WO2005108986A1

WO2005108986A1 - A diagnostic method of asthma using baff as a diagnostic marker

Info

Publication number: WO2005108986A1
Application number: PCT/KR2005/001348
Authority: WO
Inventors: Eun-Yi Moon; Hwan-Mook Kim; Jong-Soon Kang; Song-Kyu Park; Kwan-Hyoung Kim
Original assignee: Korea Research Institute Of Bioscience And Biotechnology
Priority date: 2004-05-10
Filing date: 2005-05-09
Publication date: 2005-11-17

Abstract

The present invention relates to a method for diagnosing allergic disease using BAFF (B cell activating factor). More particularly, the present invention relates to a method for diagnosing asthma using an antibody specifically recognizing BAFF in blood collected from allergic disease patients as a diagnostic marker. The diagnostic method makes it possible to diagnose asthma early and follow the prognosis of diseases using BAFF together with the existing diagnostic markers of immune diseases and provides a very useful way which can be widely applied to diagnostic and therapeutic agents against these diseases.

Description

A" DIAGNOSTIC METHOD OF ASTHMA USING BAFF AS A DIAGNOSTIC MARKER

Technical Field The present invention relates to a method for diagnosing asthma using a B cell activating factor (BAFF). The present invention further relates to a method for evaluating a pharmaceutical composition for the prevention and treatment of asthma by using BAFF as a diagnostic marker.

Background Art Immunity is that an individual has strong resistance against certain pathogen or toxins. Specifically, it is a mechanism to prevent the in vivo environment from being disturbed by exogenous and endogenous foreign substances and thus to maintain the individuality and homeostasis of the living body. Accordingly, an immune response causes defensive response in vivo on recognizing the encountered foreign substance as an antigen. The immune response is broadly divided into an allergic response (tissue disorder caused by the immune response) and an autoimmune response. The allergic response causes tissue disorder in the body by an immune response adversely affecting the in vivo defense. That is, an antigen enters the body to cause an immune response and then an antigen enters again to cause the secondary reaction adversely affecting the in vivo defense, which is an allergic response. The allergic responses include hypersensitivities by chronic inflammation and environmental allergens by IgE, which are called " allergic diseases." Examples include asthma, atopy, and the like. Meanwhile, it has been believed for a long time that a living body does not cause an immune response against the components thereof. However, it was found later, contrary to this fundamental thought, that the living body causes immune responses also against the components thereof. That is called " autoimmune diseases." The autoimmune diseases include inflammatory responses caused by the formation of an Ag-Ab complex by IgG. Examples include rheumatic arthritis, systemic lupus erythematosus, Sjorgen's syndrome, and type I diabetes. The autoimmune diseases and the allergic diseases are distinguished from each other by characteristics in Table 1. Table 1

A cell group involved in immunity consists of lymphatic cells, serum cells, reticuloendothelial cells and myeloid cells, in which the lymphatic cells are further divided into T cells, B cells and NK cells. Among them, the T cells consist of Thl and Th2 cells which are balanced in healthy persons. However, if the balance between the Thl and Th2 cells is upset due to environmental factors, immune diseases will occur. For example, bacterial or viral infection can change T-cell balance toward Thl cells to cause autoimmune diseases, and on the contrary, parasitic infection changes T-cell balance toward Th2 cells to cause allergic diseases. Asthma, which is a disease characterized by the hypersensitivity of the airway to various irritations, involves clinical symptoms, such as wheezing, shortness of breath, and coughing, and can be improved naturally or reversibly by treatment. Most asthma is an allergic disease by IgE and characterized by chronic airway inflammation and bronchial hyperresponsiveness. Allergic asthma patients are known to form 10% of the world population (i.e., 275,000,000 persons in 1995), and it is reported that 17,000,000 persons in USA suffer from asthma and 5,000,000 persons among them are young boys and girls. It is reported that the market of therapeutic agents for allergic asthma in USA was about 6,400,000,000 dollars in 2000 and the market scale in Korea was about 1,000,000,000 dollars which is about 20% of the market scale of overall medical drugs in Korea. Asthma can be grouped as exogenous asthma and endogenous asthma based on its cause. The exogenous asthma refers to an asthma whose symptoms appear when exposed to a causative antigen. It usually shows a positive response to a skin test or bronchial provocation test against the causative antigen and occurs generally in a young age group. House dust and mites are the most frequent causative antigens, and in addition, pollens, animal epithelium, molds also act as the causative antigens. The endogenous asthma is caused or becomes worse by upper air infection, exercise, emotional unrest, cold climate and humidity change and can be frequently seen in adult group. Moreover, Ostergaard classified two type of asthma, extrinsic IgE-mediated and intrinsic non-IgE-mediated asthma (Ostergaard, P. A., Non-IgE-mediated asthma in children, Ada Paediatr Scand, 1985, 74: 713-719). Recently, Corrigan reviewed that intrinsic or non-atopic asthma raised the possible role of IgE-mediated mechanism in asthma pathogenesis (Corrigan, C, Mechanisms of intrinsic asthma, Cυrr Opin Allergy Clin Immunol, 2004, 4: 53-56). Until now, it is little known what is the cause of non-IgE-mediated asthma. In addition, examples of asthma include drug-induced asthma, exercise-induced asthma, occupational asthma, etc. B-cell activating factor (BAFF) is one of the tumor necrosis factor (TNF) family members. And it is also known as BLys(B lymphocyte stimulator), TNF homologues activating apoptosis (THANK, NF-K and JNK), TNF, or ApoL-related leukocyte expression ligand-1 (TALL-1), zTNF4, and TNF family ligand (Schneider, et al., /. Exp. Med. , 189(11) ppl747-1756, 1999). BAFF is a key regulator of B- lymphocyte development. BAFF is required to generate and maintain the mature B cell pool. Its biological role is mediated by the specific receptors, B cell maturation Ag (BCMA), transmembrane activation and calcium modulator and cyclophylin ligand interactor (TACI) and BAFF receptor (BAFF-R) (Yan, M. , et al, Identification of a novel receptor for B lymphocyte stimulator that is mutated in a mouse strain with severe B cell deficiency, Curr Biol, 2001, 11: 1547-1552). BAFF-deficient mice reveal an almost complete loss of follicular and marginal zone B lymphocytes. BAFF-transgenic mouse shows a breakdown of B cell tolerance and leads to a systemic lupus erythematosus (SLE)-like condition (Mackay, F., et al, Mice transgenic for BAFF develop lymphocytic disorders along with autoimmune manifestations, J Exp Med, 1999, 190: 1697-1710). Lots of reports also mentioned that BAFF levels were high in human serum from autoimmune disease such as rheumatic arthritis, autoimmune diabetes, Sjogren syndrome and multiple sclerosis (Zouali, M., B cell diversity and longevity in systemic autoimmunity, Mol Immunol, 2002, 38: 895-901). Also, BAFF activity was observed on naive, as well as on effector/memory T cells. Recombinant BAFF induced responses (thymidine incorporation and cytokine secretion) of T cells, suboptimally stimulated through their TCR. BAFF-R is able to deliver a complete co-stimulation signal into T cells. Bacterial products up-regulates BAFF production in T cells and a low level of BAFF transcription, up-regulated upon TCR stimulation, was also detected in T cells. BAFF may regulate T cell immunity during APC- T cell interactions and as an autocrine factor once T cells have detached from the APC. Putting these study results together, BAFF is known to be related with immune diseases, particularly autoimmune diseases. However, before beginning of studies by the inventors of the present application there was no found correlation between BAFF and allergic disease. The diagnosis of asthma has been performed by auscultation, chest X-ray, electrocardiogram, and pulmonary function test. Asthma-induced factors were detected by skin response test of applying to the skin a certain factor suspected as an allergen or RAST test of detecting an allergic factor in extracted serum. Also, in exogenous asthma, the level of total IgE in serum is increased and antigen-specific IgE is detected. Currently, bronchodilators and steroid preparations are used as therapeutic agents against asthma, but known to have serious side effects since studies on these drugs were not sufficiently made.

Summary of the Invention The present inventors first found the correlation between BAFF and allergic diseases, particularly asthma. The present invention provides a method for diagnosing allergic diseases, which is characterized by using BAFF (B cell activating factor) as a diagnostic marker of allergic diseases. The present invention further provides a pharmaceutical composition for the prevention or treatment of allergic diseases, which is characterized by using BAFF (B cell activating factor) in the evaluation of the composition. Moreover, in one specific embodiment, the present invention provides a method for diagnosing allergic diseases by separating serum from blood and measuring the level of BAFF in the serum by ELISA assay. In another specific embodiment of the invention, the measurement of the level of BAFF is performed by the steps of: adding the separated serum and recombinant human BAFF as a comparative reference to an ELISA plate coated with an anti-BAFF antibody and standing the added substances on the plate for a given time; adding a biotinylated anti-BAFF secondary antibody to the plate and standing the secondary antibody for a given time; and color-developing the mixture with a detection solution and determining the level of BAFF by the degree of the color development . In further another embodiment, the present invention provides a diagnostic kit or diagnostic pharmaceutical composition comprising: an ELISA plate coated with an anti-BAFF antibody; a separated serum; recombinant human BAFF as a comparative reference; a biotinylated anti-BAFF secondary antibody; and detection solution. In the present invention, the allergic diseases include asthma and atopy, particularly asthma.

Description of Drawings Fig. 1 shows the measurement results of the level of BAFF in the blood of asthmatic patients. 180 serum samples were collected from asthmatic patients of three different hospitals. BAFF levels were measured by enzyme-linked immunosorbent assay (ELISA). As a result, BAFF level increased in serum of asthmatic patients. BAFF levels were grouped into three concentrations (low, medium and high). Fig. 2 shows the relationship of BAFF and IgE concentration. BAFF and IgE levels in asthmatic patient serum were measured by ELISA. Relationship was analyzed by Origin-linked analysis.

Samples were grouped into three concentration of BAFF and high concentration of IgE, high concentration of BAFF and high concentration of IgE, and high concentration of BAFF and low concentration of IgE. Fig. 3 shows the relationship of BAFF and FEV1(%)[FEV1 (%) was analyzed by polynomial fit in Origin 6.0 software]. Fig. 4 shows the relationship of BAFF and PC20[PC20 was analyzed by polynomial fit in Origin 6.0 software]. Fig. 5 through fig. 9 show analysis data of B and T cells by flow cytometer. Cells were prepared from asthmatic patient blood samples and stained with PE-conjugated anti-CD3 and FITC-conjugated anti-CD19 antibodies. BAFF receptor, TACI was stained with biot in-labelled anti TACI antibody and PE-conjugated streptavidin. Cells were analyzed with flow cytometer Fig. 5. Analysis of cells by flow cytometer. Fig. 6. Relationship of BAFF and the percentage of T cell. Fig. 7. Relationship of BAFF and the percentage of B cell. Fig. 8. Relationship of BAFF and T to B cell ratio(which was analyzed by polynormial fit in Origin 6.0 software). Fig. 9. Graph for plotting ratio of T cells to B cells of each patient for group I, II, III and IV according to the level of BAFF and IgE in Fig. 1. Fig. 10 through fig. 15 show analysis data of B and T cells by flow cytometer. Cells were prepared from asthmatic patient blood samples and stained with PE-conjugated anti-CD3 and FITC-conjugated anti-CD19 antibodies. Cells were analyzed with flow cytometer. Fig. 10. Analysis of cells by flow cytometer. Fig. 11. Detection of TACI expression by RT-PCR. Fig. 12. Relationship of BAFF and the percentage of CD19⁺TACI\ Fig. 13. Relationship of BAFF and the percentage of CD19⁺TACI^". Fig. 14. Relationship of BAFF and ratio of TACI⁺ CD19⁺ to TACrCD19⁺[which was analyzed by polynomial fit in Origin 6.0 software] . Fig. 15. Graph for plotting ratio of TACI⁺ CD19⁺ to TACI^" CD19⁺ of each patient for group I, II, III and IV according to the level of BAFF and IgE in Fig. 1. Fig. 16 and fig. 17 show Changes of cell proliferation by BAFF. B cells were purified from inflammatory tonsil and peripheral blood mononuclear cells (PBMC) were prepared from healthy volunteer donor blood. Cells were stimulated with phytohemmagglutin A (PHA) in the presence of 50 or 100 ng/ml BAFF for 48 hours. Cells were pulsed with lμ Ci [3H]-thymidine for 6 hours and collected with cell harvester. Radioactivity was measured with beta-scintillation counter. Fig. 18 shows the reduction of Serum BAFF level after the treatment with anti-asthmatic agent. Serum samples were collected before and 3-6 months after the treatment anti-asthmatic agent from same patients. BAFF level was measured by ELISA.

Disclosure of Invention The present invention relates to a method for diagnosing a allergic diseases using BAFF (B cell activating factor), which allows the onset of allergic diseases to be diagnosed by separating serum from blood and measuring the level of BAFF in blood by ELISA assay. The diagnostic method according to the present invention can be used for evaluating a pharmaceutical composition for the prevention or treatment of allergic diseases, including asthma, using BAFF as a diagnostic marker. Also, the present invention relates to a diagnostic kit or diagnostic pharmaceutical composition comprising: an ELISA plate coated with an anti-BAFF antibody; a separated serum; recombinant human BAFF as a comparative reference; a biotinylated anti-BAFF secondary antibody; and detection solution. Based on the different immuno-pathological mechanism between autoimmune disease, which is Inflammation by the formation of Ag-Ab complex by IgG and allergic disease such as asthma, which is hyperresponsiveness to environmental allergen and chronic inflammation by IgE, the inventors studied serum BAFF concentration and the changes of cellular phenotype of immune cells from asthma patients, which are a key regulator of B-lymphocyte development. Serum and peripheral blood mononuclear cells (PBMC) were collected from 103 patients. The inventors analyzed the level of BAFF with ELISA and the expression of BAFF receptor with flow cytometry. Serum BAFF level in 78 out of 103 patients was augmented compared to normal serum. The present inventors have analyzed the correlation between the level of BAFF and the changes of the expression level of various BAFF receptors, BAFF-R, TACI and BCMA in CD3+ or CD19+ cells, and as a result, found that BAFF is involved in asthma caused by various factors, thereby completing the present invention. BAFF versus IgE, FEV1 ( ) and PC20 The inventors determined classic parameters of asthma such as IgE, FEV1 (%) and PC20 for each patient when collected blood samples. The relationship of BAFF and those parameters was analyzed by polynomial fit in software Origin 6.0. As shown in Fig. 2, the correlation between the expression level of BAFF and the expression level of IgE in IgE-dependent and IgE-independent immune diseases was assayed, and as a result, the concentration of IgE in blood was increased with an increase in the concentration of BAFF (see FIG. 2). Even in patients with low IgE concentration, BAFF was detected at a higher concentration than the normal level. Thus, it was found that BAFF can be a new diagnostic marker in asthma and can used as a diagnostic marker of IgE-dependent and IgE- independent immune diseases. The inventors classified patients into four groups (group I, high IgE and low BAFF; group II, high IgE and high BAFF; group III, high BAFF and low IgE; group IV, low BAFF and low IgE). Asthma patients usually show high level of IgE and airway hyper- responsiveness. This is affirmed by the result of that BAFF level was correlated with FEV1 (%) and PC20 (Fig 3 and 4). In the meanwhile, some patients have low level of IgE but still show high sensitiveness of airway like group III (Fig. 1). Asthma in group III could be explained and diagnosed by high BAFF level in serum. It suggests that BAFF is a novel parameter to be able to explain the airway hyper-responsiveness of non-IgE-mediated asthma.

Phenotyping BAFF receptors of PBMC To study the changes of immune cell responsiveness in asthma, the inventors collected 50 asthma patient peripheral blood samples and mononuclear cells were purified by Ficoll-Hypaque density gradient method. B and T cells were incubated with anti-CD19 and anti-CD3 antibodies, respectively. CD3⁺ T cells and CD19⁺ B cells were analyzed by flow cytometry (Fig. 5). BAFF level was correlated with the percentage of T cells and inversely related with the percentage of B cells (Fig. 6 and 7). Patients with low BAFF level show a low T to B cell ratio, vice versa for patients with high BAFF level (Fig. 8 and 9). To test the changes of BAFF receptors, PBMC cells from asthma patients were incubated with BAFF receptor (BAFF-R, TACI and BCMA) antibodies in the presence of anti-CD3 or anti-CD19 antibodies. The expression of BAFF receptors in CD3⁺ and CD19⁺ cells were analyzed by flow cytometry. The inventors found the changes of TACI in CD19⁺ B cells (Fig. 10). The inventors also detected the strong expression of BAFF-R on B cell and the weak expression on T cell with flow cytometry analysis. TACI expression in PBMC was also detected by RT-PCR (Fig. 11). While BAFF concentration was inversely correlated with the percentage of CD19⁺ B cells with TACI expression, it was correlated with the percentage of CD19⁺ B cells without TACI expression (Fig. 12 and 13). Patients with low BAFF level shows high ratio of TACI⁺ CD19⁺ to TACI^" CD19⁺ and vice versa for patients with high BAFF (Fig. 14 and 15). Data implicated that asthma could be regulated by TACI expression on B cells, which is tightly regulated by serum BAFF level. Based on the result of that serum BAFF level was high in non-IgE-mediated asthma, it also suggest that BAFF might play a role for both IgE-mediated and non-IgE-mediated asthma. Although the inventors donot know the role of TACI expression on B cells in asthma, TACI in CD19⁺ cells may be expected to regulate B cell responsiveness or to induce airway hyper-responsiveness in asthma patient through binding BAFF.

Effect of BAFF on Tonsi liar B cells and PBMC To confirm the effect of BAFF on asthma patient, the inventors purified B cells from human tonsil and PBMC from peripheral blood from asthma patient. Cells were treated with various concentration of BAFF then incubated for 48 hours. As shown in Fig. 16, B cell proliferation was reduced by the treatment of BAFF in the absence of PHA co-stimulation. However, BAFF shows the stimulatory effect on T cell proliferation (Fig 17). As PBMC comprise a majority of T cell, PBMC proliferation can be interpreted as T cell proliferation. Data were consistent with the increased T cell ratio following the increase of serum BAFF level (Fig. 6). It has to be clarified the mechanism of action on BAFF- mediated T cell responses.

BAFF level decreased after the treatment with anti- asthmatic drugs Serum samples were collected from the same patient before and 3-6 months after the treatment with anti-asthmatic drugs. BAFF level of 8 patients were measured by ELISA and compared between before and after the treatment. Serum BAFF level in the same patients was lowered by the treatment with anti-asthmatic drugs (Fig. 18). Clinically, patients with lowered BAFF level showed less severe symptom of asthma. Therefore, it suggests that BAFF could be a novel parameter to monitor the severity of asthma symptom. As described above, asthma is an allergic disease mediated by producing various cytokines such as IL-4 and IL-10 from Th2 cells. Herein, the inventors determined the level of BAFF in asthma patient serum. 78 out of 103 patients are above normal BAFF level of human. This trend was almost identical between three different hospitals. It was reported that BAFF functions in class switching recombination (CSR) for the production of immunoglobulin E (IgE) (Huard, B., et al, BAFF production by antigen-presenting cells provides T cell co-stimulation, Int Immunol, 2004, 16: 467- 475). Here the inventors found that BAFF level^* is correlated with IgE concentration in asthma patient serum but inversely correlated with PC20 and FEV1 (%). It suggests that BAFF is a better parameter than IgE to diagnose asthma including non-IgE-mediated asthma. High BAFF level in serum was reflected to the high and low percentage of CD3⁺ T and CD19⁺ B cells, respectively. Although TACI in B cells are various from patient to patient, there is relationship for the ratio of TACI⁺ CD19⁺ to TACI^" CD19⁺ B cells and CD3⁺ T to CD19⁺ B cells with BAFF. The inventors demonstrate that group II having high BAFF and high IgE level show the low ratio of TACI⁺ CD19⁺ to TACI^" CD19⁺ B cells and high CD3⁺ T to CD19⁺ B cell ratio. In addition, the patient group III having high BAFF and low IgE also show the low ratio of TACI⁺ CD19⁺ to TACI^" CD19⁺ B cells and low CD3⁺ T to CD19⁺ B cell ratio. It suggests that BAFF regulates the production of IgE through TACI- ediated control of B cells. These data is supported by the previous report that CSR can be regulated by the expression of TACI (Huard, B. , et al, BAFF production by antigen-presenting cells provides T cell co- stimulation, Int Immunol, 2004, 16: 467-475). In the meanwhile, high BAFF is correlated with high percentage of CD3⁺ T cells. This implicates that there is any change of T cell function with BAFF level augmentation. As the majority of cells are usually T cells in PBMC, PBMC proliferation increased by the addition of BAFF into culture media demonstrate that BAFF is a positively acting molecule in T cells. This is consistent with the previous reports that BAFF may play a role as a co-stimulatory molecule in T cells. BAFF activity was observed on naive, as well as on effector/memory T cells. Recombinant BAFF induced T cell functions, suboptimally through their TCR. A low level of BAFF transcription, up-regulated upon TCR stimulation, was also detected in T cells. BAFF may regulate T cell immunity during APC-T cell interactions and as an autocrine factor once T cells have detached from the APC. These data suggest that CD3⁺ T cells and CD19⁺ B cells may communicate each other through BAFF receptors, BAFF-R or TACI. In other words, BAFF acts like a bridge for the communication between T and B cells. The role of TACI is not clarified on T and B cells. As a preliminary examination, the inventors detected TACI expression in PBMC with RT-PCR. The inventors tested the function of exogenously added BAFF on B and T cell proliferation with tonsillar B cells and PBMC, respectively. Tonsillar B cell proliferation was reduced by the addition of BAFF and PBMC proliferation was increased by the addition of BAFF. The fact that the percentage of TACI⁺ CD19⁺ B cells was reduced following the increase of BAFF concentration demonstrated that TACI on B cells could play a role as a negative regulator. The inventors also detected the high expression of BAFF-R and very low expression of TACI on T cells with flow cytometry analysis. However, it is also required to be defined the function of TACI on T cells. In asthma, the function of each BAFF receptor has not been clarified yet but herein at least the function of TACI is different between T cells and B cells. It was reported that T cell activation was mediated by the receptors BAFF- R or TACI on T cells, and BAFF play a role as a co-stimulator in the activation of T cells. In conclusions, it suggests for the first time that BAFF could be a novel parameter to diagnose asthma including non-IgE-mediated symptom. Hereinafter, the present invention will be described in more detail by examples. It is to be understood, however, that these examples are provided for illustrative purpose only and are not construed to limit the scope of the present invention.

Example Separation of serum from asthma patients After IRB-approved informed consent, blood was drawn in heparinized tubes for the purification of PBMC and in non- heparinised tubes for the separation of serum from patients with respiratory function-verified asthma who were either untreated or at least one month post-chemotherapy.

Reagents The following reagents were obtained from commercial sources. Anti-human BAFF receptor (BAF-R) antibodies, biot in-labeled anti- human BCMA antibodies and biot in-labeled anti-human TACI antibodies were purchased from R&D systems (Minneapolis, MN). PE-conjugated anti-CD3 antibodies, FITC-conjugated anti^~CD19 antibodies, streptavidin-FITC and streptavidin-PE were purchased from BD biosciences (San Jose, CA).

Cell purification and cultures Tonsillar B cells were prepared from inflamed human tonsil as previously described. (Roschke, V., et al, BLyS and APRIL form biologically active heterotrimers that are expressed in patients with systemic immune-based rheumatic diseases, J Immunol, 2002, 169: 4314-4321) Tonsil was teased with 3 ml syringe plunger and tonsillar cells were separated by density gradient centrifugation over Histopaque 1077 (Sigma Chemical Co., St. Louis, M0). After cells were washed three times with RPMI 1640 medium, B cells were separated by resetting T cells with sheep erythrocytes. Monocytes were partially depleted by adhering to plastic dishes. More than 95 % of B cells were CD19-positive. PBMC cells were isolated by density gradient centrifugation over Histopaque 1077 (Sigma Chemical Co., St. Louis, M0). Cells were cultured in the presence or absence of phytohemmaglutinin (PHA) in RPMI 1640 media (GIBC0, Rockville, MD) supplemented with 10 % fetal calf serum, 50 u M 2-mercaptoethanol , 2 mM L-glutamine, 10 mM Hepes pH 7.4, 100 U/mL penicillin, and 100 units/ml streptomycin (Sigma Chemical Company, St. Louis, M0) at 37^°C and 5% C0₂ in air. Cells were pulsed with 1 u Ci/well of [³H]- thymidine (113 Ci/nmol, NEN, Boston, MA) for 4-6 hours and collected on nitrocellulose filter with automated cell harvester (Inotech, Dottikon, Switzerland). Then, the amount of [³H]- thymidine incorporated into cells was measured as cpm by a Wallac Microbeta scintillation counter (Wallac, Turku, Finland).

Enzyme-linked immunosorbent assay (ELISA) for BAFF and IgE BAFF or IgE concentration was measured by ELISA. 100 μi of anti-BAFF (R&D system, Minneapolis, MN) or anti-IgE antibodies (Bethyl laboratories, Montgomery, TX) diluted in diluent [1 % bovine serum albumin (BSA) in phosphate-buffered saline (PBS), pH 7.4] were transferred to an ELISA plate and incubated overnight at room temperature. Plate was washed twice with washing buffer (0.05 % Tween 20 in PBS, pH 7.4) and blocked with blocking solution (1 % BSA, 5% sucrose and NaN₃ in PBS) for 1 hour, then washed twice with washing buffer. Serum from asthma patient was diluted 5 times and added 50 μi to BAFF-coated ELISA plate. After 2 hour- incubation at 37 °C, plate was washed twice with 300 μi of PBS and 100 μi of biot in-conjugated BAFF or IgE antibodies (R&D system, Minneapolis, MN) were added then incubated for 2 hours at room temperature. After washing plate twice with 300 μi of PBS, 100 μi of a 1:200 dilution of streptavidin-conjugated horseradish peroxidase (HRP) (R&D system, Minneapolis, MN) was added and incubated for 20 minutes at room temperature. Substrate for HRP was 100 μi of a 1:1 mixture of color reagent A (H₂O₂) and color reagent B [tetramethylbenzidine (TMB)] (R&D system, Minneapolis, MN). After 20 minute incubation, 50 μi of 1M H₂SO₄ was added to stop reaction. Absorbance was measured at 450 nm. Flow Cytometry Analyses PBMC (1-10 x 10⁵) were suspended in 2 % FCS containing Hank' s balanced salt solution (HBSS) and incubated with PE- conjugated anti-CD3 or FITC-conjugated anti^~CD19, bot in-conjugated anti-BCMA, biotin-conjugated anti-TACI and anti-BAFF-R antibodies for 20 min on ice. Cells were washed with HBSS and incubated with PE- or FITC conjugated streptavidin for 30 min on ice. Cells were washed with HBSS and analyzed by CELLQuest™ software in FACScalibur™ (Becton Dickinson).

RT-PCR RNA was isolated from PMBC using TRIZ0L (Invitrogen, Carlsbad, CA). cDNA was synthesized from 1 μg of total RNA, using oligo dTj.8 primers and superscript reverse transcriptase in a final volume of 21 μi (Bioneer, Taejeon, Korea). For standard PCR, one μi of the first strand cDNA product was then used as a template for PCR amplification with Taq DNA polymerase (Bioneer, Taejeon, Korea). PCR amplification proceeded as follows: 35 thermocycles of 94 °C for 1 minute, 55^°C for 1 minute, and 72^°C for 1 minute, using oligonucleotides specific for hTACI (sense; atgagtagcctgggccggac, antisense; cacctgatctgcactcagcttcagc) and β -actin (sense; ggatccgacttcgagcaagagatggccac, anti-sense; caatgccagggtacatggtg) . Analyses of correlation between parameters Data from FACS were analyzed with software WinMDI (version 2.8). Relationship between BAFF from ELISA and IgE, PC20, FEV1 (%) and percentage of each cell population from FACS was analyzed by software Origin 6.0.

Measurement of PC20 (Provocation Concentration 20) in asthmatic patients In order to analyze the correlation between the level of BAFF in serum and PC20, methacholine was inhaled into patients and then PC20, the concentration of methacholine causing a 20% reduction in forced expiratory volume in 1 sec (FEV1) was measured with a pulmonary function test system. The measurement of PC20 was performed by measuring the pulmonary function of the patients with the a pulmonary function test system, regarding the measured value as 100%, inhaling methacholine five times at the lowest concentration with a sprayer by normal breathing, and performing pulmonary function test. After methacholine was inhaled five times at two-fold increased concentration for each pulmonary function test, the pulmonary function test was repeated until the pulmonary function was reduced by 20% (i.e., reached 80% of the initial pulmonary function). The concentration of methacholine which caused a 20% fall in the pulmonary function by this procedure was recorded as PC20. As described above, the inventive method for diagnosing allergic diseases using BAFF allows the early diagnosis of asthma and the like. Also, the inventive method can be used not only in the evaluation of activity in developing substances capable of inhibiting the expression or activity of BAFF but also in the preparation of medical drugs for the prevention or treatment of allergic diseases.

Claims

What Is Claimed Is:

1. A method for diagnosing allergic disease using a B cell activating factor (BAFF) as a diagnostic marker of the allergic disease, the method comprising the steps of: separating 150 μl of serum from a blood sample collected from allergic disease patients; adding 50 μl of the serum to a BAFF-coated ELISA plate, incubating the added serum at 37 °C for 2 hours, and washing the plate twice with 300 μl of PBS; adding 100 μl of a biotin-conjugated BAFF antibody or IgE antibody to the plate, incubating the mixture at room temperature for 2 hours, and washing the plate twice with 300 μl of PBS; adding 100 μl of a 1:200 dilution of streptavidin- conjugated horseradish peroxidase (HRP) to the plate and incubating the mixture at room temperature for 20 minutes; and adding to the plate 100 μl of a detection solution consisting of a 1:1 mixture of color reagent A (H2O2) and color reagent B [tetramethylbenzidine (TMB)], incubating the mixture at room temperature for 20 minutes, adding 50 μl of IM H₂SO₄ to the plate, and measuring the absorbance at 450 nm by flow cytometry.

2. The method according to claim 1, wherein the BAFF is used as a diagnostic marker of allergic diseases caused by IgE.

3. The method according to claim 1, wherein the BAFF regulates the production of IgE by the TACI-mediated regulation of B cells.

4. The method according to claim 1, wherein the allergic disease is asthma.

5. A method for diagnosing allergic disease using BAFF as a diagnostic marker of the allergic disease, the method comprising the steps of: separating serum from a blood sample of patients with allergic disease; and measuring the level of BAFF in the serum by ELISA assay using a BAFF antibody.

6. The method according to claim 5, wherein the allergic disease is asthma.