WO2005111205A1

WO2005111205A1 - Tuberculosis vaccine

Info

Publication number: WO2005111205A1
Application number: PCT/EP2005/005409
Authority: WO
Inventors: Lars RÖSE; Stefan H. E. Kaufmann; Sabine Daugelat
Original assignee: MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.
Priority date: 2004-05-18
Filing date: 2005-05-18
Publication date: 2005-11-24

Abstract

The present invention relates to a Mycobacterium bovis (M. bovis) BCG mutant comprising a mutation in a putative undecaprenyl phosphokinase gene (upk), whereby said mutation leads to a partial or complete inactivation of said upk-gene. Also provided are pharmaceutical composition comprising said M. bovis BCG mutant.

Description

Tuberculosis vaccine

The family of mycobacteria comprises pathogens and apathogenic environmental bacteria (Falkinham, III, 2002; Rastogi, Legrand et al., 2001). Mycobacteria are unusual among bacteria since they have an enormously thick, hydrophobic cell wall which e.g. prevents desiccation. Numerous mycobacteria are harmless and useful because they degrade organic matter in soil. Better known are, however, the few human pathogenic mycobacteria which cause tuberculosis (Mycobacterium tuberculosis, Mycobacterium africanum, Mycobacterium bovis) and leprosy (Mycobacterium leprae).

From a public health standpoint, M. tuberculosis is of utmost importance because it kills more human beings than any other bacterial species. The World Health Organization (WHO) declares that approximately 2 million people die of tuberculosis each year. It is estimated that between 2002 and 2020, approximately 1000 million people will be newly infected, over 150 million people will develop disease, and 36 million will die of tuberculosis, if control is not improved. HIY and tuberculosis form a lethal combination, each speeding up the other's progression. Because HIV weakens the immune system, an HIV-positive individual who is infected with M. tuberculosis is many times more likely to develop disease than someone infected with M. tuberculosis who is HIV-negative. Tuberculosis is the leading cause of death among people who are HIV-positive with about 11% of AIDS deaths worldwide. In Africa, HIV is the single most important factor determining the increased incidence of tuberculosis in the past 10 years. By inconsistent or partial treatment, drug resistant bacilli have emerged. A particularly dangerous form of drug-resistant tuberculosis are the multidrug-resistant (MDR) strains causing MDR-tuberculosis, which is defined as the disease caused by bacilli resistant to at least Isoniazid and rifampicin, the two most powerful anti-tuberculosis drugs. Tuberculosis is caused by airborne infection. Inhaled droplets containing low numbers of bacteria are taken up by alveolar macrophages. Spontaneous healing cannot be measured nor excluded but is unlikely to occur to a significant degree. The vast majority, about 90 % of infected individuals, does not develop acute disease and stays latently infected. Patients with a compromised immune system, for example in the case of HIV infection, develop acute disease directly after primary infection (Manabe & Bishai, 2000). Within 1 year more than 10 % of infected individuals develop disease. M. tuberculosis resides in early phagosomes and blocks phagosome maturation including phagolysosome formation (Armstrong & Hart, 1975; Ferrari, Langen et al., 1999; Harth & Horwitz, 1999; Russell, Dant et al., 1996). However, the maturation arrest is incomplete and some bacteria are killed or at least impaired in replication through antibacterial effectors including reactive oxygen and nitrogen intermediates (Nathan & Shiloh, 2000). In addition, iron restriction is an important mechanism of innate immunity to control the infection (Schaible, Collins et al., 2002).

Bacterial containment is focused on the granulomatous lesion, where different T cell populations participate in the protective immune response. These include i) CD4⁺ T cells recognizing antigenic peptides in the context of gene products encoded by MHC class II, ii) CD8 T cells recognizing antigenic peptides in the context of MHC class I, iii) γδ T cells recognizing unusual antigenic ligands independent of specialized presentation molecules - notably phospholigands, and iv) CD1 restricted T cells recognizing glycolipids abundant in the mycobacterial cell walls presented by the CD1 molecules (Kaufmann, 2001 ; Kaufmann, 2002). Upon infection/reactivation antigen specific T cells produce interferon γ (IFNγ) which synergizes with tumor necrosis factor (TNF ) in activating macrophages. At least some of the CD8 T cells, γδ T cells, and CD1 restricted T cells secrete perforin and granulysin, thereby directly killing mycobacteria within macrophages (Stenger, Rosat et al., 1999). Most of this knowledge was obtained from experiments with mice. The immune response of the mouse is well understood, and a large variety of mouse mutants with defined immunodeficiencies are available. Furthermore, the function of IFNγ, IL12, TNFα, or CD4 T cells is similar in mouse and human (Flynn & Chan, 2001). Although, there are significant differences between the human and murine immune system, experimental animals are critical to gain insight into general mechanisms underlying natural resistance, and acquisition of a protective immune response.

Soon after Robert Koch's discovery of M. tuberculosis, innumerable attempts toward vaccine development began. On December 28^th, 1908, the French bacteriologists Albert C. Calmette and Guerin notified a loss of virulence of M. bovis when cultured in bile containing media. These scientists passaged M. bovis over a period of 13 years in a bile-glycerin-medium thereby developing an attenuated strain that, when used as a vaccine, provided protection to high risk groups, especially newboms of tuberculous mothers. This vaccine strain was called Mycobacterium bovis BCG. It was introduced into the clinic in 1921 and is one of the oldest applications of vaccination. Nevertheless, there were severe complications (Bottiger, Romanus et al., 1982) and later it was proven that M. bovis BCG fails to provide satisfying protection in adults against reactivated pulmonary tuberculosis (Fine, 1995; Kaufmann & Hess, 1997). In the Federal Republic of Germany the routine vaccination was discontinued in 1985 and has been offered since 1987 only upon request. Since there is no better anti-tuberculous vaccine than M. bovis BCG available so far, it still is the gold-standard to which new candidates have to be compared in animal models.

Interestingly, the different mycobacterial species and the substrate comprise very distinct genetical set ups. As for example illustrated in Behr (1999) M. tuberculosis comprises 11 regions encompassing 91 open reading frames which are absent from one or more virulent strains of M. bovis. The substrate of M. tuberculosis defined by this comparative genomic analysis was M. tuberculosis H37Rv. Furthermore, in the same study it was defined that 5 additional regions representing 38 open reading frames were present in M. bovis but absent from the corresponding BCG strains. Accordingly, even closely related mycobacteria show considerable derivation.

A potential target of medical intervention is the specific mycobacterial cell wall.

Among the strategies by which M. tuberculosis has adapted to the environmental conditions in macrophages, the resistance imparted by its cell wall is one of the most striking. The cell envelope is extremely hydrophobic and forms an exceptionally strong permeability barrier, rendering mycobacteria naturally resistant to a wide variety of antimicrobial agents. This is due to the unique structure of the mycobacterial cell wall and the presence of long fatty acids, the mycolic acids (Brennan & Nikaido, 1995). Channel forming proteins which are functionally similar to the well known porins of gram negative bacteria have been demonstrated in Mycobacterium chelonae (Trias, Jarlier et al., 1992) and M. smegmatis (Heinz, Roth et al., 2003; Niederweis, 2003; Trias & Benz, 1994), revealing how hydrophilic molecules can pass through the hydrophobic cell wall. The core unit of the envelope consists of peptidoglycan connected to arabinogalactan (AG) which is covalently linked to mycolic acids, thus forming the mycolyl-AG-peptidoglycan complex (MAPc). Cell wall synthesis can be divided into 3 separate stages which occur in distinct subcellular compartments: cytoplasm, membrane, and the cell wall itself (Fig. 3). Peptidoglycan synthesis is initiated with Uridine 5'-Diphospho-Λ/-Acetylmuramic Acid (UDP-MurNAc) derived from Uridine 5'-Diphospho-DN-AcetylGlucosamine (UDP- GlcNAc) and phosphoenylpyruvate. Five amino acids are linked to UDP-MurNAc resulting in synthesis of UDP-MurNAc-pentapeptide, also known as Park's nucleotide (Navarre & Schneewind, 1999). UDP-MurNAc-pentapeptide is linked via a phosphodiester to an undecaprenyl pyrophosphate carrier molecule (C5₅-PP) constituting C₅₅-PP-MurNAc-pentapeptide, or lipid I. A GlcNAc residue is subsequently added to form lipid II, which is thought to be translocated across the cytoplasmic membrane and serves as substrate for the assembly of peptidoglycan (Navarre & Schneewind, 1999). Generation of undecaprenyl monophosphate (C55-P) from undecaprenyl (C₅₅) by an undecaprenyl-phosphokinase (Upk) probably represents a critical step in providing mycobacteria with a sufficient amount of peptidoglycan-precursor carrier molecules. Bacitracin is an antibiotic which binds tightly to C₅₅-PP and blocks C₅₅-P-recycling, in this way also reducing the amount of carrier molecules. Recently, El Ghachi (2004) J. Biol. Chem. 279, 30106-30113 overproduced and extracted the E. coli BacA protein in the histidine-tagged form. Applying appropriate enzymatic assays they showed that BacA does not exhibit undecaprenol phosphokinase activity, but undecaprenyl pyrophosphate phosphatase activity. The finding of El Ghachi is consistent with the previously proposed function of BacA, i.e. with a role of BacA/upk in peptidoglycan synthesis and the associated bacitrain phenotype.

In Lisle (1999) a vaccination approach in guinea pig has been evaluated, whereby an upk homologue gene in M. bovis (wag520; the Wag520 strain) was employed. In a previous publication the authors have described the corresponding generation of an avirulent M. bovis strain by illegitimate recombination with a fragment containing an interrupted ahpC gene (see Wilson (1997), Tuber. Lung Dis. 78, 229-235). The wag520 mutation comprises a deletion of 2 base pairs and Lisle (1999) has shown that in the case of bovine tuberculosis some protection can be seen. Yet, this protection is not better or enhanced to known vaccination strains. As discussed in Collins (2000) a few gene deletion mutants of BCG have been produced but rather with the aim of making BCG safer for administration to immune-compromised individuals than with the expectation that this will improve the vaccine efficacy. Furthermore, the prior art as, for example, reflected in Buddie (2002) has proposed that a more effective vaccine than BCG may be generated from M. bovis alone. The proposed approach is the generation of deletion mutants comprising deletion of specific genes which are involved in virulence or which encode virulence enzymes for essential metabolic pathways. It is proposed in the prior art, like Buddie (2002), that these kinds of vaccines are more effective than M. bovis BCG.

In Skinner (2003), Immunology 108, 548-555 the efficacy of a prime-boost strategy using DNA encoding ESAT-6 and Arg85A to prime and BCG to boost has been evaluated. Additionally, the attenuated non-virulent strain of M. bovis, Wag520, was also investigated as boost component. However, priming with the DNA vaccine and boosting with an attenuated M. bovis vaccine enhanced IFN-γ immune responses compared to vaccinating with an attenuated M. bovis vaccine alone, but did not increase protection against a virulent M. bovis infection. Accordingly, no increased protection against virulent M. bovis infection could be determined by this combination approach.

Therefore, the technical problem underlying the present invention is the provision of an effective composition which may be used in the prevention and/or treatment of mycobacterial induced diseases like tuberculosis or specific kinds of cancers. The technical problem is solved by the embodiments as characterized herein below and in the claims.

Accordingly, the present invention relates to a Mycobacterium bovis (M. bovis) BCG mutant comprising a mutation in an undecaprenyl phosphokinase gene (upk), whereby said mutation leads to a partial or complete inactivation of said upk-gene.

As documented in the appended examples, it was surprisingly found that a M. bovis BCG strain that lacks the putative undecaprenyl phosphokinase (upk) activity, i.e. the corresponding gene, exhibits lower bacterial load of M. bovis BCG Δ upk upon vaccination. Furthermore, a delayed IFNγ response was observed. Yet, and most surprisingly, the modified BCG strain described herein induced a significantly improved, long-lasting protection against M. tuberculosis infection. This is an important finding since the current live vaccines against (e.g.) tuberculosis provide, in form of M. bovis BCG, merely protection in high risk groups, like newborns of tuberculous mothers. As documented in Fine (1995), Lancet 346, 1339-1345 or Kaufmann, (1997) Biologicals 25, 169-173, non-modified M. bovis BCG fails to provide a satisfying protection in adult patients against tuberculosis, in particular reactivated pulmonary tuberculosis. Furthermore, M. bovis BCG has failed to protect against TB in several trials (WHO, Tech. Rep. Ser. (1980), 651 , 1-15) for reasons that are not entirely clear (Fine, (1995) loc. cit). It has been shown that the vaccine strain of M. bovis BCG only confers protection against the severe form of miliary tuberculosis in children (Fine, Lancet 346 (1995), 1339-1345). In contrast, its protective capacity against the most common form, pulmonary tuberculosis in adults, is low and highly variable (Colditz (1994), JAMA 271 , 698).

In contrast, in the course of a vaccine trial, the M. bovis BCG Δupk mutant strain as disclosed herein induced a significantly superior protection compared to the current "gold standard" M. bovis BCG. By day 120 post M. tuberculosis aerosol infection, M. bovis BCG provided vaccinated animals with 0.9 log protection compared to 2.7 log protection in the case of M. bovis BCG Δupk in the lung. These results demonstrate that the M. bovis BCG Δupk strain is a potent vaccine against tuberculosis. This is a very surprising finding since the known M. bovis BCG strain(s) is/are an attenuated strain(s). Here, a further mutation is introduced which should, theoretically, lead to a further attenuation and, correspondingly, to a lower immunogenicity. Yet, and in contrast, the further mutated, attenuated M. bovis BCG Δupk as provided herein leads to an improved superior protection.

In the prior art mutations and modifications in homologues of the upk gene in Mycobacteria did not provide for an improved protection against mycobacterial- induced diseases. For example, in Skinner (2003) no increase in the protective efficacy of two attenuated strains of M. bovis against bovine tuberculosis could be seen by employing a DNA prime-live vaccine boost strategy in combination with the Wag520-M. bovis strain which comprises a 2 bp-deletion in the ahpC-gene (which is homologous to upk); see also Wilson (1997). The Wag520 M. bovis strain was described as attenuated strain which provides some protection against bovine tuberculosis. However, these protection data where at the most comparable to effects of vaccination obtained with attenuated strains of M. bovis (like M. bovis BCG). In Buddie (2002) it is even stated that a more effective vaccine than M. bovis BCG should be generated by genetically modifying the virulent strains of M. bovis. Accordingly, it is surprisingly found in the present invention that the less preferred candidate, namely M. bovis BCG shows an improved protection when a gene involved in the generation of undecaprenyl monophosphate (C₅₅-P) is partially or completely inactivated.

In context of the present invention, the term "M. bovis BCG" relates to well known attenuated M. bovis strains as described herein and as obtainable, inter alia, from depositories, like the ATCC (American Type Culture Collection, Rockville, MD, USA), IAF (Institute Armand Frappier, Laval, Canada) or the Institute Pasteur in Paris; see also Behr (1999).

As documented herein, the term "M bovis BCG mutant" refers to a M. bovis BCG strain which comprises a mutation in the upk-gene which provides for a partial or complete inactivation of said upk-gene. However, it is also envisaged that the M. bovis BCG mutant comprises additional (genetic) modifications, like further mutations. These additional mutations may comprise, but are not limited to further "knock-out" mutants like, PPE51 (Betts, (2002) Mol. Microbiol. 43, 717-731) or nuoE (Betts, (2002) loc. cit. and Sassetti, (2003) Mol. Microbiol. 48, 77-84). Yet, it is also envisaged that immunorelevant genes like hspX (Yuan, (1998) Proc. Natl. Acad. Sci. USA 95, 9578-9583) or rv3407 are expressed in the herein described M. bovis BCG mutant. Preferably said immunorelevant genes are (over)expressed under the control of a (strong) promoter. As will be detailed below, also comprised in the present invention are Δupk-mutants of BCG which lead to a modified expression and/or synthesis of genes located downstream of an upk-induced genetic or biochemical pathway. A partial or complete inactivation of the upk-gene denotes the fact that the introduced modification of said upk-gene in M. bovis BCG leads to a lower, modified or (e.g. down-regulated) non-expression of the upk-gene. Preferably, at least 50%, more preferably at least 60%, more preferably at least 80% of the upk- gene in M. bovis BCG is deleted and/or replaced by an irrelevant genetic structure, as documented in the appended examples. Yet, it is also envisaged that the upk mutation in M. bovis BCG comprises other genetic or biochemical modifications which lead to a less or a non-functional upk-gene product. Preferably, the mutated or (partially) deleted upk-gene leads to a hampered or modified cell envelope synthesis or assembly in mycobacterial strains, in particular in M. bovis BCG.

In a preferred embodiment of the invention, the M. bovis BCG mutant described above, comprises a partial or complete inactivation of the upk gene, whereby said partial or complete inactivation is due to an insertion, an addition, a substitution, a reversion or a deletion within the upk-gene or within its regulatory elements. Most preferably said inactivation is due to a deletion.

The person skilled in the art can easily deduce the coding sequence of upk as well as any potential regulatory sequences comprised in M. bovis BCG. Within the scope of the invention are, accordingly, also mutants of M. bovis BCG which comprise a mutation in the regulatory sequence(s) of upk whereby said mutation leads to a partial or complete inactivation of upk-gene expression. These regulatory sequences comprise, inter alia, corresponding promoter elements, such as the "-10" or the "-35" region (see, inter alia, "Molekulare Genetik" (1997), Knippers; Georg Thieme Verlag, Germany). Furthermore, the disruption of DNA binding sequences comparable to the binding sequence of IdeR, a regulatory protein involved in ion uptake are envisaged.

Most preferably, the M. bovis BCG comprises a mutation of the upk gene which is a mutation in upk 1 and/or in upk 2.

The terms "upkl" and "upk2" are known in the art and relate to the fact that the upk- gene has been sequenced in two parts and are provided by the Sanger-database. Corresponding detailed examples are given herein below. SEQ ID NO: 1 as provided herein is a nucleotide sequence coding for upk1/upk part 1. SEQ ID NO: 2 as provided herein is a nucleotide sequence coding for upk2/upk part 2. The full-length upk-gene of M. bovis BCG can be obtained by methods known in the art, which comprise but are not limited to primer extensions as well as hybridisation and sequencing approaches, in particular in M. bovis BCG wild-type strains.

As pointed out above and as illustrated in the examples, most preferred is in context of the invention a M. bovis BCG mutant comprising a deletion within the upk-gene, whereby said deletion comprises a full or partial deletion of said upk-gene, i.e. a gene coding for a (putative) undecaprenyl phosphokinase.

The upk-gene to be modified in M. bovis BCG in context of the present invention is or is highly homologous to M. tuberculosis gene rv2136c.

Said gene is known in the art and, inter alia, accessible under Gene ID NO: 887612. Whereas rv2136c is the upk-homologue in M. tuberculosis H37Rv, a similar gene is known in M. tuberculosis CDC1551 and known as MT2194 (Gene Accession Number: 924279). In M. bovis the upk-homologue is known as M62160c (Gene Accession Number 1091224) and in M. leprae as ML1297 (Gene Accession Number 910413).

The gene accession numbers given above relate to the NCBI databank, which is also accessible under http://www.ncbi.nim.nih.gov/entrez/query.fcgi.

In accordance with this invention, the upk-gene to be deleted or modified is at least 70% homologous, preferably at least 80% homologous to rv2136c of M. tuberculosis H37Rv. More preferably it is at least 85%, more preferably at least 90% and most preferably at least 95% homologous to rv2136c.

The M. bovis BCG mutant of the invention has preferably an upk gene deletion (Δ upk) which comprises a full or partial deletion of

(a) a nucleotide sequence as shown in SEQ ID NO: 1 ; a nucleotide sequence encoding an amino acid sequence as shown in SEQ ID NO: 2; or a nucleotide sequence encoding an amino acid sequence which is at least 70% homologous to an amino acid sequence as shown in SEQ ID NO: 2;

(b) a nucleotide sequence as shown in SEQ ID NO: 3; a nucleotide sequence encoding an amino acid sequence as shown in SEQ ID NO: 4; or a nucleotide sequence encoding an amino acid sequence which is at least 70% homologous to an amino acid sequence as shown in SEQ ID NO: 4; or

(c) a nucleotide sequence as shown in SEQ ID NO: 5; a nucleotide sequence encoding an amino acid sequence as shown in SEQ ID NO: 6; or a nucleotide sequence encoding an amino acid sequence which is at least 70% homologous to an amino acid sequence as shown in SEQ ID NO: 6 or 56.

In this context it is of note that SEQ ID NOS: 5 and 6 correspond to the deleted part of upkl (base pairs 1 to 712) as defined for M. bovis in the experimental part herein below. As documented in the examples, the person skilled in the art can deduce potential mutational sites in upk. As illustrated in the examples, in toto 774 bp have been deleted in M. bovis BCG which comprise the above defined sequences as shown in SEQ ID NOS: 5 and 6. The deleted sequence in the herein described M. bovis BCG strain is highly homologous to the corresponding sequence in M. tuberculosis, which is

ATCGTGTTGGCCGCGGCCCAGGGTTTGACCGAGTTCCTGCCGGTGTCGTCCTC GGGACATCTGGCGATCGTGTCGCGGATCTTCTTCAGCGGCGACGCCGGTGCC

TCGTTCACCGCCGTGAGCCAGTTGGGCACCGAGGCCGCCGTAGTGATCTACTT

TGCGCGCGATATTGTGCGCATCCTGAGCGCTTGGGTGCACGGCCTGGTCGTGA

AGGCACATCGAAACACCGATTATCGGCTGGGCTGGTATGTCATCATCGGCACA

ATCCCGATCTGCATTCTGGGCCTGTTCTTCAAAGACGACATCCGGTCGGGCGT

CCGCAACCTGTGGGTCGTGGTGACCGCGCTGGTGGTGTTTTCCGGGGTGATC

GCACTCGCCGAATACGTGGGGCGCCAGAGTCGTCACATTGAGCGGTTGACCTG

GCGGGATGCCGTGGTGGTTGGTATTGCCCAAACCCTGGCGCTGGTCCCCGGG

GTATCCAGGTCCGGGTCGACCATCAGCGCTGGACTGTTTCTCGGACTCGACCG

TGAACTGGCCGCCCGATTCGGATTCCTGCTGGCCATTCCAGCGGTGTTCGCCT

CCGGGTTGTTCTCGTTGCCCGACGCATTCCACCCGGTAACCGAGGGCATGAGC

GCTACTGGCCCGCAGTTGCTGGTGGCCACCCTGATCGCGTTCGTCCTCGGTCT

GACCGCGGTGGCCTGGCTGCTGCGGTTTCTGGTGCGACACAACATGTACTGGT

TCGTCGGCTACCGGGTGCTCGTCGGGACGGGCATG; SEQ ID NO: 56.

Said deleted sequences correspond (in M. tuberculosis) to the following amino acid sequence:

1 MSWWQVIVLA AAQGLTEFLP VSSSGHLAIV SRIFFSGDAG 41 ASFTAVSQLG TEAAVVIYFA RDIVRILSAW LHGLVVKAHR 81 NTDYRLGWYV IIGTIPICIL GLFFKDDIRS GVRNLWVVVT

121 ALVVFSGVIA LAEYVGRQSR HIERLTWRDA VVVGIAQTLA

161 LVPGVSRSGS TISAGLFLGL DRELAARFGF LLAIPAVFAS

201 GLFSLPDAFH PVTEGMSATG PQLLVATLIA FVLGLTAVAW

241 LLRFLVRHNM YWFVGYRVLV GTGMLVLLAT GTVAAT; SEQ ID NO: 57

Accordingly, the present invention also relates to a M. bovis BCG mutant which comprises a deletion or a partial deletion in a gene which is highly homologous to the nucleic acid sequence shown in SEQ ID NO: 56 and corresponding to a deleted part of upk in M. tuberculosis.

Therefore, in a preferred embodiment, the M. bovis BCG strain (mutant) of the invention comprises a deletion in a sequence, which is at least 70%, more preferably at least 80%, more preferably at least 90% and most preferably at least 95% identical to the nucleic acid sequence shown in SEQ ID NO: 56. Also envisaged is a M. bovis BCG mutant which comprises a mutation in a gene which is at least 70% identical to a nucleic acid molecule encoding an amino acid sequence as shown in SEQ ID NO: 57 or a fragment thereof, whereby said fragment comprises, preferably, at least 12 amino acids. Said mutation leads to a complete or partial inactivation of the (puatative) upk.

In a preferred embodiment, the M. bovis BCG mutant of the invention has an upk- gene mutation which comprises a mutation of an inside-loop amino acid stretch of upk which leads to a partial or complete inactivation of the upk-gene. However, it is also envisaged that a transmembrane region (helix) of the encoded upk-gene produced is modified that a partial or complete inactivation of said upk-gene product results. Corresponding domains to be modified may be easily deduced, for example by the use of computer-assisted techniques and the employment of corresponding- proprams, like secondary structure prediction tools.

Accordingly, the present invention comprises M. bovis BCG mutants which comprise modifications (preferably deletions) of the upk-gene. Yet, said inactivation may occur in the transcriptional as well as the translational level. Also modifications in the upk- gene product are envisaged, whereby said modifications (for example by deletion of functional parts of the upk gene product) lead to the expression of a shorter or enzymologically inactive or less active product.

Preferably, the partial or complete inactivation of said upk-gene leads to a modified and/or partial or complete inactivation of the upk-gene product or its biological function. Preferably, the phosphorylation of undecaprenyl (C₅₅) to undecaprenyl monophosphate (C₅₅-P) is modified, hampered or inhibited. It is envisaged in context of this invention that the enzymological/biochemical/biological function of the upk- gene product is hampered, inhibited or even missing in the M. bovis BCG mutant of the invention. Accordingly, most preferably an "active" site of the upk-gene product is modified, changed or even deleted in the M. bovis BCG mutant of the invention. As mentioned above, the upk-gene product is a putative undecaprenyl phosphokinase. Therefore, the invention also relates to a M. bovis BCG mutant, whereby the inside loop amino acid stretch of upk is modified, changed or deleted, whereby said inside loop is selected from the group consisting of

(a) an amino acid molecule encoded by a nucleic acid molecule as shown in SEQ ID NOS: 7, 9 or 11 ;

(b) an amino acid molecule encoded by a nucleic acid molecule which is at least 70% homologous to a nucleic acid molecule as shown in SEQ ID NO: 7, 9 or 11 ;

(c) an amino acid molecule which shows at least 70% identity to an amino acid molecule as shown in SEQ ID NOS: 8, 10 or 12; and

(d) an amino acid molecule which is shown in SEQ ID NOS: 8, 10 or 12.

In context of the present invention, the term "identity" or "homology" as used herein relates to a comparison of nucleic acid molecules (nucleotide stretches; DNA, RNA) or aminio acid molecules (peptides; proteins; protein-fragments).

The invention also relates to M. bovis BCG mutants which comprise a mutation in a nucleotide sequence which is complementary to the whole or a part of one of the above-mentioned sequences encoding for the putative upk.

In order to determine whether a nucleic acid sequence has a certain degree of identity to the nucleic acid sequence encoding a (putative) undecaprenyl phosphokinase (UpK), the skilled person can use means and methods well-known in the art, e.g., alignments, either manually or by using computer programs such as those mentioned further down below in connection with the definition of the term "hybridization" and degrees of homology.

For example, BLAST2.0, which stands for Basic Local Alignment Search Tool (AJtschul, Nucl. Acids Res. 25 (1997), 3389-3402; Altschul, J. Mol. Evol. 36 (1993), 290-300; Altschul, J. Mol. Biol. 215 (1990), 403-410), can be used to search for local sequence alignments. BLAST produces alignments of both nucleotide and amino acid sequences to determine sequence similarity. Because of the local nature of the alignments, BLAST is especially useful in determining exact matches or in identifying similar sequences. The fundamental unit of BLAST algorithm output is the High- scoring Segment Pair (HSP). An HSP consists of two sequence fragments of arbitrary but equal lengths whose alignment is locally maximal and for which the alignment score meets or exceeds a threshold or cutoff score set by the user. The BLAST approach is to look for HSPs between a query sequence and a database sequence, to evaluate the statistical significance of any matches found, and to report only those matches which satisfy the user-selected threshold of significance. The parameter E establishes the statistically significant threshold for reporting database sequence matches. E is interpreted as the upper bound of the expected frequency of chance occurrence of an HSP (or set of HSPs) within the context of the entire database search. Any database sequence whose match satisfies E is reported in the program output.

Analogous computer techniques using BLAST (Altschul (1997), loc. cit.; Altschul (1993), loc. cit.; Altschul (1990), loc. cit.) are used to search for identical or related molecules in nucleotide databases such as GenBank or EMBL. This analysis is much faster than multiple membrane-based hybridizations. In addition, the sensitivity of the computer search can be modified to determine whether any particular match is categorized as exact or similar. The basis of the search is the product score which is defined as: %sequence identity x % maximum BLAST score 100 and it takes into account both the degree of similarity between two sequences and the length of the sequence match. For example, with a product score of 40, the match will be exact within a 1-2% error; and at 70, the match will be exact. Similar molecules are usually identified by selecting those which show product scores between 15 and 40, although lower scores may identify related molecules. The present invention also relates to M. bovis BCG mutants comprising mutations in nucleic acid molecules which hybridize to one of the above described nucleic acid molecules and which encode a putative UpK as desciebed herein. The term "hybridizes" as used in accordance with the present invention may relate to hybridization under stringent or non-stringent conditions. If not further specified, the conditions are preferably non-stringent. Said hybridization conditions may be established according to conventional protocols described, for example, in Sambrook, Russell "Molecular Cloning, A Laboratory Manual", Cold Spring Harbor Laboratory, N.Y. (2001); Ausubel, "Current Protocols in Molecular Biology", Green Publishing Associates and Wiley lnterscience, N.Y. (1989), or Higgins and Hames (Eds.) "Nucleic acid hybridization, a practical approach" IRL Press Oxford, Washington DC, (1985). The setting of conditions is well within the skill of the artisan and can be determined according to protocols described in the art. Thus, the detection of only specifically hybridizing sequences will usually require stringent hybridization and washing conditions such as O.lxSSC, 0.1 % SDS at 65°C. Non- stringent hybridization conditions for the detection of homologous or not exactly complementary sequences may be set at 6xSSC, 1% SDS at 65°C. As is well known, the length of the probe and the composition of the nucleic acid to be determined constitute further parameters of the hybridization conditions. Note that variations in the above conditions may be accomplished through the inclusion and/or substitution of alternate blocking reagents used to suppress background in hybridization experiments. Typical blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations. The inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility. Hybridizing nucleic acid molecules also comprise fragments of the above described molecules. Such fragments may represent nucleic acid sequences which encode a UpK as defined herein and which have a length of at least 12 nucleotides, preferably at least 15, more preferably at least 18, more preferably of at least 21 nucleotides, more preferably at least 30 nucleotides, even more preferably at least 40 nucleotides and most preferably at least 60 nucleotides. Furthermore, nucleic acid molecules which hybridize with any of the aforementioned nucleic acid molecules also include complementary fragments, derivatives and allelic variants of these molecules. Additionally, a hybridization complex refers to a complex between two nucleic acid sequences by virtue of the formation of hydrogen bonds between complementary G and C bases and between complementary A and T bases; these hydrogen bonds may be further stabilized by base stacking interactions. The two complementary nucleic acid sequences hydrogen bond in an antiparallel configuration. A hybridization complex may be formed in solution (e.g., Cot or Rot analysis) or between one nucleic acid sequence present in solution and another nucleic acid sequence immobilized on a solid support (e.g., membranes, filters, chips, pins or glass slides to which, e.g., cells have been fixed). The terms complementary or complementarity refer to the natural binding of polynucleotides under permissive salt and temperature conditions by base-pairing. For example, the sequence "A-G-T" binds to the complementary sequence "T-C-A". Complementarity between two single-stranded molecules may be "partial", in which only some of the nucleic acids bind, or it may be complete when total complementarity exists between single-stranded molecules. The degree of complementartity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, which depend upon binding between nucleic acids strands.

The term "hybridizing sequences" preferably refers to sequences which display a sequence identity of at least 40%, preferably at least 50%, more preferably at least 60%, even more preferably at least 70%, particularly preferred at least 80%, more particularly preferred at least 90%, even more particularly preferred at least 95%, 97% or 98% and most preferably at least 99% identity with a nucleic acid sequence as described above encoding a (putative) UpK. Moreover, the term "hybridizing sequences" refers to sequences encoding encoding a putative UpK having a sequence identity of at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably at least 95%, and most preferably at least 99% identity with an amino acid sequence of a UpK as described herein for the UpK of M. smegmatis, M. tuberculosis or the UpK as defined herein for M. bovis (see parts 1 and 2 of M. bovis upk, upkl and upk2).

In accordance with the present invention, the term "identical" or "percent identity" in the context of two or more nucleic acid or amino acid sequences, refers to two or more sequences or subsequences that are the same, or that have a specified percentage of amino acid residues or nucleotides that are the same (e.g.,, 70-95% identity, more preferably at least 95%, 97%, 98% or 99% identity), when compared and aligned for maximum correspondence over a window of comparison, or over a designated region as measured using a sequence comparison algorithm as known in the art, or by manual alignment and visual inspection. Sequences having, for example, 60% to 95% or greater sequence identity are considered to be substantially identical. Such a definition also applies to the complement of a test sequence. Preferably the described identity exists over a region that is at least about 15 to 25 amino acids or nucleotides in length, more preferably, over a region that is about 50 to 100 amino acids or nucleotides in length. Those having skill in the art will know how to determine percent identity between/among sequences using, for example, algorithms such as those based on CLUSTALW computer program (Thompson, Nucl. Acids Res. 2 (1994), 4673-4680) or FASTDB (Brutlag, Comp. App. Biosci. 6 (1990), 237-245), as known in the art.

Accordingly, and in a preferred embodiment of the M. bovis BCG mutant of the invention the upk-gene deletion comprises a full or partial deletion of a nucleic acid molecule encoding an amino acid molecule as shown in any one of SEQ ID NOS: 8, 10 or 12 or a functional fragment thereof.

A functional fragment of the upk-gene product is preferably a fragment which is involved in mycobacterial cell wall synthesis pathways, most preferably in the C₅₅-P synthesis.

It is also envisaged in the present invention that the upk-gene or gene product modification leads in M. bovis BCG to further modifications. As shown in the appended examples, a mutation in the upk-gene as provided herein also leads to a modified expression pattern. Corresponding proteome analysis and transcriptional analysis can be carried out by methods known in the art and as illustrated in the appended example for a Δupk-mutant of M. tuberculosis. It is, accordingly, envisaged that the M. bovis BCG mutant comprising a mutation in the upk-gene also comprises a modified expression pattern. Therefore, the invention also relates to a M. bovis BCG mutant wherein the mutation in said upk-gene leads to a polarity effect in genes located downstream of upk. An example, which is not-limiting, is the M. bovis BCG homologue of M. tuberculosis rv2135c.

Said polarity effect may influence the expression or function of genes which are transcriptionally or translationally dependent on a functional, non-modified upk expression. Therefore, it is also envisaged that a M. bovis BCG mutant of the present invention comprises a modified expression of the M. bovis BCG-homologue to rv2135c of M. tuberculosis. Preferably, the polarity effect influences a gene which is at least 70%, preferably at least 80%, most preferably at least 90% homologous to rv2135c of M. tuberculosis. The rv2135c is known in the art and relates to a M. tuberculosis gene in the H37Rv (Gene Accession in NCBI-databank: 887273). Corresponding homologues genes have also been described in M. tuberculosis CDC1551 (Gene Accession in NCBI-databank: 924275), M. bovis (Gene Accession in NCBI-databank: 1091220), and M. leprae ML1298 (Gene Accession in NCBI- databank: 910410).

The invention, therefore, also relates to a M. bovis BCG mutant, whereby said polarity effect of the upk mutation leads to a transcription inhibition or transcription stop of a gene which is at least 70%, more preferably at least 80% and most preferably at least 90% homologous to rv2135c of M. tuberculosis.

As documented in the appended examples, the M. bovis BCG mutant as described herein may be generated by the use of specific plasmids, vectors and knock-out phages. Therefore, the invention also relates to a M. bovis BCG mutant, whereby for the generation of said M. bovis BCG mutant the pKO-upk plasmid and/or a knock-out phage phAE 159 - Δ upk is employed. The plasmids as well as the vector is described in the appended examples (see in particular section 7 of Example 1). The pKO-upk plasmid is also illustrated in appended SEQ ID NO: 13 and shown in the restriction map of Figure 1. The phage phAE159-Δupk is based on a TM4 phage comprising a 5.8 kb deletion in a non-essential part. It comprises the plasmid pYUB328, flanked by two Pad restriction sites, encoding for amp-resistance. The phAE159 is known in the art, see, inter alia Bardarow (2002), Microbiology 148, 3007-3017.

Preferably, but not limiting, the M. bovis BCG of the invention comprises a upk- mutant which is derived from a known M. bovis BCG strain. Preferably said strain is selected from the group consisting of BCG-Russia, BCG-Moreau, BCG-Japan, BCG- Sweden, BCG-Phipps, BCG-Denmark, BCG-Copenhagen, BCG-Tice, BCG-Frappier, BCG-Connaught, BCG-Birkhaug, BCG-Glaxo, and BCG-Pasteur.

In a further embodiment, the invention relates to a method for the preparation of a M. bovis BCG mutant as described herein, said method comprising the step of inactivating or partially inactivating the upk-gene and/or inactivating or partially inactivating (a) gene(s) located downstream of upk. Inactivation or partial inactivation may be achieved by recombinant methods as provided for in the appended examples.

The invention also relates to a pharmaceutical composition comprising a M. bovis BCG mutant described above or as prepared by the (recombinant) method provided herein.

Most preferably the pharmaceutical composition is a vaccine, but said pharmaceutical composition may also be employed in the prevention, amelioration or treatment of other disorders and diseases, like proliferative disorders. Most preferably said pharmaceutical composition is employed in vaccination approaches for tuberculosis.

The pharmaceutical composition comprises the mutant M. bovis BCG or parts thereof of the present invention. The pharmaceutical composition of the present invention may be used for effective therapy of infected humans and animals and/or for vaccination purposes. Also parts and fragments of the herein described M. bovis BCG mutant may be employed for the pharmaceutical or vaccination purpose. Such parts or fragments comprise but are not limited to ribosomal fractions, protein extracts, or lipid extracts.

The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier, excipient and/or diluent. Examples of suitable pharmaceutical carriers are well known in the art and include phosphate buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, sterile solutions etc. Compositions comprising such carriers can be formulated by well known conventional methods. These pharmaceutical compositions can be administered to the subject at a suitable dose. Administration of the suitable compositions may be effected by different ways, e.g., by intravenous, intraperitoneal, subcutaneous, intramuscular, topical, intradermal, intranasal or intrabronchial administration. The dosage regimen will be determined by the attending physician and clinical factors. As is well known in the medical arts, dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. Proteinaceous pharmaceutically active matter may be present in amounts between 1 ng and 10 mg per dose; however, doses below or above this exemplary range are envisioned, especially considering the aforementioned factors. Administration of the suitable compositions may be effected by different ways, e.g., by intravenous, intraperitoneal, subcutaneous, intramuscular, topical or intradermal administration. If the regimen is a continuous infusion, it should also be in the range of 1 μg to 10 mg units per kilogram of body weight per minute, respectively. Progress can be monitored by periodic assessment. The compositions of the invention may be administered locally or systemically. Administration will generally be parenterally, e.g., intravenously. The compositions of the invention may also be administered directly to the target site, e.g., by biolistic delivery to an internal or external target site or by catheter to a site in an artery. Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. Furthermore, the pharmaceutical composition of the invention may comprise further agents such as interleukins, interferons and/or CpG-containing DNA stretches depending on the intended use of the pharmaceutical composition.

Vaccines may be prepared, inter alia, from the M. bovis BCG mutant of the invention but also from one or more proteins, nucleic acid molecules derived from said M. bovis BCG mutants.

The proteins, nucleic acid molecules, fusion proteins, antigenic fragments or antibodies, fragments or derivatives of said antibodies of the invention used in a pharmaceutical composition as a vaccine may be formulated e.g. as neutral or salt forms. Pharmaceutically acceptable salts, such as acid addition salts, and others, are known in the art. Vaccines can be, inter alia, used for the treatment and/or the prevention of an infection with pathogens and are administered in dosages compatible with the method of formulation, and in such amounts that will be pharmacologically effective for prophylactic or therapeutic treatments.

Proteins, protein fragments and/or protein derivatives used as vaccines are well known in the art (see, e.g. Cryz, "Immunotherapy and Vaccines", VCH Weinheim (1991); Paul (1989), loc. cit.). Furthermore, it has been shown that even intracellular enzymes of bacterial pathogens can act as antigenic entities which provide immunological protection (Michetti, Gastroenterology 107 (1994), 1002; Radcliff, Infect. Immun. 65 (1997), 4668; Lowrie, Springer Semin. Immunopathol. 19 (1997), 161)

A vaccination protocol can comprise active or passive immunization, whereby active immunization entails the administration of the M. bovis BCG mutant of the invention, an antigen or antigens derived from said M. bovis BCG mutant as well as nucleic acid molecules derived from the M. bovis BCG mutant of the invention to the host/patient in an attempt to elicit a protective immune response. Passive immunization entails the transfer of preformed immunoglobulins or derivatives or fragments thereof (e.g., the antibodies, the derivatives or fragments thereof obtained by eliciting an immuno response in a host agonist the M. bovis BCG mutant of the invention) to a host/patient. Principles and practice of vaccination and vaccines are known to the skilled artisan, see, for example, in Paul, "Fundamental Immunology" Raven Press, New York (1989) or Morein, "Concepts in Vaccine Development", ed: S.H.E. Kaufmann, Walter de Gruyter, Berlin, New York (1996), 243-264. Typically, vaccines are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in or suspension in liquid prior to injection also may be prepared. The preparation may be emulsified or the protein may be encapsulated in liposomes. The active immunogenic ingredients often are mixed with pharmacologically acceptable excipients which are compatible with the active ingredient. Suitable excipients include but are not limited to water, saline, dextrose, glycerol, ethanol and the like; combinations of these excipients in various amounts also may be used. The vaccine also may contain small amounts of auxiliary substances such as wetting or emulsifying reagents, pH buffering agents, and/or adjuvants which enhance the effectiveness of the vaccine. For example, such adjuvants can include aluminum compositions, like aluminumhydroxide, aluminumphosphate or aluminumphosphohydroxide (as used in "Gen H-B-Vax®" or "DPT-lmpfstoff Behring"), N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-DMP), N- acetyl-nomuramyl-L-alanyl-D-isoglutamine (CGP 11687, also referred to as nor- MDP), N-acetylmuramyul-L-alanyl-D-isoglutaminyl-L-alanine-2-(1 '2'-dipalmitoyl-sn- glycero-3-hydroxphaosphoryloxy)-ethylamine (CGP 19835A, also referred to as MTP-PE), MF59 and RIBI (MPL + TDM + CWS) in a 2% squalene/Tween-80® emulsion. Further adjuvants may comprise DNA or oligonucleotides, like, inter alia, CpG-containing motifs (CpG-oligonucleotides; Krieg, Nature 374 (1995), 546-549; Pisetsky, An. Internal. Med. 126 (1997), 169-171).

The vaccines usually are administered by intravenous or intramuscular injection. Additional formulations which are suitable for other modes of administration include suppositories and, in some cases, oral formulations. For suppositories, traditional binders and carriers may include but are not limited to polyalkylene glycols or triglycerides. Oral formulation include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like. These compositions may take the form of solutions, suspensions, tables, pills, capsules, sustained release formulations or powders and contain about 10% to about 95% of active ingredient, preferably about 25% to about 70%.

Vaccines are administered in a way compatible with the dosage formulation, and in such amounts as will be prophylactically and/or therapeutically effective. The quantity to be adminstered generally is in the range of about 5 micrograms to about 250 micrograms of antigen per dose, and depends upon the subject to be dosed, the capacity of the subject's immune system to synthesize antibodies, and the degree of protection sought. Precise amounts of active ingredient required to be administered also may depend upon the judgment of the practitioner and may be unique to each subject. The vaccine may be given in a single or multiple dose schedule. A multiple dose is one in which a primary course of vaccination may be with one to ten separate doses, followed by other doses given at subsequent time intervals required to maintain and/or to reinforce the immune response, for example, at one to four months for a second dose, and if required by the individual, a subsequent dose(s) after several months. The dosage regimen also will be determined, at least in part, by the need of the individual, and be dependent upon the practitioner's judgment. It is contemplated that the vaccine containing the immunogenic compounds of the invention may be administered in conjunction with other immunoregulatory agents, for example, with immunoglobulins, with cytokines or with molecules which optimize antigen processing, like listeriolysin.

The person skilled in the art is readily in the position to prepare the pharmaceutical composition or vaccine of the invention. Corresponding protocols are, inter alia, mentioned in "Tuberkulose" (1997); Ed. Konietzko and Loddenkemper; Georg Thieme Veriag, Germany. The WHO guidelines for vaccine production demand a defined master seed, a defined bacterial content (dry weight), a defined number of reproducing units, heat stability (for example: 28 days of incubation at 37°C), and the capability of the vaccine to sensitize test animals, like guinea pigs against tuberculin. The BCG (mutant) life vaccine as disclosed herein may be homogenized and dry frozen. Before application, it may be dissolved in 1 ml and should be used the same day. As an example, 0.1 ml of the BCG vaccine (100,000 - 300,000 cfu) are applied intradermally into the left femoral.

Accordingly, the invention also provides for the use of a M. bovis BCG mutant of the invention or as prepared by the (recombinant) method provided herein for the preparation of a vaccine or a medicament for the treatment of cancer, for example the treatment of bladder cancer. Also the prevention of cancer (e.g. bladder cancer) is envisaged by the use of BCG mutant as provided herein.

In a most preferred embodiment the vaccine of the invention is a tuberculosis vaccine.

The subjects to be vaccinated by said vaccine may be human patients and are also envisaged to be adult human patients. The person skilled in the art is aware how M. bovis BCG may as a life vaccine may be administered.

The vaccine may be employed as a vaccine for prophylaxis as well as a vaccine after contact of the subject in need of such a vaccination with the corresponding pathogen, like M. tuberculosis.

The invention also provides for a method for the preparation of a pharmaceutical composition comprising the step of

(a) preparing a M. bovis BCG mutant by the method disclosed herein; and

(b) admixing the M. bovis BCG mutant as prepared by step (a) with a suitable carrier.

The carrier or diluent may be admixed with the M. bovis BCG mutant just before use as a pharmaceutical composition/vaccine. The diluent/carrier should be cold (between 0° and 8°C) and the mixed pharmaceutical is preferably used within the same day, most preferably within 6 hours.

Very often, sterile phosphate-buffered saline is employed as a carrier or diluent for the M. bovis BCG mutant vaccine or pharmaceutical composition provided herein. The person skilled in the art is aware of potential vaccination protocols which are, inter alia, described in "Medizinische Mikrobiologie und Infektiologie" (2001) Aahn; Falke, Kaufmann, Ullmann, Springer Veriag, Berlin, Heidelberg, New York or in "Lehrbuch der Medizinischen Mikrobiologie" (1994) Brandi, Kόhler, Eggers, Pulverer; Gustav Fischer Veriag, Germany.

Also part of the invention is a method of vaccinating a subject against a mycobacterial-induced disease, said method comprising the step of administering to a subject in need of such a vaccination a M. bovis BCG mutant of the invention or as prepared by the method described above, whereby said M. bovis BCG mutant elicits an immuno response in said subject.

The invention also comprises the use of a M. bovis BCG mutant described herein in the treatment or prevention of proliferative disorders, in particular of cancer, especially bladder cancer. Therefore, the invention also provides for a method of treating a cancer patient, said method comprising the step of administering to a subject in need of such a treatment a M. bovis BCG mutant of the invention or as prepared by the method disclosed herein. The cancer to be treated is preferably bladder cancer and the subject in need of such a treatment or prevention is a human.

The Figures show:

Figure 1 : The pKO-upk vector (see also SEQ ID NO: 13), the vector to be fused to the TM4 phage genome of phAE159. Flanking regions 1 and 2 were cloned next to the hygromycin resistance cassette.

Figure 2: Reconstitution vector pMV262-upk. The upk gene was cloned into the BamHI restriction site under control of the groEL2 promoter.

Figure 3: Protein sequence comparison with clustAI alignment reveals highly conserved features of E. coli BacA and mycobacterial Upk. Identity of E. coli to M. smegmatis and M. tuberculosis is 38% and similarity 50%(A). Identity of M. smegmatis to M. tuberculosis is 73%, and similiarity 78% (B). Figure 3 also comprises a Bestfit comparison of the corresponding sequences, relating to the corresponding genes in E. coli, M. smegmatis, M. tuberculosis, M. bovis and M. bovis BCG upkl and upk2. BestFit makes an optimal alignment of the best segment of similarity between two sequences. Optimal alignments are found by inserting gaps to maximize the number of matches using the local homology algorithm of Smith and Waterman. The algorithm provides the same results as clustAI.

Figure 4: An in-frame, unmarked deletion of upk was generated in M. smegmatis by a two step approach. In the first step, the counterselectable suicide plasmid pYUB657 carrying the deletion allele of upk recombined with the bacterial chromosome. Southern blot analysis confirmed the recombination event. Two orientations are possible (Southern blot a: lane 1 and 2). Clone 2 was selected. In the second step the plasmid loops out in the absence of hygromycin selective pressure. The deletion allele or the wildtype copy of upk are lost with equal probability. Deletion of upk was verified by Southern blot (Southern blot b). Lane 1 and 5 are deletions, the others are wildtype. For the following studies clone number 1 was selected.

Figure 5: Infection of murine bone marrow derived macrophages. M. smegmatis mc²155 (■), M. smegmatis c²155Aupk (π) and M. smegmatis mc²155Δup/ + pMV262-n/2136c (•) were used at a MOI of 200. After 27 min half of M. smegmatis Aupk mutants were killed. This was true for wildtype M. smegmatis after 98 min and after 126 min for Aupk mutant carrying pMV262-/v2136c. The Figure shows 1 representative experiment of 2 with similar results.

Figure 6: Construction of upk knockout mutants in M. tuberculosis and M. bovis BCG. Knockout phage genome phAE159-Δι/p/c was generated by ligation of the plasmid pKO-up/ and the phage genome phAE159 TM4 (A). Four phages were tested for temperature-sensitivity and revealed the expected phenotype- lysis at 30°C but not at 37°C (B). # 4 was picked, amplified and used for transduction of M. tuberculosis and M. bovis BCG. Lane 4 and 6 represent upk deletion mutants for M. tuberculosis H37Rv and M. bovis BCG, verified by Southern blot analysis (C).

Figure 7: Comparison of the original reconstitution vector pMV262-rv2136c, and the reconstitution vector purified from an electroporated Aupk strain. Lanes # 1 and # 2 show the pattern of the original insert with accurate orientation. Lanes # 3 and # 4 confirm this pattern for the vector purified from the reconstitution strain.

Figure 8: Growth curves. M. tuberculosis H37Rv (■), M. tuberculosis H37Rv Aupk (□), and M. tuberculosis H37Rv Aupk + pMV262-rv2136c (•) were grown at 37°C in 7H9 complete medium. The Figure shows 1 representative experiment of 2 with similar results.

Figure 9: Genomic organization of the Fas-ll system related operon encoding enzymes involved in biosynthetic pathway for long-chain fatty acids. Genes / proteins with higher transcription rate / amount of protein in the upk deletion mutant are highlighted by arrows.

Figure 10: Growth of M. tuberculosis wildtype, the upk deficient, and the reconstituted strain in lung and spleen. C57BLJ6 mice were infected with 1x10³ cfu. Filled squares represent cfu of wildtype M. tuberculosis, open squares M. tuberculosis Aupk deletion mutant, and filled reconstitution strain. The Figure shows 1 representative experiment of 2 with similar results. According to Mann Whitney test, bacterial numbers of M. tuberculosis wildtype and M. tuberculosis Aupk mutant were significantly different at day 60 and 90 in lung and spleen (P<0.0001).

Figure 11 : Survival of immunocompromised mice. Rag1^"/_ (A) and IFNγ deficient animals (B) were infected with M. tuberculosis H37Rv(β), upk deficient M. tuberculosis (□), and the reconstituted strain (•), respectively. The experiments were performed with 10 mice per group. Survival of Rag1^"A deficient animals was determined once. Figure B shows 1 representative experiment of 2 with similar results.

Figure 12: Growth of wildtype and αp/ -deficient M. bovis BCG in lung and liver of Balb/C mice infected with 5 x 10⁵ CFU. Filled squares represent cfu of wildtype M. bovis BCG, and open squares represent cfu of the M. bovis BCG upk deletion mutant. At each time-point 5 mice per group were sacrificed.

Figure 13: Measurement of IFNγ production by ELISA. Spleen cells of M. bovis BCG inoculated mice produced high levels of IFNγ upon stimulation at day 60 and 90 post infection. Within each group, left column displays unstimulated, right column displays stimulated samples. Spleen cells of mice vaccinated with upk deficient M. bovis BCG strain produced a delayed but also high response at day 90 post infection.

Figure 14: Bacterial burden of Balb/c mice challenged with M. tuberculosis H37Rv via aerosol. Filled squares represent M. tuberculosis cfu of wildtype M. bovis BCG vaccinated animals, open squares represent M. tuberculosis cfu of the M. bovis BCG Aupk vaccinated animals, crosses represent M. tuberculosis cfu of unvaccinated animals. According to Mann Whitney test, bacterial numbers of M. bovis BCG and the M. bovis BCG Aupk mutant were significantly different at day 60 and 120 in the lung (P<0.0001). Figure 15 IgG titers of unvaccinated, BCG vaccinated, and BCGΔup/c vaccinated mice were determined against M. tuberculosis protein extract and against Rv3407, d90 post vaccination. Anti M. tuberculosis protein IgG titer of BCGAupk immunized mice was higher compared to IgG titer of BCG wildtype immunized mice. Both groups exhibited increased IgG titers compared to the negative control of unvaccinated mice. In the case of anti Rv3407 IgG, BCG wildtype vaccinated mice showed slightly higher IgG levels as unvaccinated mice. IgG titers of BCGAupk vaccinated mice were markedly higher compared to wildtype and negative control.

Figure 16 Cytotoxicity of spleen cells of unvaccinated, BCG vaccinated, and BCGAupk vaccinated mice was investigated against P815 cells loaded with M. tuberculosis protein extract or A/A111 peptides or not loaded P815 cells. Effector : target (E:T) ratio varied (1 :1 , 10:1 , 40:1 , 100:1). Spleen cells exhibited no cytotoxicity against unloaded P815 cells. Cytotoxicity of BCGAupk derived spleen cells against M. tuberculosis protein extract loaded cells was increased compared to spleen cells derived from BCG wildtype and unvaccinated mice. Impressively high cytotoxicity exhibited BCGAupk derived spleen cells against A/A111 loaded P815 cells, markedly increased compared to spleen cells derived from BCG wildtype and unvaccinated mice.

The invention will now be illustrated by but is not limited to the following examples.

Example 1 : Materials and Methods employed in one present study

1. Bacterial strains and culture methods

E. coli was transformed by conventional heat shock transformation or electroporation and plated on LB-agar (Invitrogen, Paisley, UK) containing appropriate antibiotics (hygromycin B [Roche, Mannheim, Germany] at 150 μg/ml, kanamycin [Sigma Aldrich, St. Louis, MO, USA] at 35 μg I ml or ampicillin [ICN, Aurora, OH, USA] at 100 μg / ml). For blue-white selection, 1 mM IPTG (Gerbu, Gaiberg, Germany) and 75 μg I ml X-Gal (Roth, Karlsruhe, Germany) were added. All cloning procedures were done in E. coli DH5α (Invitrogen) unless stated differently. Liquid E. coli cultures were grown in LB-medium (Invitrogen) containing appropriate antibiotics (hygromycin B at 150 μg/ml, kanamycin at 50 μg/ml or ampicillin at 100 μg/ml). M. smegmatis mc²155 was electroporated as described (Snapper, Melton et al., 1990) and plated on Middlebrook 7H10 agar (BD, Franklin Lakes, NJ, USA) supplemented with 10 % albumin-dextrose saline (ADS: 0.81 % NaCl, 5 % BSA Fraction V [Serva, Heidelberg, Germany], 2 % glucose), 0.5 % glycerol, 0.05 % Tween-80 (Sigma) and either hygromycin B (50 μg/ml) or kanamycin (25 μg/ml). Liquid M. smegmatis cultures were grown in Middlebrook 7H9 medium (BD) supplemented with 10 % ADS, 0.05 % Tween-80 (Sigma) and 0.2 % glycerol (further referred to as 7H9 complete medium), containing either hygromycin B (50 μg/ml) or kanamycin (25 μg/ml). If required, sucrose was used at a concentration of 2 % and added after the medium had been autoclaved and cooled to 55°C. Biofilms were generated in M63 salts minimal medium. One liter M63 medium consisted of 13.6 g KH₂P0₄, 3.8 g (NH₄)₂S0₄, 0.5 mg FeS0₄ ^■ 7 H₂O, 0.2 % carbohydrate, 1 mM MgS0₄, 0.7 mM CaCI₂, 0.5 % casamino acids (BD) adjusted to pH 7.0 (further referred to as biofilm medium).

2. Construction of the . smegmatis knockout template

The plasmids used in this study are listed in herein below. The following table illustrates strains and plasmids used in this study.

Strain or Plasmid Description⁵ Source or Reference

Strains

E. coli DH5α standard cloning strain. Invitrogen E. CO// HB101 cloning strain for resolvase instable plasmids M. smegmatis mc²155 wildtype, ept-1 (Snapper, Melton, Mustafa, Kieser, & Jacobs, Jr., 1990)

M. smegmatis mc²155 pYUB657-Δup/_f single crossover strain, Hyg^R, Suc^s This study

M. smegmatis mc²155 Aupk deletion mutant of the upk gene, Hyg^s, Suc^R This study

M. smegmatis mc²155 Aupk + pMV262- reconstitution of the upk deletion mutant, Hyg^s, Suc^R, Kan^R This study rv2136c

M. tuberculosis H37Rv wildtype, standard laboratory strain

M. tuberculosis H37Rv Aupk deletion mutant of upk gene, Hyg^R This study

M. tuberculosis H37Rv Aupk÷ pMV262- reconstitution of the upk deletion mutant, Hyg^R, Kan^R This study

rv2136c

M. bovis BCG standard vaccine strain

M. bovis BCG Aupk deletion mutant of upk gene, Hyg^F This study

Plasmids pPCR-Script Amp Cloning vector, Amp Stratagene pYUB657 suicide plasmid, bearing groEL2 (Hsp60) promoter and sacB, (Pavelka, Jr. & Hyg^R, Amp^R Jacobs, Jr., 1999) pYUB657-Δi/p/ suicide plasmid carrying up/r-deletion template This study pMV262-n/2736c pMV262-Kan containing the M. tuberculosis rv2136c gene This study pMV262-Kan E. co//-mycobacteria shuttle vector, groEL2 (hsp60) W.R. Jacobs Jr. promoter, Kan^R, ColE1 , OriM pJSC284 starting plasmid for construction of a knockout template, Hyg^R W.R. Jacobs Jr. pKO-upk pJSC284, containing flanking regions, Hyg^R This study

Plasmids were amplified in E. coli HB101 or E. coli DH5α and purified with Qiagen columns as recommended by the manufacturer (Qiagen, Inc., Chatsworth, CA, USA). DNA fragments used for plasmid construction were purified by agarose gel electrophoresis and recovered by QIAEXII gel extraction kit (Qiagen). Mycobacterial genomic DNA was prepared from 10 ml cultures. Bacteria were lysed with 1.3 ml of a 3:1 mixture of chloroform-methanol. The lysate was mixed with 1.3 ml of Tris-equilibrated phenol and 2 ml of RLT buffer (Qiagen) supplemented with 0.5% N-lauroylsarcosine (Sigma) and 1 % β-mercaptoethanol. The upper phase was collected after centrifugation, and the genomic DNA was precipitated with isopropanol. This DNA preparation method was also scaled down to the use of 1 / 10 of all ingredients and thus was called microprep. For southern blotting, genomic DNA was digested with BamYW and transferred to a positively charged nylon membrane (Roche) using a pressure blotter. The probe was labeled and fragments were visualized with DIG DNA Labeling and Detection Kit (Roche) as recommended by the manufacturer.

The in-frame, unmarked deletion template Aupk contains the 2 flanking regions next to upk. Flanking regions (879 bp and 945 bp) and the M. tuberculosis upk homologue rv2136c were amplified by PCR. Specific primer pairs and chromosomal DNA are listed in the following Table. List of primers

Amplified DNA Primer³ Template DNA fragment

M. smegmatis flanking region 1 P1 : 5'-gatatccttttcgagcacgaccga-3' M. smegmatis mc²155 (SEQ ID NO: 14) P2: 5'-aagcttcttggcaccggggtactg-3' (SEQ ID NO: 15) flanking region 2 P3: 5'-aagcttcatcgcaggaacgtcagt-3' M. smegmatis mc 155 (SEQ ID NO: 16) P4: 5'-gatatcaggtcgacacggaagtagcca-3' (SEQ ID NO: 17)

M. tuberculosis flanking region 1 P1 : 5'-ggatcccgtcatcgaagaccatga-3' M. tuberculosis H37Rv (SEQ ID NO: 18) P2: 5'-ggatccgacttgccaccaagacat-3' (SEQ ID NO: 19) flanking region 2 P3: 5'-accggtctcgtgctgctggctacc-3' M. tuberculosis H37Rv (SEQ ID NO: 20) P4: 5'-accggtcacctccaaaataccgcg-3' (SEQ ID NO: 21) rv2136c rv2136c-START: 5'- M. tuberculosis H37Rv ggatccatgctgtggcacgcaatg-3' (SEQ ID NO: 22) rv2136c-END: 5'-ggatccccagtcgtcctcttcgtc- 3' (SEQ ID NO: 23)

RealTime rv2136c rv2136c-\w. 5'-atcctgagcgcttggttg-3' M. tuberculosis H37Rv (SEQ ID NO: 24) wildtype, Aupk mutant,

5'-gggtttgggcaataccaac-3' reconstitution (SEQ ID NO: 25) rv3627c rv3627c-\w. 5'-ccacagtcaaggcgggagtggt-3' M. tuberculosis H37Rv (SEQ ID NO: 26) wildtype, Aupk mutant, rv3527c-rev: 5'-acacgacaggtccctgggggtt-3' reconstitution (SEQ ID NO: 27) rv2946c rv2946c-\w. 5'-aactcgagtctgccggtg-3' (SEQ M. tuberculosis H37Rv ID NO: 28) wildtype, Aupk mutant, rv2946c-rev: 5'-tagcaccgaggcatccac-3' reconstitution (SEQ ID NO: 29)

^a restriction sites are added

PCR was carried out for 1 initial cycle of 5 min at 95°C, followed by 25-30 cycles (95 °C for 1 min, 60°C for 1 min, 72 °C for 3 min), and 1 final cycle at 72 °C for 10 min. All PCR products were blunt end cloned into the Srf site of pPCR-Script SK⁺ Amp. The respective cloning kit was used (Stratagene, La Jolla, CA, USA). Sequence identity was verified by sequencing. The flanking regions were cleaved from cloning vectors using H/ndlll and EcoRV. In a 2 step ligation, flanking regions 1 and 2 were first dimerized and then inserted into the EcoRV predigested and dephosphorylated vector pYUB657.

3. Electron microscopy

For fine structural analysis, cells were fixed with 2.5 % glutaraldehyde, postfixed with 1 % osmiumtetroxid, contrasted with uranylacetate and tannic acid, dehydrated and embedded in Polybed (Polysciences, Eppelheim, Germany). After polymerization, specimens were cut at 60 nm and contrasted with lead citrate. For immunodetection, cells were fixed with 4 % PFA and embedded in a mixture of 25 % sucrose / 10 % polyvinyl alcohol (PVA). Ultrathin sections were cut at -105 °C, blocked, reacted with primary anti-peptidoglycan-antibodies (Biotrend, Koln, Germany) followed by secondary antibodies coupled to 6 nm gold particles. Specimens were analyzed in a Leo 906E transmission electron microscope.

4. Alamar blue assay

Antimicrobial susceptibility testing of bacitracin (Calbiochem, San Diego, CA, USA) and Isoniazid (Sigma) was performed in 96-well microplates. Outer perimeter wells were filled with sterile water to prevent dehydration in experimental wells. Antibiotic dilutions were dissolved in distilled deionized water and subsequent dilutions were performed in 7H9 complete medium. Wildtype, mutant, and the reconstituted strain of M. smegmatis mc² 155 or M. tuberculosis H37Rv each were inoculated in 7H9 complete medium and grown at 37°C until OD₆oo = 1.0 was reached. This culture was diluted 1 : 40 and 100 μl per well were added to a microtiter plate containing titrated antibiotics. Plates were covered with breathable sealing membrane (Nunc, Naperville, IL, USA) and incubated at 37 °C for 16-20 h in the case of M. smegmatis and 4 to 5 days in the case of M. tuberculosis. Then 5 μl per well of Alamar Blue (Serotec, Oxford, UK) was added. After further 6-7 h (M. smegmatis) incubation at 37°C, extinction at 570 nm was measured in an ELISA-reader. Respectively, after over night (M. tuberculosis) incubation pictures were taken to document. Color change was examined visually to determine value of bacterial growth.

5. Biofilm formation

Single colonies of M. smegmatis mc² 155 wildtype and M. smegmatis Aupk mutant were inoculated in 7H9 complete medium and grown to saturation. Fifty μl from this preculture were inoculated into 1 ml of biofilm medium and cultured in 12 well plates (Nunc) at room temperature (RT) for 4 to 5 days. The medium was removed and 500 μl of 1 % crystal violet (BD) were added. Plates were incubated at RT for 30 min, rinsed with water and examined under the microscope. For microscopy, biofilms were grown on glass cover slips, which had been placed into each cavity of a 12 well plate. Auramine Rhodamine staining was performed with Fluorescent Stain Kit B according to the recommendations of the manufacturer (BD). Male C57BL/6 mice were used for the in vivo biofilm assay. Ten mice per group were anesthetized with 50 μl of a 1 :1 :3 mixture of Ketavet (Pharmacia, Erlangen, Germany), Rompun (Bayer, Leverkusen, Germany), and PBS. Subsequently 1 x 10⁷ bacteria / 5 μl were applied to a penis. Next day, overnight grown smegmata were counted. Mice wore protections manufactured from 50 ml tubes (BD), to avoid cleaning. 6. Infection of bone marrow derived mouse macrophages

Bone marrow cells from C57BL/6 mice were flushed out of femura and tibiae using a syringe with a 23G gauge (Braun, Melsungen, Germany). Differentiation and harvesting was performed as described before (Schaible & Kaufmann, 2002). Infection was executed in 24 well plates using RPMI medium (Biochrom, Berlin, Germany) supplemented with 10 % FCS (Biochrom), 1 % Hepes (Biochrom), and 1 % L-Glutamine (Biochrom). One million bone-marrow derived macrophages were used per well. M. smegmatis was added at a multiplicity of infection (MOI) of 200. Infection lasted for 2 h, followed by 3 washes with RPMI supplemented with 10 % FCS, Hepes, L-Glutamine, and 250 μg Amikacin / ml (Sigma). Subsequently, cells were lysed with 1 ml 0.1 % TritonXIOO at different time points and serial dilutions were plated on 7H10 agar plates.

7. Construction of a recombinant TM4 knockout phage

Flanking regions to the target gene upk were cloned into the vector pJSC284 next to a hygromycin resistance cassette. The sizes of the flanking regions were: flanking region 1 = 810 bp and flanking region 2 = 807 bp amplified by PCR (conditions: see above; Primers: see table above) and extended with the restriction sites BamH\ (flanking region 1) and Agel (flanking region 2). The PCR products were purified from an agarose gel and ligated in pPCR-Script Amp SK(+) (Stratagene), transformed, amplified, and sequences were verified. Flanking region 2 had an internal Age\ restriction site which was overlooked in the beginning. To overcome this problem, the fragment was Noi\-BamH\-c t out of pPCR-Script and blunted by Klenow reaction, performed as the manufacturer recommended (NEB). Subsequently fragments were ligated into the BamH\ blunted Age\ restriction site of pJSC284. The resulting vector was called pKO-upk (Fig. 1). For amplification it had to be transformed into E. coli HB101 as the DH5 strain exhibits resolvase activity which may affect plasmid stability. The pKO-upk and the genome of TM4 phage phAE159 were Pad digested in order to fuse the knockout construct to the phage genome. Before, genomic phage DNA had to be self-ligated via internal cos-sites. Because of a very inefficient phAE159-Δ-yp/f producing ligation reaction, DNA was in vitro packaged into λ-phage- heads using Gigapack III (Stratagene). Transduction-competent E. co// HB101 were used, and phasmid containing bacteria were selected on hygromycin containing LB- agar plates. As phasmids are huge molecules, DNA was purified by classical alkaline lysis miniprep. Control for correct insertion of the knockout construct, was performed by Pad digest, which revealed a 5 kb fragment by gel electrophoresis. All positive clones were pooled. One μl of recombinant phasmid DNA was used to transform M. smegmatis as a host for phage production. Phages had to maintain temperature sensitivity (t_s) so that they became lytic at 30°C but not at 37°C. This was critical because subsequently transduced M. tuberculosis was to be grown at 37°C and should not have succumbed to lysis.

Electroporation conditions for transformation of mycobacteria, in this case M. smegmatis, were: 1000 Ω 25 μF 2.5 kV

A cuvette with a 0.2 cm gap was used. This was followed by addition of 1 ml 7H9 complete medium, 30 min incubation at 30°C and plating in 2 alternative ways:

1. Electroporation of 900 μl M. smegmatis solution, mixed with 4 ml top-agar and poured on mycobacteriophage plates. This was working well in the case of inefficient transformation.

2. Electroporation of 100 μl M. smegmatis solution, mixed with 100 μl M. smegmatis wildtype solution and 4 ml top-agar poured on mycobacteriophage plates. This worked well in the case of a very efficient transformation that was in need of more bacteria for lysis. mycobacteriophage plates: - 19 g 7H10 agar (BD) - 1000 ml H₂O autoclaved, and further enriched with 10 ml 20 % dextrose and 10 ml 50 % glycerin top agar: - 0.235 g 7H9 medium powder (BD) - 0.38 g noble agar (BD) - 50 ml H₂0 autoclaved, liquefied in a microwave oven before use and enriched with 500 μl 20 % dextrose. Used in 4 ml aliquots that were kept liquid at 50°C in a heat block.

Plates were incubated 3 to 4 days at 30°C. During this time a lawn of M. smegmatis was growing in the top-agar, intermitted by plaques, produced by lytic phages. Plaques were picked and patched on 2 top-agars which were subsequently incubated at 30°C or 37°C to assess whether the phages had retained their temperature-sensitivity. One t_s phage was picked and eluted over night at 4°C in 500 μl of mycobacteriophage-buffer (MP-buffer).

MP-buffer: - 25 ml 1 M Tris / HCl, pH 7.5 - 75 ml 1 M NaCl - 5 ml 1 M MgS0₄ - 1 ml 1 M CaCI₂ - H₂0 ad 500 ml autoclaved, or filter sterilized

This extract was called "phage-lysate". To amplify the phage, 300 μl of serial phage- lysate dilutions (undiluted to 1 x 10^"4) in MP-buffer were mixed with 300 μl of M. smegmatis and adsorbed at 30°C for 30 to 120 min. Out of each dilution-mix, 3 times 200 μl were mixed with 4 ml top-agar, poured on mycobacteriophage plates, and incubated 3 to 4 days. To harvest the phages, plates were chosen in which the phage had lysed almost the entire lawn ("lacy plates"). Top agars were collected with cell scrapers (Sarstedt, Newton, USA) and incubated over night with 2 - 4 ml MP- buffer per top agar at 4°C. This was followed by 10 min centrifugation at 4000 rpm, and 0.22 μm filter sterilization of supematants. To determine the titer of the phage lysate, dilutions up to 10^"9 were prepared in MP-buffer, and 5 μl per dilution were spotted on a mycobacteriophage plate with a top-agar containing 200 to 400 μl M. smegmatis. After 3 to 4 days, plaques per spot were counted, and the titers calculated. A last verification of proper orientation of the flanking regions and possession of the hygromycin resistance cassette was done by PCR using flanking region- and HygOut- primers and 1 x 10^"2 dilutions of the phage lysate.

8. Transduction of M. tuberculosis

A culture of M. tuberculosis H37Rv was grown to OD₆oo = 0.8 - 1.0. Per transduction, 10 ml culture were centrifuged at 3000 rpm for 10 min and the pellet was resuspended 1 ml MP-buffer. One ml of a high titer phage lysate (at least 10¹⁰ pfu/ml) was pre-warmed at 37°C, mixed with the concentrated bacteria, and incubated for 4 h at 37°C. Subsequently, transduced cells were centrifuged for 10 min at 3000 rpm, resuspended in 500-1000 μl 7H9 medium, and plated on 4 7H10 plates containing 75 μg hygromycin / ml. After 4 weeks of incubation at 37°C, clones were picked to inoculate 5 ml liquid cultures in 7H9 complete medium shaking at 90 rpm for 1-2 weeks. Following, medium was added to expand the cultures. Ten ml were used to prepare chromosomal DNA for southern blot analysis of the clones.

9. Reconstitution of the mutants

The upk gene was amplified by PCR (Primers: see Table above), cloned into pPCRScript, sequenced, and cloned into the E. coli mycobacteria shuttle vector pMV262 under control of the M. bovis groEL2 (hsp60) promoter as translational fusion. Competent M. tuberculosis H37Rv Aupk were electroporated, and plated on 7H10 agar plates containing 75 μg hygromycin per ml and 25 μg kanamycin per ml. After 4 weeks, clones were picked, and 5 ml cultures were inoculated. Out of well- grown cultures, 1 ml was taken to perform DNA microprep and subsequent PCR to check for the kanamycin resistance cassette and the upk gene. DNA derived from a positive clone was also taken to transform E coli DH5α. The amplified and purified plasmid was BamHl digested and compared by agarose gel electrophoresis to the original plasmid. Transcription of the upk gene from the reconstitution vector pMV262-t/p/c was quantified by real-time PCR which is based on the measurement of amplified products after each cycle of the PCR using fluorescent dyes interacting only with double stranded DNA. The more template that is present at the beginning of the reaction, the lower the number of cycles it takes to reach a point in which the fluorescent signal is first recorded as statistically significant above background, which is the definition of the threshold cycle (Ct). Comparison of the threshold cycle for a specific template in each sample leads to semi-quantitative evaluation of original template concentration. For semi-quantitative real-time PCR total RNA was transcribed to cDNA using Superscript™ III (Invitrogen) as the manufacturer recommended. All PCRs were run for 40 cylces with 20 sec 94°C and 60 sec 60°C in the ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) using ABI PRISM optical 96-well plates (Applied Biosystems). Primers are listed in the Table above. Reaction mixtures were set up in 30 μl final volume using 15 pmol of each primer, 5 μl template cDNA and 15 μl 2x SYBR-Green PCR Master mix (Applied Biosystems). Data analysis was performed using the ABI Prism 7000 SDS Software and Microsoft Excel.

10. Preparation of competent E. coli

Five ml of Psi medium was inoculated with one colony and precultured over night at 37°C.

Psi medium: - 2.5 g Bacto Yeast Extract (BD) - 10 g Bacto Tryptone (BD) - 2.5 g MgS0₄ - 500 ml H₂0 adjusted with KOH to pH 7.6 and filter sterilized

One hundred ml of Psi medium were inoculated with 1 ml of the preculture and grown at 37°C to OD₅₅₀ = 0.5. Thereupon the culture was left 15 min on ice, centrifuged for 10 min at 3000 rpm and resuspended in 40 ml cold Tfbl solution.

Tfbl solution: - 30 mM potassium acetate - 100 mM rubidium chloride - 10 mM calcium chloride - 50 mM manganese chloride - 15 % v/v glycerol - H₂O ad 200 ml adjusted to pH 5.8 with diluted acetic acid and filter sterilized

After 15 min on ice, and centrifugation for 10 min at 3000 rpm, the pellet was resuspended in 4ml of cold Tfbll solution.

Tfbll solution: - 10 mM MOPS - 75 mM calcium chloride - 10 mM rubidium chloride - 15 % v/v glycerol - H₂O ad 100 ml adjusted to pH 6.5 with diluted caustic soda and filter sterilized

After further 15 min on ice, cells were used immediately or were frozen in liquid nitrogen and stored at -80°C. For each transformation 40 - 50 μl of the cells were mixed with up to 1 μg DNA, incubated for 30 min on ice, 45 s at 42°C, and again 2 min on ice. One ml of SOC medium was added and after 1 h at 37°C, cells were plated. 11. Purification of chromosomal DNA from mycobacteriophages

Five μl of DNAse (1 mg / ml) and 10 μl RNAse (10 mg / ml) were added to 1 ml of phage-lysate, incubated for 30 min at 37°C, and supplemented with 50 μl of freshly made STEP-buffer.

STEP-buffer: - 400 mM EDTA pH 8.0 - 50 mM Tris pH 8.0 - 1 % SDS - H₂0 EDTA was pre-warmed to 50°C, and complete STEP-buffer was kept at 50°C to avoid SDS precipitation.

After addition of 20 μl of proteinase K (10 mg / ml) (Merck, Darmstadt, Germany) and 30 min incubation at 56°C, the sample was split. Each part was 2 times extracted with 500 μl phenol and 2 times with 500 μl chloroform : iso-amyl-alcohol (24:1). Supernatants were mixed with 50 μl of sodium acetate and 1 ml of 100 % ethanol. After 2 min at RT, DNA was precipitated by spinning for 20 min at 13,000 rpm. The pellet was washed with 1 ml 70% ethanol, air-dried and resuspended in 50 - 100 μl TE-buffer over night at 4°C. A few μl on an agarose gel demonstrated a band at 50 kb.

12. In vitro packaging of phasmid DNA

Two μl of a phasmid ligation were mixed with an aliquot of Gigapack III Gold (Stratagene), briefly centrifuged and incubated at RT for 90-120 min. Afterwards 500 μl of SM-buffer were added. This solution was called packaging mix.

SM-buffer: 0.58 g NaCl 0.2 g MgS0₄ x 7 H₂0 5 ml Tris / HCI, pH 7.5 - 10 mg gelatine or 0.5 ml of a 2 % solution - H₂O ad 100 ml autoclaved

Fifty μl of the packaging mix were incubated with 200 μl of transduction competent E. CO// HB101 for 20 min at 37°C without shaking. After addition of 1 ml LB-medium and 60 min expression at 37°C, bacteria were plated on LB-plates containing 150 μg of hygromycin and grown over night at 37°C.

13. Preparation of transduction competent E. co// HB101

Twenty ml LB-medium which had been enriched with 0.4 % maltose and 10 mM MgS0 were inoculated with 500 μl of a well grown E. coli HB101 preculture, and grown to OD₆oo = 0.5 - 0.7 at 37°C. Ten ml were centrifuged at 3000 rpm for 10 min, and the pellet was resuspended in 5 ml of 10 mM MgS0 .

14. Classical miniprep

The pellet of a 5 ml E. coli culture was resuspended in 100μl of LB-medium. Cells were lysed in 300 μl TENS-solution and incubated for up to 5 min at RT.

TENS-solution 94 ml sterile TE-buffer 1 mMO M NaOH 5 ml 10 % SDS

TE-Buffer - 5 ml 1 M Tris/HCI, pH 8.0 - 1 ml 0.5 M EDTA, pH 8.0 - H₂0 ad 500 ml autoclaved

This was mixed with 150 μl sodium acetate (pH 5.2), incubated for 5 - 10 min on ice, and centrifuged for 10 min at 13,000 rpm. The supernatant (about 500 μl) was transferred to a new reaction tube, and mixed with 500 μl phenol : chloroform : iso- amyl-alcohol (25 : 24 : 1). After 5 min centrifugation at 13,000 rpm the supernatant was transferred to a new reaction tube, 900 μl 100 % ethanol was added, followed by 1 min incubation at RT and 15 min centrifugation at 13,000 rpm. The pellet was washed with 1 ml 70 % ethanol, dried, and resuspended in 50 μl TE-buffer enriched with 1 μl RNAse (10 mg / ml).

15. Preparation of electro-competent mycobacteria

Fifty ml M. tuberculosis respectively M. smegmatis was grown in 7H9 complete medium to OD₆oo = 0.6 - 1.0. M. smegmatis was cooled for 1-2 h on ice and subsequently washed 3 times with cold 10 % glycerol. The pellet was resuspended in 2 ml cold 10 % glycerol. In case of M. tuberculosis, bacteria were washed 3 times with 10 % glycerol at RT and resuspended in 5 ml 10 % glycerol.

16. Neutral-red staining

Five ml of a well grown bacterial culture were centrifuged at 3000 rpm for 10 min, supernatant was discarded, 5 ml 50 % aqueous methanol added, followed by incubation for 1 h at 37°C. Again, the bacteria were washed with 50 % aqueous methanol, and the pellet was resuspended in 5 ml neutral-red (Merck). neutral red: - 1 vial barbital buffer (Sigma) - 2 g neutral red - ad 1000 ml - pH 9.8 sterile-filtered

Color change was visible after 1 h at RT. 17. Pellicle formation

Standing cultures were used to investigate pellicle formation of the M. tuberculosis strains. Therefore 20 ml Sauton medium was inoculated with 1 ml of a well grown pre-culture, incubated in 50 ml conical tubes at 37°C.

Sauton medium: - 20 g L-asparagine - 10 g sodium-citrate - 2.5 g K₂HP0₄ - 2.5 g MgS0₄ x 7 H₂0 - 250 mg ammonium-iron-lll-citrate - 300 g glycerin - ad 5 I H₂0 sterile-filtered

18. Cording assay

About 3 μl of a well-grown culture were transferred into subdivisions of a 8 chamber- slide (Nunc), and air dried. Subsequently 1 ml of 7H9 complete medium without Tween 80 was added, followed by 2 - 3 weeks incubation at 37°C. Then, medium and chambers were removed, and the slide was soaked in formalin over night. Staining was performed with the TB Fluorescent Stain Kit B (Auramine O-Rhodamine B) (BD) as the manufacturer recommended.

19. RNA-preparation from mycobacteria and analysis of the gene expression pattern

RNA-preparation was performed in conformity with isolation of genomic DNA (see above) as this procedure allows purification of all nucleic acids. Purification of RNA from the aqueous phase was performed using RNeasy Mini Kit (Qiagen) as the manufacturer recommended. Labeling, hybridization to a DNA-array, scanning and evaluation of the signals were done in accordance with H. Rachman doctoral thesis "Functional Genome Analysis of Mycobacterium tuberculosis", 2003, Technische Universitat, Berlin.

20. Preparation of M. tuberculosis whole cell lysates for two-dimensional electrophoresis (2-DE)

A culture of 100 ml M. tuberculosis was grown to OD₆oo = 0.8 - 1 , centrifuged at 3000 g and 4°C for 15 min, washed twice with 100 ml cold PBS 0.05 % Tween 80 resuspended in 1 ml cold PBS Tween 80, transferred to a micro-centrifuge screw cab tube with lid gasket, and centrifuged at 4 °C and 10,000 g for 15 min. To avoid proteolytic degradation, 1 μl of each of the protease inhibitors TLCK (100 mg / ml), pepstatin A (50 mg / ml), leupeptin (100 mg / ml) and E64 (25 mg / ml) diluted in DMSO was added to the cell pellet, which was sonified afterwards. Urea was gradually added to a final concentration of 9 M to the sonicate (108 mg urea / 100 μl sonicate). Furthermore, dithiothreitol (DTT) to a final concentration of 70 mM, ampholytes (Servalytes 2 - 4; 2 %) and Triton X-100 (2 %) were added. The sample was kept at RT for 30 min, stirred occasionally, centrifuged at 10,000 rpm and 16°C for 15 min. The supernatant was removed and 2-DE performed.

21. Protein separation by two-dimensional electrophoresis

Protein separation by 2-DE was performed as a combination of carrier ampholyte isoelectric focusing (IEF) and SDS-PAGE using gels with a size of 23 x 30 cm (Klose & Kobalz, 1995). IEF was performed in rod gels containing 9 M urea, 3.5% acrylamide, 0.3% piperazine diacrylamide and a total of 4% ampholytes pH 2-11 (Servalytes 2-11 ; Serva, Heidelberg, Germany). Protein samples were applied at the anodic side of the IEF gels and focused under non-equilibrium pH gradient electrophoresis conditions (8,870 Vh). For analytical and preparative investigations 0.75 mm or 1.5 mm thick gels were used, respectively. For analytical investigations, 60 μg of protein sample were applied. For preparative experiments, we applied up to 600 μg of protein sample. SDS-PAGE was performed in gels containing 15% acrylamide using the IEF gels as stacking gels. Following electrophoresis, proteins were visualized by either silver (analytical gels) (Jungblut & Seifert, 1990) or Coomassie Brilliant Blue (CBB) G250 staining (preparative gels) (Doherty, Littman et al., 1998). The pi and Mr gradient of the 2-DE gels was determined using an iterative calibration method as described (Aksu, Scheler et al., 2002).

22. Evaluation of differential proteins by PDquest

The 2-DE patterns were first examined visually aimed at the identification of spots of differential relative intensity between whole cell lysates of wild-type M. tuberculosis H37Rv on the one hand and the deletion mutant M. tuberculosis H37RvΔι/p/c on the other hand. For both strains, 3 different protein samples were prepared, and two 2- DE runs were performed per sample. To elucidate potential variations, two 2-DE gels of independently prepared samples of M. tuberculosis H37Rv were compared individually with 2 patterns of the mutant strain. Variants which were detected in both gel comparisons were regarded as potential variants. These were finally checked by analyzing all 2-DE patterns, i.e. 6 patterns per strain, and only stringently confirmed differences were accepted as specific variations. For quantitative analysis, the 2-DE gels were further evaluated using the image analysis software programme PDQuest (Version 7.1 , BioRad, Hercules, CA, USA). After scanning the gels (8 bit gray values; 100 dpi), spot detection and quantification were performed automatically by fitting spot intensities with a two-dimensional Gaussian model. Corresponding spots in distinct 2-DE gels were matched using a distortion model that takes into account local gel running differences. Prior to the final quantitative data analysis, spot detection and matching were checked thoroughly and corrected manually in an interactive manner. This time-consuming step was essential to achieve reliable results. For quantitative data analysis of spot intensities, a t-test (significance level P<0.05) was applied.

23. Protein identification by mass spectrometry

Identification of gel-separated proteins was performed using matrix assisted laser desorption/ionisation mass spectrometry (MALDI-MS) peptide mass fingerprinting (MALDI-MS PMF) (Henzel, Billed et al., 1993;James, Quadroni et al., 1993;Mann, Hojrup et al., 1993;Mann & Wilm, 1994), electrospray ionisation tandem mass spectrometry (ESI-MS/MS) (Mann & Wilm, 1994) and/or capillary liquid chromatography in combination with ESI-MS/MS (CapLC-MS/MS) (Peng & Gygi, 2001). MALDI-MS PMF was performed as described (Jungblut, Schaible et al., 1999; Mollenkopf, Mattow et al., 2002) with minor modifications. In short, spots of interest were excised from preparative CBB G250-stained 2-DE gels and proteins were digested in-gel using trypsin. Resulting peptides were desalted and concentrated prior to mass analysis using ZipTipCι₈ pipette tips (Millipore, Bedford, USA). Masses of the tryptic peptides were determined using a time-of-flight mass spectrometer with delayed extraction. Mass accuracy in the range of 30 ppm was obtained by internal calibration of the spectra. Proteins were identified by PMF using the search algorithm MS-FIT. The applied presettings and criteria for identification have been described previously (Mattow, Jungblut et al., 2001). In some cases, sequence support was required, to establish protein identity. Sequence support was obtained by either ESI- MS/MS performed as described (Muller, Schumann et al., 1999) or CapLC-MS/MS as described below. For ESI-MS/MS analyses the sequence tag method (Wilm, Neubauer et al., 1996) was used to search for the proteins in the NCBI protein database (http://195.41.108.38/PA_PeptidePatternForm.html). If this was not successful, a de novo sequencing with the program MassSeq (Micromass, Manchester, UK) and a database search in the M. tuberculosis protein database of the Institute for Genomic Research (http://www.tigr.org/tigr- scripts/CMR2/GenomePage3.spl?database=gmt) were performed. The search was carried out for the coding part of the genome and the entire genome. Some peptide mixture samples were chromatographically separated prior to on-line mass analysis using a capillary liquid chromatography system delivering a gradient to formic acid (0.1%) and acetonitrile (80%). The eluted peptides were ionized by electrospray ionization on a Q-TOF hybrid mass spectrometer. The instrument, in automated switch mode, selects precursor ions based on intensity for peptide sequencing by collision-induced fragmentation tandem MS. The MS/MS analyses were conducted using collision energy profiles that were chosen based on the m/z value of the precursor. The generated mass data were processed into peak lists containing m/z value, charge state of the parent ion, fragment ion masses and intensities, and correlated with proteins and nucleic acid sequence databases using the search algorithm Mascot (Perkins, Pappin et al., 1999). Proteins were identified based on matching the MS/MS data with mass values calculated for selected ion series of a peptide. A non-redundant protein database and a nucleotide database (dbEST) were searched without applying any constraints on Mr or species. Results were validated manually.

24. Infection procedures

Before intranasal infection, mice were anesthetized according to animal protection law with 10 μl (0.2 mg) Rompun (Bayer), and 10 μl (1.2 mg) Ketavet (Pharmacia).

Thirty μl PBS was added, and a total volume of 50 μl / mouse was injected into the femoral muscle. After a few minutes mice were anesthetized, and the appropriate dose of bacteria was given as drops of 20 μl on the nostrils.

Intravenous infections (0.1 ml) were given into the tail vein using a 1 ml Sub-Q syringe (BD).

Aerosol infection was performed as described elsewhere, using a Glas-col aerosol generator (BD) resulting in approximately 100 - 200 cfu of M. tuberculosis being deposited in the lung of each mouse (Rolph, Raupach et al., 2001).

25. Determination of bacterial load

Infected mice were sacrificed at distinct time points by cervical dislocation. The examined organs were transferred to 1 ml PBS, 0.05 % Tween 80, homogenized and after serial dilution in PBS, 0.05 % Tween 80 plated on 7H11 agar plates supplemented with OADC (BD), cycloheximide (Merck), and ampicillin. After 3 - 4 weeks of incubation at 37°C the cfu were determined.

26. Histology

Tissue was fixed in 4 % formalin/PBS, dehydrated and embedded in paraffin, 5 μm sections were cut, and subsequently Hematoxylin and Eosin (H&E) stained. Rehydration was performed at 2 times 10 min Xylene, 2 x 5 min 95% ethanol, 2 x 5 min 80 % ethanol, 1 x 5 min 70 % ethanol, 1 x 5 min deionized H₂0. For hematoxylin staining samples were incubated 1 x 10 min hematoxalin (Sigma), rinsed with water for 10 min, dipped in acid ethanol, rinsed in water, followed by Eosin Y (Sigma) staining for 1 min. Subsequently samples were rinsed in water and dehydrated for 3 min 95 % ethanol and 2 min Xylene. Samples were mounted using coverslip slides and permount.

27. Enzyme-Linked Immunosorbent Assay (ELISA)

Coating of 96 well plates was performed with 100 μl / well of monoclonal antibody rat anti-mouse IFNγ (clone R4-6A2, ATCC; 1 μg / ml) for 1 h at 37°C or over night at 4°C. Subsequently, 3 x washing with PBS 0.05 % Tween 20, 1 h blocking with 200 μl of blocking buffer (PBS + 1 % BSA) for 1 h at 37°C and further 3 x washing. Standard (IFNγ [R&D] dilutions) and samples were added and incubated for 3 days. After 3 x washing, 1 h incubation with 100 μl XMG1.2-biotin second monoclonal antibody (1 μg / ml), and further 3 x washing, 100 μl of streptavidine alkaline phosphatase (Dianova, Hamburg, Germany) (diluted 1 : 2000) were added and incubated for 1 h at 37°C. Samples were 3 x washed, and 50 μl of substrate solution (1 tablet p-nitrophenyl-phosphate (Sigma) / 5ml di-ethanolamine-buffer (48.5 ml diethanolamine, 400 mg MgCI₂, 100 mg NaN₃ (0.02 %), ad 500 ml H₂0, pH 9.8) per well was added. The reaction was stopped with 50 μl of 0.5 M EDTA, pH 8.0, and samples were measured at 405 nm / 490 nm.

IFNγ containing samples were collected from cells restimulated as follows: Cells were prepared from spleens which were passaged through a mesh, centrifuged for 5 min at 1500 rpm and 4°C. The pellet was resuspended in 1.5 ml erylyse-buffer. erylyse-buffer: - 8.29 g NH₄CI - 1 g KHC0₃ - 0.037 g EDTA - ad 1000 ml H₂0 and autoclaved

Subsequently, RPMI was added to a volume of 15 ml, the cells were centrifuged, resuspended in 10 ml RPMI, and adjusted to 1 x 10⁶ / ml. One hundred μl were used per well and mixed with 100 μl medium or M. tuberculosis protein extract (10 μg / ml), respectively. After 3d of restimulation at 37°C / 5 % C0₂, culture supernatants were collected and measured for IFNγ by ELISA.

Example 2: Sequence comparison of Upk homologues

Protein sequences of E. coli undecaprenyl-phosphokinase (BacA), M. smegmatis undecaprenyl-phosphokinase (Upk), and M. tuberculosis Upk were compared by clustAI analysis (Fig. 3A). Both mycobacterial proteins showed 38 % identity to E. coli BacA and about 50 % similarity. ClustAI comparison of M. smegmatis and M. tuberculosis Upk revealed 73 % identity and 78 % similarity (Fig 3B). Highly conserved features were visible for all three homologues.

Comparison of M. tuberculosis upk and M. bovis upk revealed the exchange of one amino acid reflecting similarity of both proteins of more than 99%. Comparing the M. bovis BCG fragments upkl and upk2 to M. tuberculosis upk there is an improperly sequenced gap from amino acid 209 to 243. Apart from this gap both M. bovis BCG upk fragments are 100% similar to the M. tuberculosis upk.

Example 3: Construction of Aupk mutant of M. smegmatis mc² 155

An in-frame, unmarked deletion of the M. smegmatis upk gene was created by a two- step-method (Pavelka, Jr. & Jacobs, Jr., 1999). Regions of 879 bp and 945 bp flanking the upk gene in M. smegmatis were amplified by PCR and inserted into pYUB657. Thus 96% of the wildtype upk gene was deleted. The mutated copy of upk was introduced into M. smegmatis by electroporation. Hyg^R transformants which displayed a Suc^s phenotype were assayed for recombination by Southern blot. There is the possibility of integration upstream or downstream of the target gene by single crossover. A mutant in which the template plasmid has inserted upstream, resulting in 11 ,547 bp and 7,337 bp fragments on Southern blot (Fig 4., southern blot a) was chosen for further analysis. A culture of this single crossover strain was grown overnight in complete medium without hygromycin. This period of growth allowed double crossover events to occur, followed by plasmid loss. Deletion or preservation of the wildtype allele occur with equal probability. Two out of 5 analyzed clones displayed the characteristics of a upk deletion mutant (Fig. 4, southern blot b). The mutant strain was named M. smegmatis Aupk. A complementation strain was constructed, using pMV262-rv2136c, a multicopy plasmid expressing the M. tuberculosis H37Rv homologue of the upk gene under control of the M. bovis BCG groEL2 (HspδO) promoter. The parent plasmid, pMV262, is an episomal E. coli- mycobacteria shuttle plasmid.

Example 4: Differential abundance of peptidoglycan and colony morphology

Bacteria were grown on 7H10 agar plates. While wildtype M. smegmatis showed dome-like morphology, Aupk mutant colonies exhibited caved-in structures. Although this observation suggests that the cell wall is affected, examination by electron microscopy revealed no differences. Yet, specific immunogold-staining of peptidoglycan revealed a lower number of gold-particles associated with the cell surface of the Aupk mutant. Twenty electron microscopy images of stainings of wildtype and the Aupk mutant were examined. For wildtype, 241 particles were counted of which 27% were surface associated. Of the 225 particles counted on the Aupk mutant bacteria, only 13% were surface associated.

Example 5: Sensitivity to bacitracin

As described above, Aupk mutants are expected to be more sensitive to bacitracin than wildtype M. smegmatis. This issue was investigated by the alamar blue assay. Alamar blue is a redox-dye that converts from blue to red upon reduction, reflecting a measure of growth (Collins & Franzblau, 1997). Bacteria were incubated over night in 7H9 complete medium supplemented with serial dilutions of bacitracin (0 U/ml - 2,500 U/ml). Next day, alamar blue was added and fluorescence at 570 nm was measured. The M. smegmatis Aupk mutant showed no growth at a concentration of 500 U/ml bacitracin, whereas wildtype reached 55% of its maximal growth. The reconstituted strain M. smegmatis Aupk + pMV262-rv2136c failed to regain wildtype growth but displayed an intermediate phenotype. Example 6: Accelerated clearance from infected macrophages

A further experiment was carried out in order to verify whether upk homologues contribute to virulence of pathogenic mycobacteria. Therefore the model of macrophage infection was chosen. Although, M. smegmatis fails to persist in macrophages it was possible to compare the survival times of M. smegmatis and the Aupk mutant in murine bone marrow derived macrophages. After infection, bacteria were cleared quickly. The time needed to kill half of the bacterial number upon infection differed between M. smegmatis wildtype (98 min), M. smegmatis Aupk mutant (27 min) and the reconstituted mutant strain (126 min) (Fig. 5).

Example 7: Growth properties and biofilm formation

Bacterial growth curves exhibited slightly slower growth of the M. smegmatis Aupk mutant compared to M. smegmatis wildtype after 9 h in 7H9 complete medium and after 9 and 24 h in biofilm medium. Nevertheless, after 24 h, in 7H9 complete medium and after 72 h in biofilm medium, growth characteristics of all M. smegmatis strains adapted.

M. smegmatis forms biofilms under natural conditions (Recht & Kolter, 2001). It was determined whether deletion of the upk gene affected biofilm formation in vitro and in vivo. After 4 to 5 days shaking at RT in biofilm medium, biofilms were analyzed. Wildtype bacteria completely covered the surface whereas Aupk M. smegmatis only produced scattered islands of biofilm.

Principally, an intact biofilm is characterized by a matrix consisting of extracellular polymer substances (EPS). Such a matrix was clearly visible for wildtype M. smegmatis, whereas the Aupk mutant grew in separated single cells. Additional studies to follow in vivo biofilm development were performed. M. smegmatis wildtype applied to a mouse penis induced smegma in 65 % of the animals, whereas smegma development upon application of Aupk deletion mutant was observed for 42% only, which was about background level. Groups consisted of 10 animals each. The M. smegmatis upk gene was identified and an in-frame, unmarked deletion mutant was generated. The absence of Upk influenced bacitracin sensitivity, peptidoglycan synthesis, survival in macrophages, growth properties, and biofilm formation in vitro and in vivo. In vitro biofilms of M. smegmatis Aupk mutant were characterized as scattered islands of bacteria compared to a completely covered surface observed for wildtype bacteria. The M. smegmatis Aupk strain is the first to express a phenotype in a newly developed in vivo mouse model of biofilms.

Example 8: Construction of Aupk mutant strains of M. tuberculosis and M. bovis BCG

A temperature sensitive (ts) TM4 phage delivery system was used to generate hygromycin-marked knockout mutants in M. tuberculosis and M. bovis BCG. Flanking regions to the M. tuberculosis upk gene were cloned next to a hygromycin resistance cassette and fused to the phage genome. Recombinant ts phages were amplified at 30°C using M. smegmatis growing in top agars as a host. At 37°C, phages were impaired to become lytic and could be used to transduce M. tuberculosis H37Rv and M. bovis BCG. The recombinant phages transferred their DNA into the bacteria. Flanking regions induced double crossover events, thus exchanging the upk gene with a hygromycin resistance cassette, which subsequently was verified by Southern blot (Fig. 6). The mutant strains were named; M. tuberculosis Aupk and M. bovis BCG Aupk.

A complementation strain of M. tuberculosis was constructed using pMV262- rv2136c, a multicopy plasmid expressing upk under control of the groEL2 (Hsp60) promoter of M. bovis. The parent plasmid, pMV262, is an episomal E. coli- mycobacteria shuttle-plasmid. M. tuberculosis was difficult to transform by electroporation. In many cases, only the antibiotic resistance was transformed and other parts of the plasmid were lost. Thus, the appropriate size of the resistance cassette and the rv2136c gene (data not shown) was verified by PCR for kanamycin resistant colonies of M. tuberculosis H37Rv Aupk mutants, transformed with pM\J262-rv2136c. Additionally, whole DNA was prepared from a positive clone and used for transformation of E. coli DH5 . Subsequently, the plasmid was purified and compared to the original vector. BamHI digest, released the rv2136c insert. Sail digest was used to verify the correct orientation of the insert. The fragments were analyzed by gelelectrophoresis and appeared as the same size as the original vector. The recombinant M. tuberculosis Aupk knockout clone carrying this vector was used as the complementation strain (Fig. 7). Transcription levels of upk were determined by RT-PCR in relation to rv2946c, a gene transcribed at the same level in the M. tuberculosis H37Rv Aupk mutant and wildtype. Transcription of the upk gene under control of the groEL2 promoter was 3.51 fold higher than rv2946c- transcription and 201.56 fold lower than transcription of upk in the wildtype strain under control of the natural promoter in late logarithmic growth phase.

Example 9: Growth curve of M. tuberculosis Δ upk mutant and in vitro assays

Growth properties in 7H9 medium were examined for the 3 strains: wildtype, Aupk mutant, and reconstitution. OD₆oo was measured once a day. The M. tuberculosis Aupk mutant showed no differences in growth rate compared to wildtype whereas the complementation strain grew more slowly (Fig. 8).

Colonies of M. tuberculosis wildtype, the M. tuberculosis Aupk mutant and the reconstituted strain were of the same shape (data not shown). The attenuated strain M. tuberculosis H37Ra is known to behave differently compared to M. tuberculosis H37Rv in the following in vitro assays: Neutral red staining, cording assay, and pellicle culture. The H37Ra-strain is not stainable with neutral-red (Soto, Andreu et al., 2002).

For virulent M. tuberculosis H37Rv, bacterial cord-factors e.g. trehalose dimycolate (TDM; (Ryll, Kumazawa et al., 2001) are necessary for growth in cords on a surface in non-shaking cultures (Byrd, Green et al., 1998).

After 2 to 3 weeks, cultures of M. tuberculosis grown without shaking in Sauton medium, form pellicles on top of the medium and bacteria push each other up the wall of the tube.

All M. tuberculosis strains were examined in these 3 assays:

- The strains were treated with neutral red. Pellets of stained Aupk knockout mutant and complementation strain exhibited red color like H37Rv wildtype. did, thus revealing no phenotype-differences.

- Also cording was not affected by loss of upk. All strains were stained with rhodamine auramine.

- The M. tuberculosis strains revealed phenotype-differences in case of pellicle formation. The Aupk mutant was hampered in pellicle formation and the complementation strain developed a gapless, smooth pellicle in contrast to the rough pellicle of M. tuberculosis wildtype.

Example 10: Proteome and transcriptome analysis

Cultures of M. tuberculosis H37Rv and the Aupk mutant were grown to late log- phase (OD₆oo = 1 -0) and whole cell lysates, as well as RNA were purified.

Proteome analysis was performed with 3 independent protein lysates of both strains, M. tuberculosis wildtype and M. tuberculosis Aupk mutant. Each sample was analyzed on 2 gels. The comparative proteome analysis of 12 gels (6 wildtype and 6 mutant) revealed 45 spots of differential relative intensity. For the Aupk mutant, 23 spots belonged to the group of higher intensity and 22 spots exhibited lower intensity (Table 1) compared to M. tuberculosis wildtype. The 2-DE gels were first evaluated visually. Subsequently, the gels were re-evaluated by means of the image analysis program PDQuest. This software allowed verification of significance of the results by t-test and offered the possibility to quantify spot intensities.

In parallel to determine and compare gene expression profiles, RNA of M. tuberculosis H37Rv and the Aupk strain were purified and hybridized to a M. tuberculosis array. Wildtype and mutant showed a high number of differentially regulated genes.

Correlation of the results of proteome and transcriptome was limited. Comparing M. tuberculosis Aupk and M. tuberculosis wildtype, proteins of higher spot intensity, such as Rv0341 and Rv2462 had a higher transcription rate, too. And proteins of lower spot intensity, like Rv1912 and Rv0125 also had a lower transcription rate. However, Rv2031c / HspX was a protein of high abundance in M. tuberculosis Aupk whole cell lysates, compared to M. tuberculosis wildtype, but gene expression did not differ between both strains. HspX is of interest, because it is one of several proteins produced during persistence of bacteria under low oxygen conditions and within granulomas, but at a lower level during logarithmic growth phase (Quinn, Birkness K.A. et al., 2002; Sherman, Voskuil et al., 2001). The examined bacterial cultures were harvested at late logarithmic growth phase (OD₆oo = 0.8 - 1).

Table 1a: M. tuberculosis H37Rv Aupk protein spots of higher relative intensity

Spot Identity Functional Fold change number category ** (mutant strain

* compared to wildtype)

ft 08 NADH dehydrogenase chain E 7 new spot (nuoE, Rv3149) ft 09 Antigen 84 3 new spot (wag31 , Rv2145c) ft 11 Hypothetical protein Rv0341 and 3, 2 new spot glu-tRNA-gln amidotransferase, subunit B (gatA, Rv3011c) ft 17 not identified new spot ft 18 not identified new spot ft 19 not identified new spot ft 20 not identified new spot ft 01 14 kDa antigen 0 12.0 (hspX, Rv2031c) ft 03 14 kDa antigen 0 8.0 (hspX, Rv2031c) ft 03b 14 kDa antigen 0 6.1 (hspX, Rv2031c) ft 12 [beta]-ketoacyl-ACP synthase 1 3.7 (kasB, Rv2246) ft 03a 14 kDa antigen 0 3.3 (hspX, Rv2031c) ft 05 Hypothetical protein Rv1284 10 3.0 ft 17 not identified 2.6 ft 04 not identified 2.3 ft 12a 2.3 Spot Identity Functional Fold change number category ** (mutant strain compared to wildtype) ft 04 not identified 2.3 ft 14 not identified 2.2 new ft Putative transcriptional regulator 9 2.2

01 (Rv1956) newft 05 Two-component response regulator 9 2.1 (NarL, Rv0844c) ft 13 Chaperone protein, similar to trigger 3 2.0 factor (tig, Rv2462c) ft 07 left Hypothetical protein Rv0207c 10 2.0 ft 07 Hypothetical protein Rv0207c 10 2.0 right

* Spot numbers are according to discovery order of spots of different intensity, "ft" means higher spot intensity.

**see Table 3: tubercuiist classification of functional categories

Table 1b: M. tuberculosis H37Rv Aupk protein spots of lower relative intensity

Spot Identity Functional Fold change number category ** (mutant strain

* compared to wildtype)

Ψ θ6 Hypothetical protein Rv0481c 16 lost spot 07 Hypothetical protein Rv0968 10 lost spot

Ψ 08 Hypothetical protein Rv0968 10 lost spot 12 not identified lost spot 18 3-hydroxyacyl-CoA dehydrogenase 1 lost spot (fadB5, Rv1912c)

U 04 not identified 10.3 11 Hypothetical protein Rv2302 10 7.4

II 24 Probable serine protease 7 5.0 (pepA, Rv0125)

Ψ θ2 Hypothetical protein Rv3615c 10 4.9

J] 03 Hypothetical protein Rv3615c 10 4.6

Ψ θ9 Hypothetical protein Rv0967 10 3.7 21 not identified 3.1

U 13 possible Soj/para-related protein 3 2.9 Rv3213c

U 01 not identified 2.8 23 Hypothetical protein Rv3651 10 2.8

U 7a Hypothetical protein Rv0968 10 2.4

Ψ θ5 Hypothetical protein Rv3369 10 2.1

Ψ 16 Possible haloalkane dehalogenase 7 2.1 Rv1833c (1 10 Hypothetical protein Rv1558 10 2.1

Spot Identity Functional Fold change number category ** (mutant strain compared to wildtype)

Ψ 22 Ribose-phosphate pyrophosphokinase 7 2.1 (prsA, Rv1017c)

JjO6a Hypothetical protein Rv0481c 16 2.0 i- 14 Possible ketoacyl reductase Rv1544 1 2.0

* Spot numbers are according to discovery order of spots of different intensity. " " means lower spot intensity.

**see Table 3: tubercuiist classification of functional categories

Table 2a: . tuberculosis H37Rv Aupk genes of higher transcription rate compared to wildtype rv- Synonyms Description Function number al category

rv2243 mtFabD malonyl CoA-Acyl carrier protein 1 transacylase FabD (malonyl CoA.ΑcpM acyltransferase) rv0873 fadEW probable acyl-CoA dehydrogenase FadE10 1 rv3136 PPE PPE family protein 6 rv3407 conserved hypothetical protein 10 rv2247 accD6 acetyl/propionyl-CoA carboxylase (beta subunit) 1 AccD6

rv1871 conserved hypothetical protein 10 rv0702 rplD probable 50s ribosomal protein L4 RplD 2 rv1103c conserved hypothetical protein 10 rv2879c conserved hypothetical protein 10 rv0874c conserved hypothetical protein 10 rv3801c fadD32 probable fatty-acid-CoA ligase FadD32 (fatty-acid- 1 CoA synthetase) (fatty-acid-CoA synthase) rv2245 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 KasA 1 (beta-ketoacyl-ACP synthase) (KAS I) rv1094 desA1 probable acyl-[ acyl-carrier-protein] desaturase 1 DesA1 (acyl-[ACP] desaturase) (stearoyl-ACP desaturase) (protein Des) rv1736c narX probable nitrate reductase NarX 7 rv0685 tuf probable iron-regulated elongation factor Tu Tuf 2 (Ef-Tu) rv0313 conserved hypothetical protein 10 rv3548c probable short-chain type dehydrogenase I I reductase rv3583c possible transcription factor 9 rv1174c TB8.4 low molecular weight T-cell antigen TB8.4 3

rv1821 secA2 possible preprotein translocase ATPase SecA2 *see Table 3: tubercuiist classification of functional categories

Table 2b: M. tuberculosis H37Rv Aupk genes of lower transcription rate compared to wildtype

rv- Synonyms Description Function number al category

rv2909c probable 30s ribosomal protein s16 Rpsp 2 rv2649 probable transposase for insertion sequence 5 element Is6110 Rv2648 probable transposase for insertion sequence 5 element Is6110 rv2278 probable transposase 5 rv1669 hypothetical protein 16 rv1276c conserved hypothetical protein 10 rv3281 conserved hypothetical protein 10 rv1663 pks17 Probable polyketide synthase Pks17 1 rv2168c probable transposase 5 rv1066 conserved hypothetical protein 10 rv3280 accD5 probable propionyl-CoA carboxylase beta chain 5 1 AccD5 (Pccase) (propanoyl-CoA:carbon dioxide ligase) key enzyme in the catabolic pathway of odd-chain-fatty acids rv2666 probable transposase for insertion sequence 5 element IS1081 (fragment) rv0894 possible transcriptional regulatory protein (possibly 9 LuxR-family) rv1275 IprC possible lipoprotein LprC 3 rv3824c papA1 probable conserved polyketide synthase 1 associated protein PapA1 , thought to be involved in lipid metabolism rv2717c conserved hypothetical protein 10 rv2013 possible transposase 5 rv1047 probable transposase 5 rv2011 conserved hypothetical protein 10 rv2528c mrr probable restriction system protein Mrr 2

*see Table 3: tubercuiist classification of functional categories Table 3: functional categories

Tubercuiist classification of functional categories

# 0 virulence, detoxification, adaptation

# 1 lipid metabolism

# 2 information pathways

# 3 cell wall and cell processes

# 4 stable RNAs

# 5 insertion seqs and phages

# 6 PE/PPE

# 7 intermediary metabolism and respiration

# 8 unknown

# 9 regulatory proteins

# 10 conserved hypotheticals

# 16 conserved hypotheticals with an orthologue in M. bovis

Thirty percent of the genes with a higher transcription rate in M. tuberculosis Aupk mutant compared to M. tuberculosis wildtype encode for proteins involved in lipid metabolism, additional 10 % were cell wall and cell-process related genes. Taken together, 40 % of the most significantly up-regulated genes were involved in the cell envelope complex. This corresponds to the observation that within the group of higher intensity protein spots, 37 % belong to the cell envelope complex. Twenty percent of the genes with a lower transcription rate in M. tuberculosis Aupk encode for proteins which are related to the cell envelope complex. Again, this corresponds to 21 % of the protein spots with lower intensity which are related to cell envelope complex.

Global analysis pointed to especially one significantly upregulated gene cluster of transcriptome analysis: fabD (rv2243), kasA (rv2245), and accD6 (rv2247), and additionally from proteome analysis: KasB (Rv2246). This represents 4 members of a 5 gene operon (Fig. 9), consisting of FAS-II system encoding enzymes involved in biosynthetic pathway for long-chain fatty acids and precursors of mycolic acids which are part of MAPc. The higher transcription rate of a FAS-II system related operon in the case of the Aupk deletion mutant may reflect a mechanism to overcome the upk deficiency. The rv2244 gene and its geneproduct were inconspicuous concerning transcriptome and proteome analysis.

Example 11: Evaluation of sensitivity to antibiotics

The alamar blue assay was used to determine sensitivity to antibiotics in the same way as described for M. smegmatis. Since there was no access to an Elisa-reader under biosafety level 3 (BSL3) conditions, completed assays were documented with a digital camera and visual color change was the value of bacterial growth. Alamar blue turns from blue to red upon reduction, indicating growth. Based on observations with M. smegmatis, the Aupk mutant was expected to be more sensitive to bacitracin. In contrast, no difference between M. tuberculosis H37Rv wildtype and Aupk mutant was detectable. The reconstituted strain was slightly more susceptible to bacitracin at minute concentration differences of the antibiotic. M. tuberculosis H37Rv and M. tuberculosis Aupk were resistant to bacitracin up to a concentration of 20 units / ml. KasA and KasB which are over-expressed in the M. tuberculosis Aupk mutant, had been proposed to contribute to Isoniazid-resistance (Kremer, Dover et al., 2003; Slayden & Barry, III, 2002). Sensitivity of the Aupk mutant to this antibiotic was therefore determined. All three examined M. tuberculosis strains were able to grow at concentrations of up to 20 μg Isoniazid / ml except for M. tuberculosis Aupk mutant which was slightly more susceptible, rather contradicting profound contribution of KasA to Isoniazid resistance.

Example 12: Infection studies

To determine whether the upk deletion influenced growth of the mutant in vivo, C57BIJ6 mice were infected intranasally with 1x10³ cfu. Five mice per group, infected with M. tuberculosis H37Rv, M. tuberculosis Aupk, and M. tuberculosis Aupk + pMV262-up/ , were sacrificed at day 1 to precisely determine the concentration of the inoculum. At day 30, 60, and 90, bacterial load in lung and spleen were determined (Fig. 10). M. tuberculosis H37Rv showed a characteristic growth curve with a plateau in the lung at 1x10⁷ cfu. In contrast, cfu of the Aupk mutant increased less than a log per lung during the first 30 days and remained at a level of about 1.4 x 10⁴ cfu / lung until day 90. The reconstituted strain reached an almost constant bacterial load of 1.8 x 10³ cfu / lung at day 90. Nevertheless, all 3 strains were able to disseminate and were detected in spleen and liver (data not shown). While the burden of wildtype bacteria in spleen rose up to 1 x 10⁵ cfu / organ by day 60, the burden of the upk mutant did exceed 4.1 x 10³ cfu / spleen at day 30 and decreased afterwards. The phenotype of the reconstituted strain was unexpected and exhibited a slightly lower bacterial load than the M. tuberculosis Aupk strain in lung and spleen.

Example 13: Histology

Organs of infected animals, were removed for histological examinations. At day 90 post infection, lungs of M. tuberculosis wildtype and M. tuberculosis Aupk mutant infected mice revealed striking differences. Typically, animals infected with M. tuberculosis H37Rv showed severe pathology in the lung. Granulomas were formed and a major part of the lung consisted of affected tissue. In the case of upk deficient M. tuberculosis, granuloma and affected tissue were found but, in contrast to infection with M. tuberculosis wildtype, the majority of the lung appeared unaffected. The same observation was made for the reconstituted strain which failed to mimic the characteristics of the wildtype strain.

Example 14: Survival

Knowledge about virulence of a pathogen can be acquired by infection of immunocompromised mice which fail to control disease beyond a certain threshold. Commonly used immunocompromised animal models are i) highly susceptible Rag1^" ^/_ mice which lack T and B cells and hence, fail to mount an adaptive immune response (Mombaerts, lacomini et al., 1992) and ii) IFNγ^"7" mice which are deficient in generating the central mediator of protection against tuberculosis. In this study, Rag1^v" mice were infected with 1x10⁶ cfu mycobacteria. M. tuberculosis wildtype infected mice survived 26 days in the median (range: d23 - d49). Mice infected with M. tuberculosis Aupk survived 70 days in the median (range: d67 - d77) . Survival times of wildtype and mutant infected animals were significantly different according to logrank test (P<0.0001). The reconstituted strain killed mice after day 42 and about 50 % of the mice survived longer than those infected with the Aupk strain (Fig. 11 A).

Similar to Rag1^v" mice, IFNγ^7" animals were less susceptible to the Aupk mutant strain than to M. tuberculosis H37Rv wildtype. The median survival time of wildtype infected animals was 30 days (range: d26 - d32), and for M. tuberculosis Aupk mutant infected animals, 80 days (range: d63 - d126). Survival times of wildtype and mutant infected animals were significantly different according to logrank test (P<0.0001). Unexpectedly, the reconstituted strain was more attenuated than the mutant (Fig. 11 B).

A upk deletion mutant (M. tuberculosis Aupk) was generated on a M. tuberculosis H37Rv background. In vitro growth properties of the mutant in shaking culture in 7H9 complete medium, cording, and neutral red to staining of this strain were unaffected. In addition, standing cultures in Sauton medium exhibited impaired pellicle formation. Global analysis of proteome and transcriptome revealed a high number of genes associated with lipid metabolism upregulated in the mutant, especially an operon of the mycobacterial FAS-II system. Increased sensitivity to bacitracin, however, was not detected. The upk deficient M. tuberculosis strain exhibited markedly reduced growth and pathology in vivo as well as reduced virulence in Rag1^";" and IFNγ^";" KO mice infections.

Example 15: Infection studies with . bovis BCG Δ upk

Balb/c mice were infected with 5 x 10⁵ cfu of the M. bovis BCG Aupk strain and the M. bovis BCG wildtype strain i.v. and bacterial numbers were determined at days 15, 30, 60, and 90 post infection in lung and liver (Fig. 12). In the median, the bacterial burden in the lung of M. bovis BCG wildtype infected mice was about 2.17 times higher compared to mice infected with the upk deletion mutant, and 8.2 times higher in the liver. The small difference in bacterial load remained almost constant over the observed period of 90 days but was not significant according to "Mann Whitney" test (lung P = 0.5; liver P = 0.2).

Example 16: IFNγ production of stimulated spleen cells

IFNγ production by spleen cells of infected and of non infected mice was addressed by ELISA-assay (Fig. 13). Cells of whole spleens were either stimulated or left unstimulated with M. tuberculosis protein extracts. Spleen cells derived from naive mice failed to produce IFNγ, whilst cells of M. bovis BCG wildtype infected mice produced high levels of IFNγ at day 60 and day 90 post infection. Delayed IFNγ production of a comparably high level was measured at day 90 post infection in the case of spleen cells derived from mice infected with the BCG Aupk deletion mutant.

Example 17: Vaccine trial

A major goal of studies with recombinant M. bovis BCG would be their utilization as improved vaccines. To exploit this possibility we compared vaccine efficacy of M. bovis BCG Aupk to the existing vaccine M. bovis BCG. Balb/c mice were vaccinated i.v. with 5 x 10⁵ cfu. After 120 days these animals and an unvaccinated control group were challenged with about 200 cfu M. tuberculosis H37Rv delivered as aerosol. At distinct time-points thereafter, bacterial loads in lung and spleen were determined (Fig. 14). M. tuberculosis cfu differences in the spleen were very small between the groups 30, 60, and 120 days post infection. The M. tuberculosis burden in the lung of both groups of vaccinated animals was about the same and 60 fold lower compared to unvaccinated animals at day 30 post infection. However, by day 120 post infection, the BCG Aupk mutant strain was able to induce a significantly superior protection (Δlog = 2.7 in relation to naive mice) compared to wildtype M. bovis BCG (Δlog = 0.9) in the lung.

Mice infected with the M. bovis BCG Aupk strain exhibited lower bacterial load in lung and liver compared to mice infected with wildtype BCG. As a consequence, a delayed IFNγ response was observed. Protection against M. tuberculosis challenge induced by the BCG Aupk mutant strain was highly improved in the lung of vaccinated animals at day 120 post infection compared to animals vaccinated with M. bovis BCG wildtype.

Example 18: Polar effects of Δupk in M. tuberculosis

Determination of polar effects

50 ml cultures of M. tuberculosis H37Rv and M. tuberculosis H37Rv Aupk were grown to an OD₆oo of 0.5 to 1.0, transferred to four 15 ml polypropylene tubes and centrifuged at 2,000 x g for 10 min. After discarding the supernatant, the tubes were centrifuged at 2,000 x g for 1 minute and 1 ml of a fresh 3:1 chloroform-methanol mix was added to each pellet. After mixing and adding of 5 ml Trizol (Sigma), samples were mixed again, incubated for 10 min at room temperature and subsequently spinned for 15 min at 2,000 x g and 4 °C. The aqueous upper level was transferred to a chloroform rinsed Sarstedt tube and an equal volume of isopropanol was added. After over night precipitation at -20 °C samples were centrifuged for 30 min at 20,000 x g and the pellets were washed twice with cold 70 % ethanol. RNA was resuspended in 100 μ\ of cold diethyl pyrocarbonate (DEPC) treated distilled water and further purified using RNeasy Mini Kit (Qiagen). After DNase digest samples were checked for DNA contamination by PCR. DNA free samples were transcribed to cDNA using Superscript™ III (Invitrogen). cDNA samples were diluted 1 : 25 with DEPC treated distilled water and PCR was carried out for 1 initial cycle of 5 min at 95°C, followed by 50 cycles (95 °C for 1 min, 54°C for 1 min, 72 °C for 3 min), and 1 final cycle at 72 °C for 10 min.

There were no transcripts of the rv2136c gene and the rv2135c gene detectable by RT-PCR in the case of the Δupk mutant. This was expected for the rv2136c gene because this is the deleted upk gene. Additionally, transcription of the downstream rv2135c gene was disabled probably due to disruption of the promoter and / or regulatory elements. RT-PCR demonstrated flanking genes rv2134c and rv2137c to be transcribed. In the case of M. tuberculosis H37Rv wildtype and DNA control each of the four examined genes / transcripts was detectable. Primers: rv2134c forward primer 6->24 : CCGCGCAATTCACGTATTC Tm = 62.5 reverse primer 580->563 : CAGGGTCATCGCCAGACC Tm = 62.7

PCR product length: 575, GC = 67%

rv2135c forward primer 161 ->178 : CAATGCTGCGGTGTCAAC Tm = 59.8 reverse primer 470->453 : TTGATGACATCGCCATGG Tm = 60.0

PCR product length: 310, GC = 66%

rv2136c forward primer 196->213 : ATCCTGAGCGCTTGGTTG Tm = 59.9 reverse primer 475->457 : GGGTTTGGGCAATACCAAC Tm = 60.0

PCR product length: 280

rv2137c forward primer 1->21 : ATGCGAAACATGAAGTCAACC Tm = 60.0 reverse primer 342->325 : GTCAATGTCGACCAGGCC Tm = 60.1

PCR product length: 342, GC = 57%

Example 19: Interpretation of data presented in Example 4 to 17

A) Impact of upk deletion on cell wall attributes

S. aureus and S. pneumoniae AbacA mutants show no significant alterations in growth rate or morphology (Chalker et al., 2000). In contrast, the in-frame, unmarked deletion of upk, in M. smegmatis revealed a distinct phenotype. While the growth rate was almost unaltered, M. smegmatis Aupk colonies did not display dome-like structures, like that of the wildtype strain. Rather, they showed caved-in structures indicating autolysis of the cells. Upk deletion must be responsible for the altered colony morphology since complementation resulted in a return to dome-like colonies. A comparable phenomenon did not appear for M. tuberculosis or M. bovis BCG. This suggests that Upk may play different roles, or at least have different physiological functions, in different mycobacteria.

An altered cell wall might exhibit visible changes when examined by electron microscopy, however, the M. smegmatis Aupk cell wall appeared comparable to wildtype by electron microscopic examination (Fig. 8). More direct analyses of the cell wall by immuno-gold staining revealed less, though still detectable, peptidoglycan in the mutant. Deletion of the upk gene, therefore, did not lead to complete loss of peptidoglycan in the cell wall. Although the effect observed was small, alternative, yet less efficient pathways for undecaprenyl-phosphorylation or transport of peptidoglycan precursors may exist, as indicated by the slightly slower growth of M. smegmatis Aupk mutant in vitro.

As described for E. coli, S. aureus, and S. pneumoniae, undecaprenyl phosphokinase deletion mutants exhibit higher sensitivity to bacitracin (Cain et al., 2000). A knockout mutant strain of the mycobacterial homologue upk was expected to show the same susceptibility. This was verified unequivocally by the alamar blue assay for M. smegmatis. Complementation with the M. tuberculosis upk homologue rv2136c partially reversed the susceptibility of M. smegmatis. Incomplete complementation may be due to constitutive gene expression of upk driven by the groEL2 (Hsp60) promoter, which does not reflect the physiological regulation of the gene. Surprisingly, the M. tuberculosis mutant strain was the first described bacterial upk deletion mutant that did not exhibit altered sensitivity to bacitracin. This finding demonstrates the uniqueness of the M. tuberculosis cell envelope not only to other bacteria but also to fast growing non-pathogenic species of mycobacteria (Brennan & Nikaido, 1995; Lee, Brennan et al., 1996), and emphasizes that even highly conserved proteins can have a range of activities in different species. M. tuberculosis may possess an efficient alternative pathway to shuttle out peptidoglycan precursors or may preserve the integrity of its cell wall by overproduction of other components. However, as shown in this study growth properties of M. tuberculosis Aupk in pellicle cultures were affected and this is likely due to altered surface features.

The reconstituted strains in this study were constructed on the knockout background by electroporation with the episomal multi copy plasmid pMV262-upk. In all cases, the M. tuberculosis H37Rv upk gene was under the control of the M. bovis groEL2 (Hsp60) promoter. With regard to distinct properties, the reconstituted strain failed to display unilaterally a wildtype phenotype: M. smegmatis Aupk + pMV2G2- upk grew in dome-like colonies and persisted in macrophages similar to wildtype M. smegmatis, whereas resistance to bacitracin was intermediate between wildtype and Aupk mutant.

M. tuberculosis mouse infections never displayed a wildtype-like phenotype for M. tuberculosis Aupk + pMV262-upk. This phenomenon is likely due to weak transcriptional activity. For various genes the groEL2 promoter can provide the cell with more transcripts than the natural promoter, but for late log phase in vitro the groEL2 promoter transcribed about 200 fold weaker than the M. tuberculosis wildtype promoter. This severe regulation problem provides the most likely explanation for the failure of the complementation strain to achieve a wildtype phenotype in infection. In the case of M. tuberculosis pellicle formation, an intermediate phenotype of the complementation strain compared to wildtype and Aupk mutant was also observed.

B) Physiological balance

Upk is thought to be critical for mycobacterial cell envelope formation and it was, therefore, expected that the Aupk mutant would attempt to compensate in some way. Global screening by proteome and transcriptome analysis was performed to identify putative compensatory mechanisms. One obvious response of the M. tuberculosis Aupk mutant was the upregulation of a FASII-system related operon (n/2243 - rv2247) Fig. 9). The involvement of KasA / Rv2245, one gene product of this operon, in Isoniazid resistance, has been thoroughly investigated. A report by Mdluli et al. on Isoniazid-resistant patient isolates, which lacked other mutations associated with resistance to the drug, showed amino acid altering mutations in the KasA protein (Mdluli, Slayden et al., 1998). Additional studies further supported a role of KasA and KasB in Isoniazid resistance (Slayden & Barry, III, 2002). In contrast, other studies (Lee, Lim et al., 1999; Piatek, Telenti et al., 2000) reported that 3 of the 4 clinical isolates bearing mutated /cas/4-alleles were fully susceptible to Isoniazid. To date, gene transfer experiments determining whether any of these mutations confers Isoniazid resistance to susceptible strains of mycobacteria have not been performed. It is shown that the Aupk deletion mutant of M. tuberculosis H37Rv, which overexpressed kasA, did not exhibit increased resistance to Isoniazid in the alamar blue assay, but rather had a slightly higher susceptebility. This finding supports a recent study which favors a gene distinct from kasA, namely inhA, as the major primary target for Isoniazid (Kremer et al., 2003).

Mycobacterial FAS-II, unlike other bacterial type II FAS cognates, is incapable of de- novo fatty acid biosynthesis (Bloch, 1977), however it appears able to elongate C - AcpM of mycobacteria and Ci₆-AcpM to preferentially long chain fatty acids ranging from 24 to 56 carbon atoms. Recent studies suggest that KasA (Rv2245) is part of FAS-II and participates in mycolic acid biosynthesis (Kremer, Douglas et al., 2000;Kremer, Dover et al., 2002). Mycolic acids are high molecular weight α-alkyl, β- hydroxy fatty acids with the general structure R-CH(OH)-CH(R')-COOH, where R is a meromycolate chain consisting of 50 - 56 carbons and R' is a shorter aliphatic branch possessing 22 - 26 carbons (Brennan & Nikaido, 1995). Mycolic acids are key components of the mycobacterial cell wall and play a role in producing an effective lipophilic barrier. Considering the importance of mycolic acids in bacterial survival and maintenance of cell wall integrity, the Aupk deletion mutant may benefit from overproduction of this cell wall component in order to overcome reduced peptidoglycan. In addition, increased mycolic acids may improve the blocking of phagosome-lysosome fusion and better allow the bacteria to escape degradation by the host. This strategy prevents exposure of the bacterium to the hostile environment of the lysosome while rendering it accesible to nutrients endocytosed by the cell. The underlying mechanism is not yet fully understood (Fratti, Vergne et al., 2000; Russell, 2003). This function has been proposed and demonstrated for other cell envelope components, such as trehalose 6,6'-Dimycolate (TDM), a mycobacterial glycolipid cord factor. TDM has also been implicated in interfering with phagosome-lysosome fusion (Fischer, Chatterjee et al., 2001).

Infection of macrophages with M. smegmatis can be used as a model to analyze bacterial persistence in the host (Miller & Shinnick, 2000). Lower persistence of. the M. smegmatis Aupk mutant in macrophages indicates a role of Upk in mycobacterial virulence/persistence. Indeed, the M. smegmatis Aupk mutant was cleared more rapidly from the host cells. These findings indicate the importance of a robust cell envelope for persistence in the host. In this experiment complementation with the M. tuberculosis upk gene was sufficient to revert from mutant to wildtype phenotype. However, it is not valid to generalize knowledge gained from experiments with M. smegmatis. In certain aspects, M. tuberculosis is unique as was demonstrated in the case of resistance to bacitracin.

C) Biofilm formation

The term biofilm describes a population or community of bacteria living in organized structures at a liquid interface. Early confocal laser scanning microscopy (CLSM) of single species biofilms (Lawrence, Korber et al., 1991 ; Lawrence & Neu, 1999) revealed that biofilm bacteria live in cellular clusters or microcolonies that are encapsulated in a matrix composed of an extracellular polymeric substance (EPS), separated by open water channels which act as primitive circulatory system for the delivery of nutrients and removal of metabolic waste products. Within a biofilm, each bacterium occupies a specific microenvironment, which is defined by the surrounding cells, the proximity to a channel and the EPS matrix. The structuring of biofilms in microcolonies and fluid channels has been shown to be influenced by fluid flow, nutrient composition, and intracellular small messenger molecules, which are used for bacterial communication (Davies, Parsek et al., 1998; Huber, Riedel et al., 2002; Martinelli, Bachofen et al., 2002).

Various gram-negative and gram-positive bacteria, as well as fungi, grow in two forms: planktonic and, as a step of microbial development, in a biofilm (O'Toole et al., 2000). M. smegmatis and other non-tuberculous mycobacteria such as Mycobacterium fortuitum and Mycobacterium marinum live and grow planktonicly or as a biofilm (Bardouniotis et al., 2003). Biofilms support resistance to antimicrobial chemotherapy and play a role in contamination in clinical and industrial settings. Biofilm formation poses a major problem because they can increase drug resistance (Davies, 2003). The reduced metabolic and growth rates shown by biofilm bacteria, particularly those deep within the biofilm, can render these microbes inherently less susceptible to antibiotics. The EPS matrix can act as an absorbent or reactant, thereby reducing the amount of drug available for action on biofilm cells. Moreover, biofilm bacteria are physiologically distinct from their planktonic cognates and express specific protective factors such as multidrug efflux pumps and stress response regulons (Brown, Allison et al., 1988; Stewart, 2002). Biofilm growth of M. smegmatis was unaffected at Isoniazid concentrations that inhibited growth of planktonic bacilli (Teng & Dick, 2003). Previously described deletion mutants of M. smegmatis lacking the capability of glycopeptidolipid acetylation, which affects the cell envelope, are defective in biofilm formation (Recht & Kolter, 2001 ; Recht, Martinez et al., 2000). The in-frame, unmarked deletion mutant of the M. smegmatis upk gene is the first evidence for a role of Upk in biofilm formation. Upon adherence, the Aupk mutant strain formed a scattered biofilm only. Adherence could have been reduced due to a missing extracellular matrix and to slightly inferior growth-properties in biofilm medium.

D) In vivo Experiments and data

The apathogenic environmental M. smegmatis owes its name from isolation from genital secretions (smegma): In November 1884, Lustgarten reported to the Royal Society of Medicine in Vienna that he had discovered a bacterium with staining characteristics of tubercle bacilli in syphilitic chancres and gummae (Lustgarten, 1884). Soon thereafter Alvarez and Tavel identified microorganisms similar to those in normal genital secretions (smegma) (Alvarez & Tavel, 1885). Smegma is associated with hygienic conditions and has been proposed as risk factor for penile cancer (Brinton, Li et al., 1991 ; Chou, 1991). To determine whether Upk plays a role in genital smegma development by M. smegmatis we developed an in vivo model for M. smegmatis biofilm formation. In this in vivo mouse model of M. smegmatis biofilm formation the Aupk deletion mutant was found to be deficient in induction of smegma development, thus stressing the relevance of Upk in mycobacterial saprophytic life.

The giv phenotype

A direct consequence of the upk gene deletion in M. tuberculosis is the expression of a growth in vivo (giv) mutant phenotype. Studies on defined mutants of M. tuberculosis in the mouse model of infection have led to the classification of attenuated mutants in several phenotypic classes (Hingley-Wilson, Sambandamurthy et al., 2003). These mutants have been categorized by their growth characteristics, namely: i) severe growth in vivo (sgiv) mutants, which show a marked reduction in colony-forming units over time; ii) growth in vivo (giv) mutants, which grow less robustly than wildtype M. tuberculosis in the lungs of immunocompetent mice, yet still grow better than sgiv mutants; iii) persistence (per) mutants, which fail to grow or persist after the onset of acquired immunity, and iv) mutants with the same growth characteristics as per mutants, but show altered pathology (pat) compared with that of wildtype M. tuberculosis. Most mutants, including the Aupk mutant, fall into the giv class, showing reduced growth (Fig. 10) and pathology, resulting in an attenuated phenotype and increased survival of infected immunocompromised mice (Fig. 11). Examples for giv mutants of M. tuberculosis are the two component regulatory protein phoP (Perez, Samper et al., 2001), the accessory secretion factor secA2 (Braunstein, Espinosa et al., 2003), the glutamine synthase glnA1 (Tullius, Harth et al., 2003), and panCD (Sambandamurthy, Wang et al., 2002), which is involved in pantothenate synthesis. The gene encoding the exported repetitive protein (erp) in both M. bovis BCG and M. tuberculosis has no ascribed function and is specific for mycobacterial species (Mendonca-Lima, Picardeau et al., 2001). Deletion of the erp gene results in impaired growth of bacilli in lungs and spleens of infected mice, as with the Aupk mutant. Berthet et al. postulated that virulence depends on the ability of the bacilli to multiply (Berthet, Lagranderie et al., 1998). The virulence reduced M. tuberculosis Aupk mutant exhibited characteristics of a giv mutant, which could render it an interesting vaccine candidate, because it maintains replication and is more likely to result in a long-lasting host immune response compared to a sgiv mutant. However, a potentially dangerous situation could arise if the mutant regains its rate of growth, as may happen in immunocompromised individuals (Fig. 11), resulting in disease. Thus, continued characterization of specific mutants of M. tuberculosis is required to develop strains which elicit a strong protective immune response, but fail to reactivate in immunodeficiet individuals. The giv phenotype of the Aupk mutant, which was related to reduced growth in vivo, is probably related to its altered cell envelope. Forty percent of the most significantly upregulated genes in the Aupk mutant compared to wildtype were related to cell envelope processes and belonged to the tubercuiist categories "lipid metabolism", and "cell wall and cell processes". Hence, impaired self protection of the tubercle bacilli, as consequence of the impaired cell wall, or improved accessibility of antigens, or upregulation of one or more antigens which resulted in better processing and recognition by T cells, and therefore a more potent immune response, could allow improved control by the host. Furthermore, the M. tuberculosis Aupk mutant may switch prematurely to a dormancy program as may indicated by abundance of the HspX protein, a marker of M. tuberculosis latency (Quinn, Birkness K.A., & King J.K., 2002; Yuan, Crane et al., 1998).

In addition, host effector mechanisms may be more effective against the altered cell wall of M. tuberculosis Aupk than against M. tuberculosis wildtype. Such mechanisms may include production of highly reactive low molecular weight molecules, in particular reactive oxygen intermediates (ROI) and reactive nitrogen intermediates (RNI) (MacMicking, Xie et al., 1997; Miller & Britigan, 1997) (Fig. 1). ROI and RNI cause damage of cellular constituents by oxidation of cellular membranes and enzymes, DNA damage, mutagenesis, and inhibition of membrane transport processes (Moncada & Higgs, 1993; Nathan & Shiloh, 2000; Weiss, 1986). The impaired cell wall structure of the upk deficient strain, could form a weaker barrier against these effector molecules with the possible consequence of enhanced killing of the pathogen by the host. A larger quantity of antigen that could be processed or a higher accessibility of antigens may further contribute to increased susceptibility of M. tuberculosis Aupk to the adaptive immune response.

E) Vaccine-Development

As discussed above, the giv mutant phenotype of M. tuberculosis Aupk represents a promising phenotype for development of an attenuated M. tuberculosis mutant that could serve as a potential vaccine candidate.

The vaccine strain M. bovis BCG offers an impressive safety record but unsatisfactory protection (Collins & Kaufmann, 2001). In this study, we deleted the upk gene from M. bovis BCG. This is an alternative strategy that relies on the basic premise that M. bovis BCG could be re-engineered to enhance its efficacy. For example, recombinant M. bovis BCG expressing various cytokines have been shown to improve the response against M. tuberculosis antigens (Murray, Aldovini et al., 1996) and recombinant M. bovis BCG expressing listeriolysin of Listeria monocytogenes showed an enhanced capacity to stimulate CD8⁺ T cells (Hess, Miko et al., 1998). In addition, a recombinant M. bovis BCG strain that overexpresses the 30 kDa Ag85 protein has been reported to provide an improved protection against M. tuberculosis infection (Horwitz, Harth et al., 2000).

The upk deletion which resulted in an even more attenuated strain, was not expected to cause safety problems and accordingly used in a vaccine trial. Considering the lower bacterial load of M. bovis BCG Aupk upon vaccination (Fig. 12) and the delayed induction of the IFNγ response (Fig. 13) it was surprising that the modified vaccine strain was able to induce a significantly improved long-lasting protection against M. tuberculosis infection (Fig. 14). Without being bound by theory, it is envisaged that immunorelevant antigens were overexpressed to balance upk deficiency or that improved killing of M. bovis BCG Aupk provides the immune system with a larger amount of antigens to be processed, resulting in an improved adaptive immune response.

In accordance with this invention, IgG titers against M. tuberculosis extracts and an M. tuberculosis antigen (Rv3407) were determined. Furthermore, the cytotoxcity of spleen cells was investigated against P815 cells loaded with M. tuberculosis protein extract or A/A111 peptides. For the serum tests, serum ELISA were carried out as follows: 96 well plates (NUNC-lmmuno Plate, MaxiSorp Surface, Made in Germany) were coated with appropriate proteins (1 yg/ml) in coating buffer (0,53 g Na₂C0₃ + 0,42 g NaHC0₃ + 100 ml Aqua dest). After over night incubation plates were washed 5 times with PBS/Tween (0.05%), blocked (0,5% Casein in PBS) for 1.5 h at 37°C, washed again 5 times, sera were diluted in PBS, and 100 /I were added. For detection a Rabbit F(ab )2 anti-mouse lgG(H+L)AP antibody was 1 :1000 diluted an added. After 2h of incubation at 37°C wells were washed 5 times, substrate (p- Nitrophenylphosphat (Sigma N 9389)) was added, followed by 15 min incubation at room temperature in darkness. The reaction was stopped (0.5M EDTA 50 /l/well), and OD measured at 405nm.

Cytotoxicity/"Kill assay" comprised the following experimental protocol: Mice were vaccinated with BCG, BCGAupk or unvaccinated. After 120d spleens were taken out and 5x10⁶ isolated spleen cells per well were restimulated for 4d in RPMI. 2.5x 10^s P815 cells/ml were preincubated for 2h at 37°C with Medium, A/A111 , or purified M. tuberculosis protein extract (3/yg/ml) subsequently irradiated with 3000 rad, and washed. Effector (spleen) cells and target (P815) cells were mixed (ratios: 1 :1 , 10:1 , 40:1 , and 100:1). Cytotoxicity was measured according to CyoTox-One Homogeneous Membrane Integrity Assay (Promega).

Corresponding results of the experiments are shown in Figures 15 and 16.

The promising results of the vaccine trial with M. bovis BCG Aupk advocate further development of the M. tuberculosis Aupk mutant strain. A M. tuberculosis mutant might induce a better protection against M. tuberculosis wildtype infections because it would prime the immune system with the same antigens as the causative agent M. tuberculosis, including antigens that are missing in M. bovis BCG like the 129 antigens of the 16 regions of deletion which were lost when Calmette and Guerin generated the vaccine strain from M. bovis. Nevertheless, for safety reasons, a one gene deletion mutant of M. tuberculosis will probably not be considered as vaccine candidate. Another phase of development is needed to further attenuate the strain and keep its protective potential at the same time. The promising and unexpected results of the vaccine trial with M. bovis BCG Aupk suggest this strain as a vaccine candidate.

Additional reference list

Aksu, (2002) Proteomics. 2, 1452-1463.

Alvarez and Tavel (1885) Arch.Physiol.Normal Pathol. 303-321.

Armstrong and Hart, (1975) J.Exp.Med. 142, 1 -16.

Bardarov, (2002) Microbiology 148, 3007-3017.

Bardouniotis, (2003) Curr. Microbiol. 46, 28-32.

Behr, (1999), Science 284, 1520-1523

Berthet, (1998) Science 282, 759-762.

Bloch, (1977) Adv. Enzy mol. Relat Areas Mol. Biol. 45, 1-84.

Bottiger (1982) Ada Paediatr.Scand. 71, 471-478.

Braunstein, (2003) Mol.Microbiol. 48, 453-464.

Brennan and Nikaido, (1995) Annu.Rev.Biochem. 64, 29-63.

Brinton, (1991) Int. J. Cancer 47, 504-509.

Brown, (1988) J.Antimicrob.Chemother. 22, 777-780.

Buddie, (2002) Veterinary Immunology and Immunopathology 87, 177-185

Byrd, (1998) Infect.lmmun. 66, 5132-5139.

Cain, (1993) J.Bacteriol. 175, 3784-3789.

Chalker, (2000) Microbiology 146 ( Pt 7), 1547-1553.

Chou, (1991) Zhonghua Yi.Xue.Za Zhi.(Taipei) 48, 81-88.

Collins, (2001) Lancet Infect.Dis. 1 , 21-28.

Collins, (1997) Antimicrob. Agents Chemother. 41 , 1004-1009.

Collins, (2000) Immunology and Cell Biol. 78, 342-348

Davies, (2003) Nat.Rev.Drug Discov. 2, 114-122.

Davies, (1998) Science 280, 295-298.

Doherty, (1998) Electrophoresis 19, 355-363. Ehrlich, (1882) Deutsche Med Wochenschr 8, 269-270. Falkinham, (2002) Clin.Chest Med. 23, 529-551. Falkow, (1988) Rev. Infect. Dis. 10 Suppl 2, S274-S276. Ferlinz, (1995) Pneumologie 49, 617-632.. Ferrari, (1999) Cell 97, 435-447. Fine, (1995) Lancet 346, 1339-1345. Fischer, (2001) J.Immunol. 167, 2187-2192. Flynn, (2001) Annu. Rev. Immunol. 19, 93-129. Fratti, (2000) Electrophoresis 21 , 3378-3385. Harth, (1999) J.Exp.Med. 189, 1425-1436. Heinz, (2003) Methods Mol.Biol. 228, 139-150. Henzel, (1993) Proc.Natl.Acad.Sci.U.S.A 90, 5011-5015. Hess, (1998) Proc.Natl.Acad.Sci.U.S.A 95, 5299-5304. Hingley-Wilson, (2003) Nat. Immunol. 4, 949-955. Horwitz, (2000) Proc.Natl.Acad.Sci.U.S.A 97, 13853-13858. Huber, (2002) Mol. Microbiol. 46, 411-426. James, (1993) Biochem.Biophys.Res.Commun. 195, 58-64. Jungblut, (1999) Mol.Microbiol. 33, 1103-1117. Jungblut, (1990) J.Biochem.Biophys. ethods 21 , 47-58. Kaufmann, (2001). Nat.Rev.lmmunol. 1 , 20-30. Kaufmann, (2002) Ann.Rheum.Dis. 61 Suppl 2, U54-U58. Kaufmann, (1997) Biologicals 25, 169-173. Klose, (1995) Electrophoresis 16, 1034-1059. Koch, Berl Klin Wochenschr 15, 221-230. 1882. Ref Type: Generic

Kremer, (2000) J.Biol.Chem. 275, 16857-16864. Kremer, (2002) Biochem.J. 364, 423-430. Kremer, (2003) J.Biol.Chem. 278, 20547-20554. Lawrence, (1991 ) J.Bacteriol. 173, 6558-6567. Lawrence, (1999) Methods Enzymol. 310, 131-144. Lee, (1999) Antimicrob.Agents Chemother. 43, 2087-2089. Lee, (1996) Curr.Top.Microbiol.lmmunol. 215, 1-27. Lisle, (1999), Infection and Immunity 67, 2624-2636 Lustgarten, (1884) Wiener medizinische Wochenschrift 1. MacMicking, (1997) Annu.Rev.lmmunol. 15, 323-350. Manabe, (2000) Nat.Med. 6, 1327-1329. Mann, (1993) Biol.Mass Spectrom. 22, 338-345. Mann, (1994) Anal.Chem. 66, 4390-4399. Martinelli, (2002) Appl. Microbiol. Biotechnol. 59, 278-283. Mattow, (2001). Electrophoresis 22, 2936-2946. Mdluli, (1998) Science 280, 1607-1610. Mendonca-Lima, (2001) Microbiology 147, 2315-2320. Miller, (2000) Infect. Immun. 68, 387-390. Miller, (1997) Cϊm. Microbiol. Rev. 10, 1-18. Mollenkopf, (2002) Methods Enzymol. 358, 242-256. Mombaerts, (1992) Ce//68, 869-877. Moncada, (1993) N.Engl.J.Med. 329, 2002-2012. Muller, (1999) Electrophoresis 20, 320-330. Murray, (1996) Proc.Natl.Acad.Sci.U.S.A 93, 934-939. Nathan, (2000) Proc.Natl.Acad.Sci.U.S.A 97, 8841-8848. Navarre, (1999) Microbiol.Mol.Biol.Rev. 63, 174-229.

Neelsen, (1883) Centralblatt fur die medizinischen Wissenschaften 28, 497-501. Niederweis, (2003) Mol.Microbiol. 49, 1167-1177. O'Toole, (2000) Annu.Rev.Microbiol. 54, 49-79.

Pavelka, (1999) J.Bacteriol. 181 , 4780-4789.

Peng (2001) J.Mass Spectrom. 36, 1083-1091.

Perez, (2001) Mol.Microbiol. 41, 179-187.

Perkins, (1999) Electrophoresis 20, 3551-3567.

Piatek, (2000) Antimicrob.Agents Chemother. 44, 103-110.

Quinn, (2002) Alpha-Crystallin as a Potential Marker of Mycobacterium tuberculosis Latency. ASM News.

Rastogi, (2001) Rev.Sci.Tech. 20, 21-54.

Recht, (2001) J.Bacteriol. 183, 5718-5724.

Recht, (2000) J.Bacteriol. 182, 4348-4351.

Rolph, (2001) Eur.J. Immunol. 31., 1944-1949.

Russell, (2003) Nat.Cell Biol. 5, 776-778.

Russell, (1996) J. Immunol. 156, 4764-4773.

Ryll, (2001) Microbiol.lmmunol. 45, 801-811.

Sambandamurthy, (2002) Nat.Med. 8, 1171-1174.

Schaible, (2002) J.Exp.Med. 196, 1507-1513.

Schaible, (2002) Methods in Microbiology 31 , 343-360.

Sherman, (2001) Proc.Natl.Acad.Sci.U.S.A 98, 7534-7539.

Skinner, (2003) Immunology 108, 548-555

Slayden, (2002) Tuberculosis.(Edinb.) 82, 149-160.

Snapper, (1990). Mol.Microbiol. 4, 1911-1919.

Soto, (2002) J.CIin.Microbiol. 40, 3021-3024.

Stenger, (1999) Immunol.Today 20, 390-394.

Stewart, (2002). Int.J.Med.Microbiol. 292, 107-113.

Teng, (2003) FEMS Microbiol. Lett. 227, 171-174.

Trias, (1994) Mol.Microbiol. 14, 283-290. Trias, (1992) Science 258, 1479-1481. Tullius, (2003) Infect.lmmun. 71 , 3927-3936. Wallace, (1988) J.lnfect.Dis. 158, 52-59. Weiss (1986) Acta Physiol Scand.Suppl 548, 9-37. Wilm, (1996) Anal.Chem. 68, 527-533. Yuan, (1998) Proc.Natl.Acad.Sci.U.S.A 95, 9578-9583. Ziehl, (1882) Deutsche Med Wochenschr 33, 451.

Claims

1. A Mycobacterium bovis (M. bovis) BCG mutant comprising a mutation in an undecaprenyl phosphokinase gene (upk), whereby said mutation leads to a partial or complete inactivation of said upk-gene.

2. The M. bovis BCG mutant of claim 1 , whereby said partial or complete inactivation of said upk gene is due to an insertion, an addition, a substitution, a reversion or a deletion within the upk-gene or within its regulatory elements.

3. The M. bovis BCG mutant of claim 1 or 2, whereby said mutation of the upk gene comprises a mutation in upk 1 and/or in upk 2.

4. The M. bovis BCG mutant of claim 2 or 3, whereby said deletion within the upk-gene comprises a full or partial deletion of said upk-gene.

5. The M. bovis BCG mutant of any one of claims 1 to 4, whereby said upk-gene is or is highly homologous to M. tuberculosis gene rv2136c.

6. The M. bovis BCG mutant of any one of claims 2 to 5, whereby said upk gene deletion (Δ upk) comprises a full or partial deletion of (a) a nucleotide sequence as shown in SEQ ID NO: 1 ; a nucleotide sequence encoding an amino acid sequence as shown in SEQ ID NO: 2; or a nucleotide sequence encoding an amino acid sequence which is at least 70% homologous to an amino acid sequence as shown in SEQ ID NO: 2; (b) a nucleotide sequence as shown in SEQ ID NO: 3; a nucleotide sequence encoding an amino acid sequence as shown in SEQ ID NO: 4; or a nucleotide sequence encoding an amino acid sequence which is at least 70% homologous to an amino acid sequence as shown in SEQ ID NO: 4; or (c) a nucleotide sequence as shown in SEQ ID NO: 5; a nucleotide sequence encoding an amino acid sequence as shown in SEQ ID NO: 6; or a nucleotide sequence encoding an amino acid sequence which is at least 70% homologous to an amino acid sequence as shown in SEQ ID NO: 6 or 56.

7. The M. bovis BCG mutant of any one of claims 1 to 6, whereby said upk-gene mutation comprises a mutation of an inside-loop amino acid stretch of upk which leads to a partial or complete inactivation of the upk-gene.

8. The M. bovis BCG mutant of any one of claims 1 to 7, whereby said partial or complete inactivation of said upk-gene leads to a modified and/or partial or complete inactivation of the phosphorylation of undecaprenyl (C₅₅) to undecaprenyl monophosphate (C5₅-P).

9. The M. bovis BCG mutant of claim 7 or 8, whereby said inside loop amino acid stretch of upk is selected from the group consisting of (a) an amino acid molecule encoded by a nucleic acid molecule as shown in SEQ ID NOS: 7, 9 or 11 ; (b) an amino acid molecule encoded by a nucleic acid molecule which is at least 70% homologous to a nucleic acid molecule as shown in SEQ ID NO: 7, 9 or 11 ; (c) an amino acid molecule which shows at least 70% identity to an amino acid molecule as shown in SEQ ID NOS: 8, 10 or 12; and (d) an amino acid molecule which is shown in SEQ ID NOS: 8, 10 or 12.

10. The M. bovis BCG mutant of any one of claims 6 to 9, whereby said upk-gene deletion comprises a full or partial deletion of a nucleic acid molecule encoding an amino acid molecule as shown in any one of SEQ ID NOS: 8, 10 or 12 or a functional fragment thereof.

11. The M. bovis BCG mutant of any one of claims 1 to 10, whereby said mutation in said upk-gene leads to a polarity effect in genes located downstream of upk.

12. The M. bovis BCG mutant of claim 11 , whereby said polarity effect influences the expression or function of a gene which is at least 80% homologous to rv2135c of M. tuberculosis.

13. The M. bovis BCG mutant of claim 11 or 12, whereby said polarity effect leads to a transcription inhibition or transcription stop of a gene which is at least 90% homologous to rv2135c of M. tuberculosis.

14. The M. bovis BCG mutant of any one of claims 1 to 13, whereby for the generation of said M. bovis BCG mutant the pKO-upk plasmid and/or a knockout phage phAE 159 - Δ upk is employed.

15. The M. bovis BCG mutant of claim 14, whereby said pKO-upk plasmid has a nucleotide sequence as shown in SEQ ID NO: 13.

16. The M. bovis BCG mutant of any one of claims 1 to 15, whereby said M. bovis BCG is selected from the group consisting of BCG-Russia, BCG-Moreau, BCG-Japan, BCG-Sweden, BCG-Phipps, BCG-Denmark, BCG-Copenhagen, BCG-Tice, BCG-Frappier, BCG-Connaught, BCG-Birkhaug, BCG-Glaxo, and BCG-Pasteur.

17. A method for the preparation of a M. bovis BCG mutant of any one of claims 1 to 16 comprising the step of inactivating or partially inactivating the upk-gene and/or inactivating or partially inactivating (a) gene(s) located downstream of upk.

18. A pharmaceutical composition comprising a M. bovis BCG mutant of any one of claims 1 to 16 or as prepared by the method of claim 17.

19. The pharmaceutical composition of claim 18 which is a vaccine.

20. Use of a M. bovis BCG mutant of any one of claims 1 to 16 or as prepared by the method of claim 17 for the preparation of a vaccine or a medicament for the treatment of cancer.

21. The use of claim 20, wherein said vaccine is a tuberculosis vaccine.

22. The use of claim 20 or 21 , whereby the subjects to be vaccinated by said vaccine are adult human patients.

23. A method for the preparation of a pharmaceutical composition comprising the step of (a) preparing a M. bovis BCG mutant by the method of claim 17; and (b) admixing the M. bovis BCG mutant as prepared by step (a) with a suitable carrier.

24. A method of vaccinating a subject against a mycobacterial-induced disease, said method comprising the step of administering to a subject in need of such a vaccination a M. bovis BCG mutant of any one of claims 1 to 16 or as prepared by the method of claim 17, whereby said M. bovis BCG mutant elicits an immuno response in said subject.

25. A method of treating a cancer patient, said method comprising the step of administering to a subject in need of such a treatment a M. bovis BCG mutant of any one of claims 1 to 16 or as prepared by the method of claim 17.

26. The method of claim 25 or the use of claim 20, wherein said cancer is bladder cancer.

27. The method of any one of claims 24 to 26, wherein said subject is a human.

28. The method of any one of claims 24 to 27, wherein said subject is an adult human.

9. The method of any one of claims 24, 27 or 28, wherein said mycobacterial induced diseases is tuberculosis.