WO2005105835A1 - A protein involved in cancer - Google Patents
A protein involved in cancer Download PDFInfo
- Publication number
- WO2005105835A1 WO2005105835A1 PCT/GB2005/001669 GB2005001669W WO2005105835A1 WO 2005105835 A1 WO2005105835 A1 WO 2005105835A1 GB 2005001669 W GB2005001669 W GB 2005001669W WO 2005105835 A1 WO2005105835 A1 WO 2005105835A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- flj20584
- cancer
- agent
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4748—Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
Definitions
- the present invention relates to methods for the treatment and/or prophylaxis of cancer comprising targeting of the polypeptide FLJ20584, agents which interact with or modulate the expression or activity of the polypeptide, methods for the identification of such agents and the use of FLJ20584 in the diagnosis of cancer.
- Ovarian cancer is the deadliest of the gynaecological cancers with around 70% of sufferers with the more common epithelial ovarian cancer initially presenting with late stage disease. Their survival rate is significantly reduced compared to those who present with earlier stage disease because the cancer will have spread to the upper abdomen.
- Ovarian cancer has been generally treated with cisplatin-based chemotherapy and often recurs due to acquired cisplatin resistance (Yahata, H.
- Lung cancer accounts for a large percentage of cancer deaths in both men and women.
- lung cancer There are two major types of lung cancer: non-small cell lung cancer and small cell lung cancer. Treatment is restricted to surgery and, where possible, chemotherapy and radiotherapy.
- FLJ20584 represents a novel therapeutic target for the treatment and/or prophylaxis of cancer, eg. ovarian and/or lung cancer.
- FLJ20584 also represents a novel marker for the screening and/or diagnosis of cancer, eg. ovarian and/or lung cancer.
- a FLJ20584 polypeptide includes a polypeptide which: (a) comprises or consists of the amino acid sequence of SEQ ID NO: 1 ; (b) is a derivative having one or more amino acid substitutions, modifications, deletions or insertions relative to the amino acid sequence of SEQ ID NO: 1 which retains the activity of FLJ20584; or (c) is a fragment of (a) or (b), above, which is at least 10 amino acids long and which retains the activity of FLJ20584.
- polypeptides includes peptides, polypeptides and proteins. These are used interchangeably unless otherwise specified.
- carcinoma or “cancer” are used interchangeably and include a malignant new growth that arises from epithelium, found in skin or, more commonly, the lining of body organs, for example: ovary, breast, prostate, lung, kidney, pancreas, stomach or bowel. Carcinomas tend to infiltrate into adjacent tissue and spread (metastasise) to distant organs, for example: to bone, liver, lung or the brain.
- the carcinoma is ovarian cancer.
- the carcinoma is lung cancer.
- the cancer is osteosarcoma.
- Agents of use in the methods of the invention include without limitation, agents that are capable of interacting with (e.g. binding to, or recognising) a FLJ205S4 polypeptide or a nucleic acid molecule encoding a FLJ20584 polypeptide, or are capable of modulating the interaction, expression, activity of a FLJ20584 polypeptide or the expression of a nucleic acid molecule encoding a FLJ205S4 polypeptide.
- agents include, without limitation, antibodies, nucleic acids (e.g. DNA and RNA), carbohydrates, lipids, proteins, polypeptides, peptides, peptidomimetics, small molecules and other drugs.
- the invention also provides the use of an agent, which interacts with or modulates the expression or activity of a FLJ20584 polypeptide for the manufacture of a medicament for the treatment and/or prophylaxis of cancer.
- the agent for use in the treatment and/or prophylaxis of cancer is an antibody that interacts with (i.e. binds to or recognises) or modulates the activity of a FLJ20584 polypeptide. Accordingly, there is provided the use of an antibody that interacts with a FLJ20584 polypeptide for the manufacture of a medicament for the treatment and/or prophylaxis of cancer.
- an antibody that interacts with a FLJ20584 polypeptide may be used to mediate antibody dependent cell cytotoxicity (ADCC) and complement dependent cytotoxicity (CDC).
- ADCC antibody dependent cell cytotoxicity
- CDC complement dependent cytotoxicity
- the antibody is preferably a full length naked antibody
- an antibody that interacts with FLJ20584 polypeptides may be used to inhibit the activity of said polypeptides.
- antibodies that specifically interact with a FLJ20584 polypeptide are preferred. Specifically interacting with (e.g.
- an antibody optionally conjugated to a therapeutic moiety, can be used therapeutically alone or in combination with a cytotoxic factor(s) and or cytokine(s).
- FLJ20584 antibodies can be conjugated to a therapeutic agent, such as a cytotoxic agent, a radionuclide or drug moiety to modify a given biological response.
- the therapeutic agent is not to be construed as limited to classical chemical therapeutic agents.
- the therapeutic agent may be a drug moiety that may be a protein or polypeptide possessing a desired biological activity.
- Such moieties may include, for example and without limitation, a toxin such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin, maytansinoid (DM1), a protein such as tumour necrosis factor, ⁇ -interferon, ⁇ -interferon, nerve growth factor, platelet derived growth factor or tissue plasminogen activator, a tlirombotic agent or an anti-angiogenic agent, e.g.
- a toxin such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin
- maytansinoid (DM1) a protein such as tumour necrosis factor, ⁇ -interferon, ⁇ -interferon, nerve growth factor, platelet derived growth factor or tissue plasminogen activator, a tlirombotic agent or an anti-angiogenic agent, e.g.
- angiostatin or endostatin angiostatin or endostatin; angiogemn, gelonin, dolstatins, minor groove-binders, bis-iodo-phenol mustard, or, a biological response modifier such as a lyniphokine, interleukin-1 IL-1), interleukin-2 (IL-2), interleukin-6 (IL-6), granulocyte macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G- CSF), nerve growth factor (NGF) or other growth factor.
- Therapeutic agents also include cytotoxins or cytotoxic agents including any agent that is detrimental to (e.g. kills) cells.
- Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vinca alkaloids, e.g. vincristine, vinblastine, 4-desacetylvinblastine-3-carbohydrazide, vindesine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1 -dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof.
- vincristine vinblastine
- 4-desacetylvinblastine-3-carbohydrazide vindesine
- colchicin doxorubicin, daunorubicin, dihydroxy anthracin dione, mit
- Therapeutic agents also include, but are not limited to, anti-folates (e.g. aminopterin and methotrexate), antimetabolites (e.g. methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5- fluorouracil decarbazine, 5-fluoro-2'-deoxyuridine), alkylating agents (e.g.
- anti-folates e.g. aminopterin and methotrexate
- antimetabolites e.g. methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5- fluorouracil decarbazine, 5-fluoro-2'-deoxyuridine
- alkylating agents e.g.
- dactinomycin (formerly actinomycin), bleomycin, mithramycin, anthramycin (AMC), calicheamicins or duoca ⁇ nycins, CC-1065, enediyenes, neocarzinostatin), and anti-mitotic agents (e.g. vincristine and vinblastine). See Garnett, 2001, Advanced drug Delivery Reviews 53:171-216 for further details.
- therapeutic moieties may include radionuclides such as 131 I, ⁇ n In and 90 Y, Lu 177 , Bismuth 213 , Bismuth 212 , Californium 252 , Iridium 192 and Tunsten 1 ⁇ /Rhenium 188 , 21 astatine; or drugs such as but not limited to, alkylphosphocholines, topoisomerase I inhibitors, taxoids and suramin. Techniques for conjugating such therapeutic agents to antibodies are well known in the art (see, e.g.
- the antibodies for use in the invention include analogues and derivatives that are modified, for example but without limitation, by the covalent attachment of any type of molecule.
- an antibody can be conjugated to a second antibody to form an antibody heteroconjugate (see US 4,676,980).
- Engineered antibody fragments can also be attached to the surface of sterically stabilised (stealth) liposomes for selective tumour targeting of large payloads of drugs (see e.g. Park et al, 1995, Proc. Natl. acad. Sci USA 92:1327-1331; Park et al, 1997, Cancer Lett. 118:153-160).
- cytotoxic agents such as radionuclides and prodrugs can be pre- targeted to tumours, h particular, antibody-dependent enzyme-mediated prodrug therapy (ADEPT) involves pre-targeting of pro-drugs to tumours (Niculescu-Duvaz et al, 1999, Anticancer Drug Des. 14:517-538; Syrigos et al, 1999, Anticancer Res. 19:605-613).
- ADPT antibody-dependent enzyme-mediated prodrug therapy
- the invention provides the therapeutic use of fusion proteins of the antibodies (or functionally active fragments thereof), for example but without limitation, where the antibody or fragment thereof is fused via a covalent bond (e.g. a peptide bond), at optionally the N-terminus or the C-terminus, to an amino acid sequence of another protein (or portion thereof; preferably at least a 10, 20 or 50 amino acid portion of the protein).
- an antibody fusion protein may facilitate depletion or purification of a polypeptide as described herein, increase half-life in vivo, and enhance the delivery of an antigen across an epithelial barrier to the immune system.
- the fusion protein is an antibody fragment linked to an effector or reporter molecule, this may be prepared by standard chemical or recombinant DNA procedures.
- a preferred effector group is a polymer molecule, which may be attached to the modified Fab fragment to increase its half-life in vivo.
- Other effector groups include dextran, human serum albumin and hydroxypropylmethacrylamide (HPMA).
- the polymer molecule may, in general, be a synthetic or a naturally occurring polymer, for example an optionally substituted straight or branched chain polyalkylene, polyalkenylene or polyoxyalkylene polymer or a branched or unbranched polysaccharide, e.g. a homo- or hetero- polysaccharide.
- Particular optional substituents which may be present on the above-mentioned synthetic polymers include one or more hydroxy, methyl or methoxy groups.
- Particular examples of synthetic polymers include optionally substituted straight or branched chain poly(ethyleneglycol), poly(propyleneglycol) poly(vinylalcohol) or derivatives thereof, especially optionally substituted poly(ethyleneglycol) such as methoxypoly(ethyleneglycol) or derivatives thereof.
- Particular naturally occurring polymers include lactose, amylose, dextran, glycogen or derivatives thereof.
- “Derivatives” as used herein is intended to include reactive derivatives, for example thiol-selective reactive groups such as maleimides and the like. The reactive group may be linked directly or through a linker segment to the polymer.
- the residue of such a group will in some instances form part of the product as the linking group between the antibody fragment and the polymer.
- the size of the polymer may be varied as desired, but will generally be in an average molecular weight range from 500Da to 50000Da, preferably from 5000 to 40000Da and more preferably from 25000 to 40000Da.
- the polymer size may in particular be selected on the basis of the intended use of the product.
- a small molecular weight polymer for example with a molecular weight of around 5000Da.
- a higher molecular weight polymer for example having a molecular weight in the range from 25000Da to 40000Da.
- Particularly preferred polymers include a polyalkylene polymer, such as a poly(ethyleneglycol) or, especially, a methoxy ⁇ oly(ethyleneglycol) or a derivative thereof, and especially with a molecular weight in the range from about 25000Da to about 40000Da.
- Each polymer molecule attached to the modified antibody fragment may be covalently linked to the sulphur atom of a cysteine residue located in the fragment.
- the covalent linkage will generally be a disulphide bond or, in particular, a sulphur-carbon bond.
- the antibody fragment may have one or more effector or reporter molecules attached to it.
- the effector or reporter molecules may be attached to the antibody fragment through any available amino acid side-chain or te ⁇ ninal amino acid functional group located in the fragment, for example any free amino, imino, hydroxyl or carboxyl group.
- An activated polymer may be used as the starting material in the preparation of polymer-modified antibody fragments as described above.
- the activated polymer may be any polymer containing a thiol reactive group such as an ⁇ -halocarboxylic acid or ester, e.g. iodoacetamide, an imide, e.g. maleimide, a vinyl sulphone or a disulphide.
- Such starting materials may be obtained commercially (for example from Nektar Therapeutics, Inc (Huntsville, AL), or may be prepared from commercially available starting materials using conventional chemical procedures. Standard chemical or recombinant DNA procedures in which the antibody fragment is linked either directly or via a coupling agent to the effector or reporter molecule either before or after reaction with the activated polymer as appropriate may be used. Particular chemical procedures include, for example, those described in WO 93/06231, WO 92/22583, WO 90/09195, WO 89/01476, WO 99/15549 and WO 03/031581.
- the linkage may be achieved using recombinant DNA procedures, for example as described in WO 86/01533 and EP 0392745.
- Most preferably antibodies are attached to poly(ethyleneglycol) (PEG) moieties.
- PEG poly(ethyleneglycol)
- a modified Fab fragment is PEGylated, i.e. has PEG (poly(ethyleneglycol)) covalently attached thereto, e.g. according to the method disclosed in EP 0948544 [see also "Poly(ethyleneglycol) Chemistry, Biotechnical and Biomedical Applications", 1992, J. Milton Hanis (ed).
- a PEG modified Fab fragment has a maleimide group covalently linked to a single thiol group in a modified hinge region. A lysine residue may be covalently linked to the maleimide group.
- a methoxypoly(ethyleneglycol) polymer having a molecular weight of approximately 20,000 Da.
- the total molecular weight of the entire effector molecule may therefore be approximately 40,000 Da.
- FLJ20584 polypeptides or cells expressing said polypeptides can be used to produce antibodies, e.g. which specifically recognise said FLJ20584 polypeptides.
- Antibodies generated against a FLJ20584 polypeptide may be obtained by administering the polypeptides to an animal, preferably a non-human animal, using well known and routine protocols.
- Anti-FLJ20584 antibodies include functionally active fragments, derivatives or analogues and may be, but are not limited to, polyclonal, monoclonal, bi-, tri- or tetra-valent antibodies, humanized or chimeric antibodies, single chain antibodies, Fab fragments, Fab' and Fab' 2 fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies, and epitope-binding fragments of any of the above.
- Humanized antibodies are antibody molecules from non-human species having one or more complementarity determining regions (CDRs) from the non-human species and a framework region from a human immunoglobulin molecule (see, e.g. US 5,585,089).
- Antibodies include immunoglobulin molecules and immuno logically active portions of immunoglobulin molecules, i.e. molecules that contain an antigen binding site that specifically binds an antigen.
- the immunoglobulin molecules of the invention can be of any class (e.g. IgG, IgE, IgM, IgD and IgA) or subclass of immunoglobulin molecule.
- Monoclonal antibodies may be prepared by any method known in the art such as the hybridoma technique (Kohler & Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al, 1983, hnmunology Today, 4:72) and the EBV-hybridoma technique (Cole et al, Monoclonal Antibodies and Cancer Therapy, pp77-96, Alan R Liss, Inc., 1985).
- Chimeric antibodies are those antibodies encoded by immunoglobulin genes that have been genetically engineered so that the light and heavy chain genes are composed of immunoglobulin gene segments belonging to different species. These chimeric antibodies are likely to be less antigenic.
- Bivalent antibodies may be made by methods known in the art (Milstein et al, 1983, Nature 305:537-539; WO 93/08829, Traunecker et al, 1991, EMBO J. 10:3655-3659). Bi-, tri- and tetra-valent antibodies may comprise multiple specificities or may be monospecific (see for example WO 92/22853).
- the antibodies for use in the invention may be generated using single lymphocyte antibody methods based on the molecular cloning and expression of immunoglobulin variable region cDNAs generated from single lymphocytes that were selected for the production of specific antibodies such as described by Babcook, J. et al, 1996, Proc. Natl. Acad. Sci.
- the antibodies for use in the present invention can also be generated using various phage display methods known in the art and include those disclosed by Brinkman et al. (in J. Immunol. Methods, 1995, 182: 41-50), Ames et al. (J. Immunol. Methods, 1995, 184:177- 1S6), Kettleborough et al. (Eur. J. Immunol.
- FLJ205S4 polypeptides can be used for the identification of agents for use in the methods of treatment and/or prophylaxis according to the invention.
- a further aspect of the invention provides methods of screening for anti-cancer agents that interact with a FLJ20584 polypeptide comprising: (a) contacting said polypeptide with a candidate agent; and (b) determining whether or not the candidate agent interacts with said polypeptide. Preferably, the determination of an interaction between the candidate agent and
- FLJ20584 polypeptide comprises quantitatively detecting binding of the candidate agent and said polypeptide. Further provided is a method of screening for anti-cancer agents that modulate the expression or activity of a FLJ205S4 polypeptide comprising: (i) comparing the expression or activity of said polypeptide in the presence of a candidate agent with the expression or activity of said polypeptide in the absence of the candidate agent or in the presence of a control agent; and (ii) dete ⁇ nining whether the candidate agent causes the expression or activity of said polypeptide to change. Preferably, the expression and/or activity of a FLJ20584 polypeptide is compared with a predetermined reference range or control.
- the method further comprises selecting an agent, which interacts with a FLJ20584 polypeptide or is capable of modulating the interaction, expression or activity of a FLJ20584 polypeptide, for further testing for use in the treatment and/or prophylaxis of cancer.
- an agent which interacts with a FLJ20584 polypeptide or is capable of modulating the interaction, expression or activity of a FLJ20584 polypeptide, for further testing for use in the treatment and/or prophylaxis of cancer.
- the above screening methods are also appropriate for screening for anti-cancer agents which interact with or modulate the expression or activity of a FLJ20584 nucleic acid molecule.
- the invention also provides assays for use in drug discovery in order to identify or verify the efficacy of agents for treatment and/or prophylaxis of cancer. Agents identified using these methods can be used as lead agents for drug discovery, or used therapeutically.
- FLJ20584 polypeptide can be assayed by, for example, immunoassays, gel electrophoresis followed by visualisation, detection of mRNA or FLJ20584 polypeptide activity, or any other method taught herein or known to those skilled in the art. Such assays can be used to screen candidate agents, in clinical monitoring or in drug development. Agents can be selected from a wide variety of candidate agents. Examples of candidate agents include but are not limited to, nucleic acids (e.g. DNA and RNA), carbohydrates, lipids, proteins, polypeptides, peptides, peptidomimetics, small molecules and other drugs.
- nucleic acids e.g. DNA and RNA
- candidate agents include but are not limited to, nucleic acids (e.g. DNA and RNA), carbohydrates, lipids, proteins, polypeptides, peptides, peptidomimetics, small molecules and other drugs.
- Agents can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the "one-bead one-compound” library method; and synthetic library methods using affinity chromatography selection.
- biological libraries is suited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, 1997, Anticancer Drug Des. 12:145; U.S. 5,738,996; and U.S. 5,807,683).
- agents that interact with e.g.
- bind to) a FLJ20584 polypeptide are identified in a cell-based assay where a population of cells expressing a FLJ20584 polypeptide is contacted with a candidate agent and the ability of the candidate agent to interact with the polypeptide is determined.
- the ability of a candidate agent to interact with a FLJ20584 polypeptide is compared to a reference range or control.
- a first and second population of cells expressing a FLJ20584 polypeptide are contacted with a candidate agent or a control agent and the ability of the candidate agent to interact with the polypeptide is determined by comparing the difference in interaction between the candidate agent and control agent. If desired, this type of assay may be used to screen a plurality (e.g.
- this assay may be used to screen a plurality (e.g. a library) of candidate agents.
- the cell for example, can be of prokaryotic origin (e.g. E. coli) or eukaryotic origin (e.g. yeast or mammalian). Further, the cells can express the FLJ20584 polypeptide endogenously or be genetically engineered to express the polypeptide.
- a FLJ20584 polypeptide or the candidate agent is labelled, for example with a radioactive label (such as P, S or I) or a fluorescent label (such as fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o- phthaldehyde or fluorescamine) to enable detection of an interaction between a polypeptide and a candidate agent.
- a radioactive label such as P, S or I
- a fluorescent label such as fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o- phthaldehyde or fluorescamine
- agents that interact with e.g.
- bind to) a FLJ20584 polypeptide are identified in a cell- free assay system where a sample expressing a FLJ20584 polypeptide is contacted with a candidate agent and the ability of the candidate agent to interact with the polypeptide is determined.
- the ability of a candidate agent to interact with a FLJ20584 polypeptide is compared to a reference range or control, h a preferred embodiment, a first and second sample comprising native or recombinant FLJ20584 polypeptide are contacted with a candidate agent or a control agent and the ability of the candidate agent to interact with the polypeptide is determined by comparing the difference in interaction between the candidate agent and control agent.
- this assay may be used to screen a plurality (e.g.
- the polypeptide is first immobilized, by, for example, contacting the polypeptide with an immobilized antibody which specifically recognizes and binds it, or by contacting a purified preparation of polypeptide with a surface designed to bind proteins.
- the polypeptide may be partially or completely purified (e.g. partially or completely free of other polypeptides) or part of a cell lysate.
- the polypeptide may be a fusion protein comprising the FLJ20584 polypeptide or a biologically active portion thereof and a domain such as glutathionine-S-transferase.
- the polypeptide can be biotinylated using techniques well known to those of skill in the art (e.g. biotinylation kit, Pierce Chemicals; Rockford, IL).
- biotinylation kit Pierce Chemicals; Rockford, IL
- the ability of the candidate agent to interact with the polypeptide can be duplicated by methods known to those of skill in the art.
- a FLJ20584 polypeptide is used as a "bait protein" in a two- hybrid assay or three hybrid assay to identify other proteins that bind to or interact with the FLJ20584 polypeptide (see e.g. US 5,283,317; Zervos et al, 1993, Cell 72:223-232; Madura et al 1993, J. Biol. Chem.
- binding proteins are also likely to be involved in the propagation of signals by a FLJ20584 polypeptide.
- they may be upstream or downstream elements of a signalling pathway involving a FLJ20584 polypeptide.
- polypeptides that interact with a FLJ20584 polypeptide can be identified by isolating a protein complex comprising a FLJ20584 polypeptide (said polypeptide may interact directly or indirectly with one or more other polypeptides) and identifying the associated proteins using methods known in the art such as mass spectrometry or Western blotting (for examples see Blackstock, W. & Weir, M. 1999, Trends in Biotechnology, 17: 121-127; Rigaut, G. 1999, Nature Biotechnology, 17: 1030-1032; Husi, H. 2000, Nature Neurosci. 3:661-669; Ho, Y. et al, 2002, Nature, 415:180-183; Gavin, A. et al, 2002, Nature, 415: 141-147). In all cases, the ability of the candidate agent to interact directly or indirectly with the
- FLJ20584 polypeptide can be determined by methods known to those of skill in the art. For example but without limitation, the interaction between a candidate agent and a FLJ20584 polypeptide can be determined by flow cytometry, a scintillation assay, an activity assay, mass spectrametry, microscopy, immunoprecipitation or western blot analysis. In yet another embodiment, agents that competitively interact with (i.e. competitively binding to) a FLJ20584 polypeptide are identified in a competitive binding assay and the ability of the candidate agent to interact with the FLJ20584 polypeptide is determined. Preferably, the ability of a candidate agent to interact with a FLJ20584 polypeptide is compared to a reference range or control.
- a first and second population of cells expressing both a FLJ20584 polypeptide and a protein which is known to interact with the FLJ20584 polypeptide are contacted with a candidate agent or a control agent.
- the ability of the candidate agent to competitively interact with the FLJ20584 polypeptide is then determined by comparing the interaction in the first and second population of cells, hi another embodiment, an alternative second population or a further population of cells may be contacted with an agent which is known to competitively interact with a FLJ205S4 polypeptide.
- agents that competitively interact with a FLJ20584 polypeptide are identified in a cell-free assay system by contacting a first and second sample comprising a FLJ20584 polypeptide and a protein known to interact with the FLJ20584 polypeptide with a candidate agent or a control agent. The ability of the candidate agent to competitively interact with the FLJ20584 polypeptide is then determined by comparing the interaction in the first and second sample.
- an alternative second sample or a further sample comprising a FLJ205S4 polypeptide may be contacted with an agent which is known to competitively interact with a FLJ20584 polypeptide.
- the FLJ20584 polypeptide and known interacting protein may be expressed naturally or may be recombinantly expressed; the candidate agent may be added exogenously, or be expressed naturally or recombinantly.
- agents that modulate the interaction between a FLJ20584 polypeptide and another agent for example but without limitation a protein, may be identified in a cell-based assay by contacting cells expressing a FLJ20584 polypeptide in the presence of a known interacting agent and a candidate modulating agent and selecting the candidate agent which modulates the interaction.
- agents that modulate an interaction between a FLJ20584 polypeptide and another agent may be identified in a cell-free assay system by contacting the polypeptide with an agent known to interact with the polypeptide in the presence of a candidate agent.
- a modulating agent can act as an antibody, a cofactor, an inhibitor, an activator or have an antagonistic or agonistic effect on the interaction between a FLJ20584 polypeptide and a known agent.
- the ability of the known agent to interact with a FLJ20584 polypeptide can be determined by methods known in the art.
- These assays, whether cell-based or cell-free can be used to screen a plurality (e.g. a library) of candidate agents.
- a cell-based assay system is used to identify agents capable of modulating (i.e. stimulating or inhibiting) the activity of a FLJ20584 polypeptide.
- the activity of a FLJ20584 polypeptide is measured in a population of cells that naturally or recombinantly express a FLJ20584 polypeptide, in the presence of a candidate agent.
- the activity of a FLJ20584 polypeptide is compared to a reference range or control, hi a preferred embodiment, the activity of a FLJ20584 polypeptide is measured in a first and second population of cells that naturally or recombinantly express a FLJ20584 polypeptide, in the presence of agent or absence of a candidate agent (e.g.
- the activity of a FLJ205S4 polypeptide can be measured in a cell- free assay system where the FLJ20584 polypeptide is either natural or recombinant.
- the activity of a FLJ20584 polypeptide is compared to a reference range or control, h a preferred embodiment, the activity of a FLJ205S4 polypeptide is measured in a first and second sample in the presence or absence of a candidate agent and the activity of the FLJ205S4 polypeptide is compared.
- the candidate agent can then be identified as a modulator of the activity of a FLJ20584 polypeptide based on this comparison.
- the activity of a FLJ20584 polypeptide can be assessed by detecting its effect on a downstream effector, for example but without limitation, the level or activity of a second messenger (e.g. cAMP, intracellular Ca 2+ , diacylglycerol, IP 3 , etc.), detecting catalytic or enzymatic activity, detecting the induction of a reporter gene (e.g. luciferase) or detecting a cellular response, for example, proliferation, differentiation or transformation where appropriate as known by those skilled in the art (for activity measurement techniques see, e.g. US 5,401,639).
- a second messenger e.g. cAMP, intracellular Ca 2+ , diacylglycerol, IP 3 , etc.
- detecting catalytic or enzymatic activity detecting the induction of a reporter gene (e.g. lucifera
- the candidate agent can then be identified as a modulator of the activity of a FLJ20584 polypeptide by comparing the effects of the candidate agent to the control agent.
- Suitable control agents include PBS or normal saline.
- agents such as an enzyme, or a biologically active portion thereof, which is responsible for the production or degradation of a FLJ20584 polypeptide or is responsible for the post-translational modification of a FLJ20584 polypeptide can be identified, hi a primary screen, substantially pure, native or recombinantly expressed FLJ20584 polypeptides, nucleic acids or cellular extract or other sample comprising native or recombinantly expressed FLJ20584 polypeptides or nucleic acids are contacted with a plurality of candidate agents (for example but without limitation, a plurality of agents presented as a library) that may be responsible for the processing of a FLJ20584 polypeptide or nucleic acid, in order to identify such agents.
- a plurality of candidate agents for example but without limitation, a
- the ability of the candidate agent to modulate the production, degradation or post-translational modification of a FLJ20584 polypeptide or nucleic acid can be determined by methods known to those of skill in the art, including without limitation, flow cytonietry, radiolabelling, a kinase assay, a phosphatase assay, immunoprecipitation and Western blot analysis, or Northern blot analysis.
- cells expressing a FLJ20584 polypeptide are contacted with a plurality of candidate agents.
- the ability of such an agent to modulate the production, degradation or post-translational modification of a FLJ20584 polypeptide can be dete ⁇ nined by methods known to those of skill in the art, as described above.
- agents that modulate the expression of a FLJ20584 polypeptide are identified in a cell-based assay system. Accordingly, a population of cells expressing a FLJ205S4 polypeptide or nucleic acid are contacted with a candidate agent and the ability of the candidate agent to alter expression of the FLJ20584 polypeptide or nucleic acid is determined by comparison to a reference range or control.
- a first and second population of cells expressing a FLJ20584 polypeptide are contacted with a candidate agent or a control agent and the ability of the candidate agent to alter the expression of the FLJ20584 polypeptide or nucleic acid is dete ⁇ nined by comparing the difference in the level of expression of the FLJ20584 polypeptide or nucleic acid between the first and second populations of cells, hi a further embodiment, the expression of the FLJ20584 polypeptide or nucleic acid in the first population may be further compared to a reference range or control. If desired, this assay may be used to screen a plurality (e.g. a library) of candidate agents.
- the cell for example, can be of prokaryotic origin (e.g. E.
- the cells can express a FLJ20584 polypeptide or nucleic acid endogenously or be genetically engineered to express a FLJ20584 polypeptide or nucleic acid.
- the ability of the candidate agents to alter the expression of a FLJ20584 polypeptide or nucleic acid can be dete ⁇ nined by methods known to those of skill in the art, for example and without limitation, by flow cytonietry, radiolabelling, a scintillation assay, immunoprecipitation, Western blot analysis or Northern blot analysis.
- agents that modulate the expression of a FLJ20584 polypeptide or nucleic acid are identified in an animal model.
- suitable animals include, but are not limited to, mice, rats, rabbits, monkeys, guinea pigs, dogs and cats.
- the animal used represents a model of cancer.
- a first and second group of mammals are administered with a candidate agent or a control agent and the ability of the candidate agent to modulate the expression of the FLJ20584 polypeptide or nucleic acid is detennined by comparing the difference in the level of expression between the first and second group of mammals.
- the expression levels of the FLJ20584 polypeptides or nucleic acid in the first and second groups of mammals can be compared to the level of a FLJ20584 polypeptide or nucleic acid in a control group of mammals.
- the candidate agent or a control agent can be administered by means known in the art (e.g. orally, rectally or parenterally such as intraperitoneally or intravenously). Changes in the expression of a polypeptide or nucleic acid can be assessed by the methods outlined above, hi a particular embodiment, a therapeutically effective amount of an agent can be determined by monitoring an amelioration or improvement in disease symptoms, to delay onset or slow progression of the disease, for example but without limitation, a reduction in tumour size.
- FLJ20584 polypeptide may also be used in a method for the structure-based design of an agent, in particular a small molecule which acts to modulate (e.g.
- agents which interact with a FLJ20584 polypeptide find use in the treatment and/or prophylaxis of cancer. For such use the agents will generally be administered in the form of a pharmaceutical composition.
- a pharmaceutical composition comprising an agent which interacts with a FLJ20584 polypeptide and a pharmaceutically acceptable diluent, excipient and /or carrier.
- Pha ⁇ naceutical compositions may also find use as a vaccine and may comprise additional components acceptable for vaccine use and may additionally comprise one or more suitable adjuvants as known to the skilled person.
- the agents of use in the invention, FLJ20584 polypeptides and FLJ20584 nucleic acids of use in treatment and/or prophylaxis are referred to as 'active agents'.
- a reference is made herein to a method of treating or preventing a disease or condition using a particular active agent or combination of agents, it is to be understood that such a reference is intended to include the use of that active agent or combination of agents in the preparation of a medicament for the treatment and/or prophylaxis of the disease or condition.
- an antibody for use in the therapy of cancer will usually be supplied as part of a sterile, pharmaceutical composition that will no ⁇ nally include a pharmaceutically acceptable carrier. This composition may be in any suitable form (depending upon the desired method of administering it to a patient).
- Active agents of the invention may be administered to a subject by any of the routes conventionally used for drug administration, for example they may be administered parenterally, orally, topically (including buccal, sublingual or transdermal) or by inhalation.
- the most suitable route for administration in any given case will depend on the particular active agent, the carcinoma involved, the subject, and the nature and severity of the disease and the physical condition of the subject.
- the active agents may be administered in combination, e.g. simultaneously, sequentially or separately, with one or more other therapeutically active, e.g. anti-tumour, compounds.
- Pha ⁇ naceutical compositions may be conveniently presented in unit dose fomis containing a predete ⁇ nined amount of an active agent of the invention per dose.
- Such a unit may contain for example but without limitation, 750mg/kg to O.lmg/kg depending on the condition being treated, the route of administration and the age, weight and condition of the subject.
- Pha ⁇ naceutically acceptable earners for use in the invention may take a wide variety of forms depending, e.g. on the route of administration.
- Compositions for oral administration may be liquid or solid.
- Oral liquid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for reconstitution with water or other suitable vehicle before use.
- Oral liquid preparations may contain suspending agents as known in the art.
- earners such as starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents, and the like may be included. Because of their ease of administration, tablets and capsules represent the most advantageous oral dosage unit form in which case solid pha ⁇ naceutical earners are generally employed.
- active agents of the invention may also be administered by controlled release means and/or by delivery devices.
- Tablets and capsules may comprise conventional earners or excipients such as binding agents for example, syrup, acacia, gelatin, sorbitol, tragacanth, or polyvinylpyrrolidone; fillers, for example lactose, sugar, maize-starch, calcium phosphate, sorbitol or glycine; tableting lubricants, for example magnesium stearate, talc, polyethylene glycol or silica; disintegrants, for example potato starch; or acceptable wetting agents such as sodium lauryl sulphate.
- the tablets may be coated by standard aqueous or non-aqueous techniques according to methods well known in normal pha ⁇ naceutical practice.
- phrases of the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets, each containing a predetermined amount of the active agent, as a powder or granules, or as a solution or a suspension in an aqueous liquid, a non-aqueous liquid, an oil-in-water emulsion or a water- in-oil liquid emulsion.
- compositions may be prepared by any of the methods of pharmacy but all methods include the step of bringing into association the active agent with the earner, which constitutes one or more necessary ingredients, h general, the compositions are prepared by unifo ⁇ nly and intimately admixing the active agent with liquid earners or finely divided solid carriers or both, and then, if necessary, shaping the product into the desired presentation.
- a tablet may be prepared by compression or moulding, optionally with one or more accessory ingredients.
- Pharmaceutical compositions suitable for parenteral administration may be prepared as solutions or suspensions of the active agents of the invention in water suitably mixed with a surfactant such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof in oils.
- compositions suitable for injectable use include aqueous or non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the composition isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
- aqueous or non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the composition isotonic with the blood of the intended recipient
- aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
- Extemporaneous injection solutions, dispersions and suspensions may be prepared from sterile powders, granules and tablets.
- Pha ⁇ naceutical compositions can be administered with medical devices known in the art.
- a pharmaceutical composition of the invention can be administered with a needleless hypodermic injection device, such as the devices disclosed in US 5,399,163; 5,383,851; 5,312,335; 5,064,413; 4,941,880; 4,790,824; or 4,596,556.
- a needleless hypodermic injection device such as the devices disclosed in US 5,399,163; 5,383,851; 5,312,335; 5,064,413; 4,941,880; 4,790,824; or 4,596,556.
- Examples of well known implants and modules useful in the present invention include: US 4,487,603, which discloses an implantable micro-infusion pump for dispensing medication at a controlled rate; US 4,4S6,194, which discloses a therapeutic device for administering medicaments through the skin; US 4,447,233, which discloses a medication infusion pump for delivering medication at a precise infusion rate; US 4,447,224, which discloses a variable flow implantable infusion apparatus for continuous drag delivery; US 4,439,196, which discloses an osmotic drug delivery system having multi-chamber compartments; and US 4,475,196, which discloses an osmotic drug delivery system. Many other such implants, delivery systems, and modules are known to those skilled in the art.
- the pham aceutical compositions of the invention can be fo ⁇ nulated to ensure proper distribution in vivo.
- the blood-brain barrier excludes many highly hydrophilic compounds and it may be preferable to deliver phamiaceutical compositions in Hposomes.
- the active agents of the invention are formulated in hposomes; in a more preferced embodiment, the hposomes include a targeting moiety.
- the therapeutic compounds in the Hposomes are delivered by bolus injection to a site proximal to the tumour. For methods of manufacturing Hposomes, see, e.g.
- the Hposomes may comprise one or more moieties which are selectively transported into specific cells or organs, thus enhancing targeted drag delivery (see, e.g. Ranade, VN. 1989, J. Clin. Pharmacol. 29:685).
- exemplary targeting moieties include folate or biotin (see, e.g. U.S. Patent 5,416,016.); mannosides (Umezawa et al, 1988, Biochem. Biophys. Res.
- compositions may be presented in unit-dose or multi-dose containers, for example in sealed ampoules and vials and to enhance stability, may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use.
- the sterile liquid carrier may be supplied in a separate vial or ampoule and can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g. glycerol, propylene glycol and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils.
- agents such as a local anaesthetic, preservative and buffering agents can be included the sterile liquid carrier.
- Pharmaceutical compositions adapted for topical administration may be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, impregnated dressings, sprays, aerosols or oils, transdermal devices, dusting powders, and the like. These compositions may be prepared via conventional methods containing the active agent. Thus, they may also comprise compatible conventional carriers and additives, such as preservatives, solvents to assist drug penetration, emollients in creams or ointments and ethanol or oleyl alcohol for lotions: Such earners may be present as from about 1% up to about 98% of the composition.
- compositions adapted for transdermal administration may be presented as discrete patches intended to remain in intimate contact with the epidermis of the recipient for a prolonged period of time.
- the active agent may be delivered from the patch by iontophoresis.
- the compositions are preferably applied as a topical ointment or cream.
- the active agent may be employed with either a paraffinic or a water-miscible ointment base.
- the active agent may be formulated in a cream with an oil-in-water cream base or a water-in-oil base.
- Pha ⁇ naceutical compositions adapted for topical administration in the mouth include lozenges, pastilles and mouth washes.
- Pharmaceutical compositions adapted for topical administration to the eye include eye drops wherein the active agent is dissolved or suspended in a suitable carrier, especially an aqueous solvent. They also include topical ointments or creams as above.
- Pharmaceutical compositions suitable for rectal administration wherein the carrier is a solid are most preferably presented as unit dose suppositories.
- Suitable earners include cocoa butter or other glyceride or materials commonly used in the art, and the suppositories may be conveniently formed by admixture of the combination with the softened or melted carrier(s) followed by chilling and shaping moulds. They may also be administered as enemas.
- Pharmaceutical compositions adapted for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams or spray compositions. These may comprise emollients or bases as commonly used in the art.
- Pharmaceutical compositions adapted for use as a vaccine may comprise adjuvants such as cytokines, chemokines, co-stimulatory molecules, or other immunomodulators that amplify and direct the immune response.
- a pharmaceutical composition may comprise a FLJ20584 polypeptide with a synergistic combination of cytokines that induce dendritic cell recruitment (e.g. GM-Colony Stimulating Factor) and co-stimulatory molecules that induce dendritic cell maturation (e.g. CD40L or agonistic anti-CD40) in combination with other Thl /cytotoxic T cell-supporting cytokines such as IL-12 and IL-15.
- Dendritic cells pre- incubated with FLJ20584 polypeptide may be generated ex vivo.
- Other synergistic combinations are described in animal models (Berzofsky, et al, 2001, Nat. Rev. Immunol. 1, 209-219).
- a pharmaceutical composition may also comprise a FLJ205S4 polypeptide, broad MHC class II binding such as pan-HLA- DR-binding peptide, endogenous helper epitopes, or enhanced helper epitopes.
- the dosage to be administered of an active agent will vary according to the particular active agent, the carcinoma involved, the subject, and the nature and severity of the disease and the physical condition of the subject, and the selected route of administration; the appropriate dosage can be readily dete ⁇ nined by a person skilled in the art.
- compositions comprising antibodies can be administered to patients (e.g., human subjects) at therapeutically or prophylactically effective dosages (e.g. dosages which result in tumour growth inhibition and/or tumour cell migration inhibition) using any suitable route of administration, such as injection and other routes of administration known in the art for antibody-based clinical products.
- the compositions may contain from 0.1% by weight, preferably from 10-60%, or more, by weight, of the active agent of the invention, depending on the method of administration.
- FLJ20584 polypeptides may also be of use in the treatment and/or prophylaxis of cancer. Accordingly, provided is a method for the treatment and or prophylaxis of cancer comprising administering a therapeutically effective amount of a composition comprising a FLJ20584 polypeptide, preferably as a vaccine. Also provided is the use of a FLJ20584 polypeptide for the manufacture of a medicament for the treatment and/or prophylaxis of cancer. Where they are provided for use with the methods of the invention FLJ20584 are preferably provided in isolated form. More preferably the FLJ20584 polypeptides have been purified to at least some extent.
- FLJ20584 polypeptides can also be produced using recombinant methods, synthetically produced or produced by a combination of these methods.
- FLJ20584 polypeptides may be provided in substantially pure form, that is to say free, to a substantial extent, from other proteins.
- Recombinant FLJ20584 polypeptides may be prepared by processes well known in the art from genetically engineered host cells comprising expression systems. Accordingly, the present invention also relates to expression systems which comprise a FLJ20584 polypeptide or FLJ20584 nucleic acid, to host cells which are genetically engineered with such expression systems and to the production of FLJ20584 polypeptides by recombinant techniques.
- Cell-free translation systems can also be employed to produce recombinant polypeptides (e.g.
- host cells can be genetically engineered to incorporate expression systems or portions thereof for FLJ20584 nucleic acids.
- incorporation can be perforated using methods well known in the art, such as, calcium phosphate transfection, D ⁇ AD-dextran mediated transfection, transvection, microinjection, cationic Hpid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction or infection (see e.g. Davis et al, Basic Methods in Molecular Biology, 1986 and Sambrook et al, Molecular Cloning: A Laboratory Manual, 2 nd ⁇ d., Cold Spring Harbour laboratory Press, Cold Spring Harbour, NY, 1989).
- Representative examples of host cells include bacterial cells e.g. E.
- Coli Streptococci, Staphylococci, Streptomyces and Bacillus subtilis cells
- fungal cells such as yeast cells and Aspergillus cells
- insect cells such as Drosophila S2 and Spodoptera Sf9 cells
- animal cells such as CHO, COS, HeLa, C127, 3T3, H ⁇ K 293, BHK and Bowes melanoma cells
- plant cells such as CHO, COS, HeLa, C127, 3T3, H ⁇ K 293, BHK and Bowes melanoma cells.
- a wide variety of expression systems can be used, such as and without limitation, chromosomal, episomal and virus-derived systems, e.g.
- the expression systems may contain control regions that regulate as well as engender expression. Generally, any system or vector that is able to maintain, propagate or express a nucleic acid to produce a polypeptide in a host may be used.
- the appropriate nucleic acid sequence may be inserted into an expression system by any variety of well known and routine techniques, such as those set forth in Sambrook et al, supra.
- Appropriate secretion signals may be incorporated into the FLJ20584 polypeptide to allow secretion of the translated protein into the lumen of the endoplasmic reticulum, the periplasmic space or the extracellular environment. These signals may be endogenous to the FLJ20584 polypeptide or they may be heterologous signals. If a FLJ20584 polypeptide is to be expressed for use in cell-based screening assays, it is preferred that the polypeptide be produced at the cell surface, hi this event, the cells may be harvested prior to use in the screening assay.
- the medium can be recovered in order to isolate said polypeptide. If produced intracellularly, the cells must first be lysed before the FLJ20584 polypeptide is recovered.
- FLJ20584 polypeptides can be recovered and purified from recombinant cell cultures or from other biological sources by well known methods including, ammonium sulphate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, affinity chromatography, hydrophobic interaction chromatography, hydroxylapatite chromatography, molecular sieving chromatography, centrifugation methods, electrophoresis methods and lectin chromatography. In one embodiment, a combination of these methods is used.
- an antibody which specifically binds to a FLJ20584 polypeptide can be used to deplete a sample comprising a FLJ205S4 polypeptide of said polypeptide or to purify said polypeptide.
- Techniques well known in the art may be used for refolding to regenerate native or active conformations of the FLJ20584 polypeptides when the polypeptides have been denatured during isolation and or purification.
- FLJ205S4 polypeptides can be obtained from a biological sample from any source, such as and without limitation, a blood sample or tissue sample, e.g. ovary or lung tissue sample.
- FLJ20584 polypeptides may be in the form of a 'mature' protein or may be part of a larger protein such as a fusion protein. It is often advantageous to include an additional amino acid sequence which contains secretory or leader sequences, a pre-, pro- or prepro- protein sequence, or a sequence which aids in purification such as an affinity tag, for example, but without limitation, multiple histidine residues, a FLAG tag, HA tag or myc tag. An additional sequence that may provide stability during recombinant production may also be used. Such sequences may be optionally removed as required by incorporating a cleavable sequence as an additional sequence or part thereof.
- a FLJ20584 polypeptide may be fused to other moieties including other polypeptides.
- additional sequences and affinity tags are well known in the art.
- Amino acid substitutions may be conservative or semi-conservative as known in the art and preferably do not significantly affect the desired activity of the polypeptide. Substitutions may be naturally occurring or may be introduced for example using mutagenesis (e.g. Hutchinson et al, 1978, J. Biol. Chem. 253:6551). Thus, the amino acids glycine, alanine, valine, leucine and isoleucine can often be substituted for one another (amino acids having aliphatic side chains).
- glycine and alanine are used to substitute for one another (since they have relatively short side chains) and that valine, leucine and isoleucine are used to substitute for one another (since they have larger aliphatic side chains which are hydrophobic).
- amino acids which can often be substituted for one another include but are not limited to: - phenylalanine, tyrosine and tryptophan (amino acids having aromatic side chains); - lysine, arginine and histidine (amino acids having basic side chains); - aspartate and glutamate (amino acids having acidic side chains); - asparagine and glutamine (amino acids having amide side chains); - cysteine and methionine (amino acids having sulphui-containing side chains); and - aspartic acid and glutamic acid can substitute for phospho-serine and phospho- tlireonine, respectively (amino acids with acidic side chains).
- the substituted amino acid(s) do significantly affect the activity of the FLJ20584 polypeptide and may be selected specifically to render dominant negative activity upon the peptide. In another embodiment, the substituted amino acid(s) may be selected specifically to render the polypeptide constitutively active.
- modification of the amino acid sequence of epitopes of a FLJ20584 polypeptide commonly referred to as epitope enhancement, is used to improve the efficacy of the vaccine. Modifications include naturally occurring modifications such as and without limitation, post-translational modifications and also non-naturally occurring modifications such as may be introduced by mutagenesis.
- a derivative of a FLJ20584 polypeptide has at least 70% identity to the amino acid sequence shown in Figure 1 (SEQ ID NO:l), more preferably it has at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 98% identity.
- Percentage identity is a well known concept in the art and can be calculated using, for example but without limitation, the BLASTTM software available from NCBI (Altschul, S.F. et al, 1990, J. Mol. Biol. 215:403-410; Gish, W. & States, D.J. 1993, Nature Genet. 3:266-272. Madden, T.L. et al, 1996, Meth. Enzymol.
- a fragment of a FLJ205S4 polypeptide may also be of use in the methods of the invention and includes a fragment of a polypeptide having the amino acid sequence of SEQ ID NO:l, which has at least 70% homology over the length of the fragment.
- said fragments are at least 10 amino acids in length, preferably they are at least 20, at least 30, at least 50 or at least 100 amino acids in length.
- a fragment has at least 70% identity over its length to the amino acid sequence shown in Figure 1 (SEQ ID NO: 1), more preferably it has at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 98% identity.
- Such fragments retain the activity of a FLJ20584 polypeptide.
- activity includes antibody-binding ability.
- a FLJ20584 polypeptide is the active agent of a pharmaceutical composition for use in the treatment and/or prophylaxis of cancer
- preferably recombinant FLJ205S4 polypeptides are used.
- a FLJ20584 polypeptide fused to another polypeptide such as the protein transduction domain of the HIV/Tat protein which facilitates the entry of the fusion protein into a cell (Asoh, S. et al, 2002, Proc. Natl. Acad. Sci. USA,
- the present invention provides a method of screening for and/or diagnosis or prognosis of cancer in a subject, and/or monitoring the effectiveness of cancer therapy, which comprises the step of detecting and/or quantifying in a biological sample obtained from said subject a FLJ20584 polypeptide.
- the FLJ20584 polypeptide for use in the method of screening and/or diagnosis preferably: (a) comprises or consists of the amino acid sequence of SEQ ID NO:l ; (b) is a derivative having one or more amino acid substitutions, modifications, deletions or insertions relative to the amino acid sequence of SEQ ID NO: 1 which retains the activity of FLJ20584; or (c) is a fragment of a polypeptide having the amino acid sequence of SEQ ID NO: 1, which is at least ten amino acids long and has at least 70% homology over the length of the fragment. h one aspect, the expression is compared to a previously determined reference range.
- the step of detecting comprises: (a) contacting the sample with a capture reagent that is specific for a polypeptide as defined in (a) to (c), above; and (b) detecting whether binding has occurred between the capture reagent and said polypeptide in the sample.
- the captured polypeptide is detected using a directly or indirectly labelled detection reagent which may be immobilised on a solid phase.
- a convenient means for detecting/quantifying a FLJ20584 polypeptide involves the use of antibodies.
- a FLJ20584 polypeptide can be used as an immunogen to raise antibodies which interact with (bind to or recognise) said polypeptide using methods known in the art as described above.
- the present invention provides the use of an antibody that specifically binds to at least one FLJ20584 polypeptide for screening for and/or diagnosis of cancer in a subject or for monitoring the efficacy of an anti-cancer therapy, h a particular embodiment, the methods of diagnosis using an anti-FLJ20584 polypeptide antibody can be used to identify an appropriate patient population for treahnent according to the methods of the invention.
- FLJ20584 antibodies can also be used, inter alia, for the diagnosis of cancer by detecting FLJ20584 expression in a biological sample of human tissue and/or in subtractions thereof, for example but without limitation, membrane, cytosolic or nuclear subtractions.
- the method of detecting a FLJ20584 polypeptide in a biological sample comprises detecting and/or quantitating the amount of the FLJ20584 polypeptide in said sample using a directly or indirectly labelled detection reagent.
- a FLJ20584 polypeptide can be detected by means of any immunoassay known in the art, including, without limitation, immunoprecipitation followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis, 2 dimensional gel electrophoresis, competitive and non-competitive assay systems using techniques such as Western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich” immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays and protein A immunoassays.
- Detection of the interaction of an antibody with an antigen can be facilitated by coupling the antibody to a detectable substance for example, but without limitation, an enzyme (such as horseradish peroxidase, alkaline phosphatase, beta-galactosidase, acetylcholinesterase), a prosthetic group (such as streptavidin, avidin, biotin), a fluorescent material (such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, phycoerythrin), a luminescent material (such as luminol), a bioluminescent material (such as luciferase, luciferin, aequorin), a radioactive nuclide (such as 125 1, 131 I, l n In, 99 Tc) a positron emitting metal or a non- radioactive paramagnetic metal
- kits comprising a capture reagent (e.g. an antibody) against a FLJ20584 polypeptide as defined above.
- a capture reagent e.g. an antibody
- a kit may optionally comprise one or more of the following: (1) instructions for using the capture reagent for screening, diagnosis, prognosis, therapeutic monitoring or any combination of these applications; (2) a labelled binding partner to the capture reagent; (3) a solid phase (such as a reagent strip) upon which the capture reagent is immobilised; and (4) a label or insert indicating regulatory approval for screening, diagnostic, prognostic or therapeutic use or any combination thereof.
- the anti-FLJ20584 polypeptide capture reagent itself can be labelled with a detectable marker, e.g. a chemiluminescent, enzymatic, fluorescent, or radioactive moiety (see above).
- a detectable marker e.g. a chemiluminescent, enzymatic, fluorescent, or radioactive moiety (see above).
- detection and/or quantitation of a FLJ20584 nucleic acid may be used in a method of screening for and or diagnosis or prognosis of cancer in a subject, and/or monitoring the effectiveness of cancer therapy.
- FLJ20584 nucleic acids include those nucleic acid molecules winch may have one or more of the following characteristics and thus may: d) comprise or consist of the DNA sequence of SEQ ID NO:2 or its RNA equivalent; e) have a sequence which is complementary to the sequences of d); f) have a sequence which codes for a FLJ205S4 polypeptide; g) have a sequence which shows substantial identify with any of those of d), e) and f); or h) is a fragment of d), e), f) or g), which is at least 15 nucleotides in length; and may have one or more of the following characteristics: 1) they may be DNA or RNA; 2) they may be single or double stranded; 3) they may be in substantially pure form.
- fragments of FLJ20584 nucleic acids are preferably at least 20, at least 30, at least 50, at least 100 or at least 250 nucleotides in length.
- the invention also provides the use of nucleic acids which are complementary to the FLJ20584 nucleic acids described in (d)-(h) above, and can hybridise to said FLJ20584 nucleic acids. Such nucleic acid molecules are referred to as "hybridising" nucleic acid molecules.
- hybridising nucleic acid molecules can be useful as probes or primers.
- Hybridising nucleic acid molecules may have a high degree of sequence identity along its length with a nucleic acid molecule within the scope of (d)-(h) above (e.g. at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98%o sequence identity).
- the use of hybridising nucleic acid molecules that can hybridise to any of the nucleic acid molecules discussed above, e.g. in hybridising assays, is also covered by the present invention.
- Hybridisation assays can be used for screening, prognosis, diagnosis, or monitoring of therapy of cancer in a subject.
- such a hybridisation assay comprises: i) contacting a biological sample, obtained from a subject, containing nucleic acid with a nucleic acid probe capable of hybridising to a FLJ20584 nucleic acid molecule, under conditions such that hybridisation can occur; and ii) detecting or measuring any resulting hybridisation.
- hybridising molecules are at least 10 nucleotides in length and are preferably at least 25 or at least 50 nucleotides in length. More preferably, the hybridising nucleic acid molecules specifically hybridise to nucleic acids within the scope of any one of (d) to (h), above. Most preferably, the hybridisation occurs under stringent hybridisation conditions.
- the invention also provides a diagnostic kit comprising a nucleic acid probe capable of hybridising to RNA encoding a FLJ20584 polypeptide, suitable reagents and instructions for use.
- a diagnostic kit comprising in one or more containers a pair of primers that under appropriate reaction conditions can prime amplification of at least a portion of a FLJ20584 nucleic acid molecule, such as by polymerase chain reaction (see e.g. Innis et al, 1990, PCR Protocols, Academic Press, Inc., San Diego, CA), ligase chain reaction (see EP 320,308) use of Q ⁇ replicase, cyclic probe reaction, or other methods known in the art.
- primers are at least eight nucleotides long and will preferably be at least ten to twenty-five nucleotides long and more preferably fifteen to twenty-five nucleotides long, hi some cases, primers of at least thirty or at least thirty- five nucleotides in length may be used.
- the present invention provides the use of at least one FLJ20584 nucleic acid in the manufacture of a medicament for use in the treatment and/or prophylaxis of cancer.
- hybridising FLJ20584 nucleic acid molecules are used as anti- sense molecules, to alter the expression of FLJ205S4 polypeptides by binding to complementary FLJ20584 nucleic acids and can be used in the treatment and/or prophylaxis or prevention of cancer.
- An antisense nucleic acid includes a FLJ20584 nucleic acid capable of hybridising by virtue of some sequence complementarity to a portion of an RNA (preferably mRNA) encoding a FLJ20584 polypeptide.
- the antisense nucleic acid can be complementary to a coding and/or non-coding region of an mRNA encoding such a polypeptide.
- a FLJ20584 polypeptide is inhibited by use of antisense nucleic acids.
- the present invention provides the therapeutic or prophylactic use of nucleic acids comprising at least eight nucleotides that are antisense to a gene or cDNA encoding a FLJ20584 polypeptide.
- symptoms of cancer may be ameliorated by decreasing the level or activity of a FLJ20584 polypeptide by using gene sequences encoding a polypeptide as defined herein in conjunction with well known gene "knock-out,” ribozyme or triple helix methods to decrease gene expression of the polypeptide.
- ribozyme or triple helix molecules are used to modulate the activity, expression or synthesis of the gene, and thus to ameliorate the symptoms of cancer.
- Such molecules may be designed to reduce or inhibit expression of a mutant or non-mutant target gene. Techniques for the production and use of such molecules are well known to those of skill in the art.
- Endogenous FLJ20584 polypeptide expression can also be reduced by inactivating or "knocking out" the gene encoding the polypeptide, or the promoter of such a gene, using targeted homologous recombination (e.g.
- a mutant gene encoding a nonfunctional polypeptide (or a completely unrelated DNA sequence) flanked by DNA homologous to the endogenous FLJ20584 gene can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that express the target gene in vivo.
- the nucleic acid is administered via gene therapy (see for example Hoshida, T. et al, 2002, Pancreas, 25:111-121; L ino, Y. 2002, Invest. Ophthalmol. Vis. Sci. 2002 43:2406-2411; Bollard, C, 2002, Blood 99:3179-3187; Lee E., 2001, Mol. Med. 7:773-782).
- Gene therapy refers to administration to a subject of an expressed or expressible FLJ205S4 nucleic acid. Any of the methods for gene therapy available in the art can be used according to the present invention.
- Delivery of the therapeutic FLJ205S4 nucleic acid into a patient can be direct in vivo gene therapy (i.e. the patient is directly exposed to the nucleic acid or nucleic acid-containing vector) or indirect ex vivo gene therapy (i.e. cells are first transfonned with the nucleic acid in vitro and then transplanted into the patient).
- an expression vector containing the FLJ20584 nucleic acid is administered in such a manner that it becomes intracellular, i.e. by infection using a defective or attenuated retroviral or other viral vectors as described, for example, in US 4,980,286 or by Robbins et al, 199S, Phannacol. Ther. 80:35-47.
- retraviral vectors that are known in the art are such as those described in Miller et al. (1993, Meth. Enzymol. 217:581-599) which have been modified to delete those retroviral sequences which are not required for packaging of the viral genome and subsequent integration into host cell DNA.
- adenoviral vectors can be used which are advantageous due to their ability to infect non-dividing cells and such high-capacity adenoviral vectors are described in Kochanek (1999, Human Gene Therapy, 10:2451-2459).
- Chimeric viral vectors that can be used are those described by Reynolds et al. (1999, Molecular Medicine Today, 1 :25 -31).
- Hybrid vectors can also be used and are described by Jacoby et al.
- a nucleic acid ligand compound comprising a FLJ20584 nucleic acid
- the ligand comprises a fusogenic viral peptide designed so as to disrupt endosomes, thus allowing the FLJ20584 nucleic acid to avoid subsequent lysosomal degradation.
- the FLJ20584 nucleic acid can be targeted, in vivo, for cell specific endocytosis and expression by targeting a specific receptor such as that described in WO92/06180, WO93/14188 and WO 93/20221.
- the nucleic acid can be introduced intracellularly and incorporated within the host cell genome for expression by homologous recombination (See Zijlstra et al, 1989, Nature, 342:435-428).
- homologous recombination See Zijlstra et al, 1989, Nature, 342:435-428.
- a gene is transferred into cells in vitro using tissue culture and the cells are delivered to the patient by various methods such as injecting subcutaneously, application of the cells into a skin graft and the intravenous injection of recombinant blood cells such as haematopoietic stem or progenitor cells.
- Cells into which a FLI20584 nucleic acid can be introduced for the purposes of gene therapy include, for example, epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes and blood cells.
- the blood cells that can be used include, for example, T-lymphocytes, B-lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryotcytes, granulocytes, haematopoietic cells or progenitor cells, and the like.
- the pharmaceutical composition comprises a FLJ20584 nucleic acid, said nucleic acid being part of an expression vector that expresses a FLJ20584 polypeptide or chimeric protein thereof in a suitable host.
- a nucleic acid has a promoter operably linked to the polypeptide coding region, said promoter being inducible or constitutive (and, optionally, tissue-specific).
- a nucleic acid molecule is used in which the coding sequences and any other desired sequences are flanked by regions that promote homologous recombination at a desired site in the genome, thus providing for intrachromosomal expression of the nucleic acid (Koller & Smithies, 1989, Proc. Natl.
- FLJ205S4 nucleic acids maybe obtained using standard cloning and screening techniques, from a cDNA library derived from mRNA in human cells, using expressed sequence tag (EST) analysis (Adams, M. et al, 1991, Science, 252:1651-1656; Adams, M. et al, 1992, Nature 355:632-634; Adams, M. et al, 1995, Nature, 377:Suppl: 3-174).
- FLJ20584 nucleic acids can also be obtained from natural sources such as genomic DNA libraries or can be synthesized using well known and commercially available techniques.
- the FLJ20584 nucleic acids comprising coding sequence for FLJ20584 polypeptides described above can be used for the recombinant production of said polypeptides.
- the FLJ205S4 nucleic acids may include the coding sequence for the mature polypeptide, by itself; or the coding sequence for the mature polypeptide in reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre-, pro- or prepro-protein sequence, a cleavable sequence or other fusion peptide portions, such as an affinity tag or an additional sequence conferring stability during production of the polypeptide.
- Preferred affinity tags include multiple histidine residues (for example see Gentz et al, 1989, Proc. Natl. Acad. Sci USA 86:821-824), a
- FLJ20584 nucleic acids may also contain non-coding 5' and 3' sequences, such as transcribed, non-translated sequences, splicing and polyadenylation signals, ribosome binding sites and sequences that stabilize mRNA.
- FLJ20584 polypeptide derivatives, above, can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of a FLJ20584 nucleic acid such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Standard techniques known to those of skill in the art can be used to introduce mutations, including, for example, site-directed mutagenesis and PCR-mediated mutagenesis.
- a FLJ20584 nucleic acid encoding a FLJ20584 polypeptide, including homologues and orthologues from species other than human, may be obtained by a process which comprises the steps of screening an appropriate library under stringent hybridisation conditions with a labelled probe having the sequence of a FLJ20584 nucleic acid as described in (d)-(h) above, and isolating full-length cDNA and genomic clones containing said nucleic acid sequence.
- Such hybridisation techniques are well known in the art.
- stringent hybridisation conditions are where attempted hybridisation is carried out at a temperature of from about 35°C to about 65°C using a salt solution of about 0.9M.
- relatively stringent conditions such as low salt or high temperature conditions, are used to fo ⁇ n the duplexes.
- Highly stringent conditions include hybridisation to filter-bound DNA in 0.5M NaHPO 4 , 7% sodium dodecyl sulphate (SDS), ImM EDTA at 65°C, and washing in O.lxSSC/0.1% SDS at 68°C (Ausubel F.M.
- Hybridisation conditions can also be rendered more stringent by the addition of increasing amounts of fo ⁇ namide, to destabilise the hybrid duplex.
- particular hybridisation conditions can be readily manipulated, and will generally be chosen as appropriate, hi general, convenient hybridisation temperatures in the presence of 50% formamide are: 42°C for a probe which is 95-100% identical to the fragment of a gene encoding a polypeptide as defined herein, 37°C for 90-95% identity and 32°C for 70-90% identity.
- an isolated cDNA sequence will be incomplete, in that the region coding for the polypeptide is cut short at the 5' end of the cDNA. This is a consequence of reverse transcriptase, an enzyme with inherently low processivity (a measure of the ability of the enzyme to remain attached to the template during the polymerization reaction), failing to complete a DNA copy of the mRNA template during 1 st strand cDNA synthesis.
- Methods to obtain full length cDNAs or to extend short cDNAs are well known in the art, for example RACE (Rapid amplification of cDNA ends; e.g. Frohman et al, 1988, Proc. Natl. Acad.
- Tins technology uses cDNAs prepared from mRNA extracted from a chosen tissue followed by the ligation of an adaptor sequence onto each end. PCR is then carried out to amplify the missing 5'-end of the cDNA using a combination of gene specific and adaptor specific oligonucleotide primers. The PCR reaction is then repeated using nested primers which have been designed to anneal with the amplified product, typically an adaptor specific primer that anneals further 3' in the adaptor sequence and a gene specific primer that anneals further 5' in the known gene sequence.
- the products of this reaction can then be analysed by DNA sequencing and a full length cDNA constructed either by joining the product directly to the existing cDNA to give a complete sequence, or carrying out a separate full length PCR using the new sequence information for the design of the 5' primer.
- a further aspect of the invention relates to a vaccine composition of use in the treatment and or prophylaxis of cancer.
- a FLJ20584 polypeptide or nucleic acid as described above can be used in the production of vaccines for treatment and or prophylaxis of cancer.
- Such material can be antigenic and/or immunogenic.
- Antigenic includes a protein or nucleic acid that is capable of being used to raise antibodies or indeed is capable of inducing an antibody response in a subject.
- Immunogenic material includes a protein or nucleic acid that is capable of eliciting an immune response in a subject.
- the protein or nucleic acid may be capable of not only generating an antibody response but, in addition, a non-antibody based immune responses, i.e.
- an antigenic or immunogenic polypeptide that are responsible for the antigenicity or immunogenicity of said polypeptide, i.e. an epitope or epitopes.
- Amino acid and peptide characteristics well known to the skilled person can be used to predict the antigenic index (a measure of the probability that a region is antigenic) of a FLJ20584 polypeptide.
- the FLJ20584 polypeptides may include one or more such epitopes or be sufficiently similar to such regions so as to retain their antigenic/immunogenic properties
- the FLJ20584 polypeptide as the active agent of a pharmaceutical composition for use in a vaccine is a short peptide, preferably 5 to 20 amino acids long, more preferably 7 to 15 amino acids and most preferably 8 to 10 amino acids long.
- Such a peptide may comprise a modified epitope to enhance the efficacy of the vaccine. Such modification can serve to (a) increasing affinity of peptide for major histocompatibiltiy complex molecules; (b) increasing T cell receptor triggering; or (c) inhibiting proteolysis of the peptide by serum peptidases.
- the vaccine composition is preferably administered parenterally (e.g. subcutaneous, intramuscular, intravenous or intradermal injection) or by cellular transfection or infection using a bacterial or a viral vector, such as an adenoviral vector, comprising a FLJ20584 nucleic acid sequence.
- the present invention provides: a) the use of such a vaccine in inducing an immune response in a subject; and b) a method for the treatment and/or prophylaxis of cancer in a subject, or of vaccinating a subject against cancer which comprises the step of administering to the subject an effective amount of a FLJ20584 polypeptide or nucleic acid, preferably as a vaccine.
- Figure 1 shows an amino acid sequence (SEQ ID NOT) of a FLJ20584 polypeptide.
- Figure 2 shows a nucleic acid sequence (SEQ ID NO:2) encoding a FLJ20584 polypeptide.
- Figure 3 shows the normal tissue distribution of FLJ205S4 mRNA. Levels of mRNA were quantified by real time RT-PCR and are expressed as the number of copies ng "1 cDNA.
- Figure 4 shows the distribution of FLJ20584 mRNA in no ⁇ nal tissues (open bars) versus ovarian cancer tissues (solid black bars) and ovarian cancer-derived cell lines (diagonally- hatched bars) and in osteosarcoma tissues (dotted bars) and in osteosarcoma-derived cell lines (horizontally-hatched bars).
- Figure 5 shows the distribution of FLJ20584 mRNA in normal tissues (open bars) versus lung cancer tissues (solid black bars) and lung cancer-derived cell lines (diagonally-hatched bars).
- Example 1 Isolation of FLJ20584 Protein from Tumour-Derived Cell Lines: Proteins in the heparin binding fraction of colorectal tumour-derived cell line membranes and in gastric tumour-derived cell line membranes were separated by SDS-PAGE and analysed.
- la Cell culture A colorectal cancer line membrane pool was prepared from the following human colon adenocarcinoma cell lines: HCT-15 cells (ATCC CCL-225); HT-29 cells (ATCC HTB- 38); LoVo (ATCC Cat. No. CCL-229); LS174T (ATCC Cat. No. CL-188); SW620 (ATCC Cat. No. CCL-227); and SW948 (ATCC Cat. No. CCL-237).
- HT29 cells were cultured in McCoy's + 2 mM Glut + 10% FBS.
- LS174T cells were cultured in MEM + 2mM glutamine + 10% FBS + 1% NEAA.
- HCT-15 cells were cultured in RPMI+20% FBS.
- LoVo cells were cultured in Hams F12 +10% FBS.
- SW620 and SW948 cells were cultured in L-15 + 10% FBS.
- a gastric cancer line membrane pool was prepared from the following human cell lines: AGS gastric adenocarcinoma cells (ATCC Cat No. CRL-1739); KATO-III gastric carcinoma cells (ATCC Cat. No. HTB-103); NCI-N87 gastric adenocarcinoma cells (ATCC Cat. No.
- NCI-SNU-1 gastric carcinoma cells ATCC Cat. No. CRL-5971.
- AGS cells were cultured in Ham's F12 + 2 mM Glut + 10% FBS.
- NCI-N87 cells were cultured in RPMI + 2 mM Glut + 10%FBS.
- NCI-SNU-1 cells were cultured in RPMI + 2 mM Glut + 10%FBS.
- KATO-III cells were cultured in RPMI + 2 mM Glut + 20%FBS. All cells were grown at 37°C in a humidified atmosphere of 95% air and 5% carbon dioxide.
- lb - Cell fractionation and plasma membrane generation Purified membrane preparations were isolated from the cell lines.
- Adherent cells (2 x) 2 x
- Membranes were fractionated using the method described by Pasquali et al (Pasquali C. et al, 1999 J. Chromatography 722: pp 89-102). The fractionated cells were centrifuged at 3000 x g for 10 min at 4°C and the postnuclear supernatant was layered onto a 60% sucrose cushion and centrifuged at 100 000 x g for 45 min. The membranes were collected using a pasteur pipette and layered on a preformed 15 to 60% sucrose gradient and spun at 100 000 x g for 17hrs.
- Proteins from the fractionated sucrose gradient were ran on a 4-20% ID gel (Novex) and subject to western blotting; those fractions containing alkaline phosphatase and transfenin immunoreactivity but not oxidoreductase II or calnexin immunoreactivity were pooled and represented the plasma membrane fraction.
- ID-gel analysis Plasma membrane fractions that had transfenin immunoreactivity but no oxidoreductase II or calnexin immunoreactivity were identified and pooled.
- This pool which represented the plasma membrane fraction was diluted at least four times with lOmM HEPES, lmM EDTA lmM Vanadate, 0.02% Azide and added to a SW40 or SW60 tube and centrifuged at 100 000 x g for 45min with slow acceleration and deceleration. The supernatant was removed from the resulting membrane pellet and the pellet washed three times with PBS-CM. Resuspended membrane pellets (in 25mM Tris-HCl pH 7.5) from the colon carcinoma cell lines were pooled and passed over a 5ml heparin Sepharose Hi-Trap column (Pharmacia) using a FPLC system.
- the loaded column was washed with 10 column volumes of wash buffer (150mM NaCl, 25mM Tris-HCl pH 7.5), then eluted with 5ml 1.0M NaCl in 25mM Tris-HCl pH 7.5. Eluted protein was concentrated and buffer exchanged by centrifugation through a 30kDa cut-off filter (Vivascience). Concentrated protein was made up to 2% SDS, 63mM TrisHCl, pH 7.4. A protein assay was performed followed by the addition of mercaptoethanol (2% final), glycerol (10%) and bromophenol blue (0.0025% final) was added. A final protein concentration of 1 micro gram/mi crolitre was used for ID-gel loading. The gastric cancer cell line membrane pellet was solubilised in 2% SDS in 63mM
- a sample containing 30-50 micrograms of the protein mixtures obtained from a detergent extract were applied to the stacking gel wells using a micro-pipette.
- a well containing molecular weight markers (10, 15, 25, 37, 50, 75, 100, 150 and 250 kDa) was included for calibration by interpolation of the separating gel after imaging. Separation of the proteins was perfo ⁇ ned by applying a current of 30mA to the gel for approximately 5hrs or until the bromophenol blue marker dye had reached the bottom of the gel. After electrophoresis the gel plates were prised open, the gel placed in a tray of fixer
- Recovered peptide pools were analysed by MALDI-TOF-mass spectrometry (Voyager STR, Applied Biosystems, Framingham, MA) using a 337 mil wavelength laser for desorption and the reflectron mode of analysis. Pools were also analyzed by nano-LC tandem mass spectrometry (LC/MS/MS) using a Micromass Quadrupole Tinie-of-Flight (Q-TOF) mass spectrometer (Micromass, Altrincham, UK).
- MALDI-TOF-mass spectrometry Voyager STR, Applied Biosystems, Framingham, MA
- Pools were also analyzed by nano-LC tandem mass spectrometry (LC/MS/MS) using a Micromass Quadrupole Tinie-of-Flight (Q-TOF) mass spectrometer (Micromass, Altrincham, UK).
- Criteria for database identification included: the cleavage specificity of trypsin; the detection of a suite of a, b and y ions in peptides returned from the database, and a mass increment for all Cys residues to account for carbamidomethylation.
- masses detected in MALDI-TOF mass spectra were assigned to tryptic digest peptides within the proteins identified.
- tandem mass spectra of the peptides were interpreted manually, using methods known in the art.
- the primers used for PCR were as follows: Sense, 5'- cattccccatgaacagaagctc - 3', (SEQ ID NO: 3) Antisense, 5'- actggagcgcttgaggtagaag - 3' (SEQ ID NO: 4) Reactions containing 5ng cDNA, SYBR green sequence detection reagents (PE Biosystems) and sense and antisense primers were assayed on an ABI7700 sequence detection system (PE Biosystems). The PCR conditions were 1 cycle at 50°C for 2 min, 1 cycle at 95°C for 10 min, and 40 cycles of 95°C for 15s, 65°C for lmin.
- Example 3 Cloning of FLJ20584 A DNA sequence encoding a FLJ20584 polypeptide was amplified from a mix of
- MDA-MB-468 and DMS1 14 cDNAs prepared from RNA isolated from these cell lines.
- the primers used to amplify these sequences were: sense 5' agaccacgtcaaccacagag 3' (SEQ ID NO:5) and anti-sense 5' agagcatggaagagccagg 3' (SEQ ID NO:6).
- the amplification reaction was carried out using Pfu polymerase (Stratagene) with thennal cycling parameters of : 1 cycle of 94°C for 2 min, 40 cycles of 94°C for 30s, 50°C for 30s, 72°C for 30s and 1 cycle of 72°C for 7 min.
- the PCR product of the appropriate size was gel purified, cloned into a blunt-ended cloning vector (pCR4Blunt-TOPO, Invitrogen) and the DNA sequence verified.
- Example 4 Cell surface localisation of FLJ20584 Immunocytochemical analysis of MiaPaca-2 cells transiently transfected with the expression plasmid encoding FLJ205S4-AFP fusion was used to determine the membrane topology of FLJ20584 protein.
- the expression plasmid was constructed by amplifying the FLJ20584 ORF from a plasmid template (FLJ205S4 in pCR4Blunt-TOPO, h vitrogen) using Pfu DNA polymerase (PfuTurbo Hotstart DNA polymerase, Stratagene) and the following primers: forward 5'- ccatggtaccgccaccatggcaaatttcaagggccacg-3' (SEQ ID NO:7) and reverse 5'- ccataagcttgttcctcatctgagccactcaag-3' (SEQ ID NO:8).
- the PCR product was digested with BstEII and Hindlll restriction endonucleases and cloned into pQBI25/50-fnl vector (Quantum Biotechnologies) digested with the same restriction endonucleases, in order to express a fusion protein consisting of FLJ20584 at the N-terminus and AFP at the C- terminus.
- MiaPaCa-2 cells were seeded into 8-well chamber slides, maintained at 37°C in a humidified atmosphere of 95%> air and 5% CO 2 for 24hr and then transfected with the FLJ20584 expression plasmid using Gene Juice transfection reagent (Merck Biosciences).
- Transfected cells were cultured overnight, washed with PBS, fixed with 4% parafomialdehyde and blocked with 5% donkey seram/PBS prior to immunocytochemical analysis with an anti-AFP antibody (3E6, Invitrogen) as primary antibody.
- an anti-AFP antibody (3E6, Invitrogen) as primary antibody.
- cells were permeabilised with 0.1 % saponin after fixation and before the addition of primary antibody.
- the cells were incubated with primary antibody or mouse IgG as control for lhr incubation at room temperature with primary antibody, washed with 5% donkey seram/PBS, and further incubated for lhr at room temperature with a biotin-conjugated secondary antibody (Biotin-SP Affinipure Donkey anti-mouse, Jackson Immunoresearch).
- the cells were then washed with 5% donkey seram/PBS, incubated with ExtrAvidin-Cy3 (Sigma) for 30min at room temperature, and then processed for fluorescence microscopy.
- Specific plasma membrane staining was seen on MiaPaCa-2 cells that were transfected with the expression plasmid encoding FLJ20584. No staining was observed on untransfected cells, or control cells transfected with pQBI25/50-fnl vector.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Toxicology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Epidemiology (AREA)
- Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2007512312A JP2008509082A (ja) | 2004-05-05 | 2005-05-04 | 癌に関係するタンパク質 |
| EP05740429A EP1747234A1 (en) | 2004-05-05 | 2005-05-04 | A protein involved in cancer |
| AU2005238281A AU2005238281A1 (en) | 2004-05-05 | 2005-05-04 | A protein involved in cancer |
| US11/587,466 US20070269431A1 (en) | 2004-05-05 | 2005-05-04 | Protein Involved In Cancer |
| CA002562181A CA2562181A1 (en) | 2004-05-05 | 2005-05-04 | A protein involved in cancer |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB0410021.0 | 2004-05-05 | ||
| GBGB0410021.0A GB0410021D0 (en) | 2004-05-05 | 2004-05-05 | A protein involved in cancer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2005105835A1 true WO2005105835A1 (en) | 2005-11-10 |
Family
ID=32482711
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2005/001669 Ceased WO2005105835A1 (en) | 2004-05-05 | 2005-05-04 | A protein involved in cancer |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20070269431A1 (https=) |
| EP (1) | EP1747234A1 (https=) |
| JP (1) | JP2008509082A (https=) |
| AU (1) | AU2005238281A1 (https=) |
| CA (1) | CA2562181A1 (https=) |
| GB (1) | GB0410021D0 (https=) |
| WO (1) | WO2005105835A1 (https=) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IL300418B2 (en) * | 2020-08-06 | 2024-11-01 | Univ Tsinghua | Chemical synthesis of large and mirror-image proteins and uses thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020018766A1 (en) * | 1998-10-05 | 2002-02-14 | Roberts Bruce L. | Genes differentially expressed in cancer cells to design cancer vaccines |
| WO2004030615A2 (en) * | 2002-10-02 | 2004-04-15 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
| WO2005037865A2 (en) * | 2003-10-16 | 2005-04-28 | Zymogenetics, Inc. | Ztnfr14, A TUMOR NECROSIS FACTOR RECEPTOR |
-
2004
- 2004-05-05 GB GBGB0410021.0A patent/GB0410021D0/en not_active Ceased
-
2005
- 2005-05-04 US US11/587,466 patent/US20070269431A1/en not_active Abandoned
- 2005-05-04 WO PCT/GB2005/001669 patent/WO2005105835A1/en not_active Ceased
- 2005-05-04 AU AU2005238281A patent/AU2005238281A1/en not_active Abandoned
- 2005-05-04 JP JP2007512312A patent/JP2008509082A/ja not_active Abandoned
- 2005-05-04 EP EP05740429A patent/EP1747234A1/en not_active Withdrawn
- 2005-05-04 CA CA002562181A patent/CA2562181A1/en not_active Abandoned
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020018766A1 (en) * | 1998-10-05 | 2002-02-14 | Roberts Bruce L. | Genes differentially expressed in cancer cells to design cancer vaccines |
| WO2004030615A2 (en) * | 2002-10-02 | 2004-04-15 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
| WO2005037865A2 (en) * | 2003-10-16 | 2005-04-28 | Zymogenetics, Inc. | Ztnfr14, A TUMOR NECROSIS FACTOR RECEPTOR |
Non-Patent Citations (4)
| Title |
|---|
| DATABASE Geneseq [online] 18 November 2004 (2004-11-18), "Tumour-associated antigenic target (TAT) cDNA DNA323722, SEQ ID NO:8.", XP002346216, retrieved from EBI accession no. GSN:ACN37250 Database accession no. ACN37250 * |
| DATABASE Geneseq [online] 18 November 2004 (2004-11-18), "Tumour-associated antigenic target (TAT) polypeptide PRO80482, SEQ:9.", XP002346215, retrieved from EBI accession no. GSN:ABM80002 Database accession no. ABM80002 * |
| DATABASE Geneseq [online] 30 August 2002 (2002-08-30), "Human novel polypeptide #10.", XP002346218, retrieved from EBI accession no. GSN:ABG66675 Database accession no. ABG66675 * |
| DATABASE Geneseq [online] 9 April 2002 (2002-04-09), "Human secreted protein SECP34.", XP002346217, retrieved from EBI accession no. GSN:AAU82008 Database accession no. AAU82008 * |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2008509082A (ja) | 2008-03-27 |
| AU2005238281A1 (en) | 2005-11-10 |
| GB0410021D0 (en) | 2004-06-09 |
| CA2562181A1 (en) | 2005-11-10 |
| US20070269431A1 (en) | 2007-11-22 |
| EP1747234A1 (en) | 2007-01-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9120860B2 (en) | Protein involved in ovarian cancer | |
| JP4446036B2 (ja) | 上皮誘導性癌の治療のための薬剤組成物 | |
| AU2003249072B2 (en) | PTK7 protein involvement in carcinoma | |
| US20070142276A1 (en) | Protein involved in carcinoma | |
| US20070269431A1 (en) | Protein Involved In Cancer | |
| US20070141061A1 (en) | Protein involved in carcinoma | |
| US20090214540A1 (en) | Protein involved in cancer | |
| WO2005105143A2 (en) | Vaccines and antibodies against ltk for therapy of cancers. | |
| WO2006000753A2 (en) | Use of flj40787, a protein involved in colon, colorectal, ovarian, lung and/or liver cancer | |
| GB2455634A (en) | Treatment of cancer | |
| WO2006003427A1 (en) | A protein involved in carcinoma | |
| JP2010117358A (ja) | 癌に関与するタンパク質 | |
| WO2005049066A2 (en) | Use of dudulin2 for the treatment or prophylaxis of lung cancer | |
| WO2005019257A1 (en) | A protein involved in pancreatic cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2005740429 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2562181 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007512312 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005238281 Country of ref document: AU |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWW | Wipo information: withdrawn in national office |
Country of ref document: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2005238281 Country of ref document: AU Date of ref document: 20050504 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005238281 Country of ref document: AU |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005740429 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11587466 Country of ref document: US |
|
| WWP | Wipo information: published in national office |
Ref document number: 11587466 Country of ref document: US |