WO2005111202A1 - Recombinant enzyme with altered feedback sensitivity - Google Patents

Abstract

The present invention relates to the use of recombiant homoserine transsuccinylase enzymes with altered feedback sensitivity (MetA*) and optionally, recombinant S-adenosyl methionine synthetase enzymes with reduced activity (MetK*) for the production of methionine, its precursors or derivatives thereof.

Description

RECOMBINANT ENZYME WITH ALTERED FEEDBACK SENSITIVITY

DESCRIPTION Field of the invention The present invention relates to the use of recombinant homoserine transsuccinylase enzymes with altered feedback sensitivity (MetA*) and eventually, recombinant S-adenosyl methionine synthetase enzymes with reduced activity (MetK*) for the production of methionine, its precursors or derivatives thereof.

Prior art Sulfur-containing compounds such as cysteine, homocysteine, methionine or S- adenosylmethionine are critical to cellular metabolism and are produced industrially to be used as food or feed additives and pharmaceuticals. In particular methionine, an essential amino acid, which cannot be synthesized by animals, plays an important role in many body functions. Aside from its role in protein biosynthesis, methionine is involved in transmethylation and in the bioavailability of selenium and zinc. Methionine is also directly used as a treatment for disorders like allergy and rheumatic fever. Nevertheless most of the methionine which is produced is added to animal feed. With the decreased use of animal-derived proteins as a result of BSE and chicken flu, the demand for pure methionine has increased. Chemically D,L-metioionine is commonly produced from acrolein, methyl mercaptan and hydrogen cyanide. Nevertheless the racemic mixture does not perform as well as pure L-methionine, as for example in chicken feed additives (Saunderson, C.L., (1985) British Journal of Nutrition 54, 621-633). Pure L-melMonine can be produced from racemic methionine e.g. through the acylase treatment of N-acetyl-D,L-methionine which increases production costs dramatically. The increasing demand for pure L-methionine coupled to environmental concerns render microbial production of methionine attractive. Microorganisms have developed highly complex regulatory mechanisms that fine-tune the biosynthesis of cell components thus permitting maximum growth rates. Consequently only the required amounts of metabolites, such as amino acids, are synthesized and can usually not be detected in the culture supernatant of wild-type strains. Bacteria control amino acid biosynthesis mainly by feedback inhibition of enzymes, and repression or activation of gene transcription. Effectors for these regulatory pathways are in most cases the end products of the relevant pathways. Consequently, strategies for overproducing amino acids in microorganisms require the deregulation of these control mechanisms. The pathway for L-methionine synthesis is well known in many microorganisms

(Fig. 1A/B). Methionine is derived from the amino acid aspartate, but its synthesis requires the convergence of two additional pathways, cysteine biosynthesis and Cl metabolism (N-methyltetrahydrofolate). Aspartate is converted into homoserine by a sequence of three reactions. Homoserine can subsequently enter the fhreonine/isoleucine or methionine biosynthetic pathway. In E. coli entry into the methionine pathway requires the acylation of homoserine to succinyl-homoserine. This activation step allows subsequent condensation with cysteine, leading to the tiiioether-containing cystathionine, which is hydrolyzed to give homocysteine. The final methyl transfer leading to methionine is carried out by either a B₁₂-dependent or a Bi₂-independent methyltransferase.

Methionine biosynthesis in E. coli is regulated by repression and activation of methionine biosynthetic genes via the MeU and MetR proteins, respectively (reviewed in Neidhardt, F. C. (Ed. in Chief), R. Curtiss m₅ J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (eds). 1996. Escherichia coli and Salmonella: Cellular and Molecular Biology. American Society for Microbiology; Weissbach et al., 1991 Mol. Microbiol., 5, 1593- 1597). MetJ uses S-adenosylmethionine as a corepressor, that is made from methionine by the enzyme S-adenosylmethionine synthetase (EC 2.5.1.6) encoded by the essential gene metK. etA encoding homoserine transsuccinylase (EC 2.3.1.46), the first enzyme unique to the synthesis of methionine is another major control point for methionine production. Besides the transcriptional regulation of etA by MeU and MetR the enzyme is also feedback regulated by the end-products metMonine and S- adenosylmethionine (Lee, L.-W et al. (1966) Multimetabolite control of a biosynthetic pathway by sequential metabolites, JBC 241 (22), 5479-5780). Feedback inhibition by these two products is synergistic meaning that low concentrations of each metabolite alone are only slightly inhibitory, while in combination a strong inhibition is exerted. Amino acid analogues inhibit bacterial growth through the synthesis of abnormal polypeptides and by interfering with feedback inhibition, which lead to detrimental processes inside the cell. Analogue-resistant mutants have been obtained which show altered and deregulated enzymes leading to excess synthesis of the corresponding metabolites that can outcompete the analogue. Several groups have used the metm^nine analogues norleucine, ethionine, and α-memylmethionine to generate microbial strains that overproduce methionine. It was shown that α-methylmethionine is a potent inhibitor of the homoserine transsuccinylase enzyme MetA (Rowbury RJ, (1968) The inhibitory effect of α-memylmettaonine on Escherichia coli, J. gen. Microbiol., 52, 223-230). Feedback resistant mutants in Salmonella typhimurium that mapped to the metK locus were isolated (Lawrence D. A., (1972) Regulation of the methionine feedback-sensitive enzyme in mutants of Salmonella typhimurium; Lawrence, D.A., Smith, D.A., Rowbury, RJ. (1967) Regulation of met onine synthesis in Salmonella typhimurium: Mutants resistant to inhibition by analogues of mettaonine, Genetics 58, 473-492). Norleucine resistant mutants were shown to map to the metK locus. (Chattopadhyay, M.K., Ghosh, A. K. and Sengupia, S. (1991), Control of methionine biosynthesis in Escherichia coli K12: a closer study with analogue resistant mutants, Journal of General Microbiology, 137, 685-691). The same authors have reported the isolation of feedback resistant etA mutants and norleucine resistant mutants in E. coli, but the actual mutations in metA and metK have not been described. The critical role of homoserine transsuccinylase for bacterial methionine production by fermentation has been demonstrated (Kumar, D. Garg, S. Bisaria V.S., Sreekrishnan, T.R. and Gomes, J. (2003) Production of metMonine by a multi-analogue resistant mutant of Corynebacterium lilium, Process Biochemistry 38, 1165-1171). The patent application JP2000139471 describes a process for the production of L-methionine using mutants in the genes metA and metK. In this case the precise location of the mutations has been determined. The MetA mutant enzymes have partially lost the sensitivity to feed-back inhibition by metMonine and S-adenosyl-methionine. Nevertheless their initial activities are decreased down to about 25% when compared to the wildtype enzyme, and at concentrations of 1 mM methionine for some mutants or 1 mM SAM for others another 25-90 % of the enzyme activity is lost. The metK mutants were not characterized enzymatically but used in fermentations to increase the amount of meMonine produced.

General disclosure of the invention This invention relates to a method for the preparation of methionine, its precursors or products derived thereof in a fermentative process with a microorganism where L-homoserine is converted into O-succinyl-homoserine with a homoserine transsuccinylase, comprising the step of culturing the said microorganism on an appropriate medium and recovering methionine, its precursors or products derived thereof once produced, wherein the homoserine transsuccinylase is a mutated homoserine transsuccinylase with reduced sensitivity for the feedback inhibitors S- adenosylmethionine and methiomne. The invention also relates to the same method with microorganisms where the S- adenosyl-methionine synthetase enzyme activity is reduced. The present invention also concerns the mutated enzymes, nucleotide sequences coding for the said enzymes with reduced sensitivity or activity and microorganisms comprising the said nucleotide sequences as disclosed above and below. The recombinant enzymes can be used together and can also be combined with several other changes in the corresponding microorganisms such as overexpression of genes or their deletion. Preferentially the gene encoding aspartokinase/homoserine dehydrogenase (metL) is over expressed and the gene encoding the methionine repressor metJ is deleted. In the description of the present invention, genes and proteins are identified using the denominations of the corresponding genes in E. coli. However, and unless specified otherwise, use of these denominations has a more general meaning according to the invention and covers all the corresponding genes and proteins in other organisms, more particularly microorganisms. PFAM (protein families database of alignments and hidden Markov models; http://www.sanger.ac.uk/Software/Pfam/) represents a large collection of protein sequence alignments. Each PFAM makes it possible to visualize multiple alignments, see protein domains, evaluate distribution among organisms, gain access to other databases, and visualize known protein structures. COGs (clusters of orthologous groups of proteins; http://www.ncbi .nlm.nih. gov/COG/) are obtained by comparing protein sequences from 43 fully sequenced genomes representing 30 major phylogenic lines. Each COG is defined from at least three lines, which permits the identification of former conserved domains. The means of identifying homologous sequences and their percentage homologies are well known to those skilled in the art, and include in particular the BLAST programs, which can be used from the website http://www.ncbi.nlm.nih.gov/BLAST/ with the default parameters indicated on that website. The sequences obtained can then be exploited (e.g., aligned) using, for example, the programs CLUSTALW (http://www.ebi.ac.uk/clustalwA or MULTALLN (htφ://prodes.toulouse.irj a.fr/multalin/cgi-bin multalin.pl). with the default parameters indicated on those websites. Using the references given on GenBank for known genes, those skilled in the art are able to determine the equivalent genes in other organisms, bacterial strains, yeasts, fungi, mammals, plants, etc. This routine work is advantageously done using consensus sequences that can be deterrnined by carrying out sequence alignments with genes derived from other microorganisms, and designing degenerate probes to clone the corresponding gene in another organism. These routine methods of molecular biology are well known to those skilled in the art, and are described, for example, in Sambrook et al. (1989 Molecular Cloning: a Laboratory Manual. 2^nd ed. Cold Spring Harbor Lab., Cold Spring Harbor, New York.).

Detailed description of the invention The modified homoserine succinyltransferases showing a decreased feed-back sensitivity to melMonine and S-adenosylmethionine in comparison to the wild-type enzyme, according to the present invention, comprises at least one amino acid mutation when compared with the wild-type sequence. The mutation is preferentially selected in the conserved regions coding for amino acids 24 to 30 or in the region coding for amino acids 58 to 65 or in the region coding for a ino acids 292 to 298 with the first amino acid proline after the

counting as number 1. All references to amino acid positions are made based on the homoserine succinyltransferase encoded by the metA gene of E. coli represented in figure 2. The relative positions of corresponding conserved regions in other homoserine succinyltransferases from different organisms can be found by a person skilled in the art by simple sequence alignment as represented on figure 3 with the enzymes listed below:

- gi|20138683|sp|Q97I29|META Clostridium acetobutylicum Homoserine O- succinyltransferase - gi|12230304|sp|Q9PLV2|META Campylobacter jejuni Homoserine O- succinyltransferase

- gi|12230277|sp|Q9KAK7|META Bacillus halodurans Homoserine O- succinyltransferase

- gi|20138686|sp|Q97PM9|META Streptococcus pneumoniae Homoserine O- succinyltransferase

- gi|20138715|sp|Q9CEC5|META Lactococcus lactis Homoserine O- succinyltransferase

- gi|20138656|sp|Q92L99|META Sinorhizobium meliloti Homoserine O- succinyltransferase - gi|20138618|sp|Q8YBV5|META Brucella melitensis Homoserine O- succinyltransferase

- gi|20141549|sp|P37413|META Salmonella typhimurium Homoserine O- succinyltransferase

- gi|20138601|sp|Q8X610|META Escherichia coli O157:H7 Homoserine O- succinyltransferase

- gi|12231004|sp|P07623|METAE-?c *erz^'cm^'α coli Homoserine O-succinyltransferase

- gi|12230285|sp|Q9KRM5|META Vibrio cholerae Homoserine O-succinyltransferase

- gi|38258142|sp|Q8FWG9|META Brucella melitensis biovar suis Homoserine O- succinyltransferase - gi|20138631|sp|Q8ZAR4|META Yersinia pestis Homoserine O-succinyltransferase

- gi|12231010|sp|P54167|META Bacillus subtilis Homoserine O-succinyltransferase - gi|12230320|sp|Q9WZY3|META Thermotoga maritima Homoserine O- succinyltransferase

- gi|20138625|sp|Q8ZlWl|META Salmonella typhi Homoserine O- succinyltransferase - >gi|31340217|sρ|Q8D937|META Vibrio vulnificus Homoserine O- succinyltransferase

- gi|31340213|sp|Q87NW7|META Vibrio parahaemolyticus Homoserine O- succinyltransferase The modified homoserine succinyltransferases preferentially exhibit a specific activity which is at least ten times that of the wild-type enzyme in the presence of 10 mM methionine and 1 mM S-adenosylmethionine and at least 80 times that of the wild- type enzyme in the presence of 10 mM methionine and 0,1 mM S-adenosyj^ethionine. Preferentially, the protein sequence of the modified homoserine succinyltransferase according to the invention contains the amino acid mutation of at least one of the conserved regions sequences specified below. Preferentially at least one mutation is present in the conserved region 1 comprising the amino acid sequence defined below, in the N-terminal part of the wild type homoserine transsuccinylases, corresponding to amino acid 24 to 30 in the amino acid sequence of E. coli MetA shown in SEQ ID NO. 2. This non mutated conserved region 1 has the following sequence: X1-X2-X3-A-X4-X5-Q In which

XI represents E, D, T, S, L, preferentially T X2 represents D, S, K, Q, E, A, R, preferentially S X3 represents R, E, D, preferentially R

X4 represents Y, I, F, A, K, S, V, preferentially S X5 represents H, S, N, G, T, R, preferentially G In a preferred embodiment the unmodified homoserine succinyltransferase conserved region 1 has the following amino acid sequence: T-S-R-A-S-G-Q. In another preferred embodiment of the invention, at least one mutation is present into the conserved region 2, also in the N-terminal part of the wild type homoserine transsuccinylase, corresponding to arnino acid 58 to 65 in the amino acid sequence of E. coli MetA shown in SEQ ID NO. 2. The non mutated conserved region 2 has the following formula:

X1-X2-X3-P-L-Q-X4-X5 In which

XI represents G, A, S, preferentially S

X2 represents N, A, preferentially N

X3 represents S, T, preferentially S

X4 represents V, L, I, preferentially V X5 represents N, E, H, D, preferentially D In a preferred embodiment the unmodified homoserine succinyltransferase conserved region 2 has the following amino acid sequence: S-N-S-P- -Q-V-D. In a third embodiment of the invention the homoserine succinyltransferase comprises at least one mutation in a conserved region in its C-terminal part, corresponding to amino acid 292 to 298 in the amino acid sequence of E. coli MetA shown in SEQ ID NO. 2. The non mutated conserved region 3 has the following formula:

X1-Y-Q-X2-T-P-X3

In which XI represents V, I, M, preferentially V

X2 represents E, K, G, I, Q, T, S, preferentially I

X3 represents F, Y, preferentially Y In a preferred embodiment, the unmodified homoserine succinyltransferase conserved region 3 has the following arnino acid sequence: V-Y-Q-I-T-P-Y. In a preferred embodiment, the conserved alanine in conserved region 1 is replaced with another arnino acid, more preferentially with a valine. The modified conserved region has most preferentially the following amino acid sequence: T-S-R-V-

S-G-Q

In another preferred embodiment, the conserved a ino acids L and/or Q in conserved region 2 are replaced with other arnino acids. Preferentially, leucine is replaced by phenylalanine and/or glutamine is replaced with a glutamate. Most preferentially, the modified conserved region 2 has the following arnino acid sequence: S-N-S-P-L-E-V-D In a fϊirther preferred embodiment, the conserved amino acids L and/or Q in conserved region 3 are replaced with another arnino acid. In a preferred application the metA gene is the homoserine transsuccinylase enzyme of E. coli K12 represented by the SΕQ ID NO 1 and sequences homologous to that sequence that have homoserine transsuccinylase activity and that share at least 80% homology, preferentially 90% homology with the amino acid sequence of SΕQ TD NO 2. Modified homoserine succinyltransferases may be obtained, for example, by selecting strains growing in the presence of methionine analogues such as α- me yhnelMonine, norleucine or ethionine. Preferentially these strains will be selected while growing in the presence of α-me yhnelhionine. The present invention furthermore relates to nucleotide sequences, DNA or RNA sequences, which encode a mutated homoserine succinyltransferase according to the invention as defined above. In a preferred embodiment, the DNA sequence is characterized by the fact that it comprises at least one mutation in the coding regions of the conserved regions 1 to 3 of the wild type metA gene, represented in SΕQ ID NO 1, the said mutation being not a silent mutation. These DNA sequences can be prepared, for example, from the strains growing in the presence of methionine analogues. The starting DNA fragment encompassing the modified metA gene, is cloned in a vector using standard known techniques for preparing recombinant DNA. These DNA sequences can also be prepared, for example, by non-specific or by targeted mutagenesis methods from strains harboring the DNA sequence encoding wild- type homoserine succinyltransferase. Non-specific mutations within the said DNA region may be produced, for example, by chemical agents (e.g. nitrosoguanidine, ethylmethanesulfonic acid and the like) and/or by physical methods and/or by PCR reactions, which are carried out under particular conditions. Methods for introducing mutations at specific positions within a DNA fragment are known and are described in Molecular Cloning: a Laboratory Manual, 1989,. 2^nd ed. Cold Spring Harbor Lab., Cold Spring Harbor, New York. Using the afore mentioned methods, one or more mutations which cause the modified homoserine succinyltransferase to possess an amino acid sequence which leads to methionine and S-adenosylmethionine insensitivity can be introduced in the said DNA region of any metA gene. Preferentially, one or more nucleotides in the DNA sequence encoding homoserine succinyltransferase are changed such that the amino acid sequence that is encoded by the gene exhibits at least one mutation. Another method of producing feedback-resistant metA alleles consists in combining different point mutations which lead to feedback resistance, thereby giving rise to multiple mutants possessing new properties.

The modified S-adenosylmethionine synthetase according to the invention has decreased activity in comparison to the wild-type enzyme, and has at least one mutation in its protein sequence when compared to the wild-type sequence. The mutation is preferentially in one of the conserved regions defined below. All references to amino acid positions are made based on the S- adenosylmethionine synthetase encoded by metK gene of E. coli. The relative positions of corresponding conserved regions in other S-adenosylmethionine synthetases from different organisms can be found by a person skilled in the art by simple sequence alignment as represented in figure 4 with enzymes listed below:

>gi|39574954|emb|CAΕ78795.1| methionine adenosyltransferase Bdellovibrio bacteriovorus HD100] >gi|45657232|ref|YP_001318.11 s-adenosylmetrύonine synthetase protein Leptospira interrogans serovar Copenhageni str. Fiocruz Ll-130

>gi|28378057|ref|NP_784949.1| methionine adenosyltransferase Lactobacillus plantarum WCFS 1

>gi|26453553 jdbj jB AC43885.11 S-adenosylmethionine synthetase Mycoplasma penetrans >gi|24212014|sp|Q9K5E4| S-adenosylmethionine synthetase Corynebacterium glutamicum >gi|18145842|dbj|BAB81883.1| S-adenosylmethionine synthetase Clostridium perfringens str. 13 >gi|13363290|dbj|BAB37241.1| methionine adenosyltransferase 1 Escherichia coli O157:H7 >gi|45443250|ref|NP_994789.1| S-adenosylmetMonine synthetase Yersinia pestis biovar Mediaevails str. 91001 >gi|44888151|sp|Q7WQX8|METK S-adenosylmethionine synthetase Borrelia burgdorferi >gi|44888141|sp|Q7U4S6| S-adenosylmethionine synthetase Synechococcus sp.

WH8102

>gi|44888135|sp|Q7MHK6| S-adenosylmetMonine synthetase Vibrio vulnificus YJ016

>gi|23466330|ref|NP_696933.11 S-adenosylmetlύonine synthetase Bifidobacterium longum NCC2705]

>gi|21219978|ref|NP_625757.1 j S-adenosylme onine synthetase Streptomyces coelicolor A3 (2)]

>gi|39937076|ref]NP_949352.1| met onine S-adenosyltransferase Rhodopseudomonas palustris CGA009 >gi|l 676639 l|ref]NP_462006.1 methionine adenosyltransferase 1 Salmonella typhimurium LT2

>gi|33594910|ref|NP_882553.1 S-adenosylmethionine synthetase Bordetella parapertussis 12822

>gi|44888148|sp|Q7VRG5| S-adenosylmethionine synthetase Candidatus Blochmannia floridanus

>gi|44888147|sp|Q7VNG7|METK_HAEDU S-adenosylmethionine synthetase

Haemophilus ducreyi

>gi|44888146|sp|Q7VFY5| S-adenosylmethionine synthetase Helicobacter hepaticus

>gi|44888145|sp|Q7VDM7| S-adenosylmethionine synthetase Prochlorococcus marinus >gi|44888142|sp|Q7URU7| S-adenosylmethionine synthetase Pirellula spec.

>gi|44888138|sp|Q7NHG0| S-adenosylmethionine synthetase Gloeobacter violaceus >gi|44888137|sp|Q7N119| S-adenosylmethionine synthetase Photorhabdus luminescens subsp. laumondii

>gi|44888136|sp|Q7MTQ0| S-adenosyto ethionine synthetase Porphyromonas gingivalis

>gi|39650934|emb[CAE29457.1| methionine S-adenosyltransferase Rhodopseudomonas palustris CGA009

>gi| 15792421 |ref]NP_282244.11 S-adenosylmethionine synthetase Campylobacter ye am^* subsp. jejuni NCTC 11168

>gi|39574954|emb|CAE78795.1| methionine adenosyltransferase Bdellovibrio bacteriovorus HD100 >gi|45657232|ref|YP_001318.1| s-adenosylmetMonine synthetase protein Leptospira interrogans serovar Copenhageni str. Fiocruz Ll-130

>gi|28378057|ref]NP_784949.1| met onine adenosyltransferase Lactobacillus plantarum WCFS 1

>gi|45600470|gb|AAS69955.1| s-adenosylme onine synthetase protein Leptospira interrogans serovar Copenhageni str. Fiocruz Ll-130

>gi|26453553|dbj|BAC43885.1| S-adenosylme1monine synthetase Mycoplasma penetrans

>gi|18145842|dbj|BAB81883.1| S-adenosyJmelMonine synthetase Clostridium perfringens str. 13 >gi| 13363290|dbj |B AB37241.11 meMonine adenosyltransferase 1 Escherichia coli

O157:H7

>gi|45443250|ref]NP_994789.1| S-adenosylmethionine synthetase Yersinia pestis biovar

Mediaevails str. 91001

>gi|44888153|sp|Q8CXS7| S-adenosylmethionine synthetase Leptospira interrogans >gi|44888151 |sp|Q7WQX8| S-adenosylmethionine synthetase Bordetella bronchiseptica

>gi|44888150|sp|Q7W200| S-adenosylmethionine synthetase Bordetella parapertussis

>gi|44888149|sp|Q7VUL5| S-adenosylmethionine synthetase Bordetella pertussis The modified S-adenosylmethionine synthetase preferentially exhibits a specific activity which is at least five times less than that of the wild-type enzyme. Preferentially, the protein sequence of a modified S-adenosylmethionine synthetase contains the amino acid mutation of at least one of the sequences specified below. In one embodiment of the invention the amino acid changes concern the cystein at position 89 or the cystein at position 239 that both reduce the activity of MetK (Reczkowski and Markham, 1995, JBC 270, 31, 18484-18490) In a preferred embodiment at least one mutation is present in the conserved region 1, corresponding to amino acid 54 to 59 in the amino acid sequence of E. coli MetK shown in SΕQ LD NO. 4, the non mutated conserved region 1 comprising the amino acid sequence defined below: G-Ε-X1-X2-X3-X4 wherein

XI represents I, V, L, T preferentially I X2 represents T, K, S, R, preferentially T X3 represents T, S, G, preferentially T

X4 represents S, N, T, K, E, R, P, N, A preferentially S Preferentially the unmodified S-adenosylmethionine synthetase conserved region 1 has the following amino acid sequence: G-E-I-T-T-S. In another preferred embodiment at least one mutation is present in the conserved region 2, corresponding to amino acid 98 to 107 in the amino acid sequence of E. coli MetK shown in SEQ ID NO. 4, the non mutated conserved region 2 comprising the amino acid sequence defined below: Q-S-Xl -D-I-X2-X3-G-V-X4 wherein XI represents P, Q, A, S, preferentially P X2 represents A, N, Q, S, F, preferentially N X3 represents V, Q, Y, R, M, N preferentially Q X4 represents K, D,N, T, S, A, E preferentially D Preferentially the unmodified S-adenosylmethionine synthetase conserved region 2 has the following amino acid sequence: Q-S-P-D-I-N-Q-G-V-D. In another preferred embodiment at least one mutation is present in the conserved region 3, corresponding to arnino acid 114 to 121 in the amino acid sequence of E. coli MetK shown in SΕQ ID NO. 4, the non mutated conserved region 3 comprising the amino acid sequence defined below X1-G-A-G-D-Q-G-X2 wherein

XI represents Q, A, I, V, Ε, T, preferentially Q

X2 represents L, I, S, V, M, preferentially L Preferentially the unmodified S-adenosylmetMonine synthetase conserved region 3 has the following amino acid sequence: Q-G-A-G-D-Q-G-L. In another preferred embodiment at least one mutation is present in the conserved region 4, corresponding to arnino acid 137 to 144 in the amino acid sequence of E. coli MetK shown in SΕQ ID NO. 4, the non mutated conserved region 4 comprising the amino acid sequence defined below: X1-I-X2-X3-X4-H-X5-X6 wherein

XI represents S, P, T, A, preferentially P

X2 represents A, T, W, Y, F, S, N preferentially T

X3 represents M, Y, L, V preferentially Y X4 represents S, A, preferentially A

X5 represents K, R, Ε, D, preferentially R

X6 represents L, I, preferentially L Preferentially the unmodified S-adenosylmetMonine synthetase conserved region

4 has the following amino acid sequence: P-I-T-Y-A-H-R-L another preferred embodiment at least one mutation is present in the conserved region 5, corresponding to arnino acid 159 to 163 in the a ino acid sequence of E. coli MetK shown in SΕQ ID NO. 4, the non mutated conserved region 5 comprising the amino acid sequence defined below

X1-L-X2-X3-D wherein

XI represents W, F, Y, V, Ε preferentially W X2 represents R, G, L, K, preferentially R

X3 represents P, L, H, V, preferentially P Preferentially the unmodified S-adenosylmetMonine synthetase conserved region

5 has the following a ino acid sequence: W-L-R-P-D Preferentially at least one mutation is present in the conserved region 6, corresponding to to amino acid 183 to 189 in the amino acid sequence of E. coli MetK shown in SEQ ID NO. 4, the non mutated conserved region 6 comprising the a ino acid sequence defined below.

X1-X2-X3-S-X4-Q-H In wMch

XI represents V, I, preferentially V

X2 represents V, L, I, preferentially V

X3 represents V, L, I, M, preferentially L

X4 represents T, V, A, S, H, preferentially T In a preferred embodiment the unmodified S-adenosylmetMonine synthetase conserved region 6 has the following amino acid sequence: V-V-L-S-T-Q-H. Preferentially the mutations are introduced in the conserved region 7, corresponding to amino acid 224 to 230 in the amino acid sequence of E. coli MetK shown in SEQ ID NO. 4, the non mutated conserved region 7 comprising the amino acid sequence defined below:

X1-N-P-X2-G-X3-F

In wMch

XI represents I, V preferentially I

X2 represents T, G, S, preferentially T X3 represents R, T, Q, K, S, preferentially R In a preferred embodiment the unmodified S-adenosylmetMomne synthetase conserved region 7 has the following amino acid sequence: I-N-P-T-G-R-F Preferentially the mutations are introduced into the conserved region 8, corresponding to amino acid 231 to 237 in the amino acid sequence of E. coli MetK shown in SEQ ID NO. 4, the non mutated conserved region 8 comprising the amino acid sequence defined below. X1-X2-G-X3-P-X4-X5

In wMch

XI represents T, V, I, Y, E, preferentially V

X2 represents V, I, L, N, preferentially I X3 represents G, S, preferentially G

X4 represents M, I, Q, A, H, D preferentially M

X5 represents G, S, A, H preferentially G In a preferred embodiment the unmodified S-adenosylmetMonine synthetase conserved region 8 has the following amino acid sequence: V-I-G-G-P-M-G Preferentially the mutations are introduced in the conserved region 9, corresponding to amino acid 246 to 253 in the a ino acid sequence of E. coli MetK shown in SEQ ID NO. 4, the non mutated conserved region 9 comprising the amino acid sequence defined below.

X1-X2-D-T-Y-G-G In wMch

XI represents M, I, preferentially I X2 represents V, I preferentially I

In a preferred embodiment the unmodified S-adenosylmetMomne synthetase conserved region 9 has the following amino acid sequence: I-V-D-T-Y-G-G Preferentially the mutations are introduced into the conserved region 10, corresponding to amino acid 269 to 275 in the amino acid sequence of E. coli MetK shown in SEQ ID NO. 4, the non mutated conserved region 10 comprising the amino acid sequence defined below.

K-V-D-R-S-X1-X2 In wMch

XI represents A, G, preferentially A

X2 represents A, S, L, preferentially A In a preferred embodiment the unmodified S-adenosylmetMonine synthetase conserved region 10 has the following amino acid sequence: K-V-D-R-S-A-A. In another preferred application of the invention at least one mutation is present in the conserved region 11. The unmodified S-adenosylmetMonine synthetase harbors the conserved region in its C-terminal part with the following amino acid sequence: X1-X2-Q-X3-X4-Y-A-I-G-X5-X6 In wMch

XI represents L, E, I, Q, T preferentially E X2 represents V, I, L preferentially I X3 represents V, L, I preferentially V X4 represents A, S preferentially S X5 represents V, I, R, K, A preferentially V X6 represents A, V, T, S, preferentially A TMs region corresponds to amino acid 295 to 305 in the amino acid sequence of E. coli MetK shown in SEQ ID NO. 4. In a preferred embodiment the unmodified S-adenosylmetMomne synthetase conserved region 11 has the following amino acid sequence: E-I-Q-V-S-Y-A-I-G-V-A In another preferred application of the invention the mutations are introduced into the N-terrninus of the protein leading to a framesMft and changes in the last 6 arnino acids. In the S-adenosylmetMonine synthetase with decreased activity preferentially the serine in conserved region 1 is replaced with another amino acid. In a preferred application of the invention the serine is replaced with a asparagine. In a preferred embodiment the modified S-adenosylmetMonine synthetase has the following amino acid sequence in conserved region 1 : G-E-I-T-T-N. In the S-adenosylmetMonine synthetase with decreased activity preferentially the conserved glycine in conserved region 2 is replaced with another amino acid. In a preferred application of the invention the conserved glycine is replaced with a serine. In a preferred embodiment the modified S-adenosylmetMonine synthetase has the following amino acid sequence in conserved region 2: Q-S-P-D-I-N-Q-S-V-D In the S-adenosylmelMonine synthetase with decreased activity preferentially the conserved glycine in conserved region 3 is replaced with another amino acid. In a preferred application of the invention the conserved glycine is replaced with a serine. a preferred embodiment the modified S-adenosylmetMonine synthetase has the following amino acid sequence in conserved region 3: Q-S-A-G-D-Q-G-L JΏ. the S-adenosylmetMonine synthetase with decreased activity preferentially the conserved Mstidine and/or the semi-conserved proline in conserved region 4 is/are replaced with other amino acids. In a preferred application of the invention the conserved Mstidine is replaced with a tyrosine and/or the semi-conserved proline is replaced with a leucine. JΏ. a preferred embodiment the modified S-adenosylmetMomne synthetase has one of the following amino acid sequences in conserved region 4: P-I-T-Y-A-Y-R-L, L-I-T-Y-A-H-R-L, L-I-T-Y-A-Y-R-L. In the S-adenosylmetMonine synthetase with decreased activity preferentially the semi-conserved arginine in conserved region 5 is replaced with another amino acid. In a preferred application of the invention the arginine is replaced with a cysteine. a preferred embodiment the modified S-adenosylmetMonine synthetase has the following amino acid sequence in conserved region 5: W-L-C-P-D In the S-adenosylmetMonine synthetase with decreased activity preferentially the conserved Mstidine or semi-conserved valine m conserved region 6 is replaced with another amino acid. In a preferred application of the invention the conserved Mstidine is replaced with a tyrosine and/or the valine with aspartate. a preferred embodiment the modified S-adenosylmetMonine synthetase has one of the three following amino acid sequences in conserved region 6: V-V-L-S-T-Q-Y V-D-L-S-T-Q-H V-D-L-S-T-Q-Y In the S-adenosylmetMonine synthetase with decreased activity preferentially the semi-conserved threonine in conserved region 7 is replaced with another a ino acid. In a preferred application of the invention the threonine is replaced with an isoleucine. In a preferred embodiment the modified S-adenosylmetMonine synthetase has the following amino acid sequence in conserved region 7: 1-N-P-I-G-R-F In the S-adenosylmetMonine synthetase with decreased activity preferentially the conserved proline in conserved region 8 is replaced with another arnino acid. In a preferred application of the invention the proline is replaced with a serine. In a preferred embodiment the modified S-adenosylmetMonine synthetase has the following amino acid sequence in conserved region 8: V-I-G-G-S-M-G In the S-adenosylmetMonine synthetase with decreased activity preferentially the second conserved glycine in conserved region 9 is replaced with another arnino acid. In a preferred application of the invention the glycine is replaced with an aspartate. In a preferred embodiment the modified S-adenosylmetMonine synthetase has the following amino acid sequence in conserved region 9: 1-V-D-T-Y-G-D In the S-adenosylmetMonine synthetase with decreased activity preferentially the conserved serine in conserved region 10 is replaced with another amino acid. In a preferred application of the invention the serine is replaced with aphenyl ariine. In a preferred embodiment the modified S-adenosylmetMomne synthetase has the following amino acid sequence in conserved region 10: K-V-D-R-F-A-A In the S-adenosylmetMonine synthetase with decreased activity preferentially the conserved isoleucine in conserved region 11 is replaced with other amino acids. In a preferred application of the invention isoleucine is replaced by leucine. In a preferred embodiment the modified S-adenosylmetMonine synthetase has the following amino acid sequence in conserved region 11 : E-I-Q-V-S-Y-A-L-G-V-A The present invention furthermore relates to nucleotide sequences, DNA or RNA sequences, wMch encode a mutated S-adenosylmetMonine synthetase according to the invention as defined above. In a preferred embodiment, these DNA sequences are characterized by the fact that they comprise at least one mutation in the coding DNA sequence regions for the conserved regions 1 to 11 of the wild type metK gene, represented as wild type in SEQ ID NO 3, the said mutation being not a silent mutation. In a preferred application the metK gene is the S-adenosylmetMonine synthetase of E. coli K12 represented by the SEQ ID NO 3 and sequences homologous to that sequence that have S-adenosylmetMonine synthetase activity and that share at least 80% homology, preferentially 90% homology with the arnino acid sequence of SEQ ID NO 4. The mutated S-adenosylmetMonine synthetase genes described above may be obtained by conventional techmques known to the person skilled in the art disclosed above and below, including random or targeted mutagenesis or synthetic DNA construction. The metA gene encoding modified homoserine succinyltransferase and/or the metK gene encoding modified S-adenosyhnethiome synthetase may be encoded chromosomally or extracMomosomally. CMomosomally there may be one or several copies on the genome that can be introduced by methods of recombination known to the expert in the field. ExtracMomosomally both genes may be carried by different types of plasmids that differ with respect to their origin of replication and thus their copy number in the cell. They may be present as 1-5 copies, ca 20 or up to 500 copies corresponding to low copy number plasmids with tight replication (pSClOl, RK2), low copy number plasmids (pACYC, pRSFlOlO) or Mgh copy number plasmids (pSK bluescript II) The metA and/or metK gene may be expressed using promoters with different strength that need or need not to be induced by mducer molecules. Examples are the promoter pTrc, pTac, pLac, the lambda promoter cl or other promoters known to the expert m the field. MetA and/or MetK expression may be boosted or reduced by elements stabilizing or destabilizing the corresponding messenger RNA (Carrier and Keasling (1998) Biotechnol. Prog. 15, 58-64) or the protein (e.g. GST tags, Amersham Biosciences) The present mvention also relates to microorganisms wMch contain a feedback- resistant metA allele according to the invention and eventually a metK allele with reduced activity according to the invention. Such strains are characterized by the fact that they possess a metMonine metabolism wMch is deregulated by at least one feedback-resistant metA allele and/or by a reduced production of SAM caused by a MetK enzyme with reduced activity. Novel strains may be prepared from any microorganism in wMch metMonine metabolism proceeds by the same metabolic pathway. Gram-negative bacteria, in particular E. coli, are especially suitable. For the purpose of expressing the modified homoserine succinyltransferase enzyme and S-adenosylmetMonine synthetase, the feedback-resistant metA alleles and metK alleles with reduced activity are transformed in a host strain using customary methods. The screening for strains possessing modified homoserine succinyltransferase and S-adenosylmetMomne synthetase properties is, for example, realized using enzymatic tests. For example, the homoserine succinyltransferase activity can be determined in an enzymatic test with homoserine and succinyl-CoA as substrates. The reaction is started by adding the protein extract containing the homoserine succinyltransferase enzyme, and the formation of O-succinylhomoserine is momtored by GC-MS after protein precipitation and derivatization with a silylating reagent. Feedback inhibition is tested in the presence of metMoMne and S-adenosyhnetMonine in the reaction mixture. S-adenosymietMonine synthetase activity can be determined in an enzymatic test with metMonine and ATP as substrates. The reaction is started by adding the protein extract containing the S-adenosylmetMonine synthetase enzyme, and the formation of S- adenosylmetMonine is momtored by FIA-MS/MS. Preferentially, use is made of E. coli strains in wMch the endogenous metA and metK genes are inactivated and complemented by novel recombinant genes. The feedback-resistant metA alleles and the metK alleles with reduced activity render it possible to abolish the control at important biosynthetic control points, thereby amplifying the production of a large number of compounds wMch are situated downstream of aspartate. These include, in particular, homoserine, O- succinylhomoserine, cystatMonine, homocysteine, metMomne and S- adenosyhnetMonine. particular the invention relates to the preparation of L-metMonine, its precursors or compounds derived thereof, by means of cultivating novel microorgamsms. The above-described products are classified below as compound (I).

An increase in the production of compound (I) can be acMeved by changing the expression levels or deleting the following genes implicated in the production of aspartate, a precursor of compound (I). Gene genbank entry name ackA gl788633 acetate kinase pta gl788635 phosphotransacetylase acs gl790505 acetate synthase aceA gl790445 isocitrate lyase aceB _g1790444 malate synthase aceE gl786304 pyruvate deydrogenase El aceV gl786305 pyruvate deydrogenase E2

Ipd gl786307 pyruvate deydrogenase E3 αceK gl790446 isocitrate dehydrogenase kinase/phosphatase sucC gl786948 succinyl-CoA synthetase, beta subunit sucD gl786949 succinyl-CoA synthetase, alpha subumt ppc gl790393 phosphoenolpyruvate carboxylase pck gl789807 phosphoenolpyruvate carboxykinase pykA gl788160 pyruvate kinase II pykF gl787965 pyruvate kinase I poxB gl787096 pyruvate oxidase pps gl787994 phosphoenolpyruvate synthase ilvB gl790104 acetohydroxy acid synthase I, large subumt t/vN gl790103 acetohydroxy acid synthase I, small subtmit t/vG gl790202 acetohydroxy acid synthase LT, large subtmit gl790203 zϊvM gl790204 acetohydroxy acid synthase II, small subtmit z7vl gl786265 acetohydroxy acid synthase III, large subumt z/VH gl786266 acetohydroxy acid synthase III, small subtmit aroF gl788953 DAHP synthetase aroG gl786969 DAHP synthetase arόΑ gl787996 DAHP synthetase aspC gl787159 aspartate aminotransferase In addition pyruvate carboxylase from Rhizobium etli (accession number U51439) may be introduced by genetic engineering into E. coli and overexpressed. An additional increase in the production of compound (I) can be acMeved by overexpressing genes of the lysme/meMonine/pathway, such as the homoserine synthesizing enzymes encoded by the genes tArA (homoserine dehydrogenase/ aspartokinase, g 1786183) or etL (homoserine dehydrogenase/aspartokinase, gl 790376) or lysC (apartokinase, gl 790455) or asd (aspartate semialdehyde dehydrogenase, g 1789841) or a combination thereof. A further increase in the production of (I) is possible by overexpressing genes involved in sulfate assimilation and production of cysteme. TMs can be acMeved by overexpressing the following genes (see below) or by deregulating the pathway through the introduction of a constitutive cysB allele as described by Colyer and Kredich (1994 Mol Microbiol 13 797-805) and by introducing a cysE allele encoding a serine acetyl transferase with decreased sensitivity for its inhibitor L-cysteine (US patent application US 6,218,168, Denk & Bock 1987 J Gen Microbiol 133 515-25). The following genes need to be overexpressed. CCyyssAA ggll778888776611 sulfate permease

Cysϋ gl788764 cysteine transport system

CysΨ gl788762 membrans bound sulphate transport system

CysZ gl788753 ORF upstream of cysK cysN gl789108 ATP sulfurylase ccyyssDD ggll778899110099 sulfate adenylyltransferase cysC gl789107 adenylylsulfate kinase cysJi gl789121 adenylylsulfate reductase cysJ gl789122 sulfite reductase, alpha subumt cysJ gl789123 sulfite reductase, beta subtmit ccyyssEB gg 1l779900003355 serine acetyltransferase cysK. gl788754 cysteine synthase cysM g2367138 O-acetyl-sulfhydrolase addition genes involved in the production of Cl (methyl) groups may be enhanced by overexpressing the following genes: ser A gl 789279 phosphoglycerate dehydrogenase serB gl 790849 phosphoserine phosphatase ,serC gl787136 phosphoserine aminotransferase glyA gl 788902 serine hydroxymethyltransferase metF gl790377 5, 10-Methylenetetrahydrofolate reductase In addition genes directly involved in the production of metMonine may be overexpressed: metB gl 790375 CystatMoriine gamma-synthase metC gl789383 CystatMonine beta-lyase metH gl 790450 B12-dependent homocysteine-N5- methylterrahydrofolate transmethylase metE g2367304 Tetrahydropteroyltriglutamate methyltransferase metF gl 790377 5, 10-Methylenetetrahydrofolate reductase metR gl790262 Positive regulatory gene for metE and metH and autogenous regulation Furthermore expression of genes in pathways degrading metMonine or deviating from the metMonine production pathway may be reduced or the genes may be deleted. speD gl786311 S-AdenosylmetMomne decarboxylase speC gl789337 Ormtbine decarboxylase thrB gl786184 Homoserine kinase astA gl788043 Arginine succinyltransferase dapA gl788823 Dihydrodipicolinate synthase

A further increase in the production of (I) is possible by means of deleting the gene for the repressor protein MetJ, responsible for the down-regulation of the metMonine regulon as was suggested in JP 2000157267-A/3 (see also GenBank gl 790373). Production of (I) may be further increased by using an altered metB allele that uses preferentially or exclusively H₂S and thus produces homocysteine from O succinylhomoserine as has been described in the patent application PCT N° PCT/FR04/00354, wMch content is incorporated herein by reference. The metA and metK alleles described above may be used in eukaryotes or prokaryotes. Preferentially the orgamsm used is a prokaryote. In a preferred application the orgamsm is either E. coli or C. glutamicum. The invention also concerns the process for the production of compound (I). Compound (I) is usually prepared by fermentation of the designed bacterial strain. According to the invention, the terms 'culture' and 'fermentation' are used indifferently to denote the growth of a microorgamsm on an appropriate culture medium containing a simple carbon source. According to the invention a simple carbon source is a source of carbon that can be used by those skilled in the art to obtain normal growth of a microorgamsm, in particular of a bacterium. In particular it can be an assimilable sugar such as glucose, galactose, sucrose, lactose or molasses, or by-products of these sugars. An especially preferred simple carbon source is glucose. Another preferred simple carbon source is sucrose. Those skilled in the art are able to define the culture conditions for the microorgamsms according to the invention. In particular the bacteria are fermented at a temperature between 20°C and 55°C, preferentially between 25°C and 40°C, and more specifically about 30°C for C. glutamicum and about 37°C for E. coli. The fermentation is generally conducted in fermenters with an inorgamc culture medium of known defined composition adapted to the bacteria used, containing at least one simple carbon source, and if necessary a co-substrate necessary for the production of the metabolite. In particular, the inorganic culture medium for E. coli can be of identical or similar composition to an M9 medium (Anderson, 1946, Proc. Natl. Acad. Sci. USA 32:120-128), an M63 medium (Miller, 1992; A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York) or a medium such as defined by Schaefer et al. (1999, Anal Biochem. 270: 88-96). Analogously, the inorganic culture medium for C. glutamicum can be of identical or similar composition to BMCG medium (Liebl et al., 1989, Appl. Microbiol.

Biotechnol. 32: 205-210) or to a medium such as that described by Riedel et al. (2001, J. Mol. Microbiol. Biotechnol. 3: 573-583). The media can be supplemented to compensate for auxotropMes introduced by mutations. After fermentation compound (I) is recovered and purified if necessary. The methods for the recovery and purification of compound (I) such as metMomne in the culture media are well known to those skilled in the art.

- Figure 1A/B : MetMonine metabolism in Escherichia coli.

- Figure 2 : Alignment of wildtype and recombinant metA genes obtained upon selection on α-methyl-metMonine. Conserved residues are represented by light grey boxes and mutated residues are indicated by wMte boxes.

- Figure 3 : Alignment of MetA sequences from different microorgamsms.

- Figure 4 : Alignment of MetK sequences from different microorgamsms.

- Figure 5 : Amino acid replacements in the E. coli MetK protein. Amino acids above the coherent lines indicate the position and the replacing amino acid.

EXAMPLES

Example 1

Isolation of E. coli mutants containing homoserine transsuccinylase enzymes which show decreased feedback-sensitivity towards methionine and S-adenosylmethionine Isolation ofE. coli strains growing on a-methylmethionine α-methylmetMomne is a growth-inMbitory analogue of metMomne producing an immediate effect on the growth rate of E. coli at very low concentrations (mimmal inhibitory concentration of lμg/ml and mimmal concentration for a maximal inMbition

5μg/ml, Rowbury et al, 1968). Analogues can mimic metMonine in the feedback inhibition of homoserine transsuccinylase and interfere with protein synthesis without being metabolized. Only mutant strains are able to grow in a medium contaimng the analogue. E. coli was routinely grown aerobically at 37°C in LB supplemented when needed with the appropriate antibiotic. The medium used for the α-methyl-metMomne analogue resistant was a minimal medium containing (per liter): K₂HPO 8g, Na₂HPO

2g, (NHι)₂SO₄ 0.75g, (NH₄)₂HPO₄ 8g, NH₄CI 0.13g, citric acid 6.55g, MgSO₄ 2.05g, CaCl₂ 40mg, FeSO₄ 40mg, MnSO₄ 20mg, CoCl₂ 8 mg, ZnSO₄ 4mg, (NH₄)₂Mo₂O₇ 2.8mg, CuCl₂ 2mg, H₃BO₃ lmg. The pH was adjusted to 6.7 and the medium sterilized. Before use, glucose lOg/l and tMamine 15ml/l were added. The α-methylmetMonine powder commercialized by Sigma contains metMonine traces. An overnight liquid culture of an E. coli strain (MG1655 ΔmetΕ) unable to grow without metMonine addition was carried out to eliminate the metMonine (coming from α-methylmetMomne) from the minimal medium. The culture was centrifuged 10 minutes at 7000rpm and the supernatant was filtered (Sartorius 0.2μm). Agar 15g/l was added to tMs minimal medium. 1*10⁸ cells / ml from an overnight culture in minimal medium of the wild type strain (MG1655) were spread onto plates with minimal medium and α-methylmetMonine after 4 washing steps in sterile water. The plates were incubated at 37°C until colomes appeared. Evidence of mutations in the coding sequence of the metA gene coding for the homoserine transsuccinylase enzyme Genomic DNA was prepared from 4 clones that grew on α-methyl-metMomne at 4mg/ml after cultivation in LB medium. The cell pellet was washed once with sterile water and resuspended in 30μl of sterile water. Cells were broken by heating 5 minutes at 95°C and the debris were pelleted. The metA gene was PCR-amplified using Taq polymerase and the following primers:

MetAF (SΕQ ID NO 5): tcaccttcaacatgcaggctcgacattggc (4211759-4211788) MetAR (SΕQ ID NO 6): ataaaaaaggcacccgaaggtgcctgaggt (4212857-4212828) In three clones point mutations were detected wMch led to amino acid substitutions. In clone metA 11 CAG was exchanged for a GAG leading to the replacement of Q by Ε. In metA* 13 TTG was exchanged for a TTT leading to the replacement of L by F. In metA* 14 GCG was exchanged for GTG leading to the replacement of A by V (see fig.2).

As can be seen from the alignment shown in Fig. 3 all three arnino acid that are replaced are MgMy conserved in MetA proteins from various species. The mutated homoserine transsuccinylase enzymes show decreased feedback- sensitivity towards methionine and S-adenosylmethionine The activity of homoserine transsuccinylase was determined in vitro. E. coli strains carrying either wild-type or mutant enzymes were cultured in rich medium with 2.5 g/1 glucose and harvested at late log phase. Cells were resuspended in cold potassium phosphate buffer and somcated on ice (Branson somfier, 70W). After centrifugation, proteins contained in the supernatants were quantified (Bradford, 1976). Ten μl of the extracts were incubated for 30 minutes at 25°C with 30 mM homoserine and 4 mM succinyl-CoA. MetMonine and/or S-adenosylmetMomne were added as indicated. The succinylhomoserine produced by homoserine transsuccinylase enzymes was quantified by GC-MS after derivatization with tert- butyldmiemylsilyltrifluoroacetamide (TBDMSTFA). L-Serine[l-13C] was included as an internal standard. Results of homoserine transsuccinylase activities are reported in the table 1 below:

MetMomne S-aderiosyhnefMonine Specific activity Strain mM mM mUI/mg proteins metA 0 0 36.7 (100%) 0 0.1 27.9 (76%) 0 1 4.7 (12.8%) 10 0 0.4 (1.1%) 10 0.1 0.2 (0.5%) 10 1 0.1 (0.3%) metA* 11 0 0 19.2 (100%) 0 0.1 21.7 (113%) 0 1 18.5 (96%) 10 0 18.7 (97%) 10 0.1 16.9 (88%) 10 1 2.7 (14.1%) metA*13 0 0 10.9 (100%) 0 1 12.7 (117%) 10 0 13.7 (126%) 10 1 1.0 (9.2%) metA* 14 0 0 18.0 (100%) 0 1 15.1 (83.9%) 10 0 20.8 (116%) 10 1 2.0 (11.1%)

Table 1. Specific activities of wild-type and mutant homoserine transsuccinylase enzymes upon the addition of inhibitors L-metMonine and S-adenosyl metMonine. The mutated homoserine transsuccinylase enzymes thus show decreased feedback-sensitivity towards metMonine and S-adenosylmetMonine. Example 2

Isolation of E. coli mutants containing S-adenosylmethionine synthetase enzymes with reduced activity Isolation ofE. coli strains growing on norleucine Norleucine is a growth-inhibitory analogue of metMomne. At Mgher concentrations (50 mg/1) only mutant strains are able to grow in a medium containing the analogue. Most of these mutations map to the metK and etj loci. E. coli was routinely grown aerobically at 37°C in LB supplemented when needed with the appropriate antibiotic. The medium used for the norleucine analogue resistant was a minimal medium containing (per liter): K₂HPO₄ 8g, Na₂HPO 2g, (NH )₂SO₄ 0.75g, (NH₄)₂HPO₄ 8g, NH₄C1 0.13g, citric acid 6.55g, MgSO₄ 2.05g, CaCl₂ 40mg, FeSO₄ 40mg, MnSO₄ 20mg, CoCl₂ 8 mg, ZnSO₄ 4mg, (NH4)₂Mo₂O₇ 2.8mg, CuCl₂ 2mg, H₃BO₃ lmg. The pH was adjusted to 6.7 and the medium sterilized. Before use, glucose lOg/1 and tManiine 15ml/l were added. 1*10⁸ cells / ml from an overnight culture in minimal medium of the wild type strain (MG1655) were spread onto plates with minimal medium and norleucine (50 to 200 g/1) after 4 washing steps in sterile water. The plates were incubated at 37°C until colomes appeared. Evidence of mutations in the coding sequence of the metK gene coding for the S- adenosylmethionine synthetase enzyme Genomic DNA was prepared from cultures grown in LB liquid medium. The cell pellet was washed once with sterile water and resuspended in 30μl of sterile water. Cells were broken by heating 5 minutes at 95°C and the debris was extracted. DNA was PCR-amplifϊed with Taq polymerase using the following primers: MetKpF : cccggctggaagtggcaacacg (3084372-3084393) SEQ ID NO 07 MetKR : gccggatgcggcgtgaacgcctatcc (3085956-3085931) SEQ ID NO 08 The metK gene was sequenced. In 10 clones point mutations were detected wMch led to amino acid substitutions. In clone metK*59/105 AGC was exchanged for

AAC leading to the replacement of S by N (position 59) and GGC was exchanged for

AGC leading to the replacement of G by S (position 105). In clone metK* 105 GGC was exchanged for AGC leading to the replacement of G by S. In metK* 115 GGC was exchanged for AGC leading to the replacement of G by S. metK* 137 CCT was replaced by CTT leading to the replacement of P by L. metK* 142 CAC was replaced by TAG leading to the replacement of H by Y. In metK*161/235 CGC was replaced by

TGC leading to the replacement of R by C and CCA was replaced by TCA leading to the replacement of P by S. In metK* 189 CAC was replaced by TAC leading to the replacement of H by Y. In metK*227 ACC was replaced by ATC leading to the replacement of T by I. In metK*253 GGC was replaced by GAC leading to the replacement of G by D. In metK*273 TCC was replaced by TTC leading to the replacement of S by F (see fig.5). As can be seen from the alignment shown in fig. 4 all amino acid that are replaced are conserved in MetK proteins from various species. Recombinant S-adenosylmethionine synthetase enzymes with decreased activity The activity of S-adenosylmetMonine synthetase was determined in vitro. E. coli strains carrying either wild-type or mutant enzymes were cultured m minimal medium with 5 g/1 glucose and harvested at late log phase. Cells were resuspended in cold potassium phosphate buffer and somcated on ice (Branson somfier, 70 W). After centrifugation, proteins contained in the supernatants were quantified (Bradford, 1976). One hundred μL of the extracts were incubated for 30 minutes at 37°C with 10 mM metMomne and 10 mM ATP. Potassium cMoride was included to activate the enzymes. The adenosylmefMonine produced by metMomne adenosyltransferase enzymes was quantified by FIA-MS/MS. Results of S-adenosylmetMonine synthetase activities are reported in Table 2 below:

Table 2: S-adenosylmethionine synthetase activities (MAT) of WT and MetK* mutants.

Example 3

Construction of E. coli strains for the production of O-succinylhomoserine or methionine by overexpressing altered homoserine transsuccinylase and other enzymes of the methionine biosynthesis pathway. For the construction of E. coli strains that allow the production of O- succinylhomoserine, a plasmid overexpressing the metL gene, coding for homoserine dehydrogenase and aspartokinase was introduced into strains harboring different alleles of metA. The plasmid overexpressing etL was constructed as follows: The following two oligonucleotides were used: - MetLF with 32 bases (SΕQ LO NO 13): TATTCatgagtgtgattgcgcaggcaggggcg with

- a region (lower case) homologous to the sequence (4127415 to 4127441) of the gene metL (sequence 4127415 to 4129847, reference sequence on the website http://genolist.pasteur.fr/Colibri/).

- a region (upper case) that together with the sequence pertaining to metL forms a restriction site for the enzyme BspJϊl (underlined),

- MetBLAR with 38 bases (SEQ ID NO 14): TATAAGCTTccataaacccgaaaacatgagtaccgggc with

- a region (lower case) homologous to the sequence (4129894 to 4129866) of the gene metL

- a region (upper case) that harbors the restriction site H dlil. The gene metL was amplified by PCR using the oligonucleotides MetLF and MetBLAR and the restriction sites BspHl and HindJIJ were introduced at the N- and C- terminus of the metL gene, respectively. The resulting PCR fragment was restricted by

BspJϊl and HindϋJ and cloned into the vector pTrc99A (Stratagene) previously cut by

Ncol and Hindϊil.

Plasmid preparations were examined for the presence of inserts of the correct size. The DNA sequence of metL was verified and the resulting plasmid pTrc::metL transformed into the strains harboring the alleles metA* 11 and metA* 13. The activity of Homoserine dehydrogenase II (HDH) was determmed in vitro. E. coli strains were cultured in minimal medium with 10 g.l^"1 glucose and harvested at late log phase. Cells were resuspended in cold potassium phosphate buffer and somcated on ice (Branson somfier, 70W). After centrifugation, proteins contained in the supematants were quantified (Bradford, 1976). Thirty μl of the extracts were incubated at 30°C in a spectrophotometer, with 25 mM homoserine and 1 mM NADP⁺. Potassium cMoride was included to activate the enzyme. Since E. coli harbors a second gene encoding a homoserine dehydrogenase activity (thrA), threonine was added wMch inMbits tMs activity. The appearance of

NADPH was monitored for 30 minutes at 340 nm. Expression of metL from the pTrc promoter increases drastically the HDH activity when compared to a similar strain with the plasmid.

Tab. 3 Homoserine dehydrogenase activities of the MetL protein in the MG1655 E. coli strain harbouring the metA* 11 mutation with or without overexpressing metL from the pTrc promoter.

In another application the metMomne regulatory gene metJ was deleted in the strains harboring the metA*ll, metA* 13 and metA* 14 alleles. To inactivate the metJ gene the homologous recombination strategy described by Datsenko & Wanner (2000) was used. TMs strategy allows the insertion of a cMoramphemcol resistance cassette, wMle deleting most of the gene concerned. For tMs purpose 2 oligonucleotides were used: - DmetTF with 100 bases (SEQ ID NO 15): CaggcaccagagtaaacattgtgttaatggacgtcaatacatctggacatctaaacttctttgcgtatagattgagcaaaCAT ATGAATATCCTCCTTAG with - a region (lower case) homologous to the sequence (4126216 to 4126137) of the gene metJ (sequence 4125658 to 4125975 , reference sequence on the website http://genolist.pasteur.fr/Colibri/). - a region (upper case) for the amplification of the cMoramphemcol resistance cassette (reference sequence in Datsenko, K.A. & Wanner, B.L., 2000, PNAS, 97: 6640-6645), - DmetTR with 100 bases (SEQ ID NO 16 ): tgacgtaggcctgataagcgtagcgcatcaggcgattccactccgcgccgctcttttttgctttagtatt^ GGCTGGAGCTGCTTCG with - a region (lower case) homologous to the sequence (4125596 to 4125675) of the gene metJ - a region (upper case) for the amplification of the cMoramphemcol resistance cassette. The oligonucleotides DmeUR and DmetJF were used to amplify the cMoramphemcol resistance cassette from the plasmid pKD3. The PCR product obtained was then introduced by electroporation into the strain MG1655 (pKD46) in wMch the Red recombinase enzyme expressed permitted the homologous recombination. The cMoramphemcol resistant transformants were then selected and the insertion of the resistance cassette was verified by a PCR analysis with the oligonucleotides MetJR and MetJF defined below. The strain retained is designated MG1655 (ΔmetJ::Cm) metA*. MeUR (SEQ ID NO 17): ggtacagaaaccagcaggctgaggateagc (homologous to the sequence from 4125431 to 4125460). MetBR (SEQ ID NO 18): ttcgtcgtcatttaacccgctacgcactgc (homologous to the sequence from 4126305 to 4126276). The cMoramphemcol resistance cassette was then eliminated. The plasmid pCP20 carrying recombinase FLP acting at the FRT sites of the cMoramphemcol resistance cassette was introduced into the recombinant strains by electroporation. After a series of cultures at 42°C, the loss of the cMoramphemcol resistance cassette was verified by a PCR analysis with the same oligonucleotides as those used previously. The strains retained were designated MG1655 (AmetJ) metA*. Subsequently the plasmid pTrc::metL harbouring the metL gene was introduced into these strains giving rise to AmetJ met A*l 1 pTrc::metL, AmetJ metA* 13 pTrc::metL and ΔmetJ metA* 14 pTrc::metL.

Example 4

Construction of E. coli strains for the production of O-succinyl homoserine or methionine by combining feed-back resistant MetA alleles with MetK alleles with decreased activity. In order to transfer the recombinant metK alleles into strains harboring feedback resistant metA alleles, a kanamycin resistance cassette was introduced between the metK and gal? gene. To introduce the cassette the homologous recombination strategy described by

Datsenko & Wanner (2000) is used. TMs strategy allows the insertion of a kanamycin resistance cassette, wMle deleting most of the gene concerned. For tMs purpose 2 oligonucleotides are used:

- DMetKFscr with 100 bases (SEQ ID NO 9): ccgcccgcacaataacatcattcttcctgatcacgtttcaccgcagattatcatcacaactgaaaccgattacaccaaccTGTA GGCTGGAGCTGCTTCG with

- a region (lower case) homologous to the sequence of the region between metK and galP (sequence 3085964 to 3086043, reference sequence on the website http://genolist.pasteur.fr/Colibri/). - a region (upper case) for the amplification of the kanamycin resistance cassette (reference sequence in Datsenko, K.A. & Wanner, B.L., 2000, PNAS, 97: 6640-6645),

- DmetKRscr with 100 bases (SEQ ID NO 10): gagttatatcatcatagattaaacgctgttatctgcaattaagactttactgaaaagaaatgtaacaactgtgaaaaccgCATA TGAATATCCTCCTTAG with

- a region (lower case) homologous to the region between the gene metK and gal? (3086162 to 3086083)

- a region (upper case) for the amplification of the kanamycin resistance cassette. The oligonucleotides DMetKFscr and DmetKRscr are used to amplify the kanamycm resistance cassette from the plasmid pKD4. The PCR product obtained is then introduced by electroporation into the strain MG1655 (pKD46) in wMch the Red recombinase enzyme expressed allows the homologous recombination. The kanamycin resistant transformants are then selected and the insertion of the resistance cassette is verified by a PCR analysis with the oligonucleotides MetKFscr and MetKRscr defined below. The strain retained is designated MG1655 (ΔmetK, Km). MetKFscr (SEQ ID NO 11): gcgcccatacggtctgattcagatgctgg (homologous to the sequence from 3085732 to 3085760). MetKRscr (SEQ ID NO 12) gcgccagcaattacaccgatatccaggcc (homologous to the sequence from 3086418 to 3086390). To transfer the metK alleles, the method of phage PI transduction is used. The protocol followed is implemented in 2 steps with the preparation of the phage lysate of the strain MG1655 (metK, Km) and then transduction into strain MG1655 AmetJ metA* 11 pTrc::metL. The construction of the strain (metK, Km) is described above. Preparation of phage lysate PI : - Inoculation with 100 μl of an overnight culture of the strain MG 1655 (AmetK, Km) of 10 ml of LB + Km 50 μg/ml + glucose 0.2% + CaCl₂ 5 mM.

- Incubation for 30 min at 37°C with shaking.

- Addition of 100 μl of phage lysate PI prepared on the wild strain MG1655 (about 1.10⁹ phage/ml) - Shaking at 37°C for 3 hours until all the cells were lysed.

- Addition of 200 μl cMoroform and vortexmg.

- Centrifugation for 10 min at 4500 g to eliminate cell debris.

- Transfer of supernatant to a sterile tube and addition of 200 μl cMoroform.

- Storage of lysate at 4°C. Transduction

- Centrifuging for 10 min at 1500 g of 5 ml of an overnight culture of the strain MG1655 AmetJ metA*l 1 pTrc::metL in LB medium.

- Suspension of the cell pellet in 2.5 ml of 10 mM MgSO , 5 mM CaCl₂

- Control tubes: 100 μl cells 100 μl phages PI of strain MG1655 (AmetK, Km)

- Test tube: 100 μl of cells + 100 μl of phages PI of the strain MG1655 (AmetK, Km)

- Incubation for 30 min at 30°C without shaking.

- Addition of 100 μl of 1 M sodium citrate in each tube and vortexing.

- Addition of 1 ml of LB - Incubation for 1 hour at 37°C with shaking

- Spreading on dishes LB + Km 50 μg/ml after centrifuging of tubes for 3 min at 7000 rpm.

- Incubation at 37°C overnight. Verification of the strain The kanamycin resistant transformants are then selected and the insertion of the region containing (metK, Km) is verified by a PCR analysis with the oligonucleotides MetKFscr and MetKRscr. The strain retained is designated MG1655 ΔmetJ metA* 11 pTrc::metL metK*.

The kanamycin resistance cassette can then be eliminated. The plasmid pCP20 carrying FLP recombinase acting at the FRT sites of the kanamycin resistance cassette is then introduced into the recombinant sites by electroporation. After a series of cultures at 42°C, the loss of the kanamycin resistance cassette is verified by a PCR analysis with the same oligonucleotides as used previously (MetKFscr and MetKRscr).

Example 5 Construction of an E. coli strain overexpressing the metA*ll allele For overexpression the metA* 11 allele was cloned into the vector pTc99A (Stratagene). The following two oligonucleotides were used:

- MetA-NcoI with 49 bases (SEQ ID NO 19): TATTAAATTACCatggcaccgattcgtgtgccggacgagctacccgccg with

- a region (lower case) homologous to the sequence (4211862 to 4211892) of the gene metA (sequence 4211859 to 4212788 , reference sequence on the website http://genolist.pasteur.fr/Colibri/). - a region (upper case) that together with the sequence pertaimng to metA forms a restriction site for the enzyme Ncol (underlined),

- MetA-EcoRI with 47 bases (SEQ ID NO 20): TATTAAATTAGaattccgactatcacagaagattaatccagcgttgg with - a region (lower case) homologous to the sequence (4212804 to 42127774) of the gene metA

- a region (upper case) that harbors the restriction site EcoRI. The gene metA was amplified by PCR using oligonucleotides MetAF and MetAR and the restriction sites Ncol and EcoRI were introduced at the N- and C-terminus of the metA gene, respectively. The resultmg PCR fragment was restricted by NcoJ and EcoRI and cloned into the vector pTrc99A (Stratagene) previously cut by Ncol and EcoRI. Plasmid preparations were examined for the presence of inserts of the correct size. The DNA sequence of metA was verified and the plasmid transformed into the strains harboring the allele metA* 11.

Example 6 Fermentation of E. coli production strains and analysis of yield Production strains were imtially analyzed in small Erlenrneyer flask cultures using modified M9 medium (Anderson, 1946, Proc. Natl. Acad. Sci. USA 32:120-128) that was supplemented with 5 g/1 MOPS and 5 g/1 glucose. Carbemcillin was added if necessary at a concentration of 100 mg/1. An overnight culture was used to inoculate a 30 ml culture to an OD600 of 0.2. After the culture had reached an OD600 of 4.5 to 5, 1,25 ml of a 50% glucose solution and 0.75 ml of a 2M MOPS (pH 6.9) were added and culture was agitated for 1 hour. Subsequently IPTG was added if necessary. Extracellular metabolites were analyzed during the batch phase. Amino acids were quantified by HPLC after OPA/Fmoc derivatization and other relevant metabolites were analysed using GC-MS after silylation. The following results were obtained for the strains MG1655, MG1655 pTrc::metL MG1655 metA* 11 pTrc::metL, MG1655 metA* 13 pTrc::metL, MG1655 metA* 11 ΔmetJpTrc::metL.

Tab. 4 Concentrations of extracellular metabolites (mM) after batch fermentation of strains MG1655, MG1655 ρTrc::metL, MG1655 metA*ll pTrc::metL, MG1655 etA*13 pTrc::metL, MG1655 metA*ll ΔmetJ pTrc::metL, MG1655 metA*ll ΔmetJ pTrc:: etL metK* 142. Abbreviations: OSH O-succinylhomoserine, HOMO homoserine, THR threonine, MET metMonine, ND not detected. Strains that produced substantial amounts of metabolites of interest were subsequently tested under production conditions in 300 ml fermentors (DASGIP) using a fed batch protocol. For tMs purpose the fermentor was filled with 145 ml of modified minimal medium and inoculated with 5 ml of preculture to an optical density (OD600nm) between 0.5 and 1.2. The temperature of the culture was maintained constant at 37 °C and the pH was permanently adjusted to values between 6.5 and 8 using an NH₄OH solution. The agitation rate was maintained between 200 and 300 rpm during the batch phase and was increased to up to 1000 rpm at the end of the fed-batch phase. The concentration of dissolved oxygen was maintained at values between 30 and 40% saturation by using a gas controller. When the optical density reached a value between three and five the fed- batch was started with an imtial flow rate between 0.3 and 0.5 ml/h and a progressive increase up to flow rate values between 2.5 and 3.5 ml h. At tins point the flow rate was maintained constant for 24 to 48 hours. The media of the fed was based on nήnimal media contaimng glucose at concentrations between 300 and 500 g/1. When the concentration of biomass' reached values between 30 and 60 g/1 the fermentation was stopped and the extracellular metMomne concentration was determined using HPLC.

Tab 5 MetMonine titer of strains ΔmetJ metA* 11 pTrc:metL after fed batch fermentation.

Claims

What is claimed is: 1. A method for the preparation of metMomne, its precursors or products derived thereof, in a fermentative process with a microorgamsm where L-homoserine is converted into O-succinylhomoserine with a homoserine transsuccinylase, comprising the step of culturing the said microorgamsm on an appropriate medium and recovering metMonine, its precursors or products derived thereof once produced, wherein the homoserine transsuccinylase is a mutated homoserine transsuccmylase with reduced sensitivity for the feedback inhibitors S-adenosylmetMomne and metMonine. 2. The method as claimed in claim 1, wherein the modified homoserine succinyltransferases exMbit a specific activity wMch is at least ten times that of the wild- type enzyme in the presence of 10 mM metMomne and 1 mM S-adenosylmetMomne and at least 80 times that of the wild-type enzyme in the presence of 10 mM metMonine and 0.1 mM S-adenosylmetMomne. 3. The method as claimed in one of claims 1 or 2, wherein the modified homoserine succinyltransferases comprise at least one amino acid mutation when compared with the wild-type sequence in one of the following non mutated conserved regions and combinations thereof: conserved region 1 comprising the following sequence:

X1-X2-X3-A-X4-X5-Q wMch

XI represents E, D, T, S, L, preferentially T

X2 represents D, S, K, Q, E, A, R, preferentially S

X3 represents R, E, D, preferentially R

X4 represents Y, I, F, A, K, S, V, preferentially S X5 represents H, S, N, G, T, R, preferentially G conserved region 2 comprising the following sequence:

X1-X2-X3-P-L-Q-X4-X5

In wMch

XI represents G, A, S, preferentially S X2 represents N, A, preferentially N

X3 represents S, T, preferentially S X4 represents V, L, I, preferentially V X5 represents N, E, H, D, preferentially D conserved region 3 comprising the following sequence: X1-Y-Q-X2-T-P-X3 Jn wMch

XI represents V, I, M, preferentially V

X2 represents E, K, G, I, Q, T, S, preferentially I

X3 represents F, Y, preferentially Y 4. The method as claimed in claim 3, wherein the modified homoserine succinyltransferases comprise at least one of the following mutations and combinations thereof: conserved alanine in conserved region 1 is replaced with a valme, conserved amino acids L and/or Q in conserved region 2 are replaced with other amino acids, preferentially leucine is replaced by phenylalanine and/or glutamine is replaced with a glutamate, and conserved amino acids L and/or Q in conserved region 3 are replaced with another amino acid. 5. The method as claimed in claim 4, wherein the modified conserved region 1 comprises the amino acid sequence T-S-R-V-S-G-Q, and/or the modified conserved region 2 comprises the arnino acid sequence selected among S-N-S-P-L-E-V- D, S-N-S-P-F-Q-V-D and S-N-S-P-F-E-V-D. 6. The method as claimed in any one of claims 1 to 5, wherem the microorgamsms comprise a S-adenosylmetMomne synthetase enzyme with reduced S- adenosylmetMonine synthetase enzymatic activity. 7. The method as claimed m claim 6, wherein the modified S- adenosylmetMomne synthetase contains at least one amino acid mutation of at least one of the sequences specified below: cystein at position 89 and/or cystem at position 239 region 1, the non mutated region 1 comprising the amino acid sequence defined below: G-E-X1-X2-X3-X4 wherein XI represents I, V, L, T preferentially I

X2 represents T, K, S, R, preferentially T

X3 represents T, S, G, preferentially T

X4 represents S, N, T, K, E, R, P, N, A preferentially S conserved region' 2, the non mutated conserved region 2 comprising the a ino acid sequence defined below:

Q-S-Xl -D-I-X2-X3-G-V-X4 wherein

XI represents P, Q, A, S, preferentially P X2 represents A, N, Q, S, F, preferentially N

X3 represents V, Q, Y, R, M, N, preferentially Q

X4 represents K, D, A, N, T, S, E, preferentially D conserved region 3, the non mutated conserved region 3 comprising the amino acid sequence defined below X1-G-A-G-D-Q-G-X2 wherem

XI represents Q, A, I, V, E, T, preferentially Q

X2 represents L, I, S, V, M, preferentially L conserved region 4, the non mutated conserved region 4 comprising the amino acid sequence defined below:

X1-I-X2-X3-X4-H-X5-X6 wherein

XI represents S, P, T, A, preferentially P

X2 represents A, T, W, Y, F, S, N preferentially T X3 represents M, Y, L, V preferentially Y

X4 represents S, A, preferentially A

X5 represents K, R, E, D, preferentially R

X6 represents L, I, preferentially L conserved region 5, the non mutated conserved region 5 comprising the a ino acid sequence defined below

X1-L-X2-X3-D wherein

XI represents W, F, Y, V, E preferentially W

X2 represents R, G, L, K, preferentially R

X3 represents P, L, H, V, preferentially P conserved region 6, the non mutated conserved region 6 comprising the amino acid sequence defined below.

X1-X2-X3-S-X4-Q-H

In wMch

XI represents V, I, preferentially V X2 represents V, L, I, preferentially V

X3 represents V, L, I, M, preferentially L

X4 represents T, V, A, S, H, preferentially T conserved region 7, the non mutated conserved region 7 comprising the amino acid sequence defined below: X1-N-P-X2-G-X3-F

In wMch

XI represents V, I, preferentially I

X2 represents T, G, S, preferentially T

X3 represents R, T, Q, K, S, preferentially R conserved region 8, the non mutated conserved region 8 comprising the amino acid sequence defined below.

X1-X2-G-X3-P-X4-X5

In Mch

XI represents T, V, I, Y, E, preferentially V X2 represents V, I, L, N, preferentially I

X3 represents G, S, preferentially G

X4 represents M, I, Q, A, H, D preferentially M

X5 represents G, S, A, H preferentially G conserved region 9, the non mutated conserved region 9 comprising the amino acid sequence defined below.

X1-X2-D-T-Y-G-G wMch

XI represents M, I, preferentially I

X2 represents V, I, preferentially I

conserved region 10, the non mutated conserved region 10 comprising the amino acid sequence defined below.

K-V-D-R-S-X1-X2

InwMch

XI represents A, G, preferentially A X2 represents A, S, L, preferentially A conserved region 11, the non modified conserved region 11 comprising the amino acid sequence defined below:

X1-X2-Q-X3-X4-Y-A-I-G-X5-X6 wMch XI represents L, E, I, Q, T preferentially E

X2 represents V, I, L preferentially I

X3 represents V, L, I preferentially V

X4 represents A, S preferentially S

X5 represents V, I, R, K, A preferentially V X6 represents A, V, T, S, preferentially A 8. The method as claimed in claim 7, wherein the modified S- adenosyhnetMomne synthetase with decreased activity comprises at least one of the following mutations and combinations thereof: the conserved serine in conserved region 1 is replaced with another amino acid, preferentially with a asparagine, the conserved glycme in conserved region 2 is replaced with another amino acid, preferentially with a serine, the conserved glycine in conserved region 3 is replaced with another amino acid, preferentially with a serine, the conserved Mstidine and/or semiconserved proline in conserved region 4 is replaced with another arrtino acid, preferentially the conserved Mstidine with a tyrosine and/ or the conserved proline with a leucine, the semi-conserved arginine in conserved region 5 is replaced with another amino acid, preferentially with a cysteine, the conserved Mstidine and/or semi-conserved valine in conserved region 6 is replaced with another amino acid, preferentially the conserved Mstidine is replaced with a tyrosine and/or the valine with aspartate, the semi-conserved tMeomne in conserved region 7 is replaced with another amino acid, preferentially with an isoleucine, the conserved proline in conserved region 8 is replaced with another amino acid, preferentially with a serine, the second conserved glycine in conserved region 9 is replaced with another amino acid, preferentially with a aspartate, the conserved serine in conserved region 10 is replaced with another arnino acid, preferentially with a phenylalanine, and the conserved isoleucine in conserved region 11 is replaced with other amino acids, preferentially with a leucine. 9. The method as claimed in claim 8, wherein the modified region 1 comprises the amino acid sequence G-E-I-T-T-N and/or the modified conserved region 2 comprises the amino acid sequence Q-S-P-D-I-N-Q-S-V-D and/or the modified conserved region 3 comprises the amino acid sequence Q-S-A-G-D-Q-G-L and/or the modified conserved region 4 comprises the amino acid sequence selected among P-I-T- Y-A-Y-R-L, L-I-T-Y-A-H-R-L and L-I-T-Y-A-Y-R-L, and/or the modified conserved region 5 comprises the amino acid sequence W-L-C-P-D and/or the modified conserved region 6 comprises the amino acid sequence selected among V-V-L-S-T-Q-Y, V-D-L-S- T-Q-H and V-D-L-S-T-Q-Y, and/or the modified conserved region 7 comprises the amino acid sequence I-N-P-I-G-R-F and/or the modified conserved region 8 comprises the amino acid sequenc V-I-G-G-S-M-G and/or the modified conserved region 9 comprises the amino acid sequence I-V-D-T-Y-G-D and/or the modified conserved region 10 comprises the amino acid sequence K-V-D-R-F-A-A and/or the modified conserved region 11 comprises the amino acid sequence E-I-Q-V-S-Y-A-L-G-V-A 10. The method as claimed in any one of claims 1 to 9, wherem the modified microorgamsm is selected among prokaryotes and eukaryotes, preferentially under prokaryotes and more specifically Escherichia coli or Corynebacterium glutamicum. 11. A mutated homoserine transsuccinylase with reduced sensitivity for the feedback inMbitors S-adenosylmetMomne and metMomne as defined in any one of clam s 2 to 5. 12. A nucleotide sequence encoding a mutated homoserine transsuccinylase with reduced sensitivity for the feedback inMbitors S-adenosylmetMomne and metMomne as defined in claim 11 13. A mutated S-adenosyhnetMomne synthetase as defined in one of claims 6 to 9. 14. A nucleotide sequence encoding a mutated S-adenosylmethiomne synthetase as defined in claim 13. 15. A microorganism comprising a DNA sequence coding for a mutated homoserine transsuccinylase with reduced sensitivity for the feedback inMbitors S- adenosylmetMonine and metMomne as defined m claim 14. 16. The microorgamsm as claimed in claim 15, further comprising a nucleotide sequence encoding a mutated S-adenosylmetMomne synthetase as defined in claim 13. 17. The microorgamsm of claim 15 or 16, wherein the microorgamsm is selected among prokaryotes and eukaryotes, preferentially under prokaryotes and more specifically Escherichia coli or Corynebacterium glutamicum. 18. The microorgamsm of one of claims 15 to 17, wherem the gene encoding aspartokinase/homoserine dehydrogenase is over expressed and/or the gene encoding metMonine repressor meU is deleted.