents and, more importantly, altered metabolites. Transgenic tobacco plants are generated by a variety of transformation systems that incorporate nucleic acid fragments or full-length genes, selected from those reported herein, in orientations for either down-regulation, for example anti-sense orientation, or over-expression for example, sense orientation and the like. For over-expression to full-length genes, any nucleic acid sequence that encodes the entire or a functional part or amino acid sequence ofthe full-length genes described in this invention is desirable. Such nucleic acid sequences desirably are effective for increasing the expression of a certain enzyme and thus resulting in phenotypic effect within Nicotiana. Nicotiana lines that are homozygous are obtained through a series of backcrossing and assessed for phenotypic changes including, but not limited to, analysis of endogenous p450 RNA, transcripts, p450 expressed peptides and concentrations of plant metabolites using techniques commonly available to one having ordinary skill in the art. The changes exhibited in the tobacco plants provide information on the functional role ofthe selected gene of interest or are of use as preferred Nicotiana plant species. Example 15 Cloning ofthe Genomic Tobacco Nicotine Demethylase from Converter Burley Tobacco Genomic DNA was extracted from converter Burley tobacco plant line 4407-33 (a Nicotiana tabacum variety 4407 line) using Qiagen Plant Easy kit as described in above Examples (see also the manufacturer's procedure). The primers were designed based on the 5' promoter and 3' UTR region cloned in previous examples. The forward primers were 5'-GGC TCT AGA TAA ATC TCT TAA GTT ACT AGG TTC TAA-3' (SEQ ID NO:2280) and 5'- TCT CTA AAG TCC CCT TCC -3' (SEQ ED NO:2288) and the reverse primers were 5'-GGC TCT AGA AGT CAA TTA TCT TCT AC A AAC CTT TAT ATA TTA GC-3 ' (SEQ ED NO:2281), and 5'- CCA GCA TTC CTC AAT TTC -3' (SEQ ED NO:2289). PCR was applied to the 4407-33 genomic DNA with 100 μl of reaction mix. Pfx high fidelity enzyme was used for PCR amplification. The PCR product was visualized on 1%) agarose gel after electrophoresis. A single band with molecular weight of approximately 3.5 kb was observed and excised from the gel. The resulting band was purified using a gel purification kit (Qiagen; based on manufacturer's procedure). The purified DNA was digested by enzyme Xba I (NEB; used according to the manufacturer's instructions). The pBluescript plasmid was digested by Xba I using same procedure. The fragment was gel purified and ligated to pBluescript plasmid. The ligation mix was transformed into competent cell GM1O9 and plated onto LB plate containing 100 mg/l of ampicillin with blue/white selection. The white colonies were picked and grown into 10 ml LB liquid media containing ampicillin. The DNA was extracted by miniprep. The plasmid DNA containing the insert was sequenced using a CEQ 2000 sequencer (Beckman, Fullerton, California) based on the manufacturer's procedure. The T3 and T7 primers and 8 other internal primers were used for sequencing. The sequence was assembled and analyzed, thus providing the genomic sequence (SEQ ED NO:4; Figure 3). Based on the genomic sequence, it was determined that the nicotine demethylase gene in both converter and nonconverter tobacco lines does not contain a transposable element. Comparison ofthe sequence of SEQ ED NO:5 with the sequence of SEQ ED NO:4 allowed the determination of a single intron within the coding portion ofthe gene (identified as the sequence of SEQ ED NO:7; Figure 5). As shown in Figure 2, the genomic structure ofthe tobacco nicotine demethylase includes two exons flanking a single intron. The first exon spans nucleotides 2010 to 2949 of SEQ ED NO:4, which encodes amino acids 1-313 of SEQ ED NO:3, and the second exon spans nucleotides 3947 to 4562 of SEQ ED NO:4, which encode amino acids 314-517 of SEQ ED NO:3. Accordingly, the intron spans nucleotides 2950-3946 of SEQ ED NO:4. The intron sequence is provided in Figure 5 and is that of SEQ ED NO:7. The translation product ofthe genomic DNA sequence is provided in Figure 3 as the sequence of SEQ ED NO:3. The tobacco nicotine demethylase amino acid sequence contains an endoplasmic reticulum membrane anchoring motif.

Example 16 Cloning 5' Flanking Sequences (SEQ ED NO:8 and 3'UTR (SEQ ED NO:9) from Converter Tobacco A_^ Isolation of Total DNA from Converter Tobacco Leaves Tissue Genomic DNA was isolated from leaves of converter tobacco 4407-33. The isolation of DNA was performed using a DNeasy Plant Mini Kit from the company Qiagen, Inc. (Valencia, Ca) according to the manufacturer's protocol. The manufacturer's manual Dneasy' Plant Mini and DNeasy Plant Maxi Handbook, Qiagen January 2004 is incorporated hereby as reference. The procedure for DNA preparation included the following steps: Tobacco leaf tissue (approximately 20 mg dry weight) was ground to a fine powder under liquid nitrogen for 1 minute. The tissue powder was transferred into a 1.5 ml tube. Buffer API (400 μl) and 4 μl of RNase stock solution (100 mg/ml) were added to a maximum of 100 mg of ground leaf tissue and vortexed vigorously. The mixture was incubated for 10 min at 65°C and mixed 2-3 times during incubation by inverting tube. Buffer AP2 (130 μl) was then added to the lysate. The mixture was mixed and incubated for 5 min on ice. The lysate was applied to a QIAshredder Mini Spin Column and centrifuged for 2 min (14,000 rpm). The flow-through fraction was transferred to a new tube without disturbing the cell-debris pellet. Buffer AP3/E (1.5 volumes) was then added to the cleared lysate and mixed by pipetting. The mixture (650 μl) from the preceding step including any precipitate was applied to a DNeasy Mini Spin Column. The mixture was centrifuged for 1 min at >6000 x g (>8000 rpm) and the flow-through was discarded. This was repeated with the remaining sample and the flow-through and collection tube were discarded. DNeasy Mini Spin Column was placed in a new 2 ml collection tube. Then buffer AW (500 μl) was added to the DNeasy column and centrifuged for 1 min (>8000 rpm). The flow-through was discarded. The collection tube was reused in the next step. Buffer AW (500 μl) was then added to the DNeasy column and centrifuged for 2 min (> 14,000 rpm) in order to dry the membrane. The DNeasy column was transferred to a 1.5 ml tube. Then Buffer AE (100 μl) was pipetted onto the DNeasy membrane. The mixture was incubated for 5 min at room temperature (15-25°C) and then centrifuged for 1 min (>8000 rpm) to elute. The quality and quantity ofthe DNA was estimated by running samples on an agarose gel. Cloning of 5' flanking sequences ofthe Structural Gene A modified inverse PCR method was used to clone 750 nucleotides ofthe 5' flanking sequences ofthe structural gene from SEQ ED NO: 5. First, appropriate restriction enzymes were selected based on the restriction site in the known sequence fragment and the restriction sites distance downstream ofthe 5' flanking sequences. Two primers were designed based on this known fragment. The forward primer was located downstream ofthe reverse primer. The reverse primer was located in the 3' portion ofthe known fragment. The cloning procedure included the following steps: The purified genomic DNA (5 μg) was digested with 20-40 units ofthe appropriate restriction enzyme (EcoRI and Spel) in a 50 μl reaction mixture. An agarose gel electrophoresis with a 1/10 volume ofthe reaction mixture was performed to determine if the DNA was digested to completion. A direct ligation was performed after thorough digestion by ligating overnight at 4°C. A reaction mixture of 200 μl containing 10 μl of digested DNA and 0.2 μl of T4 DNA ligase (NEB) was ligated overnight at 4°C. PCR on the ligation reaction was performed after an artificial small circular genome was obtained. PCR was performed with 10 μl of ligation reaction and 2 primers from known fragments in two different directions in 50 μl reaction mixture. A gradient PCR program with annealing temperatures of 45-56°C was applied. Agarose gel electrophoresis was performed to check the PCR reaction. The desired band was cut from the gel and a QIAquick gel purification Kit from QIAGEN was used to purify the band. The purified PCR fragments were ligated into a pGEM-T Easy Vector (Promega, Madison, WI) following manufacturer's instructions. The transformed DNA plasmids were extracted by miniprep using SV Miniprep kit (Promega, Madison, WI) following the manufacturer's instructions. Plasmid DNA containing the insert was sequenced using a CEQ 2000 sequencer (Beckman,

Fullerton, CA). Approximately 758 nt (nucleotides 1241-2009 of SEQ ED NO:4) of the 5' flanking sequence were cloned by the method described above.

C Cloning ofthe Longer 5' Flanking Sequences (SEQ ED NO:8; Figure 6) of the Structural Gene BD Genome Walker Universal Kit (Clontech laboratories, Inc., PaloAlto, CA) was used for cloning additional 5' flanking sequence ofthe structural gene, D121- AA8 according to the manufacturer's user manual. The manufacturer's manual BD Genome Walker August, 2004 is incorporated hereby as reference. The size and purity of tobacco genomic DNA were tested by running samples on a 0.5% agarose gel. A total of 4 blunt-end reactions (DRA I, STU I, ECOR V, PVU E) were set up for tobacco 33 library genome walking construction. After purification ofthe digested DNAs, the digested genomic DNAs were ligated to the genome walker adaptor. Primary PCR reactions were applied to the four digested DNA's by using adaptor primer AP 1 and the gene specific primer from D 121 - AA8

(CTCTATTGATACTAGCTGGTTTTGGAC; SEQ ED NO:2282). The primary PCR products were used directly as templates for the nested PCR. The adaptor nested primer provided by the kit and the nested primer from the known clone D121-AA8 (SEQ ED NO:5) (GGAGGGAGAGTATAACTTACGGATTC; SEQ ED NO:2283) were used in the PCR reaction. PCR products were checked by running gel electrophoreses. The desired bands were sliced out from the gel, and the PCR fragments were purified using QIAquick gel purification Kit from QIAGEN. The purified PCR fragments were ligated into a pGEM-T Easy Vector (Promega, Madison, WI) following manufacturer's instructions. The transformed DNA plasmids were extracted by miniprep using the S V Miniprep kit (Promega, Madison, WI) and following the manufacturer's instructions. Plasmid DNA containing the insert was sequenced using a CEQ 2000 sequencer (Beckman, Fullerton, CA). Another approximately 853 nt ofthe 5' flanking sequence, including nucleotides 399-1240 of SEQ ED NO:4, were cloned by the method described above. A second round ofthe genome walking was performed according to the same method with the difference that the following primers GWRl A (5 '-

AGTAACCGATTGCTCACGTTATCCTC -3') (SEQ DD NO:2284) and GWR2A (5'- CTCTATTCAACCCCACACGTAACTG -3') (SEQ ED NO:2285) were used. Another approximately 398 nt of flanking sequence, including nucleotides 1-398 of SEQ ED NO:4, were cloned by this method. A search for regulatory elements revealed that, in addition to "TATA" box,

"CAAT" boxes, and "GAGA" boxes, several MYB-like recognition sites and organ specificity elements are present in the tobacco nicotine demethylase promoter region. Putative elicitor responsive elements and nitrogen-regulated elements, identified using standard methods, are also present in the promoter region.

D. Cloning of 3' flanking sequences ofthe Structural Gene BD Genome Walker Universal Kit (Clontech laboratories, Inc., PaloAlto, CA) was used for cloning of 3' flanking sequence ofthe structural gene, D121-AA8 according to the manufacturer's user manual. The cloning procedure is the same as describes in the preceding Section C of this example, except for the gene specific primers. The first primer was designed from close to the end of D121-AA8 structural gene (5'- CTA AAC TCT GGT CTG ATC CTG ATA CTT -3') (SEQ ED NO:2286). The nested primer was designed further downstream of primer 1 ofthe D121-AA8 structural gene (CTA TAC GTA AGG TAA ATC CTG TGG AAC) (SEQ ED NO:2287). The final PCR products were checked by gel electrophoreses. The desired bands were excised from the gel. The PCR fragments were purified using QIAquick gel purification Kit from QIAGEN. The purified PCR fragments were ligated into a pGEM-T Easy Vector (Promega, Madison, WI) following manufacturer's instructions. The transformed DNA plasmids were extracted by miniprep using SV Miniprep kit (Promega, Madison, WI) following manufacturer's instructions. Plasmid DNA containing the insert was sequenced using a CEQ 2000 sequencer (Beckman, Fullerton, CA). Approximately 1617 nucleotides of additional 3' flanking sequence (nucleotides 4731-6347 of SEQ ED NO:4) were cloned by the method described above. The nucleic acid sequence ofthe 3'UTR region is shown in Figure 7. Example 17 Screening the Nicotiana Genus for the Presence or Absence of a Nicotine Demehtylase Gene Forty-three Nicotiana species, forty-nine Nicotiana rustica lines, and approximately six hundred Nicotiana tabacum lines were seeded in pots and the resulting plants were grown in the greenhouse as shown in Table 8 below.

Table 8:

Leaf samples were taken from six- week-old plants. DNA extractions from the leaves were performed using DNeasy Plant Mini Kit (Qiagen, Inc., Valencia, CA) according to manufacturer's protocol. The primers were designed based on the 5' promoter and 3' UTR regions described herein. The forward primer was 5'-GGC TCT AGA TAA ATC TCT TAA GTT ACT AGG TTC TAA-3' (SEQ ED NO:2290) and the reverse primer was 5'- GGC TCT AGA AGT CAA TTA TCT TCT AC A AAC CTT TAT ATA TTA GC-3' (SEQ DD NO:2291) (from -750 ofthe 5' flanking region to 180 nt 3' UTR). Genomic DNA extracted from all above-mentioned Nicotiana lines was used for the PCR analysis. A 100 μl reaction mixture and the Pfx high fidelity enzyme were used for PCR amplification. The annealing temperature used was 54°C due to less homology among the species (this temperature is 2°C lower than the temperature used for cloning genomic sequence from 4407 converter tobacco as described above). The PCR product was visualized on 0.8% agarose gel after electrophoresis. A single band with molecular weight of approximately 3.5 kb was either present or absent on the gel. The lines with a positive band were scored as having the target gene. For the lines that lacked positive bands, four additional PCR reactions were performed using four more sets of primers. These sets of primers were selected from different regions of the gene. The four sets primers were: (1) from the start codon (5'- GCC CAT CCT ACA GTT ACC TAT AAA AAG GAA G -3') (SEQ ED NO:2292) to the stop codon (5'- ACC AAG ATG AAA GAT CTT AGG TTT TAA -3') (SEQ ED NO:2293), (2) from 570 nt downstream ofthe start codon (5'- CTG ATC GTG AAG ATG A -3') (SEQ ED NO:2294)to the end ofthe intron (5'- TGC TGC ATC CAA GAC CA -3') (SEQ ED NO:2295), (3) from 300 nt downstream ofthe beginning ofthe intron (5'- GGG CTA TAT GGA TTC GC -3')(SEQ ED NO:2296) to the end ofthe intron (5'- TGC TGC ATC CAA GAC CA -3') (SEQ ED NO:2295), and (4) from 300 nt downstream ofthe beginning ofthe intron (5'- GGG CTA TAT GGA TTC GC -3') (SEQ ED NO:2296) to the 3' UTR (5'- AGT CAA TTA TCT TCT ACA AAC CTT TAT ATA TTA GC -3') (SEQ ED NO:2195). If the five above-mentioned PCR reactions all showed no correct bands, the line was scored as lacking the target gene. Examples ofthe genomic DNA quantity and PCR products for the target nicotine demethylase gene are depicted in Figures 8 and 9. Germplasm identified as lacking the nicotine demethylase gene is used as source material for breeding with cultivated tobaccos. However, any nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173- 1 to 173-294, or a fragment thereof, can be used in a similar manner. Interspecific or intraspecific hybridization methods combined with standard breeding methods, such as backcrossing or the pedigree method, may be used to transfer the aberrant or absent nicotine demethylase gene or any nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173-1 to 173-294, or a fragment thereof, from the donor source to cultivated tobaccos. Results of screening experiments for nicotine demethylase are set forth in Table 9 below. A line negative for nicotine demethylase maybe bred with itself or another negative line (e.g., Nicotiana africana x Nicotiana africana or Nicotiana africana x Nicotiana amplexicaulis or any suitable breeding combination). Negative lines are also bred with any commercial variety of tobacco according to standard tobacco breeding techniques known in the art. Tobacco lines may be bred with any other compatible plant according to standard procedures in the art. Table 9: Exemplary Results from Screening the Nicotiana Genus for the Nicotine Demethylase Gene Scientific Name or Inventory Screening Common Name or (Origin) Number Results

Nicotiana africana TW6 Negative Nicotiana amplexicaulis TW10 Negative Nicotiana arentsii TW12 Negative Nicotiana benthamiana TW16 Negative Nicotiana bigelovii TW18 Negative Nicotiana corymbosa TW35 Negative Nicotiana debneyi TW36 Negative Nicotiana excelsior TW46 Negative Nicotiana exigua TW48 Negative Nicotiana glutinosa TW58 Negative Nicotiana goodspeedii TW67 Negative Nicotiana gossei TW68 Negative Nicotiana hesperis TW69 Negative Nicotiana ingulba TW71 Negative Nicotiana knightiana TW73 Negative Nicotiana maritima TW82 Negative Nicotiana megalosiphon TW83 Negative Nicotiana miersii TW85 Negative Nicotiana nesophila TW87 Negative Nicotiana noctiflora TW88 Negative Nicotiana nudicaulis TW90 Negative Nicotiana otophora TW94 Positive Nicotiana palmeri TW98 Negative Nicotiana paniculata TW99 Negative Nicotiana petunioides TW105 Negative Nicotiana plumbaginifolia TW106 Negative Nicotiana repanda TWllO Negative Nicotiana rosulata TW112 Negative Nicotiana rotundifolia TW114 Negative Nicotiana rustica TW116 Negative Nicotiana setchelli TW121 Negative Nicotiana stocktonii TW126 Negative Nicotiana eastii TW127 Negative Nicotiana suaveolens TW128 Negative Nicotiana thrysiflora TW139 Positive

Example 18 Creating or Generating Mutations and Screening for Genetic Variation in the Nicotine Demethylase Gene

Preexisting genetic variation or mutations in the sequence coding for the nicotine demethylase or any other genes represented by a nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173-1 to 173-294, or a fragment thereof, are screened using molecular technologies including targeted induced local lesions in genomes (TILLESfG), DNA fingeφrinting methods such as amplified fragment length polymorphisms (AFLP), and single nucleotide polymorphisms (SNP). In practice, plant populations representing preexisting genetic variation such as a transgenic plant (e.g., any of those described herein) or those created by exposing reproductive tissues, seed, or other plant tissues to chemical mutagens such as alkylating agents, ethane methyl sulfonate (EMS) for example, or to radiation such as x-rays or gamma rays are used. For mutagenized populations the dosage ofthe mutagenic chemical or radiation is determined experimentally for each type of plant tissue such that a mutation frequency is obtained that is below a threshold level characterized by lethality or reproductive sterility. The number of Ml generation seed or the size of Ml plant populations resulting from the mutagenic treatments are estimated based upon the expected frequency of mutations. The progeny, M2 generation, ofthe Ml plants represent the population that desirably is evaluated for a mutation in a gene, e.g., the nicotine demethylase gene. Tilling, DNA fingeφrinting, SNP or similar technologies may be used to detect induced or naturally-occurring genetic variation in a desirable gene such as the nicotine demethylase gene. The variation may result from deletions, substitutions, point mutations, franslocations, inversions, duplications, insertions or complete null mutations. These technologies could be used in a marker-assisted selection (MA breeding program) to transfer or breed the null or dissimilar alleles ofthe nicotine demthylase gene or any nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173-1 to 173-294, or a fragment thereof, into other tobaccos. A breeder could create segregating populations from hybridizations of a genotype containing the null or dissimilar allele with an agronomically desirable genotype. Plants in the F2 or backcross generations could be screened using a marker developed from the nicotine demethylase sequence or a nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173-1 to 173-294, or a fragment thereof, using one ofthe techniques listed previously. Plants identified as possessing the null or dissimilar alleles could be backcrossed or self-pollinated to create the next population that could be screened. Depending on the expected inheritance pattern or the MAS technology used, it may be necessary to self-pollinate the selected plants before each cycle of backcrossing to aid identification ofthe desired individual plants. Backcrossing or other breeding procedure can be repeated until the desired phenotype of the recurrent parent is recovered.

Example 19 Breeding or Transfer of Variant Nictoine Demethylase Gene Expression Into Cultivated Tobacco

A. Selection of Parental Lines Donor tobacco lines are identified as those having variant nicotine demethylase gene expression (e.g., a tobacco line identified using a PCR-based strategy as lacking the nicotine demethylase gene or is null for nicotine demethylase or expressing a nicotine demethylase having altered enzymatic activity; or a tobacco line expressing a transgene that alters or silences gene expression is also considered to be variant for nicotine demethylase gene expression) or variants of any nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173- 1 to 173-294, or a fragment thereof, and are selected to serve as the donor parent. Such plants are generated according to standard methods known in the art, e.g., those described herein. Other donor plants include tobacco plants that have been mutagenized and subsequently identified as having variant nicotine demethylase gene activity or variant activity of a gene product encoded by any nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173-1 to 173- 294, or a fragment thereof. One exemplary donor parent is the ne tobacco line, Nicotiana rustica. The recipient tobacco line is typically any commercial tobacco variety such as

Nicotiana tabacum TN 90. Other useful Nicotiana tabacum varieties include BU 64, CC 101, CC 200, CC 27, CC 301, CC 400, CC 500, CC 600, CC 700, CC 800, CC 900, Coker 176, Coker 319, Coker 371 Gold, Coker 48, CU 263, DF911, Galpao tobacco, GL 26H, GL 350, GL 737, GL 939, GL 973, HB 04P, K 149, K 326, K 346, K 358, K 394, K 399, K 730, KT 200, KY 10, KY 14, KY 160, KY 17, KY 171, KY 907, KY 160, Little Crittenden, McNair 373, McNair 944, msKY 14 x L8, Narrow Leaf Madole, NC 100, NC 102, NC 2000, NC 291, NC 297, NC 299, NC 3, NC 4, NC 5, NC 6, NC 606, NC 71, NC 72, NC 810, NC BH 129, OXFORD 207, 'Perique' tobacco, PVH03, PVH09, PVH19, PVH50, PVH51, R 610, R 630, R 7-11, R 7-12, RG 17, RG 81, RG H4, RG H51, RGH 4, RGH 51, RS 1410, SP 168, SP 172, SP 179, SP 210, SP 220, SP G-28, SP G-70, SP H20, SP NF3, TN 86, TN 97, TN D94, TN D950, TR (Tom Rosson) Madole, VA 309, VA 309, or VA 359. Seed from such varieties may also be from a source resulting from screening for the lack or presence of nicotine conversion using standard chemical or molecular methods. Such commercial varieties also provide material for altering nicotine demethylase activity according to the methods described herein. Other null lines and recipient or donor lines known in the art are also useful, and lines identified as being dissimilar from the nicotine demethylase gene described herein also serve as a donor parent. Recipient lines may also be chosen from any tobacco varieties for flue-cured, Burley, dark, Virginia or Oriental tobaccos. Table 10 shows exemplary Nicotiana species which exhibit breeding compatibility with Nicotiana tabacum (see also, for example, Compendium of Tobacco Diseases published by APS or The Genus Nicotiana Illustrated published by Japan Tobacco Inc.). Table 10. Exemplary Nicotiana species compatible with Nicotiana tabacum.

B. Gene Transfer The donor parent is crossed or hybridized in a reciprocal manner with the donor parent according to standard beeding methods. Successful hybridizations, identified according to standard method, yield FI plants that are fertile or that are, if desired, backcrossed with the recipient parent. A plant population in the F2 generation, derived from the FI plant, is screened for variant nicotine demethylase gene expression (e.g., a plant is identified that fails to express nicotine demethylase due to the absence ofthe nicotine demethylase gene according to standard methods, for example, by using a PCR method with primers based upon the nucleotide sequence information for nicotine demethylase described herein) or variant expression of any nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173-1 to 173-294, or a fragment thereof. Alternatively, any standard screening method known in the art for evaluating plant alkaloid content is used to identify plants that do not convert nicotine to nornicotine. Selected plants are then hybridized with the recipient parent and the first backcrossed (BC1) generation plants are self-pollinated to produce a BC1F2 population that is again screened for variant nicotine demethylase gene expression (e.g., the null version ofthe nicotine demethylase gene). The process of backcrossing, self-pollination, and screening is repeated, for example, at least 4 times until the final screening produces a plant that is fertile and reasonably similar to the recipient parent. This plant, if desired, is self- pollinated and the progeny are subsequently screened again to confirm that the plant exhibits variant nicotine demethylase gene expression (e.g., a plant that displays the null condition for nicotine demethylase) or variant expression of any nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173- 1 to 173-294, or a fragment thereof. Cytogenetic analyses ofthe selected plants is optionally performed to confirm the chromosome complement and chromosome pairing relationships. Breeder's seed ofthe selected plant is produced using standard methods including, for example, field testing, confirmation ofthe null condition for nicotine demethylase or null or increased condition of a polypeptide encoded by any nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172- 19, and 173-1 to 173-294, or a fragment thereof, and chemical analyses of cured leaf to determine the level of alkaloids especially the nornicotine content and the ratio nomicotine/nicotine + nornicotine or other such desired properties provided by those gene sequences found in any nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173-1 to 173-294, or a fragment thereof. In situations where the original FI hybrid resulting from the cross between the recipient (e.g., N. rustica) and donor parent (e.g., TΝ 90) is hybridized or backcrossed to the donor (e,g„ TΝ 90), the progeny of this backcross is self-pollinated to create a BC1F2 generation that is screened for the null or dissimilar version of nicotine demethylase or the null or increased condition of a polypeptide encoded by any nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172- 19, and 173-1 to 173-294, or a fragment thereof. The remainder ofthe breeding effort is as described in the above paragraph. C. Agronomic Performance Testing and Confirmation of Phenotype Lines resulting from the breeding and screening for variant nicotine demethylase gene expression (e.g., the null condition for nicotine demethylase) or of any nucleic acid sequence shown in Figures 1, 3 to 7, 10 to 158, 162 to 170, 172-1 to 172-19, and 173-1 to 173-294, or a fragment thereof, are evaluated in the field using standard field procedures. Control genotypes including the original recipient parent (e.g., TΝ 90) are included and entries are arranged in the filed in a randomized complete block design or other appropriate field design. Standard agronomic practices for tobacco are used, for example, the tobacco is harvested, weighed, and sampled for chemical and other common testing before and during curing. Statistical analyses ofthe data are performed to confirm the similarity ofthe selected lines to the recipient, e.g., the parental line TΝ 90.

Example 20 Breeding or Transfer of a Modified Attribute Into Cultivated Tobacco

Expression of any ofthe genes described herein, for example, any one of those nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294 may also be modified according to the methods described herein. Such genes provide a basis for modifying a plant's phenotype, for example, improving flavor or aroma or both, improving an organoleptic property, or improving curability. Plants identified as having a modified phenotype are then used in a breeding protocol according to standard methods known in the art, for example, those described herein. Example 21 Hybrid Plant Generation

Application of standard protoplast culture methodologies developed for production of hybrid plants using protoplast fusion is also useful for generating plants having variant gene expression (e.g., variant nicotine demethylase gene expression). Accordingly, protoplasts are generated from a first and a second tobacco plant having variant gene expression. Calli are cultured from successful protoplast fusions and plants are then regenerated. Resulting progeny hybrid plants are identified and selected for variant gene expression according to standard methods and, if desired, may be used in any standard breeding protocol. WO 03/078577, WO 2004/035745, PCT/US/2004/034218, and PCT/US/2004/034065, and all other references, patents, patent application publications, and patent applications referred to herein are incoφorated by reference herein to the same extent as if each of these references, patents, patent application publications, and patent applications were separately incoφorated by reference herein. Numerous modifications and variations in practice ofthe invention are expected to occur to those skilled in the art upon consideration ofthe foregoing detailed description ofthe invention. Consequently, such modifications and variations are intended to be included within the scope of the following claims. What is claimed is:

Claims

1. A breeding method for producing a tobacco plant having decreased expression of a nicotine demethylase gene, said method comprising the steps of: (a) providing a first tobacco plant having variant nicotine demethylase gene expression; (b) providing a second tobacco plant that contains at least one phenotypic trait; (c) crossing said first tobacco plant with said second tobacco plant to produce an FI progeny plant; (d) collecting seed of said FI progeny for said variant nicotine demethylase gene expression; and (e) germinating said seed to produce a tobacco plant having decreased expression of a nicotine demethylase gene.

2. The method of claim 1 , wherein said first tobacco plant comprises an endogenous nicotine demethylase gene having a mutation.

3. The method of claim 2, wherein said first tobacco plant comprises a mutation is a deletion, substitution, point mutation, translocation, inversion, duplication, or an insertion.

4. The method of claim 1, wherein said first tobacco plant comprises a nicotine demethylase gene having a null mutation.

5. The method of claim 1, wherein said first tobacco plant comprises a recombinant gene that silences an endogenous nicotine demethylase gene.

6. The method of claim 1, wherein said first tobacco plant comprises a nicotine demethylase having reduced or altered enzymatic activity.

7. The method of claim 1, wherein said first tobacco plant is a transgenic plant.

8. The method of claim 1 , wherein said first tobacco plant comprises Nicotiana africana, Nicotiana amplexicaulis, Nicotiana arentsii, Nicotiana benthamiana, Nicotiana bigelovii, Nicotiana corymbosa, Nicotiana debneyi, Nicotiana excelsior, Nicotiana exigua, Nicotiana glutinosa, Nicotiana goodspeedii, Nicotiana gossei, Nicotiana hesperis, Nicotiana ingulba, Nicotiana knightiana, Nicotiana maritima, Nicotiana megalosiphon, Nicotiana miersii, Nicotiana nesophila, Nicotiana noctiflora, Nicotiana nudicaulis, Nicotiana otophora, Nicotiana palmeri, Nicotiana paniculata, Nicotiana petunioides, Nicotiana plumbaginifolia, Nicotiana repanda, Nicotiana rosulata, Nicotiana rotundifolia, Nicotiana rustica, Nicotiana setchelli, Nicotiana stocktonii, Nicotiana eastii, Nicotiana suaveolens or Nicotiana trigonophylla.

9. The method of claim 8, wherein said first tobacco plant comprises Nicotiana amplexicaulis, Nicotiana benthamiana, Nicotiana bigelovii, Nicotiana debneyi, Nicotiana excelsior, Nicotiana glutinosa, Nicotiana goodspeedii, Nicotiana gossei, Nicotiana hesperis, Nicotiana knightiana, Nicotiana maritima, Nicotiana megalosiphon, Nicotiana nudicaulis, Nicotiana paniculata, Nicotiana plumbaginifolia, Nicotiana repanda, Nicotiana rustica, Nicotiana suaveolens or Nicotiana trigonophylla.

10. The method of claim 1 , wherein said first tobacco plant is Nicotiana tabacum.

11. The method of claim 1 , wherein said first tobacco plant is an Oriental, a dark tobacco, flue or air-cured tobacco, Virginia or a Burley tobacco plant.

12. The method of claim 1, wherein said second tobacco plant is Nicotiana tabacum.

13. The method of claim 11 , wherein said Nicotiana tabacum is BU 64, CC 101, CC 200, CC 27, CC 301, CC 400, CC 500, CC 600, CC 700, CC 800, CC 900, Coker 176, Coker 319, Coker 371 Gold, Coker 48, CU 263, DF911, Galpao tobacco, GL 26H, GL 350, GL 737, GL 939, GL 973, HB 04P, K 149, K 326, K 346, K 358, K 394, K 399, K 730, KT 200, KY 10, KY 14, KY 160, KY 17, KY 171, KY 907, KY 160, Little Crittenden, McNair 373, McNair 944, msKY 14 x L8, Narrow Leaf Madole, NC 100, NC 102, NC 2000, NC 291, NC 297, NC 299, NC 3, NC 4, NC 5, NC 6, NC 606, NC 71, NC 72, NC 810, NC BH 129, OXFORD 207, 'Perique' tobacco, PVH03, PVH09, PVH19, PVH50, PVH51, R 610, R 630, R 7-11, R 7-12, RG 17, RG 81, RG H4, RG H51, RGH 4, RGH 51, RS 1410, SP 168, SP 172, SP 179, SP 210, SP 220, SP G-28, SP G-70, SP H20, SP NF3, TN 86, TN 90, TN 97, TN D94, TN D950, TR (Tom Rosson) Madole, VA 309, VA 309, or VA 359.

14. The method of claim 1, wherein said second tobacco plant is an Oriental, a dark tobacco, flue or air-cured tobacco, Virginia or a Burley tobacco plant.

15. A method of any of claim 1 , wherein said phenotypic trait comprises disease resistance; high yield; high grade index; curability; curing quality; mechanical harvestability; holding ability; leaf quality; height; maturation; stalk size; or leaf number per plant.

16. The method of claim 1 , further comprising pollinating a male sterile or a male sterile hybrid with the plant of step (b).

17. The method of claim 1 , further comprising backcrossing or pollinating plants produced from germinated seed of step (e).

18. A method of breeding a nicotine demethylase deficiency trait into a tobacco plant, said method comprising the steps of: a) crossing a first tobacco plant having variant nicotine demethylase gene expression with a second tobacco plant; b) producing progeny tobacco plants ofthe cross; c) extracting a DNA sample from progeny tobacco plants; d) contacting the DNA sample with a marker nucleic acid molecule that hybridizes to a nicotine demethylase gene or fragment thereof; and e) performing a marker assisted breeding method for the variant nicotine demethylase gene expression trait.

19. The method of claim 18, wherein said marker assisted breeding method comprises utilizing an amplified fragment length polymoφhism, restriction fragment length polymoφhism, random amplified polymoφhism display, single nucleotide polymoφhism, a microsatellite marker, or targeted induced local lesion in a tobacco genome.

20. A method of producing tobacco seed, comprising crossing any one of the tobacco plants selected from the group consisting of Nicotiana africana, Nicotiana amplexicaulis, Nicotiana arentsii, Nicotiana benthamiana, Nicotiana bigelovii, Nicotiana corymbosa, Nicotiana debneyi, Nicotiana excelsior, Nicotiana exigua, Nicotiana glutinosa, Nicotiana goodspeedii, Nicotiana gossei, Nicotiana hesperis, Nicotiana ingulba, Nicotiana knightiana, Nicotiana maritima, Nicotiana megalosiphon, Nicotiana miersii, Nicotiana nesophila, Nicotiana noctiflora, Nicotiana nudicaulis, Nicotiana otophora, Nicotiana palmeri, Nicotiana paniculata, Nicotiana petunioides, Nicotiana plumbaginifolia, Nicotiana repanda, Nicotiana rosulata, Nicotiana rotundifolia, Nicotiana rustica, Nicotiana setchelli, Nicotiana stocktonii, Nicotiana eastii, Nicotiana suaveolens, and Nicotiana trigonophylla with itself or with a second, distinct tobacco.

21. The method of claim 20, comprising a method of preparing hybrid tobacco seed, comprising crossing the first tobacco plant having variant nicotine demethylase gene expression to the second, distinct tobacco plant.

22. The method of claim 21, wherein crossing comprises the steps of: (a) planting a seed of he cross resulting from the tobacco plant having variant nicotine demethylase gene expression and a second, distinct tobacco plant; (b) growing tobacco plants from said seed until said plants bear flowers; (c) pollinating a flower ofthe tobacco plant having variant nicotine demethylase gene expression with pollen from said second tobacco plant or pollinating a flower of said second tobacco plant with pollen from the plant ofthe tobacco plant having variant nicotine demethylase gene expression; and (d) harvesting seed resulting from said pollinating.

23. A method for developing a tobacco plant in a tobacco breeding program comprising: (a) providing a tobacco plant, or its components, having variant nicotine demethylase gene expression; and (b) employing said plant or components as a source of breeding material using tobacco plant breeding techniques.

24. The method of claim 23, wherein the plant breeding techniques comprise bulk selection, backcrossing, self-pollination, introgression, pedigree selection, pureline selection, haploid/doubled haploid breeding, or single seed descent.

25. A tobacco plant or components thereof, wherein said plant is produced according to any one of claims 1, 18, 20, or 23.

26. A tissue culture of regenerable tobacco cells obtained from any one of the plants produced according to any one of claims 1, 18, 20, or 23, wherein the tissue culture regenerates tobacco plants capable of expressing all the physiological and moφho logical characteristics ofthe tobacco plant having variant nicotine demethylase gene expression.

27. The tissue culture of claim 26, wherein the regenerable cells are embryos, meristematic cells, seeds, pollen, leaves, roots, root tips, or flowers or are protoplasts or callus derived therefrom.

28. A method of producing a tobacco product comprising: (a) providing a tobacco plant produced according to any one of claims 1, 18, 20, or 23; and (b) preparing a tobacco product from said tobacco plant.

29. The method of claim 28, wherein said tobacco product is a cured leaf or stem.

30. The method of claim 28, wherein said tobacco product is a smokeless tobacco product.

31. The tobacco product of claim 28, wherein said tobacco product is a moist or dry snuff, a chewing tobacco, a cigarette product, a cigar product, a cigarillo, a pipe tobacco, or bidis.

32. A breeding method for producing a tobacco plant having a modified attribute, said method comprising the steps of: (a) providing a first tobacco plant having a modified attribute comprising variant gene expression of a nucleic acid molecule selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172rl9, and Figures 173-1 to 173-294; (b) providing a second tobacco plant that contains at least one phenotypic trait; (c) crossing said first tobacco plant with said second tobacco plant to produce an FI progeny plant; (d) collecting seed of said FI progeny for said modified attribute; and (e) germinating said seed to produce a tobacco plant having said modified attribute.

33. The method of claim 32, wherein said first tobacco plant comprises an endogenous nucleic acid molecule selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294, wherein said nucleic acid comprises a mutation.

34. The method of claim 33, wherein said first tobacco plant comprises a mutation is a deletion, substitution, point mutation, translocation, inversion, duplication, or an insertion.

35. The method of claim 32, wherein said first tobacco plant comprises an endogenous nucleic acid molecule selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294, said nucleic acid comprises a null mutation.

36. The method of claim 32, wherein said first tobacco plant comprises a recombinant gene that silences expression of endogenous nucleic acid molecule an endogenous nucleic acid molecule selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294.

37. The method of claim 32, wherein said first tobacco plant comprises an endogenous nucleic acid molecule selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294, wherein said nucleic acid molecule encodes a polypeptide having reduced or altered enzymatic activity.

38. The method of claim 32, wherein said first tobacco plant is a transgenic plant.

39. The method of claim 32, wherein said first tobacco plant comprises Nicotiana africana, Nicotiana amplexicaulis, Nicotiana arentsii, Nicotiana benthamiana, Nicotiana bigelovii, Nicotiana corymbosa, Nicotiana debneyi, Nicotiana excelsior, Nicotiana exigua, Nicotiana glutinosa, Nicotiana goodspeedii, Nicotiana gossei, Nicotiana hesperis, Nicotiana ingulba, Nicotiana knightiana, Nicotiana maritima, Nicotiana megalosiphon, Nicotiana miersii, Nicotiana nesophila, Nicotiana noctiflora, Nicotiana nudicaulis, Nicotiana otophora, Nicotiana palmeri, Nicotiana paniculata, Nicotiana petunioides, Nicotiana plumbaginifolia, Nicotiana repanda, Nicotiana rosulata, Nicotiana rotundifolia, Nicotiana rustica, Nicotiana setchelli, Nicotiana stocktonii, Nicotiana eastii, Nicotiana suaveolens, or Nicotiana trigonophylla.

40. The method of claim 32, wherein said first tobacco plant is Nicotiana tabacum.

41. The method of claim 32, wherein said first tobacco plant is an Oriental, a dark tobacco, flue or air-cured tobacco, Virginia or a Burley tobacco plant.

42. The method of claim 32, wherein said second tobacco plant is Nicotiana tabacum.

43. The method of claim 32, wherein said Nicotiana tabacum is BU 64, CC 101, CC 200, CC 27, CC 301, CC 400, CC 500, CC 600, CC 700, CC 800, CC 900, Coker 176, Coker 319, Coker 371 Gold, Coker 48, CU 263, DF911, Galpao tobacco, GL 26H, GL 350, GL 737, GL 939, GL 973, HB 04P, K 149, K 326, K 346, K 358, K 394, K 399, K 730, KT 200, KY 10, KY 14, KY 160, KY 17, KY 171, KY 907, KY 160, Little Crittenden, McNair 373, McNair 944, msKY 14 x L8, Narrow Leaf Madole, NC 100, NC 102, NC 2000, NC 291, NC 297, NC 299, NC 3, NC 4, NC 5, NC 6, NC 606, NC 71, NC 72, NC 810, NC BH 129, OXFORD 207, 'Perique' tobacco, PVH03, PVH09, PVH19, PVH50, PVH51, R 610, R 630, R 7-11, R 7-12, RG 17, RG 81, RG H4, RGH51, RGH 4, RGH 51, RS 1410, SP 168, SP 172, SP 179, SP 210, SP 220, SP G-28, SP G-70, SP H20, SP NF3, TN 86, TN 90, TN 97, TN D94, TN D950, TR (Tom Rosson) Madole, VA 309, VA 309, or VA 359.

44. The method of claim 32, wherein said first tobacco plant is an Oriental, a dark tobacco, flue or air-cured tobacco, Virginia or a Burley tobacco plant.

45. A method of any of claim 32, wherein said phenotypic trait comprises disease resistance; high yield; high grade index; curability; curing quality; mechanical harvestability; holding ability; leaf quality; height, plant maturation; stalk size; or leaf number per plant.

46. The method of claim 32, further comprising pollinating a male sterile or a male sterile hybrid with the plant of step (b).

47. The method of claim 32, further comprising backcrossing or pollinating plants produced from germinated seed of step (e).

48. A method of breeding an attribute into a tobacco plant, said method comprising the steps of: a) crossing a first tobacco plant having a modified attribute comprising variant gene expression of a nucleic acid molecule selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294 with a second tobacco plant; b) producing progeny tobacco plants ofthe cross; c) extracting a DNA sample from progeny tobacco plants; d) contacting the DNA sample with a marker nucleic acid molecule that hybridizes to a nucleic acid sequence shown in Figure 1 , Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294 or a fragment thereof; and e) performing a marker assisted breeding method for the modified attribute.

49. The method of claim 48, wherein said marker assisted breeding method comprises utilizing an amplified fragment length polymoφhism, restriction fragment length polymoφhism, random amplified polymoφhism display, single nucleotide polymoφhism, a microsatellite marker, or targeted induced local lesion in a tobacco genome.

50. A method of producing tobacco seed, comprising crossing a first tobacco plant selected from the group consisting of Nicotiana africana, Nicotiana amplexicaulis, Nicotiana arentsii, Nicotiana benthamiana, Nicotiana bigelovii, Nicotiana corymbosa, Nicotiana debneyi, Nicotiana excelsior, Nicotiana exigua, Nicotiana glutinosa, Nicotiana goodspeedii, Nicotiana gossei, Nicotiana hesperis, Nicotiana ingulba, Nicotiana knightiana, Nicotiana maritima, Nicotiana megalosiphon, Nicotiana miersii, Nicotiana nesophila, Nicotiana noctiflora, Nicotiana nudicaulis, Nicotiana otophora, Nicotiana palmeri, Nicotiana paniculata, Nicotiana petunioides, Nicotiana plumbaginifolia, Nicotiana repanda, Nicotiana rosulata, Nicotiana rotundifolia, Nicotiana rustica, Nicotiana setchelli, Nicotiana stocktonii, Nicotiana eastii, and Nicotiana suaveolens with a second tobacco plant having a modified attribute comprising variant gene expression of a nucleic acid molecule selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172- 19, and Figures 173-1 to 173-294.

51. The method of claim 50, wherein said second tobacco plant is Nicotiana tabacum.

52. The method of claim 51 , wherein said Nicotiana tabacum is BU 64, CC 101, CC 200, CC 27, CC 301, CC 400, CC 500, CC 600, CC 700, CC 800, CC 900, Coker 176, Coker 319, Coker 371 Gold, Coker 48, CU 263, DF911, Galpao tobacco, GL 26H, GL 350, GL 737, GL 939, GL 973, HB 04P, K 149, K 326, K 346, K 358, K 394, K 399, K 730, KT 200, KY 10, KY 14, KY 160, KY 17, KY 171, KY 907, KY 160, Little Crittenden, McNair 373, McNair 944, msKY 14 x L8, Narrow Leaf Madole, NC 100, NC 102, NC 2000, NC 291, NC 297, NC 299, NC 3, NC 4, NC 5, NC 6, NC 606, NC 71, NC 72, NC 810, NC BH 129, OXFORD 207, 'Perique' tobacco, PVH03, PVH09, PVH19, PVH50, PVH51, R 610, R 630, R 7-11, R 7-12, RG 17, RG 81, RG H4, RG H51, RGH 4, RGH 51, RS 1410, SP 168, SP 172, SP 179, SP 210, SP 220, SP G-28, SP G-70, SP H20, SP NF3, TN 86, TN 90, TN 97, TN D94, TN D950, TR (Tom Rosson) Madole, VA 309, VA 309, or VA 359.

53. The method of claim 51, wherein crossing comprises the steps of: (a) planting a seed ofthe cross resulting from the tobacco plant having the modified attribute and a second, distinct tobacco plant; (b) growing tobacco plants from said seed until said plants bear flowers; (c) pollinating a flower ofthe tobacco plant having a modified attribute with pollen from said second tobacco plant or pollinating a flower of said second tobacco plant with pollen from the plant ofthe tobacco plant having said modified attribute; and (d) harvesting seed resulting from said pollinating.

54. A method for developing a tobacco plant in a tobacco breeding program comprising: (a) providing a tobacco plant, or its components, having a modified attribute comprising variant gene expression of a nucleic acid molecule selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294; and (b) employing said plant or components as a source of breeding material using tobacco plant breeding techniques.

55. The method of claim 54, wherein the plant breeding techniques comprise bulk selection, backcrossing, self-pollination, introgression, pedigree selection, pureline selection, haploid/doubled haploid breeding, or single seed descent.

56. A tobacco plant or components thereof, wherein said plant is produced according to any one of claims 32, 48, or 54.

57. A tissue culture of regenerable tobacco cells obtained from any one of the plants produced according to any one of claims 32, 48, 50, or 54, wherein the tissue culture regenerates tobacco plants capable of expressing all the physiological and moφhological characteristics ofthe tobacco plant having a modified attribute.

58. The tissue culture of claim 57, wherein the regenerable cells are embryos, meristematic cells, seeds, pollen, leaves, roots, root tips, or flowers or are protoplasts or callus derived therefrom.

59. A method of producing a tobacco product comprising: (a) providing a tobacco plant produced according to any one of claims 32, 48, 50, or 54; and (b) preparing a tobacco product from said tobacco plant.

60. The method of claim 59, wherein said tobacco product is a cured leaf or stem.

61. The method of claim 59, wherein said tobacco product is a smokeless tobacco product.

62. The tobacco product of claim 59, wherein said tobacco product is a moist or dry snuff, a chewing tobacco, a cigarette product, a cigar product, a cigarillo, a pipe tobacco, or bidis.

63. An isolated genetic marker comprising a nucleic acid sequence that is substantially identical to a nucleic acid sequence selected from the group consisting of the nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294.

64. The isolated genetic marker of claim 63, wherein said nucleic acid sequence is at least 70% identical to a nucleic acid sequence selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294.

65. The isolated genetic marker of claim 63, wherein said nucleic acid sequence comprises a sequence that hybridizes under stringent conditions to the complement of a nucleic acid sequence selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294.

66. The isolated genetic marker of claim 63, wherein said nucleic acid sequence is constitutive, or ethylene or senescence induced.

67. The isolated genetic marker of claim 63, wherein said nucleic acid sequence encodes a polypeptide that is substantially identical to an amino acid sequence selected from the group consisting ofthe amino acid sequences shown in Figure 1, Figures 3 and 4, Figures 10 to 158, Figures 160A to 160E, Figures 162 to 170, and Figures 172-1 to 172-19.

68. The isolated genetic marker of claim 63, wherein said nucleic acid sequence is operably linked to a heterologous gene. i

69. The isolated genetic marker of claim 63, wherein said nucleic acid sequence is operably linked to an inducible, constitutive, pathogen- or wound- induced, environmentally- or developmentally-regulated, or cell- or tissue-specific promoter.

70. An expression vector comprising a nucleic acid sequence selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294, said vector being capable of directing expression ofthe polypeptide encoded by said nucleic acid sequence.

71. A plant or plant component comprising an isolated nucleic acid sequence selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172- 19, and Figures 173-1 to 173-294, wherein said nucleic acid sequence is expressed in said plant or said plant component.

72. The plant or plant component of claim 71 , wherein said plant or plant component is a species of Nicotiana.

73. The plant or plant component of claim 72, wherein said species of Nicotiana is selected from the group of icotiana species shown in Table 8.

74. The plant or plant component of claim 71, wherein said plant component is a leaf, stem, or seed.

75. The plant or plant component of claim 74, wherein said leaf is a cured tobacco leaf.

76. A tobacco product comprising the plant or plant component of claim 71.

77. The tobacco product of claim 76, wherein said tobacco product is a smokeless tobacco product.

78. The tobacco product of claim 76, wherein said tobacco product is a moist or dry snuff, a chewing tobacco, a cigarette product, a cigar product, a cigarillo, a pipe tobacco, or bidis.

79. A plant produced from a genninated seed of claim 74.

80. A method for reducing the expression or enzymatic activity of a constitutive, or an ethylene induced or senescence induced tobacco polypeptide in a plant cell, said method comprising reducing the level or enzymatic activity of an endogenous constitutive, or ethylene or senescence induced tobacco polypeptide in said plant cell.

81. The method of claim 80, wherein said tobacco polypeptide is a p450.

82. The method of claim 80, wherein said plant cell is from a species of Nicotiana.

83. The method of claim 82, wherein said species of Nicotiana is selected from the group of Nicotiana species shown in Table 8.

84. The method of claim 80, wherein reducing the level of said endogenous constitutive, or ethylene or senescence induced tobacco polypeptide comprises expressing a transgene encoding an antisense nucleic acid molecule of a nucleic acid sequence selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172- 1 to 172-19, and Figures 173-1 to 173-294 in said plant cell.

85. The method of claim 80, wherein reducing the level of said constitutive, or ethylene or senescence induced tobacco polypeptide comprises expressing a transgene comprising a nucleic acid sequence selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294, said transgene encoding a double-stranded RNA molecule of a constitutive, or an ethylene or senescence induced tobacco polypeptide in said plant cell.

86. The method of claim 80, wherein reducing the level of said endogenous constitutive, or ethylene or senescence induced tobacco polypeptide comprises co-suppression of said constitutive, or ethylene or senescence induced tobacco polypeptide in said plant cell.

87. The method of claim 80, wherem reducing the level of said endogenous constitutive, or ethylene or senescence induced tobacco polypeptide comprises expressing a dominant negative gene product in said plant cell.

88. The method of claim 87, wherein said endogenous constitutive, or ethylene or senescence induced tobacco polypeptide comprises a mutation in a gene that encodes an amino acid sequence selected from the group consisting of amino acid sequences shown in Figure 1, Figures 3 and 4, Figures 10 to 158, Figures 160 A to 160E, Figures 162 to 170, and Figures 172-1 to 172-19.

89. The method of claim 80, wherem said reduced expression occurs at the transcriptional level, at the translational level, or at the post-translational level.

90. A method for increasing the expression or enzymatic activity of a constitutive, or an ethylene or senescence induced tobacco polypeptide in a plant cell, said method comprising increasing the level or enzymatic activity of an endogenous constitutive, or ethylene or senescence induced tobacco polypeptide in said plant cell.

91. The method of claim 90, wherein said plant cell is from a species of Nicotiana.

92. The method of claim 91 , wherein said species of Nicotiana is selected from the group of Nicotiana species shown in Table 8.

93. The method of claim 90, wherein increasing the level of said constitutive, or ethylene or senescence induced tobacco polypeptide comprises expressing a transgene comprising a nucleic acid sequence selected from the group consisting ofthe nucleic acid sequences shown in Figure 1, Figures 3 to 7, Figures 10 to 158, Figures 162 to 170, Figures 172-1 to 172-19, and Figures 173-1 to 173-294 in said plant cell.

94. The method of claim 90, wherein said increased expression occurs at the transcriptional level, at the translational level, or at the post-translational level.