WO2005108563A2 - Peptidoglycan-hydrolyzing protein encoded by bacteriophage n4 - Google Patents

Peptidoglycan-hydrolyzing protein encoded by bacteriophage n4 Download PDF

Info

Publication number
WO2005108563A2
WO2005108563A2 PCT/US2005/013509 US2005013509W WO2005108563A2 WO 2005108563 A2 WO2005108563 A2 WO 2005108563A2 US 2005013509 W US2005013509 W US 2005013509W WO 2005108563 A2 WO2005108563 A2 WO 2005108563A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nucleic acid
pharmaceutical composition
peptidoglycan
bacteria
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2005/013509
Other languages
French (fr)
Other versions
WO2005108563A3 (en
Inventor
Emina Stojkovic
Lucia B. Rothman-Denes
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Chicago
Original Assignee
University of Chicago
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Chicago filed Critical University of Chicago
Publication of WO2005108563A2 publication Critical patent/WO2005108563A2/en
Anticipated expiration legal-status Critical
Publication of WO2005108563A3 publication Critical patent/WO2005108563A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01092Peptidoglycan beta-N-acetylmuramidase (3.2.1.92)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/20Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00Bacteriophages
    • C12N2795/00011Details
    • C12N2795/10011Details dsDNA Bacteriophages
    • C12N2795/10022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • the present invention relates generally to the fields of molecular biology and bacteriophage genetics. More particularly, it concerns methods and compositions related to a novel peptidoglycan-hyrdolyzing enzyme (an N-acetylmuramidase) encoded by bacteriophage N4 and homologs thereof. 2.
  • Peptidoglycan hydrolases are enzymes that degrade the peptidoglycan, an essential cell wall component of most eubacteria. They are found in the genomes of many species, in particular bacteria and phages. Phage peptidoglycan hydrolases, otherwise known as lysins, are an essential component of phage-encoded systems for lysis of the infected host. Recently, a potential therapeutic role has been described for these enzymes.
  • lysins from several bacteriophages that infect Bacillus anthracis or Streptococcus pneumonie, to their respective bacterial strains in liquid or solid media resulted in cell lysis (Loeffler et al, 2001; Loeffler and Fischetti, 2003; Schuch et al, 2002).
  • a benefit of lysins is the apparent inability of bacteria to develop resistance to these proteins.
  • peptidoglycan-hydrolyzing proteins are not membrane bound, and the lack of an N-terminal signal sequence limits the potential applications for these proteins, which limits the potential applications for these proteins. Therefore, the discovery of a peptidoglycan-hydrolyzing enzyme that can be exported to the periplasm and reach peptidoglycan substrate in an active form would greatly improve the efficacy and utility of the use of the peptidoglycan-hydrolyzing protein in certain applications. For example, if peptidoglycan hydrolase has an N-terminal signal sequence, it would be exported to the periplasm upon expression and would not require additional compounds such as CHC1 3 to facilitate degradation of the peptidoglycan and bacterial lysis.
  • a peptidoglycan-hydrolyzing enzyme would eliminate the need for the external addition of compounds such as lysozyme or the use of French press or sonication for cell lysis during purification of recombinant proteins. Furthermore, if the exported peptidoglycan hydrolase remains membrane-bound and therefore insoluble, contamination of the soluble fraction containing the recombinant protein can be avoided.
  • N4 gp61 possesses a N-terminal signal sequence that is not proteolytically removed upon gp61 export to the periplasm (also referred to as the "transmembrane domain" or “transmembrane region"), and N4 gp61 exhibits a potent ability to lyse bacteria when bacteria express, and/or are contacted with, N4 gp61 (SEQ LD NO:l).
  • the invention provides an isolated nucleic acid sequence encoding a gp61 polypeptide comprising the polypeptide sequence of SEQ LD NO:l or a fragment thereof having peptidoglycan-hydrolyzing activity, h one embodiment of the invention, the nucleic acid is operably linked to a heterologous promoter. Such a promoter may be an inducible promoter.
  • the invention provides an isolated polypeptide comprising the polypeptide sequence of gp61 (SEQ LD NO:l) or a fragment thereof having peptidoglycan- hydrolyzing activity. Also included in the invention are polypeptides that are at least 90, 95 or 99% homologous to the polypeptide sequence of gp61.
  • compositions comprising this and/or the other polypeptides described in accordance with the invention.
  • the compositions may be formulated for treatment of a bacterial disease and may be formulated for topical or intravenous administration.
  • the pharmaceutical compositions may also be further defined as an inhaled pharmaceutical composition.
  • the compositions may comprise at least a second active ingredient, including an anti-infective agent.
  • An example of an anti-infective agent is an antibiotic.
  • the compositions may comprise EDTA.
  • the invention provides a pharmaceutical composition comprising a homolog of gp61 (SEQ LD NO:l) having peptidoglycan-hydrolyzing activity, wherein the homolog is selected from the group consisting of SARO0833 (SEQ LD NO:2), STM0016 (SEQ ID NO:3), STY0016 (SEQ ID NO:4), VV10124 (SEQ ID NO:5), STY1889 (SEQ LD NO:6), VFTML ORF19 (SEQ LD NO:7), BMEI0095 (SEQ ID NO:8), NMB 1012 (SEQ ID NO:9), BPP-1 Bbp2 (SEQ LD NO:10), mlr8035 (SEQ ID NO:ll), ECA2616 (SEQ LD NO:12), NMA1230 (SEQ LD NO:13), and WA0851 (SEQ LD NO:14), including polypeptides having at least 90, 95 or 99% amino acid identity to these polypeptide sequences,
  • the composition may further comprise CHC1 .
  • the invention provides a recombinant host cell transformed with the nucleic acid of claim 1, including sequences hybridizing thereto under stringent conditions. Such a nucleic acid may encode the polypeptide of SEQ ID NO: 1.
  • the cell may be a bacterium, including a Gram-positive or Gram-negative bacterium.
  • the invention provides a method of treating a bacterial disease in a subject comprising administering to the subject a pharmaceutical composition of the invention.
  • the subject is a mammal, including a human.
  • the pharmaceutical composition may be applied topically, administered intranasally, and/or administered intravenously.
  • the composition may further comprise CHC1 3 .
  • the bacterial disease may be caused by a Gram-negative or Gram-positive bacterium.
  • the bacterial disease is caused by salmonella, E. coli, pneumococci, or streptococci.
  • the pharmaceutical composition may comprise EDTA.
  • the invention provides a method for lysing a bacteria comprising contacting the bacteria with gp61 (SEQ ID NO:l) or a fragment thereof having peptidoglycan-hydrolyzing activity. The method may be performed in vitro. The method may further comprise purifying a protein expressed by the bacteria.
  • the protein may be a cytoplasmic protein and may be native to the bacteria, hi certain embodiments, the cytoplasmic protein is heterologously expressed by the bacteria, h the method, the bacterium may be transformed with a nucleic acid encoding gp61 (SEQ ID NO:l) or a fragment thereof having peptidoglycan-hydrolyzing activity and contacting may be achieved by inducing expression of the nucleic acid.
  • the nucleic acid may be chromosomally integrated or extrachromosomal.
  • the nucleic acid may also be operably linked to an inducible promoter, and the expression of the nucleic acid may be induced by activating the inducible promoter.
  • the bacteria may be contacted with exogenously applied gp61 (SEQ LD NO:l).
  • the invention provides a method for lysing a bacteria comprising contacting the bacteria with a gp61 (SEQ ID NO:l) homolog or a fragment thereof having peptidoglycan-hydrolyzing activity, wherein the homolog is selected from the group consisting of SARO0833 (SEQ ID NO:2), STM0016 (SEQ ID NO:3), STY0016 (SEQ LD NO:4), VV10124 (SEQ LD NO:5), STY1889 (SEQ LD NO:6), VHML ORF19 (SEQ ID NO:7), BMEI0095 (SEQ ID NO:8), NMB 1012 (SEQ LD NO:9), BPP-1 Bbp2 (SEQ LD NO:10), mlr8035 (SEQ ED NO:ll), ECA2616 (SEQ ID NO:12), NMA1230 (SEQ ID NO:2), S
  • the invention provides a method for lysing a bacteria comprising contacting the bacteria with a chimeric proteins containing the N-terminus and transmembrane domain of gp61 (SEQ LD NO:l) fused to SARO0833 (SEQ ID NO:2), STM0016 (SEQ ID NO:3), STY0016 (SEQ LD NO:4), VV10124 (SEQ LD NO:5), STY1889 (SEQ LD NO:6), VHML ORF19 (SEQ LD NO:7), BMEI0095 (SEQ LD NO:8), NMB 1012 (SEQ ID NO:9), BPP-1 Bbp2 (SEQ ID NO:10), mlr8035 (SEQ ID NO:ll), ECA2616 (SEQ LD NO:12), NMA1230 (SEQ ED NO:13), and VVA0851 (SEQ ID NO:14).
  • SARO0833 SEQ ID NO:2
  • STM0016 SEQ ID NO:3
  • the invention provides a method for lysing a bacteria by expressing gp61 (SEQ ID NO:l) or chimeric proteins containing the N-terminus and transmembrane domain of gp61 (SEQ ID NO:l) fused to SARO0833 (SEQ BO NO:2), STM0016 (SEQ ID NO:3), STY0016 (SEQ ED NO:4), W10124 (SEQ ID NO:5), STY1889 (SEQ ED NO:6), VHML ORF19 (SEQ ID NO:7), BMEI0095 (SEQ ID NO:8), NMB 1012 (SEQ ID NO:9), BPP-1 Bbp2 (SEQ ID NO:10), mlr8035 (SEQ ED NO:ll), ECA2616 (SEQ LD NO:12), NMA1230 (SEQ ID NO:13), or WA0851 (SEQ LD NO:14), under an inducible promoter.
  • SARO0833 SEQ BO NO:2
  • compositions of the invention can be used to achieve the methods of the invention.
  • the term “about” is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.
  • the use of the term “or” in the claims is used to mean “and/or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive.
  • FIG. 1A-B Schematic representation of the bacterial cell wall.
  • FIG. 1A Gram- positive bacteria have a 20-80 nm peptidoglycan layer, located on the outer side of the inner membrane.
  • FIG. IB Gram-negative bacteria have a 2-3 nm peptidoglycan layer located in the periplasmic space enclosed by the inner and outer membranes of the cell.
  • FIG. 2 Schematic representation of the phage lytic enzymes' action.
  • the holin protein forms pores in the inner membrane (LM) making peptidoglycan (PG) accessible to soluble endolysins. (OM - outer membrane). Peptidoglycan degradation due to endolysin activity leads to lysis of the infected cell and release of phage progeny.
  • FIG. 3 Schematic representation of peptidoglycan structural components found in
  • FIG. 4 Schematic representation of peptidoglycan structure. Numbered arrows point to bonds cleaved by the four major types of peptidoglycan hydrolases as described in the text.
  • FIG. 5 Sequence alignment of gp61 with hypothetical proteobacterial proteins, Vibrio harveyi phage VHML ORF 19, and Bordetella phage BMP-1 Bbp2.
  • N4 ORF 61 present in the late region of the N4 genome, encodes a putative 208 aa protein with an N- terminal transmembrane domain (highlighted in yellow, only found in the gp61 sequence) and a putative peptidoglycan-binding domain (highlighted in blue) (gp61; SEQ ID NO:l).
  • SARO833 (SEQ ID NO:2): Novosphingobium aromaticivorans DSM 12444 (gi:2308512), le-26; STM0016 (SEQ ID NO:3): Salmonella typhimurium LT2 (gi: 16763406), le-24;
  • STY0016 Salmonella enterica subsp. enterica serovar Typhi (gi: 16759009),
  • ECA2616 SEQ ID NO:12: Er-winia carotovora subsp. Atroseptica SCRI1043,
  • VV10124 SEQ ID NO:5: Vibrio vulnificus CMCP6 (gi:27363607),
  • STY1889 Salmonella enterica subsp. enterica serovar Typhi (gi:16760660), 4e-17; VHMLORF19 (SEQ ID NO:7): Vibrio harveyi bacteriophage VHML (gi:27311185), 2e-16; BPP-1 Bbp2 (SEQ ID NO:10): Bordetella phage BPP-1 (gi:41179364), 3e-08; NMA1230 (SEQ ID NO:13): Neisseria meningitidis Z2491 (gi:7379919), 5e-08 are shown.
  • NMB1012 SEQ ID NO:9: Neisseria meningitidis MC58 (gi:15676901), 5e-08; BMEI0995 (SEQ ID NO:8): Brucella melitensis 16M (gi: 17987278), 5e-08; mh8035 (SEQ ID NO:ll): Mesorhizobium loti MAFF303099 (gi: 13476651), le-06; VVA0851 (SEQ ID NO:14): Vibrio vulnificus YJ016 (gi:37676511), 2e-06.
  • FIG. 6A-B ORF 61 expression leads to cell lysis.
  • FIG. 6 A SDS-PAGE showing expression of gp61 under pBAD control; in the right lane all soluble proteins are missing due to cell lysis.
  • FIG. 6B Absorbance curve of E. coli cells expressing gp61 (SEQ ID NO:l) under pBAD control. Cells lysed 20 minutes after induction of gp61 expression with 0.2% arabinose.
  • FIG. 7A-B Determining the topology of gp61.
  • FIG. 7A Schematic representation of gp61 (SEQ ED NO:l) orientation with respect to the cell wall in Gram-negative bacteria (OM — outer membrane, PG - peptidoglycan, EVI-inner membrane).
  • FIG. 7B SDS-PAGE of gp61 and gp61-phoA (gp61 -alkaline phosphatase) fusions. PhoA is only active in the periplasm.
  • FIG. 8A-B C-terminally His 6 -tagged gp61 is active.
  • FIG. 8A C-terminally His 6 - tagged gp61 was purified under denaturing conditions via LMAC.
  • FIG. 8B Renatured protein was tested for peptidoglycan-degrading activity using a zymographic assay and compared to hen lysozyme at different protein concentrations. Peptidoglycan degradation on the zymogram is indicated by clearance at the position of protein in question. Whether the high activity is inherent to gp61 (SEQ ID NO:l) or due to better renaturation after SDS-PAGE is unknown.
  • FIG. 9A-B C-terminally His 6 -tagged gp61 lyses EDTA-treated E. coli.
  • FIG. 9 A Purified gp61 was added to E. coli cells (3xl0 8 cells/ml) in TE buffer at 1.25 ( ⁇ ), 2.5 (A) and 10 ( ⁇ ) ⁇ M concentration. Lysis was determined based on the decrease in absorbance intensity at 600 nm upon gp61 (SEQ ED NO:l) addition.
  • FIG. 9B Initial rates of cell lysis upon addition of gp61 at different gp61 concentrations.
  • FIG. 10A Absorbance of cell cultures expressing gp61 (SEQ ID NO:l) (in black) and STMOOl 6 (in red) as a function of time after induction. Cells expressing STMOOl 6 lyse only after CHC1 3 since STMOOl 6 is predicted to be a soluble protein.
  • FIG. 10B SDS-PAGE showing expression of gp61 and STM0016, 30 min after induction.
  • FIG. 11A-B SDS-PAGE showing expression of gp61 and STM0016, 30 min after induction.
  • gp61TM-STM0016 chimera lyses cells without CHC1 3 treatment.
  • FIG. 11A Absorbance of cell cultures expressing gp61 (SEQ ID NO:l) (in green), STM0016 (SEQ ID NO:3) (in blue) and gp61TM-STM0016 (in red) as a function of time after induction (+ indicates induced cultures).
  • FIG. 11B SDS-PAGE showing expression of gp61, STM0016 and gp61TM-STM0016 chimera, 30 min after induction.
  • FIG. 12A-B Gp61 is an N-acetylmuramidase.
  • FIG. 12 A HPLC chromatograms (A206) of muropeptide fragments resulting from overnight digest of purified E. coli peptidoglycan with gp61 or T4 lysozyme (N-acetylmuramidase) in 20mM Tris, 0.2% Triton X-100.
  • Muropeptides were eluted from a C-18 Hypersil BDS column using a linear 4-30% MeOH gradient in 0.1% TFA.
  • FIG. 12 A HPLC chromatograms (A206) of muropeptide fragments resulting from overnight digest of purified E. coli peptidoglycan with gp61 or T4 lysozyme (N-acetylmuramidase) in 20mM Tris, 0.2% Triton X-100.
  • Muropeptides were eluted from a C-18 Hypersil BDS column using
  • the expected products from gp61 (T4 lysozyme - N-acetyl muramidase) digest are disaccharide-tetrapeptide of predicted mass 941.93 and disaccharide-tetrapeptide crosslinked to adjacent disaccharide-tetrapeptide of predicted mass 1865.85.
  • FIG. 13A-C nESI-QIT mass spec analysis of HPLC fraction eluting at 37 min from gp61 digest of E. coli peptidoglycan reveals the expected product for N-acetylmuramidase digest of the predicted mass 941.93.
  • FIG. 13A Positive ion-mode nESI-QIT MS of HPLC fraction 38 min from the gp61 digest of E. coli peptidoglycan dominated by the singly charged molecular ion at m/z 942.5.
  • FIG. 13A Positive ion-mode nESI-QIT MS of HPLC fraction 38 min from the gp61 digest of E. coli peptidoglycan dominated by the singly charged molecular ion at m/z 942.5.
  • MS 2 - the first generation of the product ion spectrum (m/z 942.5) is dominated by a singly charged molecular ion at m/z 739.6 corresponding to the loss of one neutral N-acetylglucosamine (203.1 Da) as indicated in FIG. 13C that shows expected molecular ions resulting from the fragmentation of ion at m/z 942.5.
  • FIG. 14A-C nESI-QIT mass spec analysis of HPLC fraction eluting at 63 min from gp61 digest of E. coli peptidoglycan reveals the expected product for N-acetylmuramidase digest of the predicted mass 1865.8.
  • FIG. 14A Positive ion-mode nESI-QIT MS of HPLC fraction 63 min from the gp61 digest of E. coli peptidoglycan dominated by the doubly charged molecular ion at m/z 933.9.
  • FIG. 14A Positive ion-mode nESI-QIT MS of HPLC fraction 63 min from the gp61 digest of E. coli peptidoglycan dominated by the doubly charged molecular ion at m/z 933.9.
  • FIG. 15A gp61 (SEQ ID NO:l) amino acid sequence with N-terminal transmembrane domain highlighted in yellow and putative peptidoglycan-binding domain highlighted in blue. Arrows indicate conserved amino acid residues that were changed to alanine (green arrows indicate mutations that did not have any effect on gp61 activity; purple arrows indicate mutations with partial effect on gp61 activity and red arrows indicate mutations that lead to inactivation of gp61 in vivo and in vitro).
  • FIG 16A-B In vitro activity of gp61 mutant proteins.
  • FIG. 16A SDS-PAGE shows expression of gp61 mutant proteins. Those denoted by a star contain a His 6 -tag at the C- terminus.
  • FIG. 16B Zymographic analysis of gp61 mutant proteins. Mutant proteins highlighted in purple and wild-type protein were 50-fold diluted before loading onto the zymogram. All gp ⁇ l mutant proteins are identical to gp61 (SEQ ID NO:l) except for the noted mutation or presence of C-terminal His 6 -tag.
  • FIG. 17A-C Mutational analysis identifies catalytically essential glutamic acid located in the conserved EGGY motif.
  • FIG. 17A In vivo activity of gp61 mutant proteins. The expression of mutant gp61 proteins was induced and cell lysis was monitored.. - • - BL21(pES61H) cells expressing C-terminally His 6 -tagged gp61; -0- BL21(pES61H5) cells expressing C-terminally His 6 -tagged gp61 E26A; - - BL21(pES61H6) cells expressing C- terminally His 6 -tagged gp61 E26D. FIG. 17B, SDS-PAGE (left) and zymographic analysis (right) of gp61 wt, gp61 E26A and E26D proteins.
  • FIG. 17C Sequence alignment of T4 lysozyme active site amino acids (in bold) and the putative gp61 active site, as determined from gp61 mutant analysis suggesting that gp61 may be an ortholog of T4 lysozyme.
  • the present invention overcomes deficiencies in the prior art by providing the peptidoglycan-hydrolyzing protein N-acetylmuramidase gp61 (SEQ ID NO:l).
  • Gp61 possesses a transmembrane domain region and exhibits a potent ability to lyse bacteria when bacteria express, and/or are contacted with, gp61.
  • Gp61 is unique among phage lysins since it does not depend on other phage-coded factors for its function in vivo; for example, expression of gp61 is sufficient for in vivo lysis of E. coli.
  • homologous proteins including, for example, Novosphingobium aromaticivorans SARO0833 [qi
  • Gp61 and its derivatives have many potential uses, including treatment of bacterial infections and isolation of proteins expressed heterologously in bacteria.
  • Bacterial infection continues to be a serious clinical problem.
  • the emergence of antibiotic-resistant strains of bacteria has made treatment of bacterial infections increasingly more difficult, and in many cases no effective treatments exist for these infections.
  • Bacteriophages infect bacteria, and in the final stage of infection cause lysis of the infected bacterium.
  • peptidoglycan-degrading enzymes lysins or endolysins
  • lysins or endolysins are expressed by certain bacteriophages in the late stage of infection and cause degradation of the bacterial membrane, which results in cell lysis.
  • Peptidoglycan-degrading enzymes and in particular gp61 of the present invention, hold great promise for the treatment of bacterial infection.
  • the final stage in a phage infectious cycle is the lysis of the host cell, which is accomplished by the degradation of the peptidoglycan (murein) structure located in the periplasmic space of Gram-negative bacteria and on the outer side of the cell membrane of Gram-positive bacteria (FIG. 1).
  • lysis of Escherichia coli by various bacteriophages occurs via at least the following two strategies: 1.) Some single-stranded DNA or single-stranded RNA phages rely on a single gene that does not encode a muralytic enzyme activity; instead, the gene product leads to inhibition of murein synthesis (Bernhardt et al, 2000; Bernhardt et al, 2001); and 2.) Double-stranded DNA phages encode an enzyme with peptidoglycan- degrading activity (Young, 1992), an endolysin lacking a secretion signal sequence that actively accumulates in the cytoplasm until a pore created by a phage-encoded holin protein forms in the inner membrane allowing endolysins access to the peptidoglycan (FIG.
  • the peptidoglycan layer of the bacterial membrane has a particular structure.
  • the glycan strands in peptidoglycan consist of the amino sugars N-acetylglucosamine (GlcNAc) and N-acetylmuramic acid (MurNAc), which are linked by ⁇ -1,4 glycosidic bonds.
  • Short peptides covalently attached to muramic acid are cross-linked forming the characteristic net structure of the peptidoglycan.
  • eso-diaminopimelic acid m-A 2 pm
  • the dimeric peptide bridges form through D, D-peptide bonds between m-A pm and D-alanine via a pemcillin-sensitive transpeptidation reaction (FIG. 3) (Holtje, 1998).
  • FOG. 3 pemcillin-sensitive transpeptidation reaction
  • FIG. 4 There are four major groups of endolysins (FIG. 4).
  • Glycosylases e.g., N- acetylmuramidase and/or N-acetylglucosaminidase
  • cleave cleave the ⁇ -1,4 glycosidic bond between muramic acid and glucosamine e.g., N- acetylmuramidase and/or N-acetylglucosaminidase
  • Transglycosylases catalyze the same reaction onto the OH group of C6 from the muramic acids, yielding a 1,6 anhydromuramic acid ( ⁇ phage endolysin). These enzymes usually start at the non-reducing glucosamine end, cleaving the glycan strand in a progressive manner giving off disaccharide polypeptide chains as products. Amidases cleave the amide bond between the lactyl group of muramic acid and L-alanine of the peptide chain, releasing peptide chains with free N-terminal amino groups (Heidrich et al, 2001).
  • Endopeptidases catalyze cleavage of the peptide cross-bridges in the peptidoglycan where the majority of crosslinks are formed by D, D peptide bond between D- alanine and eso-diaminopimelic acid (Ghyssen et al, 1966; Holtje, 1995).
  • Some endolysins such as T4, T7 and ⁇ phage lysins have been called lysozymes when in fact each protein has a different muralytic activity: glysosylase, amidase and transglycosylase, respectively (Young, 1992).
  • ⁇ acteriai diseases and pharmaceutical compositions comprises methods and compositions for the treatment and/or prevention of bacterial infection.
  • a bacterial infection is treated and/or prevented by administration of gp61(SEQ ED NO:l) or a derivative thereof, h additional embodiments of the invention, a homolog of gp61 is provided, including SARO0833 (SEQ ID NO:2), STM0016 (SEQ ID NO:3), STY0016 (SEQ ID NO:4), VV10124 (SEQ ID NO:5), STY1889 (SEQ ID NO:6), VHMLORF19 (SEQ ID NO:7), BPP-lBbp2 (SEQ ID NO:10).
  • NMB1012 (SEQ ID NO:9), BMEI0095 (SEQ ID NO:8), mlr8035 (SEQ ID NO: 11) and VVA0851 (SEQ ID NO: 14). It will be understood by those of skill in the art in light of the invention that fragments of these sequences and gp61 having peptidoglycan-hydrolyzing activity will similarly find use with the invention, as will variants comprising at least about 90%, 95%, 97%, 98% or 99% amino acid identity relative to these sequences and having peptidoglycan-hydrolyzing activity. Such variants will preferably retain conserved residues conferring peptidoglycan-hydrolyzing activity, for example, as shown in FIG. 15.
  • genomes that infect pathogenic bacteria may be modified by addition of one or more heterologous coding sequence of a peptidoglycan-hydrolyzing polypeptide provided by the invention.
  • coding sequences therapeutic benefit may be obtained in treating bacterial infections.
  • nucleic acids encoding gp61 or other nucleic acids encoding peptidoglycan- hydrolyzing polypeptides may be introduced into a phage that is delivered as an antibacterial.
  • Examples of bacterial viruses that may be modified in accordance with the invention and used to infect any given bacterium are well known in the art, as more than 5000 have been examined to date (Ackermann, 2001).
  • Bacterial diseases include, but are not limited to, infection by the 83 or more distinct serotypes of pneumococci, streptococci such as S. pyogenes, S. agalactiae, S. equi, S. canis, S. bovis, S. equinus, S. anginosus, S. sanguis, S. salivarius, S. mitis, S. mutans, other viridans streptococci, peptostreptococci, other related species of streptococci, enterococci such as E. faecalis, E. faecium, Staphylococci, such as S. epidermidis, S.
  • streptococci such as S. pyogenes, S. agalactiae, S. equi, S. canis, S. bovis, S. equinus, S. anginosus, S. sanguis, S. salivarius
  • aureus particularly in the nasopharynx, Hemophilus influenzae, pseudomonas species such as P. aeruginosa, P. pseudomallei, P. mallei, brucellas such as B. melitensis, B. suis, B. abortus, B. pertussis, N. meningitidis, N. gonorrhoeae, M. catarrhalis, C. diphtheriae, C. ulcerans, C. pseudotuberculosis, C. pseudodiphtheriticum, C. urealyticum, C. hemolyticum, C. equi, etc. L. monocytogenes, N.
  • Bacteria that cause bacterial diseases include Gram-positive and Gram-negative bacteria.
  • the invention may also be useful against Gram-negative bacteria such as K. pneumoniae, E. coli, Proteus, S. species, Acinetobacter, Y. pestis, F. tularensis, Enterobacter species, Bacteriodes and Legionella species and the like.
  • Preferred embodiments of the present invention include treatment of bacterial diseases caused by Salmonella and E. coli.
  • One example of a treatment method may involve use of phage comprising heterologous nucleic acids provided by the invention, including the use of different regulatory elements.
  • a peptidoglycan-hydrolyzing compound provided by the invention it may be desirable to formulate the compound in a pharmaceutical composition.
  • One aspect of the current invention thus comprises a pharmaceutical composition comprising a peptidoglycan-hydrolysing compound provided by the invention in a biologically- acceptable carrier.
  • compositions may be formulated for delivery by any means of administration, for example, intranasally, intradermally, intraarterially, intraperitoneally, mtralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, intramuscularly, subcutaneously, subconjunctival, intravesicularlly, mucosally, intrapericardially, intraumbilically, intraocularally, orally, topically, locally, inhalation (e.g., aerosol inhalation), injection, infusion, continuous infusion, localized perfusion bathing target cells directly, via a catheter, via a lavage, in cremes, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed
  • Compounds may be administered in a pharmaceutically acceptable carrier, diluent or vehicle.
  • pharmaceutically acceptable carrier diluent or vehicle.
  • pharmaceutically acceptable refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate.
  • pharmaceutical phrases “pharmaceutical or pharmacologically acceptable” refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate.
  • an pharmaceutical composition that contains at least one polypeptide selected from the group consisting of gp61 (SEQ ID NO:l), SARO0833 (SEQ ED NO:2), STM0016 (SEQ ED NO:3), STY0016 (SEQ ID NO:4), VV10124 (SEQ ED NO:5), STY1889 (SEQ ID NO:6), VHML ORF19 (SEQ ED NO:7), BMEI0095 (SEQ ID NO:8), NMB 1012 (SEQ ID NO:9), BPP-1 Bbp2 (SEQ ID NO: 10), mlr8035 (SEQ ID NO:ll), ECA2616 (SEQ ID NO: 12), NMA1230 (SEQ ID NO: 13), and VVA0851 (SEQ ID NO: 14), including an active fragment or additional active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 18th Ed., 1990, incorporated herein by reference.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed., 1990, incorporated herein by reference).
  • compositions of the present invention administered to an animal patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration.
  • about 100 units/ml to about 500,000 units/ml of fluid may be used in varying environments, including about 500, 1000, 10,000, 50,000, 200,000 and 400,000 units/ml.
  • methods for determining appropriate dosages are well known to those of skill in the art and may involve consideration of many known variables. Those of skill in the art will immediately understand how to optimize these or other concentrations and determine an appropriate dosage for any given treatment in view of the current disclosure.
  • a biologically-functional equivalent may comprise a polynucleotide that has been engineered to contain distinct sequences while at the same time retaining the capacity to encode the "wild-type" or standard protein.
  • a polynucleotide made be (and encode) a biologically-functional equivalent with more significant changes. Certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen-binding regions of antibodies, binding sites on substrate molecules, receptors, and such like.
  • biologically-functional equivalents are thus defined herein as those proteins (and polynucleotides) in which selected amino acids (or codons) may be substituted.
  • Functional activity can be defined as the degree to which a polypeptide and/or polynucleotide (e.g., a polypeptide similar to gp61, SEQ ID NO:l) correlates with an increase in the lysis of bacteria.
  • arginine, lysine and/or histidine are all positively charged residues; that alanine, glycine and/or serine are all a similar size; and/or that phenylalanine, tryptophan and/or tyrosine all have a generally similar shape. Therefore, based upon these considerations, arginine, lysine and/or histidine; alanine, glycine and/or serine; and/or phenylalanine, tryptophan and/or tyrosine; are defined herein as biologically functional equivalents. To effect more quantitative changes, the hydropathic index of amino acids may be considered.
  • Each amino acid has been assigned a hydropathic index on the basis of its hydrophobicity and or charge characteristics, these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and/or arginine (-4.5).
  • hydropathic amino acid index in conferring interactive biological function on a protein is generally understood in the art (Kyte and Doolittle, 1982, incorporated herein by reference). It is known that certain amino acids may be substituted for other amino acids having a similar hydropathic index and/or score and/or still retain a similar biological activity. In making changes based upon the hydropathic index, the substitution of amino acids whose hydropathic indices are within ⁇ 2 is preferred, those which are within ⁇ 1 are particularly preferred, and/or those within ⁇ 0.5 are even more particularly preferred.
  • Patent 4,554,101 the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0 ⁇ 1); glutamate (+3.0 ⁇ 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5 ⁇ 1); alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4).
  • the present invention in many aspects, relies on the synthesis of peptides and polypeptides (e.g., gp ⁇ l, SEQ ID NO:l) in cyto, via transcription and translation of appropriate polynucleotides. These peptides and polypeptides will include the twenty "natural" amino acids, and post-translational modifications thereof. However, in vitro peptide synthesis permits the use of modified and/or unusual amino acids.
  • a table of exemplary, but not limiting, modified and/or unusual amino acids is provided herein below.
  • Mimetics In addition to the biologically-functional equivalents discussed above, the present inventors also contemplate that structurally similar compounds may be formulated to mimic the key portions of peptide or polypeptides of the present invention. Such compounds, which may be termed peptidomimetics, may be used in the same manner as the peptides of the invention and, hence, also are functional equivalents. Certain mimetics that mimic elements of protein secondary and tertiary structure are described in Johnson et al, (1993). The underlying rationale behind the use of peptide mimetics is that the peptide backbone of proteins exists chiefly to orient amino acid side chains in such a way as to facilitate molecular interactions, such as those of antibody and/or antigen.
  • a peptide mimetic is thus designed to permit molecular interactions similar to the natural molecule.
  • Some successful applications of the peptide mimetic concept have focused on mimetics of ⁇ -turns within proteins, which are known to be highly antigenic.
  • ⁇ -turn structure within a polypeptide can be predicted by computer-based algorithms, as discussed herein.
  • mimetics can be constructed to achieve a similar spatial orientation of the essential elements of the amino acid side chains.
  • Other approaches have focused on the use of small, multidisulfide-containing proteins as attractive structural templates for producing biologically active conformations that mimic the binding sites of large proteins. Vita et al, (1998).
  • a structural motif that appears to be evolutionarily conserved in certain toxins is small (30-40 amino acids), stable, and highly permissive for mutation.
  • This motif is composed of a beta sheet and an alpha helix bridged in the interior core by three disulfides. Beta II turns have been mimicked successfully using cyclic L-pentapeptides and those with D-amino acids.
  • Johannesson et al, (1999) report on bicyclic tripeptides with reverse turn inducing properties. Methods for generating specific structures have been disclosed in the art. For example, alpha-helix mimetics are disclosed in U.S.
  • nucleic Acid Compositions Certain embodiments of the present invention concern a nucleic acid encoding gp61 (SEQ ED NO:l) and homologs thereof, hi other aspects, a gp61 nucleic acid comprises a biologically functional equivalent thereof, hi further aspects, nucleic acid gp61 homologs may find use in the lysis of bacteria in a method provided by the invention, including nucleic acids encoding SARO0833 (SEQ ID NO:2), STM0016 (SEQ ID NO:3), STY0016 (SEQ ID NO:4), CMP6 VV10124 (SEQ ID NO:5), STY1889 (SEQ ID NO:6), VHML ORF19 (SEQ ED NO:7), BMEI0095 (SEQ ID NO:8), NMB 1012 (SEQ ED NO:
  • nucleic acid will generally refer to a molecule (i.e., a strand) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase.
  • a nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine "A,” a guanine “G,” a thymine “T” or a cytosine “C”) or RNA (e.g., an A, a G, an uracil "U” or a C).
  • nucleic acid encompass the terms “oligonucleotide” and “polynucleotide,” each as a subgenus of the term “nucleic acid.”
  • oligonucleotide refers to a molecule of between about 3 and about 100 nucleobases in length.
  • polynucleotide refers to at least one molecule of greater than about 100 nucleobases in length.
  • a nucleic acid may encompass a double-stranded molecule or a triple-stranded molecule that comprises one or more complementary strand(s) or "complement(s)" of a particular sequence comprising a molecule.
  • a single stranded nucleic acid may be denoted by the prefix "ss,” a double stranded nucleic acid by the prefix "ds,” and a triple stranded nucleic acid by the prefix "ts.”
  • a “nucleobase” refers to a heterocyclic base, such as for example a naturally occurring nucleobase (i.e., an A, T, G, C or U) found in at least one naturally occurring nucleic acid (i.e., DNA and RNA), and naturally or non-naturally occurring derivative(s) and analogs of such a nucleobase.
  • a nucleobase generally can form one or more hydrogen bonds (“anneal” or “hybridize”) with at least one naturally occurring nucleobase in manner that may substitute for naturally occurring nucleobase pairing (e.g., the hydrogen bonding between A and T, G and C, and A and U).
  • a "nucleoside” refers to an individual chemical unit comprising a nucleobase covalently attached to a nucleobase linker moiety.
  • a non-limiting example of a “nucleobase linker moiety” is a sugar comprising 5-carbon atoms (i.e., a "5-carbon sugar"), including but not limited to a deoxyribose, a ribose, an arabinose, or a derivative or an analog of a 5-carbon sugar.
  • Non-limiting examples of a derivative or an analog of a 5-carbon sugar include a 2'- fluoro-2'-deoxyribose or a carbocyclic sugar where a carbon is substituted for an oxygen atom in the sugar ring.
  • the term "nucleotide” refers to a nucleoside further comprising a "backbone moiety".
  • a backbone moiety generally covalently attaches a nucleotide to another molecule comprising a nucleotide, or to another nucleotide to form a nucleic acid.
  • the "backbone moiety" in naturally occurring nucleotides typically comprises a phosphorus moiety, which is covalently attached to a 5-carbon sugar.
  • the attachment of the backbone moiety typically occurs at either the 3'- or 5'-position of the 5-carbon sugar.
  • other types of attachments are known in the art, particularly when a nucleotide comprises derivatives or analogs of a naturally occurring 5-carbon sugar or phosphorus moiety.
  • a nucleic acid may be made by any technique known to one of ordinary skill in the art, such as for example, chemical synthesis, enzymatic production or biological production.
  • a synthetic nucleic acid e.g., a synthetic oligonucleotide
  • Non-limiting examples of a synthetic nucleic acid include a nucleic acid made by in vitro chemical synthesis using phosphotriester, phosphite or phosphoramidite chemistry and solid phase techniques such as described in EP 266,032, incorporated herein by reference, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al, 1986 and U.S. Patent 5,705,629, each incorporated herein by reference.
  • one or more oligonucleotide may be used.
  • Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S. Patents. 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference.
  • a non-limiting example of an enzymatically produced nucleic acid include one produced by enzymes in amplification reactions such as PCRTM (see for example, U.S. Patent 4,683,202 and U.S.
  • a non-limiting example of a biologically produced nucleic acid includes a recombinant nucleic acid produced (i.e., replicated) in a living cell, such as a recombinant DNA vector replicated in bacteria (see for example, Sambrook et al, 2001, incorporated herein by reference).
  • a nucleic acid may be purified on polyacrylamide gels, cesium chloride centrifugation gradients, or by any other means known to one of ordinary skill in the art (see for example, Sambrook et al, 2001, incorporated herein by reference).
  • the present invention concerns a nucleic acid that is an isolated nucleic acid.
  • isolated nucleic acid refers to a nucleic acid molecule (e.g., an RNA or DNA molecule) that has been isolated free of, or is otherwise free of, the bulk of the total genomic and transcribed nucleic acids of one or more cells, hi certain embodiments, "isolated nucleic acid” refers to a nucleic acid that has been isolated free of, or is otherwise free of, bulk of cellular components or in vitro reaction components such as for example, macromolecules such as lipids or proteins, small biological molecules, and the like.
  • a nucleic acid may be a nucleic acid segment.
  • nucleic acid segment means smaller fragments of a nucleic acid, such as for non-limiting example, those that encode only part of the gp61 (SEQ ED NO:l) peptide or polypeptide sequence.
  • a “nucleic acid segment” may comprise any part of a gene sequence, of from about 2 nucleotides to the full length of the gp61 (SEQ ID NO:l) peptide or polypeptide encoding region.
  • the present invention also encompasses a nucleic acid that is complementary to a gp61 (SEQ ED NO:l) nucleic acid.
  • the invention encompasses a nucleic acid or a nucleic acid segment complementary to the sequence set forth in SEQ ED NO:l.
  • a nucleic acid is "complement(s)” or is “complementary” to another nucleic acid when it is capable of base-pairing with another nucleic acid according to the standard Watson-Crick, Hoogsteen or reverse Hoogsteen binding complementarity rules.
  • another nucleic acid may refer to a separate molecule or a spatially separated sequence of the same molecule.
  • the term “complementary” or “complement(s)” also refers to a nucleic acid comprising a sequence of consecutive nucleobases or semiconsecutive nucleobases (e.g., one or more nucleobase moieties are not present in the molecule) capable of hybridizing to another nucleic acid strand or duplex even if less than all the nucleobases do not base pair with a counterpart nucleobase.
  • a "complementary" nucleic acid comprises a sequence in which about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%), about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, to about 100%, and any range derivable therein, of the nucleobase sequence is capable of base-pairing with a single or double stranded nucleic acid molecule during hybridization.
  • the term “complementary” refers to a nucleic acid that may hybridize to another nucleic acid strand or duplex in stringent conditions, as would be understood by one of ordinary skill in the art.
  • a “partly complementary” nucleic acid comprises a sequence that may hybridize in low stringency conditions to a single or double stranded nucleic acid, or contains a sequence in which less than about 70%o of the nucleobase sequence is capable of base-pairing with a single or double stranded nucleic acid molecule during hybridization.
  • hybridization As used herein, “hybridization”, “hybridizes” or “capable of hybridizing” is understood to mean the forming of a double or triple stranded molecule or a molecule with partial double or triple stranded nature.
  • the term “anneal” as used herein is synonymous with “hybridize.”
  • the term “hybridization”, “hybridize(s)” or “capable of hybridizing” encompasses the terms “stringent condition(s)” or “high stringency” and the terms “low stringency” or “low stringency condition(s).” “Stringent condition(s)” or “high stringency” are those conditions that allow hybridization between or within one or more nucleic acid strand(s) containing complementary sequence(s), but precludes hybridization of random sequences.
  • Stringent conditions tolerate little, if any, mismatch between a nucleic acid and a target strand. Such conditions are well known to those of ordinary skill in the art, and are preferred for applications requiring high selectivity. Non-limiting applications include isolating a nucleic acid, such as a gene or a nucleic acid segment thereof, or detecting at least one specific mRNA transcript or a nucleic acid segment thereof, and the like. Stringent conditions may comprise low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.15 M NaCl at temperatures of about 50°C to about 70°C, including 0.02 M NaCl at about 50°C.
  • the temperature and ionic strength of a desired stringency are determined in part by the length of the particular nucleic acid(s), the length and nucleobase content of the target sequence(s), the charge composition of the nucleic acid(s), and to the presence or concentration of formamide, tetramethylammonium chloride or other solvent(s) in a hybridization mixture. It is also understood that these ranges, compositions and conditions for hybridization are mentioned by way of non-limiting examples only, and that the desired stringency for a particular hybridization reaction is often determined empirically by comparison to one or more positive or negative controls. Depending on the application envisioned it is preferred to employ varying conditions of hybridization to achieve varying degrees of selectivity of a nucleic acid towards a target sequence.
  • identification or isolation of a related target nucleic acid that does not hybridize to a nucleic acid under stringent conditions may be achieved by hybridization at low temperature and/or high ionic strength.
  • Such conditions are termed “low stringency” or “low stringency conditions”
  • non-limiting examples of low stringency include hybridization performed at about 0.15 M to about 0.9 M NaCl at a temperature range of about 20°C to about 50°C.
  • hybridization performed at about 0.15 M to about 0.9 M NaCl at a temperature range of about 20°C to about 50°C.
  • mutants of the disclosed peptidoglycan-hydrolyzing enzymes e.g., gp61; SEQ ED NO:l
  • mutagenesis will be accomplished by a variety of standard, mutagenic procedures. Mutation is the process whereby changes occur in the quantity or structure of an organism. Mutation can involve modification of the nucleotide sequence of a single gene, blocks of genes or whole chromosome. Changes in single genes may be the consequence of point mutations that involve the removal, addition or substitution of a single nucleotide base within a DNA sequence, or they may be the consequence of changes involving the insertion or deletion of large numbers of nucleotides. Mutations can arise spontaneously as a result of events such as errors in the fidelity of
  • DNA replication or the movement of transposable genetic elements (transposons) within the genome are induced following exposure to chemical or physical mutagens.
  • mutation-inducing agents include ionizing radiations, ultraviolet light and a diverse array of chemical such as alkylating agents and polycyclic aromatic hydrocarbons, all of which are capable of interacting either directly or indirectly (generally following some metabolic biotransformations) with nucleic acids.
  • the DNA lesions induced by such environmental agents may lead to modifications of base sequence when the affected DNA is replicated or repaired and thus to a mutation. Mutation also can be site-directed through the use of particular targeting methods. Random mutagenesis also may be introduced using error prone PCR (Cadwell and Joyce, 1992).
  • the rate of mutagenesis may be increased by performing PCR in multiple tubes with dilutions of templates.
  • One particularly useful mutagenesis technique is alanine scanning mutagenesis in which a number of residues are substituted individually with the amino acid alanine so that the effects of losing side-chain interactions can be determined, while minimizing the risk of large-scale perturbations in protein conformation (Cunningham et al, 1989).
  • a method for generating libraries of displayed polypeptides is described in U.S. Patent 5,380,721.
  • the method comprises obtaining polynucleotide library members, pooling and fragmenting the polynucleotides, and reforming fragments therefrom, performing PCR amplification, thereby homologously recombining the fragments to form a shuffled pool of recombined polynucleotides.
  • Structure-guided site-specific mutagenesis represents a powerful tool for the dissection and engineering of protein-ligand interactions (Wells, 1996, Braisted et al, 1996).
  • the technique provides for the preparation and testing of sequence variants by introducing one or more nucleotide sequence changes into a selected DNA.
  • Site-specific mutagenesis uses specific oligonucleotide sequences which encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent, unmodified nucleotides.
  • a primer sequence is provided with sufficient size and complexity to form a stable duplex on both sides of the base-substitution or deletion junction being traversed.
  • a primer of about 17 to 25 nucleotides in length is preferred, with about 5 to 10 residues on both sides of the junction of the sequence being altered.
  • the technique typically employs a bacteriophage vector that exists in both a single- stranded and double-stranded form.
  • Vectors useful in site-directed mutagenesis include vectors such as the M13 phage.
  • Double-stranded plasmids are also routinely employed in site-directed mutagenesis, which eliminates the step of transferring the gene of interest from a phage to a plasmid.
  • one first obtains a single-stranded vector, or melts two strands of a double- stranded vector, which includes within its sequence a DNA sequence encoding the desired protein or genetic element.
  • An oligonucleotide primer bearing the desired mutated sequence, synthetically prepared, is then annealed with the single-stranded DNA preparation, taking into account the degree of mismatch when selecting hybridization conditions.
  • the hybridized product is subjected to DNA polymerizing enzymes such as E. coli polymerase I (Klenow fragment) in order to complete the synthesis of the mutation-bearing strand.
  • DNA polymerizing enzymes such as E. coli polymerase I (Klenow fragment)
  • E. coli polymerase I Klenow fragment
  • This heteroduplex vector is then used to transform appropriate host cells, such as E. coli cells, and clones are selected that include recombinant vectors bearing the mutated sequence arrangement.
  • nucleic acids comprising sequences that encode gp61 (SEQ ID NO:l), SARO0833 (SEQ ED NO:2), STM0016 (SEQ ID NO:3), STY0016 (SEQ ID NO:4), CMP6 VV10124 (SEQ ED NO:5), STY1889 (SEQ ID NO:6), VHML ORF19 (SEQ ID NO:7), BMEI0095 (SEQ ID NO:8), NMB 1012 (SEQ ID NO:9), BPP-1 Bbp2 (SEQ ID NO:10), mlr8035 (SEQ ID NO:ll), ECA2616 (SEQ ID NO:12), NMA1230 (SEQ ID NO:13), and VVA0851 (SEQ ID NO:14), may be operably linked to a heterologous promoter and may be expressed using various in vitro or in vivo expression systems and vectors.
  • vectors are used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated.
  • a nucleic acid sequence can be "exogenous,” which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found.
  • Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs).
  • plasmids include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs).
  • viruses bacteriophage, animal viruses, and plant viruses
  • artificial chromosomes e.g., YACs
  • expression vector refers to any type of genetic construct comprising a nucleic acid capable of being transcribed into an RNA. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules or ribozymes.
  • Expression vectors can contain a variety of "control sequences,” which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host cell. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described infra. a.
  • Promoters and Enhancers are a control sequence that is a region of a nucleic acid sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind, such as RNA polymerase and other transcription factors, to initiate the specific transcription of a nucleic acid sequence.
  • the phrases "operatively positioned,” “operatively linked,” “under control,” and “under transcriptional control” mean that a promoter is in a correct functional location and/or orientation in relation to a nucleic acid sequence to control transcriptional initiation and/or expression of that sequence.
  • a promoter generally comprises a sequence that functions to position the start site for RNA synthesis.
  • Vectors for transformation of cells generally, including prokaryotes and eukaryotes, and methods for introducing and expressing foreign genes with these vectors are well known in the art and are described in, for example, U.S. Pat. No. 4,952,496; U.S. Pat. No. 4,366,246; U.S. Pat. No. 4,798,885 and in Molecular Cloning, Cold Spring Harbor Laboratories, 1982; each of the disclosures of which are specifically incorporated herein by reference in the entirety.
  • Examples of such vectors include the pBlueskript and phage Lambda ZAP vectors (Stratagene, La Jolla, Calif), and the like.
  • Suitable vectors include the pET expression vectors, which contains the T7 promoter, T7 terminator, the inducible E. coli lac operator, and the lac repressor gene.
  • examples of some prokaryotic promoters include prec A, ptrp, plac, ptac, pBAD and bacteriophage lambda P , and P L - Promoter function and expression of genes in prokaryotes typically requires availability of a sigma factor, which permits recognition of promoter elements and initiation of transcription at these specific sites. Cells may contain multiple sigma factors and their relative levels can control gene expression. It will therefore typically be desired to ensure adequate and appropriate expression of sigma factors for heterologous gene expression.
  • a promoter may or may not be used in conjunction with an "enhancer,” which refers to a cis-acting regulatory sequence involved in the transcriptional activation of a nucleic acid sequence.
  • a promoter may be one naturally associated with a nucleic acid sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and/or exon.
  • an enhancer may be one naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence.
  • an enhancer may be one naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence.
  • certain advantages will be gained by positioning the coding nucleic acid segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid sequence in its natural environment.
  • a recombinant or heterologous enhancer refers also to an enhancer not normally associated with a nucleic acid sequence in its natural environment.
  • promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other virus, or prokaryotic or eukaryotic cell, and promoters or enhancers not "naturally occurring," i.e., containing different elements of different transcriptional regulatory regions, and/or mutations that alter expression.
  • promoters that are most commonly used in recombinant DNA construction include the bacterial arabinose (pBAD), ⁇ -lactamase (penicillinase), lactose and tryptophan (tip) promoter systems.
  • sequences may be produced using recombinant cloning and/or nucleic acid amplification technology, including PCRTM, in connection with the compositions disclosed herein (see U.S. Patent Nos. 4,683,202 and 5,928,906, each incorporated herein by reference).
  • control sequences that direct transcription and/or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.
  • a promoter and/or enhancer that effectively directs the expression of the DNA segment in the organelle, cell type, tissue, organ, or organism chosen for expression.
  • promoters for protein expression
  • the promoters employed may be constitutive, cell type-specific, inducible, and/or useful under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and/or peptides.
  • the promoter may be heterologous or endogenous.
  • a specific initiation signal also may be required for efficient translation of coding sequences. These signals include the ATG initiation codon or adjacent sequences.
  • Exogenous translational control signals including the ATG initiation codon, may need to be provided.
  • One of ordinary skill in the art would readily be capable of determining this and providing the necessary signals. It is well known that the initiation codon must be "in-frame" with the reading frame of the desired coding sequence to ensure translation of the entire insert.
  • the exogenous translational control signals and initiation codons can be either natural or synthetic.
  • the efficiency of expression may be enhanced by the inclusion of appropriate translation enhancer elements such as a Shine-Dalgarno sequence. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message (see U.S. Patent Nos. 5,925,565 and 5,935,819, each herein incorporated by reference). c.
  • Vectors can include a multiple cloning site (MCS), which is a nucleic acid region that contains multiple restriction enzyme sites, any of which can be used in conjunction with standard recombinant technology to digest the vector (see, for example, Carbonelli et al, 1999, Levenson et al, 1998, and Cocea, 1997, incorporated herein by reference.)
  • MCS multiple cloning site
  • Restriction enzyme digestion refers to catalytic cleavage of a nucleic acid molecule with an enzyme that functions only at specific locations in a nucleic acid molecule. Many of these restriction enzymes are commercially available. Use of such enzymes is widely understood by those of skill in the art.
  • a vector is linearized or fragmented using a restriction enzyme that cuts within the MCS to enable exogenous sequences to be ligated to the vector.
  • "Ligation” refers to the process of forming phosphodiester bonds between two nucleic acid fragments, which may or may not be contiguous with each other. Techniques involving restriction enzymes and ligation reactions are well known to those of skill in the art of recombinant technology.
  • Termination Signals The vectors or constructs of the present invention will generally comprise at least one termination signal.
  • a “termination signal” or “terminator” is comprised of the DNA sequences involved in specific termination of an RNA transcript by an RNA polymerase.
  • a termination signal that ends the production of an RNA transcript is contemplated.
  • a terminator may be necessary in vivo to achieve desirable message levels.
  • Origins of Replication In order to propagate a vector in a host cell, it may contain one or more origins of replication sites (often termed "ori"), which is a specific nucleic acid sequence at which replication is initiated. Alternatively, an autonomously replicating sequence (ARS) can be employed if the host cell is yeast.
  • ARS autonomously replicating sequence
  • cells containing a nucleic acid construct of the present invention may be identified in vitro or in vivo by including a marker in the expression vector.
  • a selectable marker is one that confers a property that allows for selection.
  • a positive selectable marker is one in which the presence of the marker allows for its selection, while a negative selectable marker is one in which its presence prevents its selection.
  • An example of a positive selectable marker is a drug resistance marker.
  • a drug selection marker aids in the cloning and identification of transformants, for example, genes that confer resistance to kanamycin, tetracycline, chloramphenicol and ampicillin are useful selectable markers.
  • markers conferring a phenotype that allows for the discrimination of transformants based on the implementation of conditions are also contemplated.
  • screenable markers such as GFP, whose basis is colorimetric analysis
  • screenable enzymes such as chloramphenicol acetyltransferase (CAT) may be utilized.
  • CAT chloramphenicol acetyltransferase
  • One of skill in the art would also know how to employ immunologic markers, possibly in conjunction with FACS analysis. The marker used is not believed to be important, so long as it is capable of being expressed simultaneously with the nucleic acid encoding a gene product. Further examples of selectable and screenable markers are well known to one of skill in the art. g.
  • Plasmid Vectors in certain embodiments, a plasmid vector is contemplated for use to transform a host cell, hi general, plasmid vectors containing replicon and control sequences which are derived from species compatible with the host cell are used in connection with these hosts.
  • the vector ordinarily carries a replication origin, as well as marking sequences which are capable of providing phenotypic selection in transformed cells.
  • E. coli is often transformed using derivatives of pBR322, a plasmid derived from an E. coli species.
  • pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells.
  • the pBR plasmid, or other microbial plasmid or phage must also contain, or be modified to contain, for example, promoters which can be used by the microbial organism for expression of its own proteins followed by sequences (Shine-Dalgarno) for efficient translation.
  • phage vectors containing replicon and control sequences that are compatible with the host microorganism can be used as transforming vectors in connection with these hosts.
  • the phage lambda G ⁇ MTM-11 may be utilized in making a recombinant phage vector that can be used to transform host cells, such as, for example, E. coli LE392.
  • Plasmid vectors include pIN vectors (hiouye et al, 1985); and pGEX vectors, for use in generating glutathione S-transferase (GST) soluble fusion proteins for later purification and separation or cleavage.
  • GST glutathione S-transferase
  • Other suitable fusion proteins are those with ⁇ -galactosidase, ubiquitin, and the like.
  • Bacterial host cells for example, E. coli, comprising the expression vector, are grown in any of a number of suitable media, for example, LB.
  • a nucleic acid is introduced into a cell via electroporation. Electroporation involves the exposure of a suspension of cells and DNA to a high-voltage electric discharge.
  • certain cell wall-degrading enzymes such as pectin-degrading enzymes
  • pectin-degrading enzymes are employed to render the target recipient cells more susceptible to transformation by electroporation than untreated cells.
  • recipient cells can be made more susceptible to transformation by mechanical wounding.
  • the terms "cell,” “cell line,” and “cell culture” may be used interchangeably. All of these terms also include their progeny, which is any and all subsequent generations. It is understood that all progeny may not be identical due to deliberate or inadvertent mutations.
  • host cell refers to a prokaryotic or eukaryotic cell, and it includes any transformable organism that is capable of replicating a vector and/or expressing a heterologous gene encoded by a vector.
  • a host cell can, and has been, used as a recipient for vectors.
  • a host cell may be "transfected” or “transformed,” which refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell.
  • a transformed cell includes the primary subject cell and its progeny.
  • RNAs or proteinaceous sequences may be co-expressed with other selected RNAs or proteinaceous sequences in the same host cell. Co-expression may be achieved by co-transfecting the host cell with two or more distinct recombinant vectors.
  • a single recombinant vector may be constructed to include multiple distinct coding regions for RNAs, which could then be expressed in host cells transfected with the single vector.
  • the host cell or tissue may be comprised in at least one organism.
  • the organism may be, but is not limited to, a prokaryote (e.g., a eubacteria, an archaea) or an eukaryote, as would be understood by one of ordinary skill in the art (see, for example, webpage phylogeny.arizona.edu/tree/phylogeny.html).
  • a plasmid or cosmid can be introduced into a prokaryote host cell for replication of many vectors.
  • Cell types available for vector replication and/or expression include, but are not limited to, bacteria, such as E. coli (e.g., E. coli strain RR1, E. coli L ⁇ 392, E. coli B, E. coli X 1776 (ATCC No. 31537) as well as E.
  • coli W3110 F-, lambda-, prototrophic, ATCC No. 273325), DH5 ⁇ , JM109, and KC8, bacilli such as Bacillus subtilis; and other enterobacteriaceae such as Salmonella typhimurium, Serratia marcescens, various Pseudomonas specie, as well as a number of commercially available bacterial hosts such as SURE ® Competent Cells and SOLOPACKTM Gold Cells (STRATAGENE ® , La Jolla).
  • bacterial cells such as E. coli LE392 are particularly contemplated as host cells for phage viruses. Many host cells from various cell types and organisms are available and would be known to one of skill in the art.
  • a viral vector may be used in conjunction with either a eukaryotic or prokaryotic host cell, particularly one that is permissive for replication or expression of the vector.
  • Some vectors may employ control sequences that allow it to be replicated and/or expressed in both prokaryotic and eukaryotic cells.
  • One of skill in the art would further understand the conditions under which to incubate all of the above described host cells to maintain them and to permit replication of a vector.
  • techniques and conditions that would allow large-scale production of vectors, as well as production of the nucleic acids encoded by vectors and their cognate polypeptides, proteins, or peptides. Numerous expression systems exist that comprise at least a part or all of the compositions discussed above.
  • Prokaryote- and/or eukaryote-based systems can be employed for use with the present invention to produce nucleic acid sequences, or their cognate polypeptides, proteins and peptides. Many such systems are commercially and widely available.
  • the insect cell/baculovirus system can produce a high level of protein expression of a heterologous nucleic acid segment, such as described in U.S. Patent No. 5,871,986,
  • proteins, polypeptides or peptides produced by the methods of the invention may be "overexpressed", i.e., expressed in increased levels relative to its natural expression in cells.
  • overexpression may be assessed by a variety of methods, including radio-labeling and/or protein purification.
  • simple and direct methods are preferred, for example, those involving SDS/PAGE and protein staining or western blotting, followed by quantitative analyses, such as densitometric scanning of the resultant gel or blot.
  • a specific increase in the level of the recombinant protein, polypeptide or peptide in comparison to the level in natural cells is indicative of overexpression, as is a relative abundance of the specific protein, polypeptides or peptides in relation to the other proteins produced by the host cell and, e.g., visible on a gel.
  • the expressed proteinaceous sequence forms an inclusion body in the host cell, the host cells are lysed, for example, by disruption in a cell homogenizer, washed and/or centrifuged to separate the dense inclusion bodies and cell membranes from the soluble cell components.
  • This centrifugation can be performed under conditions whereby the dense inclusion bodies are selectively enriched by incorporation of sugars, such as sucrose, into the buffer and centrifugation at a selective speed.
  • Inclusion bodies may be solubilized in solutions containing high concentrations of urea (e.g. 8M) or chaotropic agents such as guanidine hydrochlori.de in the presence of reducing agents, such as ⁇ -mercaptoethanol or DTT (dithiothreitol), and refolded into a more desirable conformation.
  • urea e.g. 8M
  • chaotropic agents such as guanidine hydrochlori.de
  • reducing agents such as ⁇ -mercaptoethanol or DTT (dithiothreitol)
  • purified proteins, polypeptides, or peptides as used herein, is intended to refer to an proteinaceous composition, isolatable from mammalian cells or recombinant host cells, wherein the at least one protein, polypeptide, or peptide is purified to any degree relative to its naturally-obtainable state, i.e., relative to its purity within a cellular extract.
  • a purified protein, polypeptide, or peptide therefore also refers to a wild-type or mutant protein, polypeptide, or peptide free from the environment in which it naturally occurs.
  • the nucleotide and protein, polypeptide and peptide sequences for various genes have been previously disclosed, and may be found at computerized databases known to those of ordinary skill in the art.
  • Genbank and GenPept databases are the National Center for Biotechnology Information's Genbank and GenPept databases (www.ncbi.nlm.nih.gov/).
  • the coding regions for these known genes may be amplified and/or expressed using the techniques disclosed herein or by any technique that would be known to those of ordinary skill in the art.
  • peptide sequences may be synthesized by methods known to those of ordinary skill in the art, such as peptide synthesis using automated peptide synthesis machines, such as those available from Applied Biosystems (Foster City, CA).
  • purified will refer to a specific protein, polypeptide, or peptide composition that has been subjected to fractionation to remove various other proteins, polypeptides, or peptides, and which composition substantially retains its activity, as may be assessed, for example, by the protein assays, as described herein below, or as would be known to one of ordinary skill in the art for the desired protein, polypeptide or peptide.
  • substantially purified will refer to a composition in which the specific protein, polypeptide, or peptide forms the major component of the composition, such as constituting about 50% of the proteins in the composition or more.
  • a substantially purified protein will constitute more than 60%, 70%,
  • a peptide, polypeptide or protein that is "purified to homogeneity," as applied to the present invention, means that the peptide, polypeptide or protein has a level of purity where the peptide, polypeptide or protein is substantially free from other proteins and biological components.
  • a purified peptide, polypeptide or protein will often be sufficiently free of other protein components so that degradative sequencing may be performed successfully.
  • Various methods for quantifying the degree of purification of proteins, polypeptides, or peptides will be known to those of skill in the art in light of the present disclosure.
  • determining the specific protein activity of a fraction or assessing the number of polypeptides within a fraction by gel electrophoresis.
  • a natural or recombinant composition comprising at least some specific proteins, polypeptides, or peptides will be subjected to fractionation to remove various other components from the composition, hi addition to those techniques described in detail herein below, various other techniques suitable for use in protein purification will be well known to those of skill in the art.
  • any purification method can now be employed. Although preferred for use in certain embodiments, there is no general requirement that the protein, polypeptide, or peptide always be provided in their most purified state. Indeed, it is contemplated that less substantially purified protein, polypeptide or peptide, which are nonetheless enriched in the desired protein compositions, relative to the natural state, will have utility in certain embodiments. Methods exhibiting a lower degree of relative purification may have advantages in total recovery of protein product, or in maintaining the activity of an expressed protein. Inactive products also have utility in certain embodiments, such as, e.g., in determining antigenicity via antibody generation.
  • EXAMPLE 1 METHODS USED FOR EVALUATION OF GP61 1.
  • Bacterial strains and plasmids E. coli DH5 ⁇ [F ⁇ 80dlacZAM15A(lacZYA-argF) U169 deoR recAl endAl hsdR17rk ' mk phoA supE44 ⁇ " thi-1 gyrA96 relAl] was used for plasmid purifications and as the general cloning host.
  • the E. coli BL21 (FomptT hsdSs r ⁇ i ) was used for expression and purification of recombinant gp61 and STMOOl 6.
  • coli K38 HfrC tonA22 garBIO ompF relAl pit- 10 spoTl T2 r phoA6
  • E. coli K.12 W3350 Fcou r r + m + ga lac
  • Bacteria were grown aerobically at 37°C in Luria-Bertani (LB) medium, supplemented, when required, with ampicillin at 100 ⁇ g/ml.
  • Protein expression was induced by supplementing media with arabinose to 0.2% final concentration in strains carrying pES61, pES613, pES614, pES615-pES6114, pES61H, pES16 andpES16H.
  • the gp61 gene was sequenced independently as part of the N4 genome (Pittsburgh Bacteriophage Institute, unpublished data). All sequence homology searches were done using available sequence data-bases via the BlastP program. Further regions of sequence similarity (i.e. putative peptidoglycan binding-domain) were identified via ProDom search program. 4. CHCl 3 -induced lysis of N4-infected cells E.
  • the recombinant proteins contain a 25 amino acid vector-encoded, C-terminal sequence ASFLEQKLISEEDLNSAVDHHHHHH (SEQ ID NO:21). 6. Cloning of gp61-phoA fusion proteins The sequences encoding the N-terminus of gp61 (aa 1-25 of SEQ ED NO:l), the full- length gp ⁇ l gene (SEQ ID NO:l), and the phoA gene (lacking the 5' segment coding for the signal sequence) were amplified using Pfu DNA-polymerase according to manufacturer's recommendations [gp61 N-terminal sequence primers:
  • CAGGCCATGGCAATAAGTAAGAAGAAAGTTGG (SEQ ED NO: 15) and CCACGAGCTCGGATCCACCCTCAACAGCAATAC (SEQ ID NO:22); gp61 primers: CAGGCCATGGCAATAAGTAAGAAGAAAGTTGG (SEQ ID NO: 15) and GCAGGAGCTCGGATCCGATGTCTTCATTACACC (SEQ ID NO:23); phoA primers: AAGGATCCCCACCTGTTCTGGAAAACCGGGCT (SEQ ID NO:24) and TTCTGCAGGTCTGGTTGCTAACAGC (SEQ ED NO:25)].
  • gp61 N-terminus or full-length gp61 gene and phoA were fused and inserted into pBAD/Myc-HisB plasmid through three-piece ligation to generate ⁇ ES613 (gp61N- terminus - phoA) and pES614 (gp61 full-length - phoA), respectively.
  • ⁇ ES613 gp61N- terminus - phoA
  • pES614 gp61 full-length - phoA
  • GGT ⁇ GCT, GGA ⁇ GCA (pES61H7)
  • Y29A TAC ⁇ GCG (pES618)
  • D35A GAC ⁇
  • GCC pES619
  • G37A, G38A GGA ⁇ GCA, GGT ⁇ GCT (pES61H10)
  • T40A ACT ⁇
  • GCT (pES61Hl l); T45A: ACT -> GCT (pES61H12); D104A: GAT ⁇ GCT (pES6113); N108A: AAT ⁇ GCT (pES61H14); Q119A: CAA ⁇ GCA (pES6115); N123A: AAT ⁇
  • GCT (pES61H16); Y132A: TAC ⁇ GCC (pES61H17); D138A: GAT ⁇ GCT (pES6118);
  • T145A ACT ⁇ GCT (pES6119); R156A: CGA ⁇ GCA (pES6120); E160A: GAA ⁇ GCA
  • Mutant STMOOl 6 enzymes contain the following DNA sequence changes: E12A: GAA ⁇ GCA (pES161 and pES16Hl) and E12D:
  • coli BL21 cells carrying pES61H were grown aerobically at 37°C to 3xl0 8 cells/ml. After 1 hour induction with 0.2% arabinose at 37°C in the presence of 5mM NaN 3 in order to prevent cell lysis, cells expressing gp61-His 6 were pelleted, resuspended in sonication buffer [(20mM Tris-HCl pH 8.0, 20mM NaCl, IX complete protease inhibitor EDTA-free (Roche)] and sonicated in pulses on ice.
  • sonication buffer (20mM Tris-HCl pH 8.0, 20mM NaCl, IX complete protease inhibitor EDTA-free (Roche)] and sonicated in pulses on ice.
  • Samples for N-terminal peptide sequencing were prepared by adding 25 ⁇ l of 5x loading buffer (250mM Tris-HCl pH 6.8, 500mM DTT, 10% SDS, 0.5% bromphenol blue, 50% glycerol) to lOO ⁇ l of lOmM purified gp ⁇ l. After electrophoresis on a 10% polyacrylamide - SDS gel, peptides were electroblotted to Immobilon-PSQ membrane (PVDF, Millipore) using transfer conditions as described (Matsudaira, 1987). Peptide sequencing was performed. 12. Lysis of EDTA-treated E. coli Purified gp ⁇ l (SEQ ID NO:l) His 6 was added to E.
  • 5x loading buffer 250mM Tris-HCl pH 6.8, 500mM DTT, 10% SDS, 0.5% bromphenol blue, 50% glycerol
  • E. coli peptidoglycan was purified according to Heidrich et al (2001). Purified peptidoglycan was freed from SDS by four washes with sterilized water. Purified peptidoglycan was resuspended in 20mM sodium phosphate buffer pH 4.8 and stored with addition of 0.02% NaN 3 . 14.
  • Nano-electrospray ionization mass spectrometry Positive ion mass spectra were acquired on Agilent 1100 XCT Ion Trap LC/MS/MS running standard ESI spray chamber equipped with a microspray nebulizer.
  • Fractions were loaded onto lOO ⁇ m id x 150mm Zorbax stable bond, 300A pore C-18 column.
  • the ion-trap was operated at an estimated dry gas flow of 7 L/min, dry gas temp of 250°C, nebulizer gas pressure 15 psi, cap voltage setting 1800V, skimmer 140V and scan range 100-2000 m/z.
  • the Agilent software allowed up to six consecutive fragmentation steps.
  • EXAMPLE 2 GP61 IS A NOVEL N-ACETYLMURAMIDASE
  • N4 phage does not lyse the host up to three hours after infection (Schito, 1967).
  • Approximately 3000 phage particles accumulate per infected cell forming paracrystalline phage inclusions within the host, hi the laboratory, phage progeny may be released by addition of CHC1 3 to disrupt the inner membrane.
  • ORF 61 encodes a 208aa protein (SEQ ID NO:l) with high sequence similarity to hypothetical proteobacterial proteins [Novosphingobium aromaticivorans SARO0833 (SEQ ID NO:2), Salmonella typhimurium STM0016 (SEQ ID NO:3), Salmonella typhi STY0016 (SEQ ID NO:4), Vibrio vulnificus CMP6 VV10124 (SEQ ID NO:5), Salmonella typhi STY1889 (SEQ ID NO:6), Brucella melitensis BMEI0095 (SEQ ID NO:8), Neisseria meningitides NMB1012 (SEQ ID NO:9), Neisseria meningitidis NMA1230 (SEQ ID NO:13), Vibrio vulnificus WA0851 (SEQ ID NO: 14), Mesorhizobium loti mlr8035 (SEQ ED NO: 11)] and
  • This 208aa protein contains a putative peptidoglycan binding domain (aa 118-157 of SEQ ID NO:l) common to some proteins with peptidoglycan-degrading activity. No predicted signal peptidase cleavage site following the N-terminal 18aa transmembrane domain is present suggesting that gp ⁇ l (SEQ ED NO:l) remains membrane bound (FIG. 5). E. coli or S. typhimurium cells expressing gp61 (SEQ ED NO:l) under pBAD control were lysed 20 min after induction (FIG. 6).
  • EDTA was used to disrupt the outer membrane in order to make peptidoglycan accessible to the enzyme (Leive, 1965). Based on these results, gp61 is a phage-encoded peptidoglycan-hydrolyzing enzyme capable of degrading peptidoglycan independently of holin proteins (Loessner et al, 1998; Loessner et al, 1999; Wang et al, 2000). Since gp ⁇ l has sequence similarity to hypothetical proteins, the Salmonella typhimurium ORF0016 (STMOOl 6, 2e-25) was cloned under pB AD control.
  • Negative ion MALDI and nESI-QIT mass spectrometry analysis of muropeptide fractions isolated after gp61 digest of the purified E. coli peptidoglycan via reverse-phase HPLC indicates that gp ⁇ l is an N-acetylmuramidase.
  • Alanine substitutions were made at some amino acids conserved amongst members of the family to identify amino acid residues essential for gp ⁇ l activity. Alanine substitutions at positions Y185, E26 and Y177 resulted in proteins with a marked delay in lysis (FIG. 15) and no detectable activity in vitro (FIG. 16).
  • Alanine substitutions at positions W189, D35 and Y29 resulted in proteins with a mild delay in lysis (FIG.
  • Bacteriophage lysins e.g., bacteriophage-encoded peptidoglycan hydrolases
  • N4 gp ⁇ l Based on the ability of gp ⁇ l (SEQ ID NO:l) to lyse Gram-negative strains from inside of the cell upon overexpression or from the outside of the cell with application of the purified enzyme following EDTA-treatment, uses for N4 gp ⁇ l include the following: 1) gp ⁇ l (SEQ ED NO:l) could be used for lysis of cells expressing gp ⁇ l for purification of cytoplasmic proteins either present or cloned in E. coli or Salmonella strains. Since gp61 localizes to the insoluble, membrane fraction of the cell, cytoplasmic proteins will not be contaminated with expressed or exogenously-added lysin. 2) gp ⁇ l (SEQ ID NO:l) could be used for lysis of Gram-negative pathogenic bacterial strains present in the nasopharyngeal tract through topical application, or systemic infections through intravenous injection.
  • compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
  • Bernhardt et al Proc. Natl. Acad. Sci. USA, 97:4297-4302, 2000. Bernhardt et al. , Science, 292:2326-2329, 2001.
  • Loessner et al J. Bacteriol, 181:4452-4460, 1999. Loessner et al, Mol. Micro., 44:335-349, 2002.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention overcomes the limitations of the prior art by providing novel peptidoglycan-hydrolases. In one aspect of the invention the peptidoglycan-hydrolyzing enzyme is gp61 (an N-acetylmuramidase) encoded by ORF61 of bacteriophage N4. The invention provides methods and compositions comprising use of gp6l, as well as homologs thereof. The invention will find use, for example, in the treatment of bacterial infections.

Description

DESCRIPTION PEPTIDOGLYCAN-HYDROLYZING PROTEIN ENCODED BY BACTERIOPHAGE N4 BACKGROUND OF THE INVENTION This application claims the benefit of U.S. Provisional Application Serial No.
60/563,327 filed April 19, 2004, and U.S. Provisional Application Serial No. 60/581,860 filed June 22, 2004, the entire disclosures of which are specifically incorporated herein by reference. The government may own rights in the present invention pursuant to grant number AI12575 from The National Institutes of Health. 1. Field of the Invention The present invention relates generally to the fields of molecular biology and bacteriophage genetics. More particularly, it concerns methods and compositions related to a novel peptidoglycan-hyrdolyzing enzyme (an N-acetylmuramidase) encoded by bacteriophage N4 and homologs thereof. 2. Description of Related Art Peptidoglycan hydrolases are enzymes that degrade the peptidoglycan, an essential cell wall component of most eubacteria. They are found in the genomes of many species, in particular bacteria and phages. Phage peptidoglycan hydrolases, otherwise known as lysins, are an essential component of phage-encoded systems for lysis of the infected host. Recently, a potential therapeutic role has been described for these enzymes. It was shown that application of purified lysins, from several bacteriophages that infect Bacillus anthracis or Streptococcus pneumonie, to their respective bacterial strains in liquid or solid media resulted in cell lysis (Loeffler et al, 2001; Loeffler and Fischetti, 2003; Schuch et al, 2002). Other studies demonstrated that previously colonized mice had undetectable pneumococcal titers after 5 hours of single enzyme treatment (Fischetti, 2003; Loeffler et al, 2003; Nelson et al, 2001). A benefit of lysins is the apparent inability of bacteria to develop resistance to these proteins. This is likely due to the fact that mutational changes preventing binding of the purified lysin would compromise the cell wall structure and, therefore, kill the bacterium. For these reasons, antibiotic-resistant bacteria that continue to be a serious problem in clinical settings are still vulnerable to exposure to peptidoglycan-hydrolyzing proteins. Although the use of peptidoglycan hydrolases to treat infections by bacteria holds great potential, several significant deficiencies have previously existed. For example, only a limited number of peptidoglycan-hydrolyzing proteins have been identified to date; thus, identification of additional peptidoglycan-hydrolyzing proteins would benefit clinical applications. Additionally, many peptidoglycan-hydrolyzing proteins are not membrane bound, and the lack of an N-terminal signal sequence limits the potential applications for these proteins, which limits the potential applications for these proteins. Therefore, the discovery of a peptidoglycan-hydrolyzing enzyme that can be exported to the periplasm and reach peptidoglycan substrate in an active form would greatly improve the efficacy and utility of the use of the peptidoglycan-hydrolyzing protein in certain applications. For example, if peptidoglycan hydrolase has an N-terminal signal sequence, it would be exported to the periplasm upon expression and would not require additional compounds such as CHC13 to facilitate degradation of the peptidoglycan and bacterial lysis. Therefore, expression of a peptidoglycan-hydrolyzing enzyme would eliminate the need for the external addition of compounds such as lysozyme or the use of French press or sonication for cell lysis during purification of recombinant proteins. Furthermore, if the exported peptidoglycan hydrolase remains membrane-bound and therefore insoluble, contamination of the soluble fraction containing the recombinant protein can be avoided.
SUMMARY OF THE INVENTION The present invention overcomes deficiencies in the prior art by providing the peptidoglycan-hydrolyzing protein N-acetylmuramidase N4 gp61 (SEQ ID NO:l) and derivatives and homologs thereof. N4 gp61 possesses a N-terminal signal sequence that is not proteolytically removed upon gp61 export to the periplasm (also referred to as the "transmembrane domain" or "transmembrane region"), and N4 gp61 exhibits a potent ability to lyse bacteria when bacteria express, and/or are contacted with, N4 gp61 (SEQ LD NO:l). h one aspect, the invention provides an isolated nucleic acid sequence encoding a gp61 polypeptide comprising the polypeptide sequence of SEQ LD NO:l or a fragment thereof having peptidoglycan-hydrolyzing activity, h one embodiment of the invention, the nucleic acid is operably linked to a heterologous promoter. Such a promoter may be an inducible promoter. In another aspect, the invention provides an isolated polypeptide comprising the polypeptide sequence of gp61 (SEQ LD NO:l) or a fragment thereof having peptidoglycan- hydrolyzing activity. Also included in the invention are polypeptides that are at least 90, 95 or 99% homologous to the polypeptide sequence of gp61. In further aspects of the invention, pharmaceutical compositions are provided comprising this and/or the other polypeptides described in accordance with the invention. The compositions may be formulated for treatment of a bacterial disease and may be formulated for topical or intravenous administration. The pharmaceutical compositions may also be further defined as an inhaled pharmaceutical composition. The compositions may comprise at least a second active ingredient, including an anti-infective agent. An example of an anti-infective agent is an antibiotic. In certain embodiments the compositions may comprise EDTA. In yet another aspect, the invention provides a pharmaceutical composition comprising a homolog of gp61 (SEQ LD NO:l) having peptidoglycan-hydrolyzing activity, wherein the homolog is selected from the group consisting of SARO0833 (SEQ LD NO:2), STM0016 (SEQ ID NO:3), STY0016 (SEQ ID NO:4), VV10124 (SEQ ID NO:5), STY1889 (SEQ LD NO:6), VFTML ORF19 (SEQ LD NO:7), BMEI0095 (SEQ ID NO:8), NMB 1012 (SEQ ID NO:9), BPP-1 Bbp2 (SEQ LD NO:10), mlr8035 (SEQ ID NO:ll), ECA2616 (SEQ LD NO:12), NMA1230 (SEQ LD NO:13), and WA0851 (SEQ LD NO:14), including polypeptides having at least 90, 95 or 99% amino acid identity to these polypeptide sequences, including cliimeras comprising the amino terminal sequences of gp61 including the transmembrane domain fused to the amino terminus of gp61 homologs. In one embodiment, the composition may further comprise CHC1 . In still yet another aspect, the invention provides a recombinant host cell transformed with the nucleic acid of claim 1, including sequences hybridizing thereto under stringent conditions. Such a nucleic acid may encode the polypeptide of SEQ ID NO: 1. The cell may be a bacterium, including a Gram-positive or Gram-negative bacterium. In still yet another aspect, the invention provides a method of treating a bacterial disease in a subject comprising administering to the subject a pharmaceutical composition of the invention. In certain embodiments, the subject is a mammal, including a human. The pharmaceutical composition may be applied topically, administered intranasally, and/or administered intravenously. The composition may further comprise CHC13. The bacterial disease may be caused by a Gram-negative or Gram-positive bacterium. In one embodiment, the bacterial disease is caused by salmonella, E. coli, pneumococci, or streptococci. The pharmaceutical composition may comprise EDTA. In still yet another aspect, the invention provides a method for lysing a bacteria comprising contacting the bacteria with gp61 (SEQ ID NO:l) or a fragment thereof having peptidoglycan-hydrolyzing activity. The method may be performed in vitro. The method may further comprise purifying a protein expressed by the bacteria. The protein may be a cytoplasmic protein and may be native to the bacteria, hi certain embodiments, the cytoplasmic protein is heterologously expressed by the bacteria, h the method, the bacterium may be transformed with a nucleic acid encoding gp61 (SEQ ID NO:l) or a fragment thereof having peptidoglycan-hydrolyzing activity and contacting may be achieved by inducing expression of the nucleic acid. The nucleic acid may be chromosomally integrated or extrachromosomal. The nucleic acid may also be operably linked to an inducible promoter, and the expression of the nucleic acid may be induced by activating the inducible promoter. In the method, the bacteria may be contacted with exogenously applied gp61 (SEQ LD NO:l). In still yet another aspect, the invention provides a method for lysing a bacteria comprising contacting the bacteria with a gp61 (SEQ ID NO:l) homolog or a fragment thereof having peptidoglycan-hydrolyzing activity, wherein the homolog is selected from the group consisting of SARO0833 (SEQ ID NO:2), STM0016 (SEQ ID NO:3), STY0016 (SEQ LD NO:4), VV10124 (SEQ LD NO:5), STY1889 (SEQ LD NO:6), VHML ORF19 (SEQ ID NO:7), BMEI0095 (SEQ ID NO:8), NMB 1012 (SEQ LD NO:9), BPP-1 Bbp2 (SEQ LD NO:10), mlr8035 (SEQ ED NO:ll), ECA2616 (SEQ ID NO:12), NMA1230 (SEQ ID NO:13), and VVA0851 (SEQ ID NO:14). In still yet another aspect, the invention provides a method for lysing a bacteria comprising contacting the bacteria with a chimeric proteins containing the N-terminus and transmembrane domain of gp61 (SEQ LD NO:l) fused to SARO0833 (SEQ ID NO:2), STM0016 (SEQ ID NO:3), STY0016 (SEQ LD NO:4), VV10124 (SEQ LD NO:5), STY1889 (SEQ LD NO:6), VHML ORF19 (SEQ LD NO:7), BMEI0095 (SEQ LD NO:8), NMB 1012 (SEQ ID NO:9), BPP-1 Bbp2 (SEQ ID NO:10), mlr8035 (SEQ ID NO:ll), ECA2616 (SEQ LD NO:12), NMA1230 (SEQ ED NO:13), and VVA0851 (SEQ ID NO:14). hi still yet another aspect, the invention provides a method for lysing a bacteria by expressing gp61 (SEQ ID NO:l) or chimeric proteins containing the N-terminus and transmembrane domain of gp61 (SEQ ID NO:l) fused to SARO0833 (SEQ BO NO:2), STM0016 (SEQ ID NO:3), STY0016 (SEQ ED NO:4), W10124 (SEQ ID NO:5), STY1889 (SEQ ED NO:6), VHML ORF19 (SEQ ID NO:7), BMEI0095 (SEQ ID NO:8), NMB 1012 (SEQ ID NO:9), BPP-1 Bbp2 (SEQ ID NO:10), mlr8035 (SEQ ED NO:ll), ECA2616 (SEQ LD NO:12), NMA1230 (SEQ ID NO:13), or WA0851 (SEQ LD NO:14), under an inducible promoter. Induction of expression of these proteins will produce cell lysis under conditions where the peptidoglycan-hydrolyzing activity will remain primarily membrane-bound, and therefore allow for purification of recombinant proteins with little or no contamination with exogenous soluble peptidoglycan-hydrolyzing activity. As used herein the specification, "a" or "an" may mean one or more. As used herein in the claim(s), when used in conjunction with the word "comprising", the words "a" or "an" may mean one or more than one. As used herein "another" may mean at least a second or more. It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method or composition of the invention, and vice versa. Furthermore, compositions of the invention can be used to achieve the methods of the invention. Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects. The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive. As used in this specification and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include"), or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. BRIEF DESCRIPTION OF THE DRAWINGS The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
FIG. 1A-B. Schematic representation of the bacterial cell wall. FIG. 1A, Gram- positive bacteria have a 20-80 nm peptidoglycan layer, located on the outer side of the inner membrane. FIG. IB, Gram-negative bacteria have a 2-3 nm peptidoglycan layer located in the periplasmic space enclosed by the inner and outer membranes of the cell.
FIG. 2. Schematic representation of the phage lytic enzymes' action. The holin protein forms pores in the inner membrane (LM) making peptidoglycan (PG) accessible to soluble endolysins. (OM - outer membrane). Peptidoglycan degradation due to endolysin activity leads to lysis of the infected cell and release of phage progeny. FIG. 3. Schematic representation of peptidoglycan structural components found in
Escherichia coli.
FIG. 4. Schematic representation of peptidoglycan structure. Numbered arrows point to bonds cleaved by the four major types of peptidoglycan hydrolases as described in the text.
FIG. 5. Sequence alignment of gp61 with hypothetical proteobacterial proteins, Vibrio harveyi phage VHML ORF 19, and Bordetella phage BMP-1 Bbp2. N4 ORF 61, present in the late region of the N4 genome, encodes a putative 208 aa protein with an N- terminal transmembrane domain (highlighted in yellow, only found in the gp61 sequence) and a putative peptidoglycan-binding domain (highlighted in blue) (gp61; SEQ ID NO:l).
SARO833 (SEQ ID NO:2): Novosphingobium aromaticivorans DSM 12444 (gi:2308512), le-26; STM0016 (SEQ ID NO:3): Salmonella typhimurium LT2 (gi: 16763406), le-24;
STY0016 (SEQ ID NO:4): Salmonella enterica subsp. enterica serovar Typhi (gi: 16759009),
5e-24; ECA2616 (SEQ ID NO:12): Er-winia carotovora subsp. Atroseptica SCRI1043,
(gi:49612067), 2e-22; VV10124 (SEQ ID NO:5): Vibrio vulnificus CMCP6 (gi:27363607),
3e-19; STY1889 (SEQ ED NO:6): Salmonella enterica subsp. enterica serovar Typhi (gi:16760660), 4e-17; VHMLORF19 (SEQ ID NO:7): Vibrio harveyi bacteriophage VHML (gi:27311185), 2e-16; BPP-1 Bbp2 (SEQ ID NO:10): Bordetella phage BPP-1 (gi:41179364), 3e-08; NMA1230 (SEQ ID NO:13): Neisseria meningitidis Z2491 (gi:7379919), 5e-08 are shown. Other homologs are NMB1012 (SEQ ID NO:9): Neisseria meningitidis MC58 (gi:15676901), 5e-08; BMEI0995 (SEQ ID NO:8): Brucella melitensis 16M (gi: 17987278), 5e-08; mh8035 (SEQ ID NO:ll): Mesorhizobium loti MAFF303099 (gi: 13476651), le-06; VVA0851 (SEQ ID NO:14): Vibrio vulnificus YJ016 (gi:37676511), 2e-06.
FIG. 6A-B. ORF 61 expression leads to cell lysis. FIG. 6 A, SDS-PAGE showing expression of gp61 under pBAD control; in the right lane all soluble proteins are missing due to cell lysis. FIG. 6B, Absorbance curve of E. coli cells expressing gp61 (SEQ ID NO:l) under pBAD control. Cells lysed 20 minutes after induction of gp61 expression with 0.2% arabinose.
FIG. 7A-B. Determining the topology of gp61. FIG. 7A, Schematic representation of gp61 (SEQ ED NO:l) orientation with respect to the cell wall in Gram-negative bacteria (OM — outer membrane, PG - peptidoglycan, EVI-inner membrane). FIG. 7B, SDS-PAGE of gp61 and gp61-phoA (gp61 -alkaline phosphatase) fusions. PhoA is only active in the periplasm.
FIG. 8A-B. C-terminally His6-tagged gp61 is active. FIG. 8A, C-terminally His6- tagged gp61 was purified under denaturing conditions via LMAC. FIG. 8B, Renatured protein was tested for peptidoglycan-degrading activity using a zymographic assay and compared to hen lysozyme at different protein concentrations. Peptidoglycan degradation on the zymogram is indicated by clearance at the position of protein in question. Whether the high activity is inherent to gp61 (SEQ ID NO:l) or due to better renaturation after SDS-PAGE is unknown.
FIG. 9A-B. C-terminally His6-tagged gp61 lyses EDTA-treated E. coli. FIG. 9 A, Purified gp61 was added to E. coli cells (3xl08 cells/ml) in TE buffer at 1.25 (■), 2.5 (A) and 10 (♦) μM concentration. Lysis was determined based on the decrease in absorbance intensity at 600 nm upon gp61 (SEQ ED NO:l) addition. FIG. 9B, Initial rates of cell lysis upon addition of gp61 at different gp61 concentrations.
FIG. 10A-B. Salmonella typhimurium ORF 0016 lysis cells upon CHC13 treatment. STMOOl 6 (SEQ ID NO:3) was cloned under pBAD control and cells were induced with 0.2% arabinose at t=0. FIG. 10A, Absorbance of cell cultures expressing gp61 (SEQ ID NO:l) (in black) and STMOOl 6 (in red) as a function of time after induction. Cells expressing STMOOl 6 lyse only after CHC13 since STMOOl 6 is predicted to be a soluble protein. FIG. 10B, SDS-PAGE showing expression of gp61 and STM0016, 30 min after induction. FIG. 11A-B. gp61TM-STM0016 chimera lyses cells without CHC13 treatment. gp61TM-STM0016 chimera was cloned under pBAD control and cells were induced with 0.2% arabinose at t=0. FIG. 11A, Absorbance of cell cultures expressing gp61 (SEQ ID NO:l) (in green), STM0016 (SEQ ID NO:3) (in blue) and gp61TM-STM0016 (in red) as a function of time after induction (+ indicates induced cultures). Cells expressing gpόlTM- STMOOl 6 lyse without CHC13 treatment since gp61 N-terminal transmembrane domain is sufficient for STMOOl 6 export to the periplasm. FIG. 11B, SDS-PAGE showing expression of gp61, STM0016 and gp61TM-STM0016 chimera, 30 min after induction.
FIG. 12A-B. Gp61 is an N-acetylmuramidase. FIG. 12 A, HPLC chromatograms (A206) of muropeptide fragments resulting from overnight digest of purified E. coli peptidoglycan with gp61 or T4 lysozyme (N-acetylmuramidase) in 20mM Tris, 0.2% Triton X-100. Muropeptides were eluted from a C-18 Hypersil BDS column using a linear 4-30% MeOH gradient in 0.1% TFA. FIG. 12B, The expected products from gp61 (T4 lysozyme - N-acetyl muramidase) digest are disaccharide-tetrapeptide of predicted mass 941.93 and disaccharide-tetrapeptide crosslinked to adjacent disaccharide-tetrapeptide of predicted mass 1865.85.
FIG. 13A-C. nESI-QIT mass spec analysis of HPLC fraction eluting at 37 min from gp61 digest of E. coli peptidoglycan reveals the expected product for N-acetylmuramidase digest of the predicted mass 941.93. FIG. 13A, Positive ion-mode nESI-QIT MS of HPLC fraction 38 min from the gp61 digest of E. coli peptidoglycan dominated by the singly charged molecular ion at m/z 942.5. FIG. 13B, MS2 - the first generation of the product ion spectrum (m/z 942.5) is dominated by a singly charged molecular ion at m/z 739.6 corresponding to the loss of one neutral N-acetylglucosamine (203.1 Da) as indicated in FIG. 13C that shows expected molecular ions resulting from the fragmentation of ion at m/z 942.5.
FIG. 14A-C. nESI-QIT mass spec analysis of HPLC fraction eluting at 63 min from gp61 digest of E. coli peptidoglycan reveals the expected product for N-acetylmuramidase digest of the predicted mass 1865.8. FIG. 14A, Positive ion-mode nESI-QIT MS of HPLC fraction 63 min from the gp61 digest of E. coli peptidoglycan dominated by the doubly charged molecular ion at m/z 933.9. FIG. 14B, MS2 - the first generation of the product ion spectrum (m/z 933.9) reveals two singly charged molecular ions at m/z 1662.6 and 1459.5 corresponding to the sequential loss of two neutral N-acetylglucosamine residues (203.1 Da) as indicated in FIG. 14C. FIG. 15A-B. Mutational analysis identifies residues essential for N4 gp61 activity
(SEQ ID NO:l). FIG. 15A, gp61 (SEQ ID NO:l) amino acid sequence with N-terminal transmembrane domain highlighted in yellow and putative peptidoglycan-binding domain highlighted in blue. Arrows indicate conserved amino acid residues that were changed to alanine (green arrows indicate mutations that did not have any effect on gp61 activity; purple arrows indicate mutations with partial effect on gp61 activity and red arrows indicate mutations that lead to inactivation of gp61 in vivo and in vitro). FIG. 15B, In vivo activity of gp61 mutant proteins. The expression of mutant gp61 proteins was induced at t= 0 min and cell lysis was monitored at A600.
FIG 16A-B. In vitro activity of gp61 mutant proteins. FIG. 16A, SDS-PAGE shows expression of gp61 mutant proteins. Those denoted by a star contain a His6-tag at the C- terminus. FIG. 16B, Zymographic analysis of gp61 mutant proteins. Mutant proteins highlighted in purple and wild-type protein were 50-fold diluted before loading onto the zymogram. All gpδl mutant proteins are identical to gp61 (SEQ ID NO:l) except for the noted mutation or presence of C-terminal His6-tag. FIG. 17A-C. Mutational analysis identifies catalytically essential glutamic acid located in the conserved EGGY motif. FIG. 17A, In vivo activity of gp61 mutant proteins. The expression of mutant gp61 proteins was induced and cell lysis was monitored.. - • - BL21(pES61H) cells expressing C-terminally His6-tagged gp61; -0- BL21(pES61H5) cells expressing C-terminally His6-tagged gp61 E26A; - - BL21(pES61H6) cells expressing C- terminally His6-tagged gp61 E26D. FIG. 17B, SDS-PAGE (left) and zymographic analysis (right) of gp61 wt, gp61 E26A and E26D proteins. 1, gp61-uninduced; 2, gp61; 3, gpδl E26A; 4, gp61 E26D. FIG. 17C, Sequence alignment of T4 lysozyme active site amino acids (in bold) and the putative gp61 active site, as determined from gp61 mutant analysis suggesting that gp61 may be an ortholog of T4 lysozyme. DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS The present invention overcomes deficiencies in the prior art by providing the peptidoglycan-hydrolyzing protein N-acetylmuramidase gp61 (SEQ ID NO:l). Gp61 possesses a transmembrane domain region and exhibits a potent ability to lyse bacteria when bacteria express, and/or are contacted with, gp61. Gp61 is unique among phage lysins since it does not depend on other phage-coded factors for its function in vivo; for example, expression of gp61 is sufficient for in vivo lysis of E. coli. In addition to gpδl, also provided are homologous proteins including, for example, Novosphingobium aromaticivorans SARO0833 [qi|23108512] (SEQ ID NO:2), Salmonella typhimurium STMOOl 6 [qi| 16763406] (SEQ ID NO:3), Salmonella typhi STY0016 [qi|16759009] (SEQ ID NO:4), Vibrio vulnificus VV10124 [gi|27363607] (SEQ ID NO:5), Salmonella Typhi STY1889 [gi|16760660] (SEQ ID NO:6), Vibrio harveyi bacteriophage VHMLORF19 [gi|27311185] (SEQ ID NO:7), Bordetella phage BPP-1 Bbp2 [gi|41179364] (SEQ ID NO:10), Neisseria meningitidis NMB1012 [gi|15676901] (SEQ ID NO:9), Brucella melitensis BMEI0995 [gi|17987278] (SEQ ID NO:8), Mesorhizobium loti mlr8035 [gi|13476651] (SEQ ID NO:l l), Vibrio vulnificus VVA0851 [gi|37676511] (SEQ ED NO:14), ECA2616 (SEQ ID NO: 12), NMA1230 (SEQ ID NO: 13), each of which are specifically contemplated by the inventors for lysing bacteria and/or treating bacterial diseases. Gp61 and its derivatives have many potential uses, including treatment of bacterial infections and isolation of proteins expressed heterologously in bacteria. Bacterial infection continues to be a serious clinical problem. In particular, the emergence of antibiotic-resistant strains of bacteria has made treatment of bacterial infections increasingly more difficult, and in many cases no effective treatments exist for these infections. Thus a need exists for new treatments for bacterial infection. Bacteriophages infect bacteria, and in the final stage of infection cause lysis of the infected bacterium. In particular, peptidoglycan-degrading enzymes (lysins or endolysins) are expressed by certain bacteriophages in the late stage of infection and cause degradation of the bacterial membrane, which results in cell lysis. Peptidoglycan-degrading enzymes, and in particular gp61 of the present invention, hold great promise for the treatment of bacterial infection. The final stage in a phage infectious cycle is the lysis of the host cell, which is accomplished by the degradation of the peptidoglycan (murein) structure located in the periplasmic space of Gram-negative bacteria and on the outer side of the cell membrane of Gram-positive bacteria (FIG. 1). Several strategies exist for lysis of bacteria by bacteriophages. The lysis of Escherichia coli by various bacteriophages occurs via at least the following two strategies: 1.) Some single-stranded DNA or single-stranded RNA phages rely on a single gene that does not encode a muralytic enzyme activity; instead, the gene product leads to inhibition of murein synthesis (Bernhardt et al, 2000; Bernhardt et al, 2001); and 2.) Double-stranded DNA phages encode an enzyme with peptidoglycan- degrading activity (Young, 1992), an endolysin lacking a secretion signal sequence that actively accumulates in the cytoplasm until a pore created by a phage-encoded holin protein forms in the inner membrane allowing endolysins access to the peptidoglycan (FIG. 2) (Wang et al, 2000; Young et al, 2000). The peptidoglycan layer of the bacterial membrane has a particular structure. The glycan strands in peptidoglycan consist of the amino sugars N-acetylglucosamine (GlcNAc) and N-acetylmuramic acid (MurNAc), which are linked by β-1,4 glycosidic bonds. Short peptides covalently attached to muramic acid are cross-linked forming the characteristic net structure of the peptidoglycan. eso-diaminopimelic acid (m-A2pm) is a dibasic amino acid that enables cross-linked peptide formation in E. coli. The dimeric peptide bridges form through D, D-peptide bonds between m-A pm and D-alanine via a pemcillin-sensitive transpeptidation reaction (FIG. 3) (Holtje, 1998). There are four major groups of endolysins (FIG. 4). Glycosylases (e.g., N- acetylmuramidase and/or N-acetylglucosaminidase) cleave cleave the β-1,4 glycosidic bond between muramic acid and glucosamine. Transglycosylases catalyze the same reaction onto the OH group of C6 from the muramic acids, yielding a 1,6 anhydromuramic acid (λ phage endolysin). These enzymes usually start at the non-reducing glucosamine end, cleaving the glycan strand in a progressive manner giving off disaccharide polypeptide chains as products. Amidases cleave the amide bond between the lactyl group of muramic acid and L-alanine of the peptide chain, releasing peptide chains with free N-terminal amino groups (Heidrich et al, 2001). Endopeptidases catalyze cleavage of the peptide cross-bridges in the peptidoglycan where the majority of crosslinks are formed by D, D peptide bond between D- alanine and eso-diaminopimelic acid (Ghyssen et al, 1966; Holtje, 1995). Some endolysins such as T4, T7 and λ phage lysins have been called lysozymes when in fact each protein has a different muralytic activity: glysosylase, amidase and transglycosylase, respectively (Young, 1992). i. ϋacteriai diseases and pharmaceutical compositions One aspect of the invention comprises methods and compositions for the treatment and/or prevention of bacterial infection. In one embodiment of the invention, a bacterial infection is treated and/or prevented by administration of gp61(SEQ ED NO:l) or a derivative thereof, h additional embodiments of the invention, a homolog of gp61 is provided, including SARO0833 (SEQ ID NO:2), STM0016 (SEQ ID NO:3), STY0016 (SEQ ID NO:4), VV10124 (SEQ ID NO:5), STY1889 (SEQ ID NO:6), VHMLORF19 (SEQ ID NO:7), BPP-lBbp2 (SEQ ID NO:10). NMB1012 (SEQ ID NO:9), BMEI0095 (SEQ ID NO:8), mlr8035 (SEQ ID NO: 11) and VVA0851 (SEQ ID NO: 14). It will be understood by those of skill in the art in light of the invention that fragments of these sequences and gp61 having peptidoglycan-hydrolyzing activity will similarly find use with the invention, as will variants comprising at least about 90%, 95%, 97%, 98% or 99% amino acid identity relative to these sequences and having peptidoglycan-hydrolyzing activity. Such variants will preferably retain conserved residues conferring peptidoglycan-hydrolyzing activity, for example, as shown in FIG. 15. hi certain further aspects of the invention, genomes that infect pathogenic bacteria may be modified by addition of one or more heterologous coding sequence of a peptidoglycan-hydrolyzing polypeptide provided by the invention. By introducing such coding sequences, therapeutic benefit may be obtained in treating bacterial infections. For example, nucleic acids encoding gp61 or other nucleic acids encoding peptidoglycan- hydrolyzing polypeptides may be introduced into a phage that is delivered as an antibacterial. Examples of bacterial viruses that may be modified in accordance with the invention and used to infect any given bacterium are well known in the art, as more than 5000 have been examined to date (Ackermann, 2001). Bacterial diseases include, but are not limited to, infection by the 83 or more distinct serotypes of pneumococci, streptococci such as S. pyogenes, S. agalactiae, S. equi, S. canis, S. bovis, S. equinus, S. anginosus, S. sanguis, S. salivarius, S. mitis, S. mutans, other viridans streptococci, peptostreptococci, other related species of streptococci, enterococci such as E. faecalis, E. faecium, Staphylococci, such as S. epidermidis, S. aureus, particularly in the nasopharynx, Hemophilus influenzae, pseudomonas species such as P. aeruginosa, P. pseudomallei, P. mallei, brucellas such as B. melitensis, B. suis, B. abortus, B. pertussis, N. meningitidis, N. gonorrhoeae, M. catarrhalis, C. diphtheriae, C. ulcerans, C. pseudotuberculosis, C. pseudodiphtheriticum, C. urealyticum, C. hemolyticum, C. equi, etc. L. monocytogenes, N. asteroides, Bacteroides species, Actinomycetes species, T. pallidum, Bacillus species including B. anthracis, Leptospirosa species and related organisms. Bacteria that cause bacterial diseases include Gram-positive and Gram-negative bacteria. The invention may also be useful against Gram-negative bacteria such as K. pneumoniae, E. coli, Proteus, S. species, Acinetobacter, Y. pestis, F. tularensis, Enterobacter species, Bacteriodes and Legionella species and the like. Preferred embodiments of the present invention include treatment of bacterial diseases caused by Salmonella and E. coli. One example of a treatment method may involve use of phage comprising heterologous nucleic acids provided by the invention, including the use of different regulatory elements. When administering a peptidoglycan-hydrolyzing compound provided by the invention, it may be desirable to formulate the compound in a pharmaceutical composition. One aspect of the current invention thus comprises a pharmaceutical composition comprising a peptidoglycan-hydrolysing compound provided by the invention in a biologically- acceptable carrier. Pharmaceutical compositions may be formulated for delivery by any means of administration, for example, intranasally, intradermally, intraarterially, intraperitoneally, mtralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, intramuscularly, subcutaneously, subconjunctival, intravesicularlly, mucosally, intrapericardially, intraumbilically, intraocularally, orally, topically, locally, inhalation (e.g., aerosol inhalation), injection, infusion, continuous infusion, localized perfusion bathing target cells directly, via a catheter, via a lavage, in cremes, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. 1990, incorporated herein by reference). Compounds may be administered in a pharmaceutically acceptable carrier, diluent or vehicle. The phrases "pharmaceutical or pharmacologically acceptable" refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate. The phrases "pharmaceutical or pharmacologically acceptable" refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate. The preparation of an pharmaceutical composition that contains at least one polypeptide selected from the group consisting of gp61 (SEQ ID NO:l), SARO0833 (SEQ ED NO:2), STM0016 (SEQ ED NO:3), STY0016 (SEQ ID NO:4), VV10124 (SEQ ED NO:5), STY1889 (SEQ ID NO:6), VHML ORF19 (SEQ ED NO:7), BMEI0095 (SEQ ID NO:8), NMB 1012 (SEQ ID NO:9), BPP-1 Bbp2 (SEQ ID NO: 10), mlr8035 (SEQ ID NO:ll), ECA2616 (SEQ ID NO: 12), NMA1230 (SEQ ID NO: 13), and VVA0851 (SEQ ID NO: 14), including an active fragment or additional active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 18th Ed., 1990, incorporated herein by reference. For animal (e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards. As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed., 1990, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated. The actual dosage amount of a composition of the present invention administered to an animal patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. In certain embodiments, about 100 units/ml to about 500,000 units/ml of fluid may be used in varying environments, including about 500, 1000, 10,000, 50,000, 200,000 and 400,000 units/ml. As described above, methods for determining appropriate dosages are well known to those of skill in the art and may involve consideration of many known variables. Those of skill in the art will immediately understand how to optimize these or other concentrations and determine an appropriate dosage for any given treatment in view of the current disclosure.
2. Biologically-Functional Equivalents Modifications and/or changes may be made in the structure of the polynucleotides and/or proteins provided by the invention, for example, SEQ ID NOs:l-12, while obtaining molecules having similar or improved characteristics, such biologically functional equivalents are also encompassed within the present invention. Set forth below are methods and considerations for preparing such modified compositions. A. Modified Polynucleotides and Polypeptides A biologically-functional equivalent may comprise a polynucleotide that has been engineered to contain distinct sequences while at the same time retaining the capacity to encode the "wild-type" or standard protein. This can be accomplished due to the degeneracy of the genetic code, i.e., the presence of multiple codons, which encode for the same amino acid, h one example, one of skill in the art may wish to introduce a restriction enzyme recognition sequence into a polynucleotide while not disturbing the ability of that polynucleotide to encode a protein. In another example, a polynucleotide made be (and encode) a biologically-functional equivalent with more significant changes. Certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen-binding regions of antibodies, binding sites on substrate molecules, receptors, and such like. So-called "conservative" changes do not disrupt the biological activity of the protein, as the structural change is not one that impinges on the protein's ability to carry out its designed function. It is thus contemplated by the inventors that various changes may be made in the sequence of genes and proteins disclosed herein, including the preparation of chimeras of soluble homologs to the transmembrane domain of N4 gp61, while still fulfilling the goals of the present invention. hi terms of functional equivalents, it is well understood by the skilled artisan that, inherent in the definition of a "biologically-functional equivalent" protein and/or polynucleotide, is the concept that there is a limit to the number of changes that may be made within a defined portion of the molecule while retaining a molecule with an acceptable level of equivalent biological activity. Biologically- functional equivalents are thus defined herein as those proteins (and polynucleotides) in which selected amino acids (or codons) may be substituted. Functional activity can be defined as the degree to which a polypeptide and/or polynucleotide (e.g., a polypeptide similar to gp61, SEQ ID NO:l) correlates with an increase in the lysis of bacteria. hi general, the shorter the length of the molecule, the fewer changes that can be made within the molecule while retaining function. Longer domains may have an intermediate number of changes. The full-length protein will have the most tolerance for a larger number of changes. However, it must be appreciated that certain molecules or domains that are highly dependent upon their structure may tolerate little or no modification. jr nmo aciα substitutions are generally based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and/or the like. An analysis of the size, shape and/or type of the amino acid side-chain substituents reveals that arginine, lysine and/or histidine are all positively charged residues; that alanine, glycine and/or serine are all a similar size; and/or that phenylalanine, tryptophan and/or tyrosine all have a generally similar shape. Therefore, based upon these considerations, arginine, lysine and/or histidine; alanine, glycine and/or serine; and/or phenylalanine, tryptophan and/or tyrosine; are defined herein as biologically functional equivalents. To effect more quantitative changes, the hydropathic index of amino acids may be considered. Each amino acid has been assigned a hydropathic index on the basis of its hydrophobicity and or charge characteristics, these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and/or arginine (-4.5). The importance of the hydropathic amino acid index in conferring interactive biological function on a protein is generally understood in the art (Kyte and Doolittle, 1982, incorporated herein by reference). It is known that certain amino acids may be substituted for other amino acids having a similar hydropathic index and/or score and/or still retain a similar biological activity. In making changes based upon the hydropathic index, the substitution of amino acids whose hydropathic indices are within ±2 is preferred, those which are within ±1 are particularly preferred, and/or those within ±0.5 are even more particularly preferred. It also is understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity, particularly where the biologically-functional equivalent protein and/or peptide thereby created is intended for use in immunological embodiments, as in certain embodiments of the present invention. U.S. Patent 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with its immunogenicity and/or antigenicity, i.e., with a biological property of the protein. As detailed in U.S. Patent 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0 ± 1); glutamate (+3.0 ± 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5 ± 1); alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4). hi making changes based upon similar hydrophilicity values, the substitution of amino acids whose hydrophilicity values are within ±2 is preferred, those which are within ±1 are particularly preferred, and/or those within ±0.5 are even more particularly preferred. B. Altered Amino Acids The present invention, in many aspects, relies on the synthesis of peptides and polypeptides (e.g., gpδl, SEQ ID NO:l) in cyto, via transcription and translation of appropriate polynucleotides. These peptides and polypeptides will include the twenty "natural" amino acids, and post-translational modifications thereof. However, in vitro peptide synthesis permits the use of modified and/or unusual amino acids. A table of exemplary, but not limiting, modified and/or unusual amino acids is provided herein below.
Figure imgf000018_0001
C. Mimetics In addition to the biologically-functional equivalents discussed above, the present inventors also contemplate that structurally similar compounds may be formulated to mimic the key portions of peptide or polypeptides of the present invention. Such compounds, which may be termed peptidomimetics, may be used in the same manner as the peptides of the invention and, hence, also are functional equivalents. Certain mimetics that mimic elements of protein secondary and tertiary structure are described in Johnson et al, (1993). The underlying rationale behind the use of peptide mimetics is that the peptide backbone of proteins exists chiefly to orient amino acid side chains in such a way as to facilitate molecular interactions, such as those of antibody and/or antigen. A peptide mimetic is thus designed to permit molecular interactions similar to the natural molecule. Some successful applications of the peptide mimetic concept have focused on mimetics of β-turns within proteins, which are known to be highly antigenic. Likely, β-turn structure within a polypeptide can be predicted by computer-based algorithms, as discussed herein. Once the component amino acids of the turn are determined, mimetics can be constructed to achieve a similar spatial orientation of the essential elements of the amino acid side chains. Other approaches have focused on the use of small, multidisulfide-containing proteins as attractive structural templates for producing biologically active conformations that mimic the binding sites of large proteins. Vita et al, (1998). A structural motif that appears to be evolutionarily conserved in certain toxins is small (30-40 amino acids), stable, and highly permissive for mutation. This motif is composed of a beta sheet and an alpha helix bridged in the interior core by three disulfides. Beta II turns have been mimicked successfully using cyclic L-pentapeptides and those with D-amino acids. Weisshoff et al, (1999). Also, Johannesson et al, (1999) report on bicyclic tripeptides with reverse turn inducing properties. Methods for generating specific structures have been disclosed in the art. For example, alpha-helix mimetics are disclosed in U.S. Patents 5,446,128; 5,710,245; 5,840,833; and 5,859,184. These structures render the peptide or protein more thermally stable, also increasing resistance to proteolytic degradation. Six, seven, eleven, twelve, thirteen and fourteen membered ring structures are disclosed. Methods for generating conformationally restricted beta turns and beta bulges are described, for example, in U.S. Patents 5,440,013; 5,618,914; and 5,670,155. Beta-turns permit changed side substituents without having changes in corresponding backbone conformation, and have appropriate termini for incorporation into peptides by standard synthesis procedures. Other types of mimetic turns include reverse and gamma turns. Reverse turn mimetics are disclosed in U.S. Patents 5,475,085 and 5,929,237, and gamma turn mimetics are described in U.S. Patents 5,672,681 and 5,674,976. 3. Nucleic Acid Compositions Certain embodiments of the present invention concern a nucleic acid encoding gp61 (SEQ ED NO:l) and homologs thereof, hi other aspects, a gp61 nucleic acid comprises a biologically functional equivalent thereof, hi further aspects, nucleic acid gp61 homologs may find use in the lysis of bacteria in a method provided by the invention, including nucleic acids encoding SARO0833 (SEQ ID NO:2), STM0016 (SEQ ID NO:3), STY0016 (SEQ ID NO:4), CMP6 VV10124 (SEQ ID NO:5), STY1889 (SEQ ID NO:6), VHML ORF19 (SEQ ED NO:7), BMEI0095 (SEQ ID NO:8), NMB 1012 (SEQ ED NO:9), BPP-1 Bbp2 (SEQ ED NO: 10), mlr8035 (SEQ ID NO: 11), ECA2616 (SEQ ID NO: 12), NMA1230 (SEQ ED NO:13), and WA0851 (SEQ ID NO:14) and active fragments, including chimeras. The term "nucleic acid" as used herein will generally refer to a molecule (i.e., a strand) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase. A nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine "A," a guanine "G," a thymine "T" or a cytosine "C") or RNA (e.g., an A, a G, an uracil "U" or a C). The term "nucleic acid" encompass the terms "oligonucleotide" and "polynucleotide," each as a subgenus of the term "nucleic acid." The term "oligonucleotide" refers to a molecule of between about 3 and about 100 nucleobases in length. The term "polynucleotide" refers to at least one molecule of greater than about 100 nucleobases in length. These definitions generally refer to a single-stranded molecule, but in specific embodiments will also encompass an additional strand that is partially, substantially or fully complementary to the single-stranded molecule. Thus, a nucleic acid may encompass a double-stranded molecule or a triple-stranded molecule that comprises one or more complementary strand(s) or "complement(s)" of a particular sequence comprising a molecule. As used herein, a single stranded nucleic acid may be denoted by the prefix "ss," a double stranded nucleic acid by the prefix "ds," and a triple stranded nucleic acid by the prefix "ts." As used herein a "nucleobase" refers to a heterocyclic base, such as for example a naturally occurring nucleobase (i.e., an A, T, G, C or U) found in at least one naturally occurring nucleic acid (i.e., DNA and RNA), and naturally or non-naturally occurring derivative(s) and analogs of such a nucleobase. A nucleobase generally can form one or more hydrogen bonds ("anneal" or "hybridize") with at least one naturally occurring nucleobase in manner that may substitute for naturally occurring nucleobase pairing (e.g., the hydrogen bonding between A and T, G and C, and A and U). A "nucleoside" refers to an individual chemical unit comprising a nucleobase covalently attached to a nucleobase linker moiety. A non-limiting example of a "nucleobase linker moiety" is a sugar comprising 5-carbon atoms (i.e., a "5-carbon sugar"), including but not limited to a deoxyribose, a ribose, an arabinose, or a derivative or an analog of a 5-carbon sugar. Non-limiting examples of a derivative or an analog of a 5-carbon sugar include a 2'- fluoro-2'-deoxyribose or a carbocyclic sugar where a carbon is substituted for an oxygen atom in the sugar ring. The term "nucleotide" refers to a nucleoside further comprising a "backbone moiety".
A backbone moiety generally covalently attaches a nucleotide to another molecule comprising a nucleotide, or to another nucleotide to form a nucleic acid. The "backbone moiety" in naturally occurring nucleotides typically comprises a phosphorus moiety, which is covalently attached to a 5-carbon sugar. The attachment of the backbone moiety typically occurs at either the 3'- or 5'-position of the 5-carbon sugar. However, other types of attachments are known in the art, particularly when a nucleotide comprises derivatives or analogs of a naturally occurring 5-carbon sugar or phosphorus moiety. A nucleic acid may be made by any technique known to one of ordinary skill in the art, such as for example, chemical synthesis, enzymatic production or biological production. Non-limiting examples of a synthetic nucleic acid (e.g., a synthetic oligonucleotide), include a nucleic acid made by in vitro chemical synthesis using phosphotriester, phosphite or phosphoramidite chemistry and solid phase techniques such as described in EP 266,032, incorporated herein by reference, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al, 1986 and U.S. Patent 5,705,629, each incorporated herein by reference. In the methods of the present invention, one or more oligonucleotide may be used. Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S. Patents. 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference. A non-limiting example of an enzymatically produced nucleic acid include one produced by enzymes in amplification reactions such as PCR™ (see for example, U.S. Patent 4,683,202 and U.S. Patent 4,682,195, each incorporated herein by reference), or the synthesis of an oligonucleotide described in U.S. Patent 5,645,897, incorporated herein by reference. A non-limiting example of a biologically produced nucleic acid includes a recombinant nucleic acid produced (i.e., replicated) in a living cell, such as a recombinant DNA vector replicated in bacteria (see for example, Sambrook et al, 2001, incorporated herein by reference). A nucleic acid may be purified on polyacrylamide gels, cesium chloride centrifugation gradients, or by any other means known to one of ordinary skill in the art (see for example, Sambrook et al, 2001, incorporated herein by reference). In certain aspect, the present invention concerns a nucleic acid that is an isolated nucleic acid. As used herein, the term "isolated nucleic acid" refers to a nucleic acid molecule (e.g., an RNA or DNA molecule) that has been isolated free of, or is otherwise free of, the bulk of the total genomic and transcribed nucleic acids of one or more cells, hi certain embodiments, "isolated nucleic acid" refers to a nucleic acid that has been isolated free of, or is otherwise free of, bulk of cellular components or in vitro reaction components such as for example, macromolecules such as lipids or proteins, small biological molecules, and the like. A nucleic acid may be a nucleic acid segment. As used herein, the term "nucleic acid segment," means smaller fragments of a nucleic acid, such as for non-limiting example, those that encode only part of the gp61 (SEQ ED NO:l) peptide or polypeptide sequence. Thus, a "nucleic acid segment" may comprise any part of a gene sequence, of from about 2 nucleotides to the full length of the gp61 (SEQ ID NO:l) peptide or polypeptide encoding region. The present invention also encompasses a nucleic acid that is complementary to a gp61 (SEQ ED NO:l) nucleic acid. In particular embodiments the invention encompasses a nucleic acid or a nucleic acid segment complementary to the sequence set forth in SEQ ED NO:l. A nucleic acid is "complement(s)" or is "complementary" to another nucleic acid when it is capable of base-pairing with another nucleic acid according to the standard Watson-Crick, Hoogsteen or reverse Hoogsteen binding complementarity rules. As used herein "another nucleic acid" may refer to a separate molecule or a spatially separated sequence of the same molecule. As used herein, the term "complementary" or "complement(s)" also refers to a nucleic acid comprising a sequence of consecutive nucleobases or semiconsecutive nucleobases (e.g., one or more nucleobase moieties are not present in the molecule) capable of hybridizing to another nucleic acid strand or duplex even if less than all the nucleobases do not base pair with a counterpart nucleobase. hi certain embodiments, a "complementary" nucleic acid comprises a sequence in which about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%), about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, to about 100%, and any range derivable therein, of the nucleobase sequence is capable of base-pairing with a single or double stranded nucleic acid molecule during hybridization. In certain embodiments, the term "complementary" refers to a nucleic acid that may hybridize to another nucleic acid strand or duplex in stringent conditions, as would be understood by one of ordinary skill in the art. In certain embodiments, a "partly complementary" nucleic acid comprises a sequence that may hybridize in low stringency conditions to a single or double stranded nucleic acid, or contains a sequence in which less than about 70%o of the nucleobase sequence is capable of base-pairing with a single or double stranded nucleic acid molecule during hybridization. As used herein, "hybridization", "hybridizes" or "capable of hybridizing" is understood to mean the forming of a double or triple stranded molecule or a molecule with partial double or triple stranded nature. The term "anneal" as used herein is synonymous with "hybridize." The term "hybridization", "hybridize(s)" or "capable of hybridizing" encompasses the terms "stringent condition(s)" or "high stringency" and the terms "low stringency" or "low stringency condition(s)." "Stringent condition(s)" or "high stringency" are those conditions that allow hybridization between or within one or more nucleic acid strand(s) containing complementary sequence(s), but precludes hybridization of random sequences. Stringent conditions tolerate little, if any, mismatch between a nucleic acid and a target strand. Such conditions are well known to those of ordinary skill in the art, and are preferred for applications requiring high selectivity. Non-limiting applications include isolating a nucleic acid, such as a gene or a nucleic acid segment thereof, or detecting at least one specific mRNA transcript or a nucleic acid segment thereof, and the like. Stringent conditions may comprise low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.15 M NaCl at temperatures of about 50°C to about 70°C, including 0.02 M NaCl at about 50°C. It is understood that the temperature and ionic strength of a desired stringency are determined in part by the length of the particular nucleic acid(s), the length and nucleobase content of the target sequence(s), the charge composition of the nucleic acid(s), and to the presence or concentration of formamide, tetramethylammonium chloride or other solvent(s) in a hybridization mixture. It is also understood that these ranges, compositions and conditions for hybridization are mentioned by way of non-limiting examples only, and that the desired stringency for a particular hybridization reaction is often determined empirically by comparison to one or more positive or negative controls. Depending on the application envisioned it is preferred to employ varying conditions of hybridization to achieve varying degrees of selectivity of a nucleic acid towards a target sequence. In a non-limiting example, identification or isolation of a related target nucleic acid that does not hybridize to a nucleic acid under stringent conditions may be achieved by hybridization at low temperature and/or high ionic strength. Such conditions are termed "low stringency" or "low stringency conditions", and non-limiting examples of low stringency include hybridization performed at about 0.15 M to about 0.9 M NaCl at a temperature range of about 20°C to about 50°C. Of course, it is within the skill of one in the art to further modify the low or high stringency conditions to suit a particular application. In certain instances, the inventors anticipate that mutants of the disclosed peptidoglycan-hydrolyzing enzymes (e.g., gp61; SEQ ED NO:l) and homologs thereof will be useful. Where employed, mutagenesis will be accomplished by a variety of standard, mutagenic procedures. Mutation is the process whereby changes occur in the quantity or structure of an organism. Mutation can involve modification of the nucleotide sequence of a single gene, blocks of genes or whole chromosome. Changes in single genes may be the consequence of point mutations that involve the removal, addition or substitution of a single nucleotide base within a DNA sequence, or they may be the consequence of changes involving the insertion or deletion of large numbers of nucleotides. Mutations can arise spontaneously as a result of events such as errors in the fidelity of
DNA replication or the movement of transposable genetic elements (transposons) within the genome. They also are induced following exposure to chemical or physical mutagens. Such mutation-inducing agents include ionizing radiations, ultraviolet light and a diverse array of chemical such as alkylating agents and polycyclic aromatic hydrocarbons, all of which are capable of interacting either directly or indirectly (generally following some metabolic biotransformations) with nucleic acids. The DNA lesions induced by such environmental agents may lead to modifications of base sequence when the affected DNA is replicated or repaired and thus to a mutation. Mutation also can be site-directed through the use of particular targeting methods. Random mutagenesis also may be introduced using error prone PCR (Cadwell and Joyce, 1992). The rate of mutagenesis may be increased by performing PCR in multiple tubes with dilutions of templates. One particularly useful mutagenesis technique is alanine scanning mutagenesis in which a number of residues are substituted individually with the amino acid alanine so that the effects of losing side-chain interactions can be determined, while minimizing the risk of large-scale perturbations in protein conformation (Cunningham et al, 1989). A method for generating libraries of displayed polypeptides is described in U.S. Patent 5,380,721. The method comprises obtaining polynucleotide library members, pooling and fragmenting the polynucleotides, and reforming fragments therefrom, performing PCR amplification, thereby homologously recombining the fragments to form a shuffled pool of recombined polynucleotides. Structure-guided site-specific mutagenesis represents a powerful tool for the dissection and engineering of protein-ligand interactions (Wells, 1996, Braisted et al, 1996). The technique provides for the preparation and testing of sequence variants by introducing one or more nucleotide sequence changes into a selected DNA. Site-specific mutagenesis uses specific oligonucleotide sequences which encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent, unmodified nucleotides. In tins way, a primer sequence is provided with sufficient size and complexity to form a stable duplex on both sides of the base-substitution or deletion junction being traversed. A primer of about 17 to 25 nucleotides in length is preferred, with about 5 to 10 residues on both sides of the junction of the sequence being altered. The technique typically employs a bacteriophage vector that exists in both a single- stranded and double-stranded form. Vectors useful in site-directed mutagenesis include vectors such as the M13 phage. These phage vectors are commercially available and their use is generally well known to those skilled in the art. Double-stranded plasmids are also routinely employed in site-directed mutagenesis, which eliminates the step of transferring the gene of interest from a phage to a plasmid. In general, one first obtains a single-stranded vector, or melts two strands of a double- stranded vector, which includes within its sequence a DNA sequence encoding the desired protein or genetic element. An oligonucleotide primer bearing the desired mutated sequence, synthetically prepared, is then annealed with the single-stranded DNA preparation, taking into account the degree of mismatch when selecting hybridization conditions. The hybridized product is subjected to DNA polymerizing enzymes such as E. coli polymerase I (Klenow fragment) in order to complete the synthesis of the mutation-bearing strand. Thus, a heteroduplex is formed, wherein one strand encodes the original non-mutated sequence, and the second strand bears the desired mutation. This heteroduplex vector is then used to transform appropriate host cells, such as E. coli cells, and clones are selected that include recombinant vectors bearing the mutated sequence arrangement. Comprehensive information on the functional significance and information content of a given residue of protein can best be obtained by saturation mutagenesis in winch all 19 amino acid substitutions are examined. The shortcoming of this approach is that the logistics of multiresidue saturation mutagenesis are daunting. However, improved techniques make production and rapid screening of mutants much more straightforward. See also, U.S. Patents 5,798,208 and 5,830,650, for a description of "walk-through" mutagenesis. Other methods of site-directed mutagenesis are disclosed in U.S. Patents 5,220,007; 5,284,760; 5,354,670; 5,366,878; 5,389,514; 5,635,377; and 5,789,166.
4. Nucleic Acid-Based Expression Systems In certain embodiments of the present invention, nucleic acids comprising sequences that encode gp61 (SEQ ID NO:l), SARO0833 (SEQ ED NO:2), STM0016 (SEQ ID NO:3), STY0016 (SEQ ID NO:4), CMP6 VV10124 (SEQ ED NO:5), STY1889 (SEQ ID NO:6), VHML ORF19 (SEQ ID NO:7), BMEI0095 (SEQ ID NO:8), NMB 1012 (SEQ ID NO:9), BPP-1 Bbp2 (SEQ ID NO:10), mlr8035 (SEQ ID NO:ll), ECA2616 (SEQ ID NO:12), NMA1230 (SEQ ID NO:13), and VVA0851 (SEQ ID NO:14), may be operably linked to a heterologous promoter and may be expressed using various in vitro or in vivo expression systems and vectors. One non-limiting example of such a use will be the lysis of bacteria on demand by induction of an inducible promoter linked to a nucleic acid encoding a peptidoglycan-hydrolyzing protein provided by the invention. In this manner, bacteria could be selectively lysed in order to facilitate purification of proteins expressed by the bacteria (e.g., recombinant proteins), since gp61 predominantly localizes to the membrane, and therefore would not contaminate the soluble fraction of the cell containing the protein of interest. A. Vectors The term "vector" is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated. A nucleic acid sequence can be "exogenous," which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found. Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs). One of skill in the art would be well equipped to construct a vector through standard recombinant techniques (see, for example, Maniatis et al, 1990 and Ausubel et al, 1996, both incorporated herein by reference). The term "expression vector" refers to any type of genetic construct comprising a nucleic acid capable of being transcribed into an RNA. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules or ribozymes. Expression vectors can contain a variety of "control sequences," which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host cell. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described infra. a. Promoters and Enhancers A "promoter" is a control sequence that is a region of a nucleic acid sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind, such as RNA polymerase and other transcription factors, to initiate the specific transcription of a nucleic acid sequence. The phrases "operatively positioned," "operatively linked," "under control," and "under transcriptional control" mean that a promoter is in a correct functional location and/or orientation in relation to a nucleic acid sequence to control transcriptional initiation and/or expression of that sequence. A promoter generally comprises a sequence that functions to position the start site for RNA synthesis. Vectors for transformation of cells generally, including prokaryotes and eukaryotes, and methods for introducing and expressing foreign genes with these vectors are well known in the art and are described in, for example, U.S. Pat. No. 4,952,496; U.S. Pat. No. 4,366,246; U.S. Pat. No. 4,798,885 and in Molecular Cloning, Cold Spring Harbor Laboratories, 1982; each of the disclosures of which are specifically incorporated herein by reference in the entirety. Examples of such vectors include the pBlueskript and phage Lambda ZAP vectors (Stratagene, La Jolla, Calif), and the like. Other suitable vectors include the pET expression vectors, which contains the T7 promoter, T7 terminator, the inducible E. coli lac operator, and the lac repressor gene. Examples of some prokaryotic promoters include prec A, ptrp, plac, ptac, pBAD and bacteriophage lambda P , and PL- Promoter function and expression of genes in prokaryotes typically requires availability of a sigma factor, which permits recognition of promoter elements and initiation of transcription at these specific sites. Cells may contain multiple sigma factors and their relative levels can control gene expression. It will therefore typically be desired to ensure adequate and appropriate expression of sigma factors for heterologous gene expression. Such sigma factors and the use thereof are well known in the art. See, e.g., U.S. Patent Nos. 6,297,358; the entire disclosures of which is specifically incorporated herein by reference. Depending on the promoter, individual elements may function either cooperatively or independently to activate transcription. A promoter may or may not be used in conjunction with an "enhancer," which refers to a cis-acting regulatory sequence involved in the transcriptional activation of a nucleic acid sequence. A promoter may be one naturally associated with a nucleic acid sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and/or exon. Such a promoter can be referred to as "endogenous." Similarly, an enhancer may be one naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence. Alternatively, certain advantages will be gained by positioning the coding nucleic acid segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid sequence in its natural environment. A recombinant or heterologous enhancer refers also to an enhancer not normally associated with a nucleic acid sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other virus, or prokaryotic or eukaryotic cell, and promoters or enhancers not "naturally occurring," i.e., containing different elements of different transcriptional regulatory regions, and/or mutations that alter expression. For example, promoters that are most commonly used in recombinant DNA construction include the bacterial arabinose (pBAD), β-lactamase (penicillinase), lactose and tryptophan (tip) promoter systems. In addition to producing nucleic acid sequences of promoters and enhancers synthetically, sequences may be produced using recombinant cloning and/or nucleic acid amplification technology, including PCR™, in connection with the compositions disclosed herein (see U.S. Patent Nos. 4,683,202 and 5,928,906, each incorporated herein by reference). Furthermore, it is contemplated the control sequences that direct transcription and/or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well. Naturally, it will be important to employ a promoter and/or enhancer that effectively directs the expression of the DNA segment in the organelle, cell type, tissue, organ, or organism chosen for expression. Those of skill in the art of molecular biology generally know the use of promoters, enhancers, and cell type combinations for protein expression, (see, for example Sambrook et al, 2001, incorporated herein by reference). The promoters employed may be constitutive, cell type-specific, inducible, and/or useful under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and/or peptides. The promoter may be heterologous or endogenous. b. Initiation Signals and Internal Ribosome Binding Sites A specific initiation signal also may be required for efficient translation of coding sequences. These signals include the ATG initiation codon or adjacent sequences. Exogenous translational control signals, including the ATG initiation codon, may need to be provided. One of ordinary skill in the art would readily be capable of determining this and providing the necessary signals. It is well known that the initiation codon must be "in-frame" with the reading frame of the desired coding sequence to ensure translation of the entire insert. The exogenous translational control signals and initiation codons can be either natural or synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate translation enhancer elements such as a Shine-Dalgarno sequence. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message (see U.S. Patent Nos. 5,925,565 and 5,935,819, each herein incorporated by reference). c. Multiple Cloning Sites Vectors can include a multiple cloning site (MCS), which is a nucleic acid region that contains multiple restriction enzyme sites, any of which can be used in conjunction with standard recombinant technology to digest the vector (see, for example, Carbonelli et al, 1999, Levenson et al, 1998, and Cocea, 1997, incorporated herein by reference.) "Restriction enzyme digestion" refers to catalytic cleavage of a nucleic acid molecule with an enzyme that functions only at specific locations in a nucleic acid molecule. Many of these restriction enzymes are commercially available. Use of such enzymes is widely understood by those of skill in the art. Frequently, a vector is linearized or fragmented using a restriction enzyme that cuts within the MCS to enable exogenous sequences to be ligated to the vector. "Ligation" refers to the process of forming phosphodiester bonds between two nucleic acid fragments, which may or may not be contiguous with each other. Techniques involving restriction enzymes and ligation reactions are well known to those of skill in the art of recombinant technology. d. Termination Signals The vectors or constructs of the present invention will generally comprise at least one termination signal. A "termination signal" or "terminator" is comprised of the DNA sequences involved in specific termination of an RNA transcript by an RNA polymerase. Thus, in certain embodiments a termination signal that ends the production of an RNA transcript is contemplated. A terminator may be necessary in vivo to achieve desirable message levels. e. Origins of Replication In order to propagate a vector in a host cell, it may contain one or more origins of replication sites (often termed "ori"), which is a specific nucleic acid sequence at which replication is initiated. Alternatively, an autonomously replicating sequence (ARS) can be employed if the host cell is yeast. f. Selectable and Screenable Markers In certain embodiments of the invention, cells containing a nucleic acid construct of the present invention may be identified in vitro or in vivo by including a marker in the expression vector. Such markers would confer an identifiable change to the cell permitting easy identification of cells containing the expression vector. Generally, a selectable marker is one that confers a property that allows for selection. A positive selectable marker is one in which the presence of the marker allows for its selection, while a negative selectable marker is one in which its presence prevents its selection. An example of a positive selectable marker is a drug resistance marker. Usually the inclusion of a drug selection marker aids in the cloning and identification of transformants, for example, genes that confer resistance to kanamycin, tetracycline, chloramphenicol and ampicillin are useful selectable markers. In addition to markers conferring a phenotype that allows for the discrimination of transformants based on the implementation of conditions, other types of markers including screenable markers such as GFP, whose basis is colorimetric analysis, are also contemplated. Alternatively, screenable enzymes such as chloramphenicol acetyltransferase (CAT) may be utilized. One of skill in the art would also know how to employ immunologic markers, possibly in conjunction with FACS analysis. The marker used is not believed to be important, so long as it is capable of being expressed simultaneously with the nucleic acid encoding a gene product. Further examples of selectable and screenable markers are well known to one of skill in the art. g. Plasmid Vectors In certain embodiments, a plasmid vector is contemplated for use to transform a host cell, hi general, plasmid vectors containing replicon and control sequences which are derived from species compatible with the host cell are used in connection with these hosts. The vector ordinarily carries a replication origin, as well as marking sequences which are capable of providing phenotypic selection in transformed cells. In a non-limiting example, E. coli is often transformed using derivatives of pBR322, a plasmid derived from an E. coli species. pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells. The pBR plasmid, or other microbial plasmid or phage must also contain, or be modified to contain, for example, promoters which can be used by the microbial organism for expression of its own proteins followed by sequences (Shine-Dalgarno) for efficient translation. In addition, phage vectors containing replicon and control sequences that are compatible with the host microorganism can be used as transforming vectors in connection with these hosts. For example, the phage lambda GΕM™-11 may be utilized in making a recombinant phage vector that can be used to transform host cells, such as, for example, E. coli LE392. Further useful plasmid vectors include pIN vectors (hiouye et al, 1985); and pGEX vectors, for use in generating glutathione S-transferase (GST) soluble fusion proteins for later purification and separation or cleavage. Other suitable fusion proteins are those with β-galactosidase, ubiquitin, and the like. Bacterial host cells, for example, E. coli, comprising the expression vector, are grown in any of a number of suitable media, for example, LB. The expression of the recombinant protein in certain vectors may be induced, as would be understood by those of skill in the art, by contacting a host cell with an agent specific for certain promoters, e.g., by adding EPTG or arabinose to the media or by switching incubation to a higher temperature. After culturing the bacteria for a further period, generally of between 2 and 24 h, the cells are collected by centrifugation and washed to remove residual media. B. Vector Delivery In certain embodiments of the present invention, a nucleic acid is introduced into a cell via electroporation. Electroporation involves the exposure of a suspension of cells and DNA to a high-voltage electric discharge. In some variants of this method, certain cell wall-degrading enzymes, such as pectin-degrading enzymes, are employed to render the target recipient cells more susceptible to transformation by electroporation than untreated cells (U.S. Patent No. 5,384,253, incorporated herein by reference). Alternatively, recipient cells can be made more susceptible to transformation by mechanical wounding. As used herein, the terms "cell," "cell line," and "cell culture" may be used interchangeably. All of these terms also include their progeny, which is any and all subsequent generations. It is understood that all progeny may not be identical due to deliberate or inadvertent mutations. In the context of expressing a heterologous nucleic acid sequence, "host cell" refers to a prokaryotic or eukaryotic cell, and it includes any transformable organism that is capable of replicating a vector and/or expressing a heterologous gene encoded by a vector. A host cell can, and has been, used as a recipient for vectors. A host cell may be "transfected" or "transformed," which refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A transformed cell includes the primary subject cell and its progeny. As used herein, the terms "engineered" and "recombinant" cells or host cells are intended to refer to a cell into which an exogenous nucleic acid sequence, such as, for example, a vector, has been introduced. Therefore, recombinant cells are distinguishable from naturally occurring cells that do not contain a recombinantly introduced nucleic acid. In certain embodiments, it is contemplated that RNAs or proteinaceous sequences may be co-expressed with other selected RNAs or proteinaceous sequences in the same host cell. Co-expression may be achieved by co-transfecting the host cell with two or more distinct recombinant vectors. Alternatively, a single recombinant vector may be constructed to include multiple distinct coding regions for RNAs, which could then be expressed in host cells transfected with the single vector. In certain embodiments, the host cell or tissue may be comprised in at least one organism. In certain embodiments, the organism may be, but is not limited to, a prokaryote (e.g., a eubacteria, an archaea) or an eukaryote, as would be understood by one of ordinary skill in the art (see, for example, webpage phylogeny.arizona.edu/tree/phylogeny.html). Numerous cell lines and cultures are available for use as a host cell, and they can be obtained through the American Type Culture Collection (ATCC), which is an organization that serves as an archive for living cultures and genetic materials (www.atcc.org). An appropriate host can be determined by one of skill in the art based on the vector backbone and the desired result. A plasmid or cosmid, for example, can be introduced into a prokaryote host cell for replication of many vectors. Cell types available for vector replication and/or expression include, but are not limited to, bacteria, such as E. coli (e.g., E. coli strain RR1, E. coli LΕ392, E. coli B, E. coli X 1776 (ATCC No. 31537) as well as E. coli W3110 (F-, lambda-, prototrophic, ATCC No. 273325), DH5α, JM109, and KC8, bacilli such as Bacillus subtilis; and other enterobacteriaceae such as Salmonella typhimurium, Serratia marcescens, various Pseudomonas specie, as well as a number of commercially available bacterial hosts such as SURE® Competent Cells and SOLOPACK™ Gold Cells (STRATAGENE®, La Jolla). In certain embodiments, bacterial cells such as E. coli LE392 are particularly contemplated as host cells for phage viruses. Many host cells from various cell types and organisms are available and would be known to one of skill in the art. Similarly, a viral vector may be used in conjunction with either a eukaryotic or prokaryotic host cell, particularly one that is permissive for replication or expression of the vector. Some vectors may employ control sequences that allow it to be replicated and/or expressed in both prokaryotic and eukaryotic cells. One of skill in the art would further understand the conditions under which to incubate all of the above described host cells to maintain them and to permit replication of a vector. Also understood and known are techniques and conditions that would allow large-scale production of vectors, as well as production of the nucleic acids encoded by vectors and their cognate polypeptides, proteins, or peptides. Numerous expression systems exist that comprise at least a part or all of the compositions discussed above. Prokaryote- and/or eukaryote-based systems can be employed for use with the present invention to produce nucleic acid sequences, or their cognate polypeptides, proteins and peptides. Many such systems are commercially and widely available. The insect cell/baculovirus system can produce a high level of protein expression of a heterologous nucleic acid segment, such as described in U.S. Patent No. 5,871,986,
4,879,236, both herein incorporated by reference, and which can be bought, for example, under the name MAXBAC® 2.0 from INVITROGEN® and BACPACK™ BACULOVIRUS
EXPRESSION SYSTEM FROM CLONTECH®. It is contemplated that the proteins, polypeptides or peptides produced by the methods of the invention may be "overexpressed", i.e., expressed in increased levels relative to its natural expression in cells. Such overexpression may be assessed by a variety of methods, including radio-labeling and/or protein purification. However, simple and direct methods are preferred, for example, those involving SDS/PAGE and protein staining or western blotting, followed by quantitative analyses, such as densitometric scanning of the resultant gel or blot. A specific increase in the level of the recombinant protein, polypeptide or peptide in comparison to the level in natural cells is indicative of overexpression, as is a relative abundance of the specific protein, polypeptides or peptides in relation to the other proteins produced by the host cell and, e.g., visible on a gel. In some embodiments, the expressed proteinaceous sequence forms an inclusion body in the host cell, the host cells are lysed, for example, by disruption in a cell homogenizer, washed and/or centrifuged to separate the dense inclusion bodies and cell membranes from the soluble cell components. This centrifugation can be performed under conditions whereby the dense inclusion bodies are selectively enriched by incorporation of sugars, such as sucrose, into the buffer and centrifugation at a selective speed. Inclusion bodies may be solubilized in solutions containing high concentrations of urea (e.g. 8M) or chaotropic agents such as guanidine hydrochlori.de in the presence of reducing agents, such as β-mercaptoethanol or DTT (dithiothreitol), and refolded into a more desirable conformation. C. Proteins, Polypeptides, and Peptides The present invention also provides purified, and in preferred embodiments, substantially purified, proteins, polypeptides, or peptides. The term "purified proteins, polypeptides, or peptides" as used herein, is intended to refer to an proteinaceous composition, isolatable from mammalian cells or recombinant host cells, wherein the at least one protein, polypeptide, or peptide is purified to any degree relative to its naturally-obtainable state, i.e., relative to its purity within a cellular extract. A purified protein, polypeptide, or peptide therefore also refers to a wild-type or mutant protein, polypeptide, or peptide free from the environment in which it naturally occurs. The nucleotide and protein, polypeptide and peptide sequences for various genes have been previously disclosed, and may be found at computerized databases known to those of ordinary skill in the art. One such database is the National Center for Biotechnology Information's Genbank and GenPept databases (www.ncbi.nlm.nih.gov/). The coding regions for these known genes may be amplified and/or expressed using the techniques disclosed herein or by any technique that would be known to those of ordinary skill in the art. Additionally, peptide sequences may be synthesized by methods known to those of ordinary skill in the art, such as peptide synthesis using automated peptide synthesis machines, such as those available from Applied Biosystems (Foster City, CA). Generally, "purified" will refer to a specific protein, polypeptide, or peptide composition that has been subjected to fractionation to remove various other proteins, polypeptides, or peptides, and which composition substantially retains its activity, as may be assessed, for example, by the protein assays, as described herein below, or as would be known to one of ordinary skill in the art for the desired protein, polypeptide or peptide. Where the term "substantially purified" is used, this will refer to a composition in which the specific protein, polypeptide, or peptide forms the major component of the composition, such as constituting about 50% of the proteins in the composition or more. In preferred embodiments, a substantially purified protein will constitute more than 60%, 70%,
80%, 90%), 95%), 99%) or even more of the proteins in the composition. A peptide, polypeptide or protein that is "purified to homogeneity," as applied to the present invention, means that the peptide, polypeptide or protein has a level of purity where the peptide, polypeptide or protein is substantially free from other proteins and biological components. For example, a purified peptide, polypeptide or protein will often be sufficiently free of other protein components so that degradative sequencing may be performed successfully. Various methods for quantifying the degree of purification of proteins, polypeptides, or peptides will be known to those of skill in the art in light of the present disclosure. These include, for example, determining the specific protein activity of a fraction, or assessing the number of polypeptides within a fraction by gel electrophoresis. To purify a desired protein, polypeptide, or peptide a natural or recombinant composition comprising at least some specific proteins, polypeptides, or peptides will be subjected to fractionation to remove various other components from the composition, hi addition to those techniques described in detail herein below, various other techniques suitable for use in protein purification will be well known to those of skill in the art. These include, for example, precipitation with ammonium sulfate, PEG, antibodies and the like or by heat denaturation, followed by centrifugation; chromatography steps such as ion exchange, gel filtration, reverse phase, hydroxylapatite, lectin affinity and other affinity chromatography steps; isoelectric focusing; gel electrophoresis; and combinations of such and other techniques . Another example is the purification of a specific fusion protein using a specific binding partner. Such purification methods are routine in the art. As the present invention provides DNA sequences for the specific proteins, any fusion protein purification method can now be practiced. This is exemplified by the generation of a specific protein-glutathione S-transferase fusion protein, expression in E. coli, and isolation to homogeneity using affinity chromatography on glutathione-agarose or the generation of a polyhistidine tag on the N- or C-terminus of the protein, and subsequent purification using Ni-affinity chromatography. However, given that many DNA and proteins are known, or may be identified and amplified using the methods described herein, any purification method can now be employed. Although preferred for use in certain embodiments, there is no general requirement that the protein, polypeptide, or peptide always be provided in their most purified state. Indeed, it is contemplated that less substantially purified protein, polypeptide or peptide, which are nonetheless enriched in the desired protein compositions, relative to the natural state, will have utility in certain embodiments. Methods exhibiting a lower degree of relative purification may have advantages in total recovery of protein product, or in maintaining the activity of an expressed protein. Inactive products also have utility in certain embodiments, such as, e.g., in determining antigenicity via antibody generation.
5. Examples The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
EXAMPLE 1 METHODS USED FOR EVALUATION OF GP61 1. Bacterial strains and plasmids E. coli DH5α [F§80dlacZAM15A(lacZYA-argF) U169 deoR recAl endAl hsdR17rk' mk phoA supE44 λ" thi-1 gyrA96 relAl] was used for plasmid purifications and as the general cloning host. The E. coli BL21 (FomptT hsdSs r^ i ) was used for expression and purification of recombinant gp61 and STMOOl 6. E. coli K38 (HfrC tonA22 garBIO ompF relAl pit- 10 spoTl T2r phoA6) was used for expression of recombinant gp61-phoA fusions as described below. E. coli K.12 W3350 (Fcour r+m+ ga lac ) was used for phage infections. 2. Media and growth conditions Bacteria were grown aerobically at 37°C in Luria-Bertani (LB) medium, supplemented, when required, with ampicillin at 100 μg/ml. Protein expression was induced by supplementing media with arabinose to 0.2% final concentration in strains carrying pES61, pES613, pES614, pES615-pES6114, pES61H, pES16 andpES16H. 3. Sequence analysis of N4 genome The gp61 gene was sequenced independently as part of the N4 genome (Pittsburgh Bacteriophage Institute, unpublished data). All sequence homology searches were done using available sequence data-bases via the BlastP program. Further regions of sequence similarity (i.e. putative peptidoglycan binding-domain) were identified via ProDom search program. 4. CHCl3-induced lysis of N4-infected cells E. coli K12 W3350 was used to prepare wild-type N4 phage as described (Falco et al, 1980). E. coli K12 W3350 strain was grown aerobically at 37°C to 3xl08 cells/ml concentration. At t = 0 min, cells were infected with N4wt or N4am7 phage (blocked in late transcription) at a multiplicity of infection of 10. Where indicated, 100 μl of CHC13 was added to 10 ml culture aliquots. Cell lysis was determined by the decrease in absorbance of the infected cultures at 600 nm. 5. Cloning of the full-length gp61 gene and STMOOl 6 gene Standard cloning techniques were used for manipulating plasmid DNA, which was electro-transformed into E. coli. Restriction endonucleases were purchased from New England Biolabs (Beverly, MA) and ohgonucleotides were purchased from Integrated DNA Technologies (Coralville, LA). DNA fragments used for cloning the gp61 and STMOOl 6 genes were generated by PCR amplification using coliphage N4 and S. typhi genomic DNAs, respectively. Amplicons encoding gpδl and STMOOl 6, were synthesized using Pfu DNA polymerase (Stratagene) according to the manufacturer's conditions. [gp61 primers: CAGGCCATGGCAATAAGTAAGAAGAAAGTTGG (SEQ ED NO: 15) and CAGCGGTACCCCTCCCAAAAGACATACAG (SEQ ID NO: 16); STM0016 primers: GCAGCCATGGGGAATCCAATTATAGATGG (SEQ ID NO: 17) and
CTGCGGTACCTTAGGTCACTCTATTCTTG (SEQ ID NO:18)]. The gp61 and STM0016 amplicons were cloned into the Ncol and Kpnl sites of expression plasmid pB AD/Myc-His B (Invitrogen) to generate pES61 and pES 16, respectively. To clone the gp61 (SEQ ID NO:l) and STMOOl 6 (SEQ ID NO:3) genes with a C- terminal His6 tag, Pfu DNA polymerase (Stratagene) was used for gene amplification according to manufacturer's conditions [gp61 primers:
CAGGCCATGGCAATAAGTAAGAAGAAAGTTGG (SEQ ID NO: 15) and GGACAAGCTTGCATTAACGATGTCTTCATTACAC (SEQ ED NO:19); STM0016 primers: GCAGCCATGGGGAATCCAATTATAGATGG (SEQ ID NO: 17) and CTGCAAGCTTGTCACTCTATTCTTGATCC (SEQ ID NO:20)] These amplicons were cloned into pBAD/Myc-His B (invitrogen) using Ncol and Hindlll sites to generate pES61H and pES16H. The recombinant proteins contain a 25 amino acid vector-encoded, C-terminal sequence ASFLEQKLISEEDLNSAVDHHHHHH (SEQ ID NO:21). 6. Cloning of gp61-phoA fusion proteins The sequences encoding the N-terminus of gp61 (aa 1-25 of SEQ ED NO:l), the full- length gpδl gene (SEQ ID NO:l), and the phoA gene (lacking the 5' segment coding for the signal sequence) were amplified using Pfu DNA-polymerase according to manufacturer's recommendations [gp61 N-terminal sequence primers:
CAGGCCATGGCAATAAGTAAGAAGAAAGTTGG (SEQ ED NO: 15) and CCACGAGCTCGGATCCACCCTCAACAGCAATAC (SEQ ID NO:22); gp61 primers: CAGGCCATGGCAATAAGTAAGAAGAAAGTTGG (SEQ ID NO: 15) and GCAGGAGCTCGGATCCGATGTCTTCATTACACC (SEQ ID NO:23); phoA primers: AAGGATCCCCACCTGTTCTGGAAAACCGGGCT (SEQ ID NO:24) and TTCTGCAGGTCTGGTTGCTAACAGC (SEQ ED NO:25)]. Using primer-introduced restriction sites, Ncol and Bam HI for the gp61 gene segments and Bam HI and Pstl for the phoA gene, the gp61 N-terminus or full-length gp61 gene and phoA were fused and inserted into pBAD/Myc-HisB plasmid through three-piece ligation to generate ρES613 (gp61N- terminus - phoA) and pES614 (gp61 full-length - phoA), respectively. 7. Alkaline-phosphatase activity assay Cells carrying pES613 and pES614 were grown at 37°C to 3xl08 cells/ml and induced for 1 hour with 0.2%) arabinose. Cells were spun down and resuspended in IM Tris-HCl, pH 8.0. Alkaline phosphatase activity was determined as described (Brickman and Beckwith, 1975). p-nitrophenyl phosphate was purchased from Sigma- Aldrich. 8. Site-directed mutagenesis of gp61 Site-directed mutagenesis was carried out on pES61 using the Stratagene QuikChange Site-Directed Mutagenesis Kit. Mutant gpδl enzymes contain the following DNA sequence changes: E26A: GAG → GCG (pES615); E26D: GAG -> GAC (pES61H6); G27A, G28A:
GGT → GCT, GGA→ GCA (pES61H7); Y29A: TAC →GCG (pES618); D35A: GAC →
GCC (pES619); G37A, G38A: GGA → GCA, GGT → GCT (pES61H10); T40A: ACT →
GCT (pES61Hl l); T45A: ACT -> GCT (pES61H12); D104A: GAT → GCT (pES6113); N108A: AAT → GCT (pES61H14); Q119A: CAA → GCA (pES6115); N123A: AAT →
GCT (pES61H16); Y132A: TAC → GCC (pES61H17); D138A: GAT → GCT (pES6118);
T145A: ACT → GCT (pES6119); R156A: CGA → GCA (pES6120); E160A: GAA → GCA
(pES6121); Y176A, TAC → GCC (pES6122); Y177A:, TAT → GCT (pES6123); Y185A:
TAC → GCC (pES6124); W189A: TGG → GCG (pES6125). The sequence of all constructs was confirmed. Except for the intended mutation, mutant gp61 genes were identical to gp61
(SEQ ED NO: 1). 9. Site-directed mutagenesis of STMOOl 6 Site-directed mutagenesis was carried out on pES16 and pES16H using the Strategene
QuickChange Site-Directed mutagenesis Kit. Mutant STMOOl 6 enzymes contain the following DNA sequence changes: E12A: GAA → GCA (pES161 and pES16Hl) and E12D:
GAA → GAC (pES162 and pES16H2). Except for the intended mutation, STM0016 mutant genes were identical to wild-type STMOOl 6 (SEQ ID NO: 3). 10. Cloning of gp61TM-STM0016 chimera The sequence encoding N-terminus of gp61 gene (aa 1-29 of SEQ ID NO: 1) and STM0016 gene (SEQ ID NO: 3) lacking first 15 amino acids from N-terminus were amplified using Pfu DNA-polymerase according to manufacturer's recommendations [(gp61 N-terminal sequence primers: CAGGCCATGGCAATAAGTAAGAAGAAAGTTGG (SEQ ED NO: 15) and CGAGCGGGATCCGTATCCACCCTCAACAGC (SEQ ID NO: 26); STM0016 (- N-terminal 15 aa) primers:
CGACCGGATCCGTATTTAACCCTAAAGATAAAGGC (SEQ ID NO: 27) and CTGCGGTACCTTAGGTCACTCTATTCTTG (SEQ ID NO: 18)]. Using primer-introduced restriction enzyme sites, Nco I and Bam HI for the gp61 gene and Bam HI and Kpn I for the STMOOl 6 gene, the gp61 N-terminus and STMOOl 6 were fused and inserted into pBAD/Myc-HisB plasmid through three-piece ligation to generate pES6116C (gp61TM (transmembrane domain)-STM0016 chimera). 11. Expression and purification of His6-tagged recombinant gpόl E. coli BL21 cells carrying pES61H were grown aerobically at 37°C to 3xl08 cells/ml. After 1 hour induction with 0.2% arabinose at 37°C in the presence of 5mM NaN3 in order to prevent cell lysis, cells expressing gp61-His6 were pelleted, resuspended in sonication buffer [(20mM Tris-HCl pH 8.0, 20mM NaCl, IX complete protease inhibitor EDTA-free (Roche)] and sonicated in pulses on ice. After low speed centrifugation, the pellet was resuspended in 5M Guanidine-HCl and applied to a Talon Co2+ - EM AC resin column (Clontech) equilibrated in sonication buffer. The column was washed with 20mM Tris-HCl pH 8.0, IM NaCl, followed by cold sonication buffer. Protein was eluted with 20mM Tris- HCl pH 8.0, 20mM NaCl, 60mM imidazole and concentrated on HiTrap Q (Amersham- Pharmacia). Eluted protein was diluted 1:1 (v/v) in glycerol and stored at -20°C. Samples for N-terminal peptide sequencing were prepared by adding 25μl of 5x loading buffer (250mM Tris-HCl pH 6.8, 500mM DTT, 10% SDS, 0.5% bromphenol blue, 50% glycerol) to lOOμl of lOmM purified gpδl. After electrophoresis on a 10% polyacrylamide - SDS gel, peptides were electroblotted to Immobilon-PSQ membrane (PVDF, Millipore) using transfer conditions as described (Matsudaira, 1987). Peptide sequencing was performed. 12. Lysis of EDTA-treated E. coli Purified gpδl (SEQ ID NO:l) His6 was added to E. coli cells (3xl08 cells/ml) in TE buffer (50mM Tris-HCl, ImM EDTA pH 8.0). Absorbance readings were taken at δOOnm wavelength every minute at room temperature. Samples were stirred to prevent cell precipitation. 13. Purification of E. coli peptidoglycan E. coli peptidoglycan was purified according to Heidrich et al (2001). Purified peptidoglycan was freed from SDS by four washes with sterilized water. Purified peptidoglycan was resuspended in 20mM sodium phosphate buffer pH 4.8 and stored with addition of 0.02% NaN3. 14. Zymogram analysis Peptidoglycan-hydrolyzing activity of gpδl was directly detected in protein samples prepared from cells expressing gpδl or N4-infected cells as described (Potvin et al, 1988). The proteins were separated on denaturing sodium dodecyl sulfate 12% polyacrylamide gel containing 0.1% E. coli purified peptidoglycan. Prior to PAGE, samples were boiled for 10 min in 5X loading buffer. Following PAGE, the gel was rinsed and soaked in water for 30 min with gentle agitation at room temperature. The gel was incubated overnight in renaturation buffer (lOOmM Tris-HCl, 1% Triton X-100 pH 8.0) at 37°C with gentle agitation. The intact peptidoglycan was stained with 0.1% Methylene blue in 0.01% KOH as described (Bernadsky et al, 1994). After destaining with water, the unstained autolytic bands appeared as a clear zone in the blue background. 15. Determining gp61 specificity HPLC separation of Muropeptides Purified E. coli peptidoglycan (500μl, A540 = 0.5 AU) in lOmM Tris, 0.1% Triton X-
100 and lOnM purified C-terminally His6-tagged gp61 or T4 lysozyme (a gift of Dr Brian Mathews) was incubated overnight at 37°C. Insoluble peptidoglycan was pelleted at 12,000g for 10 min at room temperature. The supernatant was removed and reduced with sodium borohydride (8 mg/ml) in sodium borate buffer (0.5M boric acid; sodium hydroxide added to pH 8.8) for 15 min at room temperature. The reaction was terminated by addition of phosphoric acid (~ pH 4). Following sodium borohydride reduction, the supernatant was filtered (0.45 μm pore size, Millipore) and analyzed by reversed phase (RP) HPLC.
Peptidoglycan digestion products were separated on a Hypersil BDS C18 column (Keystone
Scientific) (250 x 4.6mm i.d., particle size 5 μm) using linear a 8%>-25% MeOH gradient in
0.1% TFA, and 0.5ml fractions collected. All eluted components were monitored at 206 nm. Fractions were further concentrated via Speedvac and resuspended in 10 μl of dH2O prior to analysis with negative and positive ion matrix-assisted laser desorption/ionization time-of- flight (MALDI-TOF) and nano-electrospray ionization mass spectrometry. Nano-electrospray ionization mass spectrometry Positive ion mass spectra were acquired on Agilent 1100 XCT Ion Trap LC/MS/MS running standard ESI spray chamber equipped with a microspray nebulizer. Fractions were loaded onto lOOμm id x 150mm Zorbax stable bond, 300A pore C-18 column. The ion-trap was operated at an estimated dry gas flow of 7 L/min, dry gas temp of 250°C, nebulizer gas pressure 15 psi, cap voltage setting 1800V, skimmer 140V and scan range 100-2000 m/z. The Agilent software allowed up to six consecutive fragmentation steps.
EXAMPLE 2 GP61 IS A NOVEL N-ACETYLMURAMIDASE In contrast to other lytic phages that lyse the host on the average 30 min after infection, N4 phage does not lyse the host up to three hours after infection (Schito, 1967). Approximately 3000 phage particles accumulate per infected cell forming paracrystalline phage inclusions within the host, hi the laboratory, phage progeny may be released by addition of CHC13 to disrupt the inner membrane. Sequence analysis of the late region of the N4 genome indicated that ORF 61 encodes a 208aa protein (SEQ ID NO:l) with high sequence similarity to hypothetical proteobacterial proteins [Novosphingobium aromaticivorans SARO0833 (SEQ ID NO:2), Salmonella typhimurium STM0016 (SEQ ID NO:3), Salmonella typhi STY0016 (SEQ ID NO:4), Vibrio vulnificus CMP6 VV10124 (SEQ ID NO:5), Salmonella typhi STY1889 (SEQ ID NO:6), Brucella melitensis BMEI0095 (SEQ ID NO:8), Neisseria meningitides NMB1012 (SEQ ID NO:9), Neisseria meningitidis NMA1230 (SEQ ID NO:13), Vibrio vulnificus WA0851 (SEQ ID NO: 14), Mesorhizobium loti mlr8035 (SEQ ED NO: 11)] and hypothetical bacteriophage proteins [Vibrio harveyi phage VHML ORF19 (SEQ ED NO:7) and Bordetella phage BPP-1 Bbp2 (SEQ ID NO:10)] (Pfam05838) (FIG. 5). This 208aa protein contains a putative peptidoglycan binding domain (aa 118-157 of SEQ ID NO:l) common to some proteins with peptidoglycan-degrading activity. No predicted signal peptidase cleavage site following the N-terminal 18aa transmembrane domain is present suggesting that gpδl (SEQ ED NO:l) remains membrane bound (FIG. 5). E. coli or S. typhimurium cells expressing gp61 (SEQ ED NO:l) under pBAD control were lysed 20 min after induction (FIG. 6). Active alkaline phosphatase fusions (Brickman and Beckwith, 1975) to gp61 confirmed the predicted topology with the positively charged N-terminus in the cytoplasm and C-terminus in the periplasm (FIG. 7). The C-terminally His6-tagged gp61 was purified using EVIAC under denaturing conditions and renatured during elution (FIG. 8). Zymographic assays showed that purified C-terminally His6-tagged gp61 has peptidoglycan-degrading activity (FIG. 8). The purified C-terminally His6-tagged gpδl lyses EDTA-treated E. coli cells (FIG. 9). EDTA was used to disrupt the outer membrane in order to make peptidoglycan accessible to the enzyme (Leive, 1965). Based on these results, gp61 is a phage-encoded peptidoglycan-hydrolyzing enzyme capable of degrading peptidoglycan independently of holin proteins (Loessner et al, 1998; Loessner et al, 1999; Wang et al, 2000). Since gpδl has sequence similarity to hypothetical proteins, the Salmonella typhimurium ORF0016 (STMOOl 6, 2e-25) was cloned under pB AD control. Cells expressing STMOOl 6 were lysed 10 min post induction only after CHC13 treatment, since STMOOl 6 is a soluble protein and, therefore, is unable to access the peptidoglycan layer (FIG. 10). However, expression of the chimeric protein containing the N-terminus and transmembrane domain of gp61 fused to STMOOl 6 led to cell lysis in the absence of CHC13 treatment (FIG. 11). These results suggest that gp61 (SEQ LD NO:l) and STM0016 (SEQ ED NO:3) are members of a new family (COG3926.1) of peptidoglycan-hydrolyzing proteins. Negative ion MALDI and nESI-QIT mass spectrometry analysis of muropeptide fractions isolated after gp61 digest of the purified E. coli peptidoglycan via reverse-phase HPLC indicates that gpδl is an N-acetylmuramidase. Alanine substitutions were made at some amino acids conserved amongst members of the family to identify amino acid residues essential for gpδl activity. Alanine substitutions at positions Y185, E26 and Y177 resulted in proteins with a marked delay in lysis (FIG. 15) and no detectable activity in vitro (FIG. 16). Alanine substitutions at positions W189, D35 and Y29 resulted in proteins with a mild delay in lysis (FIG. 15) and a 5-fold decrease in in vitro activity (FIG. 16). Whether these amino acids are involved in catalysis or peptidoglycan binding is not known yet. Replacement of glutamic acid with alanine or aspartic acid in the gp61 (E26A or E26D) and STM0016 (E12A or E12D) EGGY motifs present near the N- terminus of all homologs lead to inactive proteins in vivo and in vitro (FIG. 17), suggesting that tins conserved glutamic residue is essential for enzymatic activity. Recently, a potential therapeutic role has been described for these enzymes. Fischetti' s group has investigated the role of lysins in killing pathogenic Gram-positive bacterial strains. They demonstrated that application of purified lysins, from several bacteriophages that infect Bacillus anthracis or Streptococcus pneumonie, to their respective bacterial strains in liquid or solid media resulted in cell lysis (Loeffler et al, 2001; Loeffler and Fischetti, 2003; Schuch et al, 2002). Fischetti' s group demonstrated that previously colonized mice had undetectable pneumococcal titers after 5 hours of single enzyme treatment (Fischetti, 2003; Loeffler et al, 2003; Nelson et al, 2001). The inability to isolate cells resistant to these lysins is most likely due to the fact that mutational changes preventing binding of the purified lysin would compromise the cell wall structure and, therefore, kill the bacterium. Bacteriophage lysins (e.g., bacteriophage-encoded peptidoglycan hydrolases) could become a tool for treatment of antibiotic-resistant pathogenic strains due to their rapid and specific lytic activities (high affinity binding KA = 3-6x10 ) towards species or strain-specific cell wall carbohydrates that are often essential for viability (Loessner et al, 2002). Based on the ability of gpδl (SEQ ID NO:l) to lyse Gram-negative strains from inside of the cell upon overexpression or from the outside of the cell with application of the purified enzyme following EDTA-treatment, uses for N4 gpδl include the following: 1) gpδl (SEQ ED NO:l) could be used for lysis of cells expressing gpδl for purification of cytoplasmic proteins either present or cloned in E. coli or Salmonella strains. Since gp61 localizes to the insoluble, membrane fraction of the cell, cytoplasmic proteins will not be contaminated with expressed or exogenously-added lysin. 2) gpδl (SEQ ID NO:l) could be used for lysis of Gram-negative pathogenic bacterial strains present in the nasopharyngeal tract through topical application, or systemic infections through intravenous injection.
All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
REFERENCES
The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.
U.S. Patent 4,366,246
U.S. Patent 4,554,101
U.S. Patent 4,659,774 U.S. Patent 4,682,195 .
U.S. Patent 4,683,202
U.S. Patent 4,798,885
U.S. Patent 4,816,571
U.S. Patent 4,879,236 U.S. Patent 4,952,496
U.S. Patent 4,952,500
U.S. Patent 4,959,463
U.S. Patent 5,141,813
U.S. Patent 5,220,007 U.S. Patent 5,264,566
U.S. Patent 5,284,760
U.S. Patent 5,354,670
U.S. Patent 5,366,878
U.S. Patent 5,380,721 U.S. Patent 5,384,253
U.S. Patent 5,389,514
U.S. Patent 5,428,148
U.S. Patent 5,440,013
U.S. Patent 5,446,128 U.S. Patent 5,475,085
U.S. Patent 5,554,744
U.S. Patent 5,574,146
U.S. Patent 5,602,244
U.S. Patent 5,618,914 U.S. Patent 5,635,377
U.S. Patent 5,645,897
U.S. Patent 5,670,155
U.S. Patent 5,672,681 U.S. Patent 5,674,976
U.S. Patent 5,705,629
U.S. Patent 5,710,245
U.S. Patent 5,789,166
U.S. Patent 5,798,208 U.S. Patent 5,830,650
U.S. Patent 5,840,833
U.S. Patent 5,859,184
U.S. Patent 5,871,986
U.S. Patent 5,925,565 U.S. Patent 5,928,906
U.S. Patent 5,929,237
U.S. Patent 5,935,819
U.S. Patent 6,297,358
Ackermann, Arch Virol, 146(5):843-57, 2001
Ausubel et al, In: Current Protocols in Molecular Biology, John, Wiley & Sons, h e, New York, 1996.
Bernadsky et α/., J Bacterial, 176:5225-5232, 1994.
Bernhardt et al, Proc. Natl. Acad. Sci. USA, 97:4297-4302, 2000. Bernhardt et al. , Science, 292:2326-2329, 2001.
Braisted and Wells, Proc. Natl Acad. Sci. USA, 93(12):5688-5692, 1996.
Brickman and Beckwith, J. Mol Biol. 96:307-316, 1975.
Cadwell and Joyce, PCR Methods Appl, 2(l):28-33, 1992.
Carbonelli et al, FEMS Microbiol Lett, 177(l):75-82, 1999. Cocea, Biotechniques, 23(5):814-816, 1997.
Cunningham and Wells, Science, 244(4908):1081-1085, 1989.
Fischetti, Ann. NY Acad. Sci., 987:207-214, 2003.
Froehler et al, Nucleic Acids Res., 14(13):5399-5407, 1986.
Ghyssen et al, Methods Enzymol, 8:685-699, 1966. Heidrich et al, Mol Micro., 41:167-178, 2001.
Holtje, Arch. Microbiol, 164: 243-254, 1995.
Holtje, Microbiol. Mol. Biol Rev., 62:181-203, 1998. h ouye and Inouye, Nucleic Acids Res., 13:3101-3109, 1985. Johannesson et al, J. Med. Chem., 42:601-608, 1999.
Johnson et al, In: Biotechnology And Pharmacy, Pezzuto et al. (Eds.), Chapman and Hall, NY, 1993.
Leive, Biochem. Biophys. Res. Commun., 21:290-296, 1965.
Levenson et al, Hum. Gene Ther., 9(8):1233-1236, 1998. Loeffler et al, Agents and Chemo., 47:375-377, 2003.
Loeffler et al, Infec. and Immun., 71:6199-6204, 2003.
Loeffler et al, Science, 294:2170-2172, 2001.
Loessner et al, FEMS Microbiol. Lett, 162:265-274, 1998.
Loessner et al, J. Bacteriol, 181:4452-4460, 1999. Loessner et al, Mol. Micro., 44:335-349, 2002.
Maniatis, et al, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1990.
Matsudaira, J Biol. Chem., 262:10035-10038, 1987.
Nelson et al, Proc. Natl. Acad. Sci. USA, 98:4107-4112, 2001. Potvin, Mol. Gen. Genet, 21:241-248, 1988.
Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1289-1329, 1990.
Sambrook et al, In: Molecular cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001.
Schito, Virology, 32:723-725, 1967. Schuch et al, Nature, 418:884-889, 2002.
Vita et al, Biopolymers, 47:93-100, 1998.
Wang et al, Annu. Rev. Microbiol, 54:799-825, 2000.
Weisshoff et al, Eur. J. Biochem., 259:776-788, 1999.
Wells et al, J. Leukoc. Biol, 59(l):53-60, 1996. Young et al, Trends in Microbiol, 8: 120-128, 2000.
Young, Microbiol. Rev., 56:430-481, 1992.

Claims

1. An isolated nucleic acid sequence encoding a gpδl polypeptide comprising the polypeptide sequence of SEQ JD NO:l or a fragment thereof having peptidoglycan- hydrolyzing activity.
2. The nucleic acid sequence of claim 1, wherein said nucleic acid is operably linked to a heterologous promoter.
3. The nucleic acid sequence of claim 2, wherein said heterologous promoter is an inducible promoter.
4. An isolated polypeptide comprising the polypeptide sequence of gp61 (SEQ ED NO : 1 ) or a fragment thereof having peptidoglycan-hydrolyzing activity.
5. A pharmaceutical composition comprising the polypeptide of claim 4.
6. The pharmaceutical composition of claim 5, further defined as formulated for treatment of a bacterial disease.
7. The pharmaceutical composition of claim 5, further defined as formulated for topical or intravenous administration.
8. The pharmaceutical composition of claim 5, further defined as an inhaled pharmaceutical composition.
9. The pharmaceutical composition of claim 5, further defined as comprising at least a second active ingredient.
10. The pharmaceutical composition of claim 9, wherein the second active ingredient is an anti-infective agent.
11. The pharmaceutical composition of claim 9, wherein the anti-infective agent is an antibiotic.
12. The pharmaceutical composition of claim 5, further comprising EDTA.
13. A pharmaceutical composition comprising a homolog of gp61 (SEQ ID NO:l) having peptidoglycan-hydrolyzing activity, wherein the homolog is selected from the group consisting of: SARO0833 (SEQ ED NO:2), STM0016 (SEQ ID NO:3), STY0016 (SEQ ID NO:4), VV10124 (SEQ ID NO:5), STY1889 (SEQ ID NO:6), VHML ORF19 (SEQ ID NO:7), BMEI0095 (SEQ ID NO:8), NMB 1012 (SEQ ID NO:9), BPP-1 Bbp2 (SEQ ID NO:10), mh8035 (SEQ ID NO:ll), ECA2616 (SEQ ID NO:12), NMA1230 (SEQ ED NO:13), and VVA0851 (SEQ DD NO:14).
14. The pharmaceutical composition of claim 13, further comprising CHC13.
15. A recombinant host cell transformed with the nucleic acid of claim 1.
16. The cell of claim 15, wherein the nucleic acid encodes the polypeptide of SEQ ID NO:l.
17. The cell of claim 15, wherein said cell is a bacterium.
18. The cell of claim 15, wherein said cell is a Gram-positive bacterium.
19. The cell of claim 15, wherein said cell is a Gram-negative bacterium.
20. A method of treating a bacterial disease in a subject comprising administering to the subject the pharmaceutical composition of claim 5 or claim 13.
21. The method of claim 20, wherein said subj ect is a mammal.
22. The method of claim 20, wherein said subject is a human.
23. The method of claim 20, wherein said pharmaceutical composition is applied topically.
24. The method of claim 20, wherein said pharmaceutical composition is inhaled.
25. The method of claim 24, wherein the pharmaceutical composition is administered intranasally.
26. The method of claim 20, wherein said pharmaceutical composition is administered intravenously.
27. The method of claim 20, comprising administering to the subject the pharmaceutical composition of claim 13, wherein said pharmaceutical composition further comprises CHC13.
28. The method of claim 23, wherein said bacterial disease is caused by a Gram-negative bacterium.
29. The method of claim 23, wherein said bacterial disease is caused by a Gram-positive bacterium.
30. The method of claim 22, wherein the pharmaceutical composition comprises EDTA.
31. The method of claim 22, wherein said bacterial disease is caused by salmonella, E. coli, pneumococci, or streptococci.
32. A method for lysing a bacteria comprising contacting said bacteria with gpδl (SEQ ID NO:l) or a fragment thereof having peptidoglycan-hydrolyzing activity.
33. The method of claim 32, wherein said method is performed in vitro.
34. The method of claim 33, further comprising purifying a protein expressed by said bacteria.
35. The method of claim 34, wherein the protein is a cytoplasmic protein.
36. The method of claim 35, wherein said cytoplasmic protein is native to said bacteria.
37. The method of claim 35, wherein said cytoplasmic protein is heterologously expressed by said bacteria.
38. The method of claim 34, wherein said bacteria is transformed with a nucleic acid encoding said gp61 (SEQ ID NO:l) or a fragment thereof having peptidoglycan- hydrolyzing activity and contacting is achieved by inducing expression of the nucleic acid.
39. The method of claim 38, wherein said nucleic acid is chromosomally integrated.
40. The method of claim 38, wherein said nucleic acid is extrachromosomal.
41. The method of claim 38, wherein the nucleic acid is operably linked to an inducible <.- promoter.
42. The method of claim 41, wherein the expression of the nucleic acid is induced by activating said inducible promoter.
43. The method of claim 32, wherein said bacteria is contacted with exogenously applied gpδl (SEQ ED NO: 1).
44. A method for lysing a bacteria comprising contacting said bacteria with a gpδl (SEQ ED NO:l) homolog or a fragment thereof having peptidoglycan-hydrolyzing activity, wherein the homolog is selected from the group consisting of : SARO0833 (SEQ ED NO:2), STM0016 (SEQ ID NO:3), STY0016 (SEQ ID NO:4), VV10124 (SEQ ED NO:5), STY1889 (SEQ ED NO:6), VHML ORF19 (SEQ ID NO:7), BMEI0095 (SEQ ID NO:8), NMB 1012 (SEQ ID NO:9), BPP-1 Bbp2 (SEQ ID NO:10), mlr8035 (SEQ ID NO:l l), ECA2616 (SEQ ID NO:12), NMA1230 (SEQ ID NO:13), and VVA0851 (SEQ ID NO: 14).
PCT/US2005/013509 2004-04-19 2005-04-19 Peptidoglycan-hydrolyzing protein encoded by bacteriophage n4 Ceased WO2005108563A2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US56332704P 2004-04-19 2004-04-19
US60/563,327 2004-04-19
US58186004P 2004-06-22 2004-06-22
US60/581,860 2004-06-22

Publications (2)

Publication Number Publication Date
WO2005108563A2 true WO2005108563A2 (en) 2005-11-17
WO2005108563A3 WO2005108563A3 (en) 2006-12-07

Family

ID=35320799

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/013509 Ceased WO2005108563A2 (en) 2004-04-19 2005-04-19 Peptidoglycan-hydrolyzing protein encoded by bacteriophage n4

Country Status (1)

Country Link
WO (1) WO2005108563A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010149792A3 (en) * 2009-06-26 2011-02-24 Katholieke Universiteit Leuven, K.U. Leuven R&D Antimicrobial agents
US9809808B2 (en) 2008-08-26 2017-11-07 Katholieke Universiteit Leuven K.U. Leuven R&D Antimicrobial agents
US11136570B2 (en) 2009-06-26 2021-10-05 Lysando Ag Antimicrobial fusion proteins comprising an endolysin and an amphipathic peptide segment

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000029588A1 (en) * 1998-11-18 2000-05-25 Children's Hospital Medical Center Lysozyme fusion proteins in infections
US6436703B1 (en) * 2000-03-31 2002-08-20 Hyseq, Inc. Nucleic acids and polypeptides

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9809808B2 (en) 2008-08-26 2017-11-07 Katholieke Universiteit Leuven K.U. Leuven R&D Antimicrobial agents
KR101711062B1 (en) * 2009-06-26 2017-02-28 카톨리에케 유니버시테이트 루벤 Antimicrobial agents
JP2012530509A (en) * 2009-06-26 2012-12-06 カトリック ユニバーシテイト ルーベン ケイ.ユー. ルーベン アール アンド ディー Antimicrobial agent
US8906365B2 (en) 2009-06-26 2014-12-09 Lysando Ag Antimicrobial agents
AU2010264656B2 (en) * 2009-06-26 2016-01-21 Katholieke Universiteit Leuven, K.U. Leuven R&D Antimicrobial agents
EP3058950A3 (en) * 2009-06-26 2016-10-12 Lysando AG Antimicrobial agents
WO2010149792A3 (en) * 2009-06-26 2011-02-24 Katholieke Universiteit Leuven, K.U. Leuven R&D Antimicrobial agents
KR20120095345A (en) * 2009-06-26 2012-08-28 뤼산도 홀딩 아게 Antimicrobial agents
AU2016202296B2 (en) * 2009-06-26 2017-12-21 Katholieke Universiteit Leuven, K.U. Leuven R&D Antimicrobial Agents
US10137175B2 (en) 2009-06-26 2018-11-27 Lysando Ag Antimicrobial agents
EP3714895A3 (en) * 2009-06-26 2020-11-25 Lysando AG Antimicrobial agents
EA037202B1 (en) * 2009-06-26 2021-02-18 Катхолике Университейт Лёвен, К.У. Лёвен Р Энд Д Fusion proteins for treating gram-negative bacterial infections
US11052137B2 (en) 2009-06-26 2021-07-06 Lysando Ag Antimicrobial agents
US11136570B2 (en) 2009-06-26 2021-10-05 Lysando Ag Antimicrobial fusion proteins comprising an endolysin and an amphipathic peptide segment

Also Published As

Publication number Publication date
WO2005108563A3 (en) 2006-12-07

Similar Documents

Publication Publication Date Title
Zimmer et al. Genome and proteome of Listeria monocytogenes phage PSA: an unusual case for programmed+ 1 translational frameshifting in structural protein synthesis
KR102769515B1 (en) Cas9 retroviral integrase system and Cas9 recombinase system for targeted incorporation of DNA sequences into the genome of a cell or organism
Loessner et al. Evidence for a holin-like protein gene fully embedded out of frame in the endolysin gene of Staphylococcus aureus bacteriophage 187
CN102186878A (en) Artificial peptidoglycan lysing enzymes and peptidoglycan binding proteins
Garinot-Schneider et al. Identification of putative active-site residues in the DNase domain of colicin E9 by random mutagenesis
Basit et al. Cloning and expression analysis of fused holin-endolysin from RL bacteriophage; Exhibits broad activity against multi drug resistant pathogens
US8357511B2 (en) Protein purification tags and uses thereof
Auzat et al. Origin and function of the two major tail proteins of bacteriophage SPP1
CN110036105B (en) modified peptide
JP5732397B2 (en) Antibacterial phage peptides and uses thereof
JP5242388B2 (en) Method for secretory expression of lysostaphin in E. coli at high levels
KR20220061126A (en) Caspase-2 variants
Kovalskaya et al. Antimicrobial activity of bacteriophage endolysin produced in Nicotiana benthamiana plants
JP2009502125A5 (en)
CN114908077A (en) Phage lyase, its chimera and application
CN106834252B (en) A highly stable MazF mutant and its application
WO2005108563A2 (en) Peptidoglycan-hydrolyzing protein encoded by bacteriophage n4
García-Rodríguez et al. Similar mechanisms of retron-mediated anti-phage defense for different families of tailed phages
US10738090B2 (en) Engineered microcompartment protein and related methods and systems of engineering bacterial systems for non-native protein expression and purification
CN107164350B (en) A kind of pyrazinamide hydrolase and its coding gene and application
CN108699545A (en) Beta-lactam enzyme variants
Niaz et al. Molecular Cloning and Functional Analysis of Holin and Endolysin From Escherichia Phage UE‐M6 as Potential Antibacterial Agents
KR20200074982A (en) Beta-lactamase variants
US20220017884A1 (en) Lysin Agent and Method of Use for Diagnostic Testing
Kılıç et al. Cloning and Protein Production of the Antigenic FliC Gene of Salmonella enterica serovar typhimurium ATCC 14028 Strain

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase