WO2005103247A1 - Oligonucleotide probe - Google Patents

Abstract

An oligonucleotide probe which is tenaciously fixed to a support and efficiently holds a complementary target nucleic acid. It is an oligonucleotide probe represented by the general formula B-D-A (wherein A represents an oligonucleotide; D represents a divalent organic group having at least one aromatic group; and B represents a reactive functional group or a protected form thereof.)

Description

 Oligonucleotide probes

Technical field

 The present invention relates to an oligonucleotide probe composed of a linker having an aromatic group and an oligonucleotide, a carrier having the oligonucleotide probe immobilized thereon, and a compound for synthesizing the oligonucleotide probe.

 Light

 Background art

 In a genetic analysis using a DNA chip or beads, it is necessary to immobilize a synthetic oligonucleotide or a P.CR product on a carrier as a probe. By binding the probe immobilized on the carrier and the target nucleic acid labeled with fluorescence, etc., the target nucleic acid is retained on the carrier and measuring the fluorescence intensity derived from the label The amount of the target nucleic acid can be detected. In the DNA chip, thousands to hundreds of thousands of probes are immobilized at predetermined locations on a flat carrier, so that the expression level of other types of genes can be determined at once. It is extremely useful for elucidating complex networks between genes. Therefore, it is expected as one of the powerful methods for genetic diagnosis.

In order to immobilize the synthetic oligonucleotide probe on the carrier, a method of directly synthesizing the oligonucleotide on the carrier (Nucleic Acids Res., Vol. 20, 1675-16-1678 (1) 992) and Trends Biotechno 1., vol. 12, 19-26 (1994)), and a method of purifying synthesized oligonucleotides and immobilizing them on a carrier. is there. In the latter method, during the synthesis of the oligonucleotide probe, functional groups such as amino groups are introduced, and after spotting, these functional groups form covalent bonds with the functional groups coated on the carrier. Methods for irreversibly immobilizing probes are known. In addition, there has been reported a method of electrostatically binding an oligonucleotide probe to a carrier coated with a positively charged poly-L-lysine or the like. Electrostatic binding depends on the negative charge of the oligonucleotide Therefore, the shorter the length of the oligonucleotide probe, the lower the immobilization efficiency. Therefore, a method of immobilizing an oligonucleotide on a carrier via a covalent bond is widely used.

 It is known that a functional group such as an amino group is introduced into an oligonucleotide via a linker (Coulleta 1-, Tetrahedron, vol. 27, 3991-3994 (19986) ) And Connolly, B. A., Nucleic Acids Res., Vol. 1, 5, 3 1 3 1—3 13 9 (1 98 7))). Currently, the most frequently used linker with an amino group is a linker having 6 carbon atoms. Oligonucleotide probes to which an amino group is bound via this linker are also commercially available as a probe library for a DNA chip (for example, MWG, Sigma dienosis, etc.).

 When an oligonucleotide probe is immobilized on a carrier such as a chip, a functional group such as an amino group or a mercapto group is introduced during the synthesis of the oligonucleotide. Currently used reagents for introducing an amino group into an oligonucleotide include an amidite compound in which the amino group is protected with a trifluoroacetyl group or a monomethoxytrityl group. However, the reagents as described above have a problem that the efficiency of introducing an amino group into an oligonucleotide is low. In addition, when an N-trifluoroacetyl-16-aminohexylamidite compound is used, it is difficult to separate and purify an oligonucleotide having an amino group introduced therein (oligonucleotide having an amino group introduced therein) and an oligonucleotide not having been introduced thereinto. The problem was that these were mixed. On the other hand, when an N-monomethoxytrityl-6-aminohexylamidite compound is used, separation and purification can be performed, but it takes time to remove the monomethoxytrityl group under acidic conditions after separation, and the oligonucleotide is highly purified. Was difficult to purify. In gene diagnosis, a large number of oligonucleotide probes are required, and it has been desired to purify the DNA more easily and with higher purity.

Furthermore, when the purified amino group-introduced oligonucleotide obtained above is immobilized on a carrier, sufficient reactivity of the amino group with the coating agent on the carrier surface is low, and sufficient oligonucleotide is immobilized on the carrier. Contains a high concentration of oligonucleotides I needed to spot the tide. As a result, a large number of oligonucleotides were required, which increased the price of the chip. Therefore, it has been desired to effectively immobilize the oligonucleotide probe on a carrier.

 Also, in order to obtain high sensitivity in a DNA chip or the like, it is important to efficiently retain the target nucleic acid to be detected on the oligonucleotide probe. Since the stability of binding between an oligonucleotide and a target nucleic acid depends on the length of the oligonucleotide, it was necessary to synthesize a long-chain oligonucleotide in order to increase the binding stability. However, when a large number of oligonucleotide probes are required, such as a DNA chip, there is a problem that it is not suitable from the viewpoint of cost to synthesize a long-chain oligonucleotide probe. Disclosure of the invention

 An object of the present invention is to provide an oligonucleotide probe which is firmly immobilized on a carrier, can be easily purified after synthesis, and efficiently retains a complementary target nucleic acid.

 The present inventors have conducted intensive studies to solve the above problems, and as a result, synthesized a novel compound in which a reactive functional group required for immobilization to a carrier was linked to an aromatic group, and converted this into an oligonucleotide. The inventors have found that the above-mentioned problems can be solved by introducing the present invention, and have completed the present invention.

 That is, the present invention includes the following inventions.

 (1) — General formula 1:

 B— D _ A (1)

 (Wherein A represents an oligonucleotide, D represents a divalent organic group having at least one aromatic group, and B represents a reactive functional group or a protected form thereof) Oligonucleotide probe.

 (2) The oligonucleotide probe according to (1), wherein the aromatic group is a substituted or unsubstituted monocyclic to pentacyclic aromatic hydrocarbon group.

(3) The oligonucleotide probe according to (2), wherein the aromatic group contains a substituted or unsubstituted phenanthrene ring, fluorene ring, naphthalene ring, anthracene ring or pyrene ring. (HNNH4) D 'is a linear or branched substituted or unsubstituted divalent hydrocarbon group which may contain a heteroatom and has at least one aromatic group (1) to (3) The oligonucleotide probe according to any one of the above.

 (5) The oligonucleotide probe according to any one of (1) to (4), wherein D contains a divalent aromatic group in the main chain.

 (6) The oligonucleotide probe according to any one of (1) to (4), wherein D has an aromatic group in a side chain.

 (7) The oligonucleotide probe according to (6), wherein D is represented by general formula 2:

R ₃

One R Wu CI—R ₂ '-(2)

 I

 R1

(Wherein, L represents an aromatic group, represents a hydrogen atom or a substituent, and R ₂ , R ₂ ′ and R ₃ each independently represent a direct bond or a substituted or unsubstituted hetero atom. Represents a divalent hydrocarbon group). -(8) R ₂ is a general formula 3:

— R ₄ — (CH ₂ ) _m -R _5- (CH ₂ ) _n — (3)

Represented by

R ₃ has the general formula 4:

One (CH ₂ ) _t One R ₆ — (CH ₂ ) _w — (4)

Represented by

R ₄ is a direct bond or one (CH ₂ ) (OCH ₂ CH ₂ ) _q — O—,

R _c and R ₆ are each independently a direct bond or a group shown below:

Represents

m and t each independently represent an integer from 0 to 20,

 n, w, i, and q each independently represent an integer of 1 to 20,

R ₇ represents a hydrogen atom or a phosphate protecting group,

 The oligonucleotide probe according to (7).

 (9) The oligonucleotide probe according to (7) or (8), wherein L is a substituted or unsubstituted fuel group, phenanthryl group, fluorenyl group, naphthyl group, anthryl group or pyrenyl group.

 (10) The oligonucleotide probe according to any one of (1) to (6), wherein D has an additional oligonucleotide on a side chain.

 (11) The oligonucleotide probe according to (5), wherein D is represented by the general formula 2 ′:

 A 'l3

— R "— L— R ₁₂ —? 一 R ₁₄ — (2 ')

(Wherein, L represents a divalent aromatic group, represents a hydrogen atom or a substituent,

R ₁₂ , ₃ and R ₁₄ each independently represent a direct bond or a substituted or unsubstituted divalent hydrocarbon group which may contain a hetero atom, and A ′ represents a hydroxyl group or an oligonucleotide. ).

 (12) A carrier on which the oligonucleotide probe according to any one of (1) to (11) is immobilized.

 (13) General formula 5:

? ⁹

-R ₁₀

 B-D'-O-R (5)

OR 8 (where D 'represents a divalent organic group having at least one aromatic group, and B is Represents a reactive functional group or a protected form thereof, o represents an oxygen atom, P represents a phosphorus atom, R ₈ represents a phosphate protecting group, R ₉ and. Is an organic group, and may form a ring together with the nitrogen atom to which they are bonded.)

 (14) The compound according to (13), wherein the aromatic group is a substituted or unsubstituted 1 to 5 cyclic aromatic hydrocarbon group.

 (15) The compound according to (14), wherein the aromatic group contains a substituted or unsubstituted phenanthrene ring, a fluorene ring, a naphthalene ring, an anthracene ring or a pyrene ring.

 (16) D ′ is a linear or branched, substituted or unsubstituted divalent hydrocarbon group optionally containing a heteroatom, and has at least one aromatic group. 15. The compound according to any one of 5).

 (17) The compound according to any one of (13) to (16), wherein D 'contains a divalent aromatic group in the main chain.

 (18) The compound according to any one of (13) to (16), wherein D 'has an aromatic group in a side chain.

 (19) The compound according to (18), wherein D 'is represented by General Formula 2:

(Wherein L represents an aromatic group, represents a hydrogen atom or a substituent, and R ₂ , R ₂ ′ and R ₃ each independently represent a direct bond or a substituted or unsubstituted hetero atom. Represents a substituted divalent hydrocarbon group). -

(2 0) R ₂ is a general formula 3:

One _{R 4 - (CH 2) m} -R 5 - (CH 2) n - (3)

Represented by

R ₃ has the general formula 4: One HN NH (CH ₂ ) _t — R _6- (CH ₂ ) _w- (4)

 Represented by

R ₄ is a direct bond or one (CH ₂ ) i— (〇CH ₂ CH ₂ ) _q — 0_, and R ₅ and R ₆ are each independently a direct bond or a group shown below:

Represents

m and t each independently represent an integer from 0 to 20,

 n, w, i, and q each independently represent an integer of 1 to 20,

R ₇ represents a hydrogen atom or a phosphate protecting group, HN

 0

 (19) The compound described in (19). NH

 (21) The compound according to (19) or (20), wherein L is a substituted or unsubstituted phenanthryl group, fluorenyl group, naphthyl group, anthryl group or pyrenyl group.

 (22) The compound according to (17), wherein D and are represented by general formula 6:

(Wherein, L is a divalent aromatic group, represents a hydrogen atom or a substituent, R _12, 1 ₁₃及Pi 1 ^ ₁₄ are each independently, comprise a direct bond or a hetero atom Represents a substituted or unsubstituted divalent hydrocarbon group, and R ₁₅ represents a hydroxyl-protecting group).

Since the oligonucleotide probe of the present invention has a high reaction efficiency to a carrier, the amount of oligonucleotide required for immobilization can be reduced. In addition, The clear oligonucleotide probe has a high binding efficiency to the target nucleic acid, so that it can be detected with high sensitivity even if it has the same chain length as before. Further, the oligonucleotide probe of the present invention can be easily purified after synthesis, and can be purified by automation even when a plurality of types of probes are prepared.

 The present specification is described in the description and / or drawings of Japanese Patent Application No. 2004-124477, Japanese Patent Application No. 2004-239831, and Japanese Patent Application No. 2004-336414, which are the basis of the priority of the present application. Included content. Brief Description of Drawings

 FIG. 1 shows the structures of a conventional oligonucleotide probe and the oligonucleotide probe of the present invention.

 FIG. 2 shows a method for synthesizing the amidite compound (Y2).

 FIG. 3 shows a method for synthesizing the amidite compound (Y 3).

 FIG. 4 shows a method for synthesizing the amidite compound (Y5, 6).

 FIG. 5 shows a method for synthesizing the amidite compound (Υ7).

 FIG. 6 shows a method for synthesizing the amidite compound (Υ8).

 FIG. 7 shows a method for synthesizing the amidite compound (Υ9).

 FIG. 8 shows the structure of the oligonucleotide probe (Xn—Sp).

 Figure 9 shows the amount of oligonucleotide probe (Xn-Sp) immobilized on the glass substrate (a) and the reactivity with FITC (b: 50 nucleotide oligonucleotide, c: 25 nucleotide oligonucleotide). .

 FIG. 10 shows the results of the hybridization in Example 6.

 FIG. 11 shows a specific example of the intermediate compound.

 Figure 12 shows the immobilization of a 25-base oligonucleotide probe (Xn—Sp25; n = l, 5, 9) and a probe with oligonucleotides on both sides (X9—Sp35) on a glass substrate. The results of measuring the amount are shown.

 FIG. 13 shows a method for synthesizing the amidite compound (Y10, Y11).

Figure 14 shows the X10—Sp25 sequence and the scheme of the X10-Sp25 deprotection reaction (a), and the results of reverse phase HP LC analysis of X10—Sp25 (b), And X10-Sp25 were subjected to acid treatment, and the results of reverse phase HP LC analysis (c) are shown. Hereinafter, the present invention will be described in detail.

 The oligonucleotide probe of the present invention has a structure in which a linker having a reactive functional group and an aromatic group is bonded to an oligonucleotide. That is,

—Expressed by general formula 1.

 B _ D— A (1)

 In the formula, A represents an oligonucleotide, D represents a divalent organic group having at least one aromatic group, and B represents a reactive functional group or a protected form thereof. In the present invention, the oligonucleotide may be natural or synthetic, and includes a polynucleotide. Oligonucleotides include nucleic acids such as DNA and RNA, double-stranded oligonucleotides, and oligonucleotide derivatives. PCR products are also included. Oligonucleotide derivatives include oligonucleotide derivatives in which phosphodiester bonds in oligonucleotides have been converted to phosphorothioate bonds, and phosphodiester bonds in oligonucleotides have been converted to N3'-P5, phosphoramidite bonds. Oligonucleotide derivative, oligonucleotide derivative in which report and phosphodiester bond in oligonucleotide are converted to peptide nucleoacid bond, oligonucleotide in which peracyl in oligonucleotide is substituted with C-15 propynyl peracyl Derivatives, Oligonucleotide derivatives in which peracyl in oligonucleotides is substituted with C-5 thiazoleperacyl, Oligonucleotide derivatives in which cytosines in oligonucleotides are substituted with C-15 propynylcytosine, Oligonucleotides Oligonucleotide derivative in which cytosine in otide is replaced by phenoxazine-modified cytosine, oligonucleotide derivative in which report in oligonucleotide is replaced by 2,1-propylribose, ribose in oligonucleotide is 2′-O-medium Oligonucleotide derivatives substituted with toxic ribose, and oligonucleotide derivatives substituted with 2,1-methoxyethoxy ribose in ribose in the oligonucleotide can be exemplified.

 In the present invention, the number of bases of the oligonucleotide is usually 1 to 500, preferably 5 to 200, and more preferably 10 to 100.

In the general formula 1, B represents a reactive functional group or a protected form thereof. Reactive functional groups are present on the carrier to which the oligonucleotide probe is to be immobilized. A group capable of forming a covalent bond with an existing functional group, such as an active ester group, an epoxy group, an aldehyde group, a carbodiimide group, an isothiocyanate group or a group capable of forming a covalent bond with an isocyanate group (for example, , An amino group, etc.), or a group capable of reacting with a maleimide group or a disulfide group (eg, a mercapto group, etc.). In the present invention, a mercapto group and a diamino group are preferred. The amino group is preferably a primary amino group.

 B may be a protected form of the reactive functional group. The protected form means a form in which a hydrogen atom of the functional group is substituted with a protecting group. The protecting group for the amino group is not particularly limited, but may be an acyl group, a carbamate group, a trialkylsilyl group, a phthalyl group, a carboxyalkylcarbonyl group, a tosyl group, a trifluoroacetyl group, a trityl group, and Disubstituted trityl groups. Examples of the mono-substituted trityl group include, for example, a monoalkoxytrityl group, preferably a monoalkoxytrityl group having an alkoxy group having 1 to 4 carbon atoms, and more preferably a monomethoxytrityl group, Examples include an ethoxytrityl group, a monopropoxytrityl group, a monoisopropoxytrityl group and a monobutoxytrityl group. A trityl group or a mono- or di-substituted trityl group has an advantage in that the synthesized oligonucleotide probe can be easily purified by a reversed-phase column because of its strong hydrophobicity. In general, when an amino group is protected with a trityl group or a mono- or di-substituted trityl group, it is necessary to react under a strong acidic condition for a long time in order to deprotect the amino group. Such conditions are not preferable in that they may damage the nucleic acid and require time. However, in the oligonucleotide probe of the present invention, when the amino group is protected with a trityl group or a mono- or di-substituted trityl group, the nucleic acid may be damaged because it can be deprotected in a short time under mildly acidic conditions. No, and the deprotection time can be reduced. For example, deprotection can be performed by treating for 5 to 20 minutes in the presence of pH 2 to 6 or 5 to 80% by volume of acetic acid. '

 The protective group for the mercapto group is not particularly limited, and examples thereof include a t-butyl group, an aralkyl group, a diphenylmethyl group, a triphenylmethyl group, and a dimethyl group.

In the oligonucleotide probe of the present invention, the oligonucleotide is It is linked to a reactive functional group via a linker part represented by in the general formula 1. D represents a divalent organic group having at least one aromatic group. The divalent organic group is not particularly limited as long as it does not inhibit the binding property of the oligonucleotide probe to the carrier and the complementary binding to the target oligonucleotide, but preferably includes a hetero atom. It is a well-substituted or unsubstituted divalent hydrocarbon group. As the divalent hydrocarbon group, a chain member of 250, preferably a chain member of 3 to 30, more preferably a chain member of 1 to 5, a chain member of 2 to 50, preferably a chain member of 3 to 3 0, more preferably an alkylene group having a chain member of 1 to 5, a chain member having a chain member of 2 to 50, preferably a chain member having a chain member of 3 to 30, more preferably a chain member having a chain member of 1 to 5 Preferably, a divalent alicyclic hydrocarbon group having a chain member of 3 to 30, more preferably 1 to 10 is exemplified. In the above hydrocarbon group, a part of carbon atoms may be substituted with a complex atom. Examples of the hetero atom include an oxygen atom, a nitrogen atom, a sulfur atom, a silicon atom, and a phosphorus atom.

 Examples of the substituent include a halogen atom selected from fluorine, chlorine, bromine and iodine, a hydroxyl group, a substituted or unsubstituted amino group, a nitro group, a cyano group, and a substituted or unsubstituted carbon number of 1 to 1. 0 alkyl group, substituted or unsubstituted alkenyl group having 1 to 10 carbon atoms, substituted or unsubstituted cycloalkyl group having 1 to 10 carbon atoms, substituted or unsubstituted alkoxy group having 1 to 10 carbon atoms And a substituted or unsubstituted alkoxycarbonyl group or a carboxyl group.

 In one embodiment of the present invention, the linker portion D is preferably a group represented by the following general formula 2.

I

— R ₂ -C— R ₂ '-2)

 I

In the formula, L represents an aromatic group, represents a hydrogen atom or a substituent, and R ₂ , R ₂ ′ and R ₃ each independently represent a direct bond or a substituent which may contain a hetero atom or Represents an unsubstituted divalent hydrocarbon group. Here, the substituent is the same as described above. The Examples of the divalent hydrocarbon group include the same as those described above. In the general formula 2, R ₂ binds to the reactive functional group B, and R ₂ , binds to the oxygen of the hydroxyl group or phosphate group at the 5 ′ end or 3 ′ end of the oligonucleotide. When R ₂ ′ is a direct bond, the carbon atom in the general formula 2 is directly bonded to the hydroxyl or phosphate oxygen at the 5 ′ end or 3 ′ end of the oligonucleotide.

R ₂ is preferably of the general formula 3:

_{-R 4 - (CH 2) m} -R 5 - (CH 2) n - (3)

It is represented by R ₃ is preferably of the general formula 4:

― (CH ₂ ) _t — R _6- (CH ₂ ) _w — (4)

It is represented by R ₂ 'is preferably a direct bond or _R _2', Ru Oh one (CH ₂₎ "one.

In R ₂ , R ₄ is bonded to the reactive functional group B, in R ₃ , 1 ′ (CH ₂ ) _w — is bonded to the aromatic group L, and in R ₂ , one (CH ₂ ) is an oligo. Binds to nucleotides.

R ₄ is preferably a direct bond or 1 (CH ₂ ); — (OCH ₂ CH ₂ ) _g —〇-1.

R ₅ , R ₆ and R ₂ ″ are each independently a direct bond or a group shown below:

Is selected from

 m and t each independently represent an integer of 0 to 20, preferably 0 to 10, more preferably 0 to 6, and still more preferably an integer of 0 to 3, n, w, i, q And j each independently represent an integer of 1 to 20, preferably 1 to 10, more preferably 1 to 6, and even more preferably 1 to 3.

Here, 111 + 11 is usually 1 to 40, preferably 1 to 20, more preferably 1 to 5, and t + w is usually 1 to 40, preferably 1 to 20, more preferably 1 to 5. 5, i + q is usually 2 to 40, preferably 2 to 20, more preferably 2 And R ₇ represents a hydrogen atom or a phosphate protecting group. The phosphate protecting group is not particularly limited, but preferred examples include a methyl group, a 2-cyanoethyl group, a 2-trimethylsilylethyl group, and a 4-oxypentyl group.

R ₄ is preferably a direct bond.

R ₅ is preferably

——

And R ₆ is preferably 1 O—.

 In the present invention, examples of the aromatic group include a substituted or unsubstituted aromatic hydrocarbon group, a substituted or unsubstituted aromatic heterocyclic group, and a substituted or unsubstituted polycyclic aromatic group. In the present invention, an aromatic group having high hydrophobicity is preferred. In the present invention, the aromatic group does not include a nucleobase.

 Examples of the substituent of the aromatic group include a halogen atom selected from fluorine, chlorine, bromine and iodine, a hydroxyl group, a substituted or unsubstituted amino group, a nitro group, a cyano group, and a substituted or unsubstituted carbon atom. Alkyl group of 1 to 10; substituted or unsubstituted alkenyl group of 1 to 10 carbon atoms; substituted or unsubstituted cycloalkyl group of 1 to 10 carbon atoms; substituted or unsubstituted carbon number of 1 to 10 And a substituted or unsubstituted alkoxycarbonyl group and a carboxyl group.

 Examples of the substituted or unsubstituted aromatic hydrocarbon group include a substituted or unsubstituted monocyclic aromatic hydrocarbon group, specifically, phenyl, 2-fluorophenyl, 3-fluorophenyl, 4 -Phenol group, 2-phenyl phenyl group, 3-chloro phenyl group, 2,3-difluorophenyl group, 2,5-diphenylolenophenylene group, 3,5-difluorophenyl group, 2,3—dichloropheninole, 2,5—dichloropheninole, 3,5—dichloropheninole, 2-methinolephenine, 3-methylphenyl, 4-methylphenyl, 2-— Examples thereof include an ethylphenyl group, a 3-ethylphenyl group, and a 4-ethylphenyl group.

Examples of the aromatic heterocyclic group include a pyridyl group, a pyridazinyl group, a pyrimidinyl group, a virazinyl group, a furyl group, a phenyl group, a pyrrolyl group, an imidazolyl group, a thiazolyl group, and an oxazolyl group. ' Specific examples of the substituted or unsubstituted aromatic heterocyclic group include 2-pyridyl, 3-pyridyl, 4-pyridyl, 3-pyridazinyl, 4-pyridazinyl, 2-pyrimidinyl, 4-pyrimidinyl Group, 5-pyrimidinyl group, pyrazinyl group 2-furyl group, 3_furyl group, 2-thenyl group, 3-thenyl group, 2-pyrrolyl group, 3-pyrrolyl group, imidazolyl group, thiazolyl group, oxazolyl group, 2-Methyl-3-pyridyl group, 6-methyl-1-pyridyl group, 2-chloro-3-pyridyl group, 6-chloro-3-pyridyl group, 2-methoxy-13-pyridyl group, 6-methoxy-3 —Pyridyl group, 2,6-dichloro-3-pyridyl group, 2,6-dimethoxy-3-pyridyl group, and the like. Preferred substituted or unsubstituted aromatic heterocyclic groups include a furyl group, a pyrrolyl group and an oxazolyl group.

 Polycyclic aromatic groups include naphthyl, phenanthryl, fluorenyl, anthryl, pyrenyl, indanyl, tetrahydronaphthyl, quinolyl, isoquinolyl, nnolinyl, quinazolinyl, quinoxalinyl, naphthyridinyl, Examples include a phthalazinyl group, an indolyl group, an isoindolyl group, a benzofurinole group, a benzochenolinole group, an indazolinole group, a benzimidazoly / le group, and a benzothiazolyl group.

Specific examples of the substituted or unsubstituted polycyclic aromatic group include: 1-naphthyl group, 2-naphthyl group, 4-indanyl group, 5-indanyl group, 5-tetrahydronaphthyl group, 6-tetrahydronaphthyl group, Quinolyl group, isoquinolyl group, cinnolinyl group, quinazolinyl group, quinoxalinyl group, naphthyridinyl group, phthaladyl group, indolyl group, isoindolyl group, benzofuryl group, benzochelyl group, indazolyl group, benzimidazolyl group, benzothiazolyl group, 2, 3-methylenedioxyphenyl group, 3,4-methylenedioxyphenyl group, 2,3-ethylenedioxyphenyl group, 3,4-ethylenedioxyphenyl group, 4 1-naphthyl group, 4-naphthyl group, 1-naphthyl group, 2-methylinole 1-naphthyl group, 4-methyl-1-naphthol Phthyl group, 2-methoxy-1-naphthyl group, 5-methoxy-11-naphthyl group, 6-methoxy-1-naphthyl group, 7-methoxy-1-naphthyl group, 2-ethoxy-11-naphthyl group, 5-ethoxy-1-naphthyl group, 6-ethoxy-1-naphthyl group, 7-ethoxy-11-naphthyl group, 1-1 Methoxy 2-naphthyl, 3-methoxy-2-naphthyl, 5-methoxy-2-naphthyl, 6-methoxy-12-naphthyl, 1-ethoxy-12-naphthyl, 3-ethoxy-1 A 2-naphthyl group, a 5-ethoxy-2-naphthyl group, a 6-ethoxy-2-naphthyl group, a 2-chloro-5-quinolyl group, and the like can be used. Preferred substituted or unsubstituted polycyclic aromatic groups include a naphthyl group, an anthryl group, a pyrenyl group, a fluorenyl group, and a phenanthryl group. When an aromatic group is present in the main chain portion of D ', the aromatic group becomes a divalent form. For example, phenylene group, pyridylene group, pyridazinyl group, pyrimidinylene group, pyrazinylene group, furylene group, thi ^ -ylene group, pyrrolylene group, imidazolenylene group, thiazolenylene group, oxazolylen group, naphthylene group Group, anthrylene group, pyrenylene group, indannylene group, tetrahydronaphthylene group, quinolylene group, isoquinolylene group, cinnolinylene group, quinazolinylene group, quinoxalinylene group, naphthyridinylene group, phthaladulylene group, indolylene group, Examples include an isoindolinylene group, a benzofurylene group, a benzochenylene group, an indazoylene group, a benzimidazoylene group, and a benzothiazolylene group, and a naphthylene group, an anthrylene group or a pyrenylene group is preferable. The divalent aromatic group may be substituted or unsubstituted.

 In the present invention, the aromatic group is preferably a monocyclic to pentacyclic aromatic hydrocarbon group. In particular, preferably a bicyclic to tetracyclic aromatic hydrocarbon group, more specifically, a substituted or unsubstituted naphthyl group, anthryl group, phenanthryl group, fluorenyl group and pyrenyl group, particularly 1-naphthyl group 9 is an anthryl group.

 The oligonucleotide probe of the present invention includes those having an additional oligonucleotide on the side chain of the linker portion D. The further oligonucleotide may be the same or different from the other oligonucleotide.

 In another embodiment of the present invention, examples of the oligonucleotide probe include those in which D in the general formula 1 is represented by the following general formula 2 ′.

Wherein, L is a divalent aromatic group, represents a hydrogen atom or a substituent, Ru, are each independently R _{1 2,} 1 ₁₃及Pi 1 _14, include a direct bond or a hetero atom Represents a substituted or unsubstituted divalent hydrocarbon group, and A ′ represents a hydroxyl group or an oligonucleotide.

Here, the substituent is the same as described above. Examples of the substituted or unsubstituted divalent hydrocarbon group which may contain a hetero atom include the same as described above. In the general formula 2 ′, R ii binds to the reactive functional group B, and R ₁₄ binds to the oxygen of the hydroxyl group or phosphate group at the 5 ′ end or 3 ′ end of the oligonucleotide. If R E ₄ is a direct bond, general formula 2 'carbon atoms in the, 5 Origonukureo tides' end or 3' end, directly binds to the oxygen of a hydroxyl group or phosphate group. Similarly, when A ′ is an oligonucleotide, when R i ₃ binds to the hydroxyl or phosphate oxygen at the 5 ′ end or 3 ′ end of the oligonucleotide and R ₁₃ is a direct bond, the general formula The carbon atom at 2 'is directly bonded to the hydroxyl or phosphate oxygen at the 5' or 3 'end of the oligonucleotide.

 Rue preferably has the general formula 3 ′:

(CH ₂ ) R one (CH ₂ ) _b — (3 ')

It is represented by R ₁₂ is preferably of the general formula 4 ′

One (CH ₂ ) R one (CH ₂ ) _d — (4 ')

It is represented by R ₁₃ is preferably a direct bond or 1 (CH ₂ ) _ε · _, and R ₁₄ is preferably a direct bond or 1 (CH ₂ ) _f —.

In the formula, one (CH ₂ ) _a — is bonded to the reactive functional group B, and — (CH ₂ ) _e — is bonded to the aromatic group L in R ₁₂ .

R ₅ and R ₆ are each independently a direct bond or a group shown below:

Is selected from

e and f each independently represent an integer of 20, preferably 1 to 10, More preferably represents an integer of 1 to 5, more preferably represents an integer of 1 to 3, each of a to d independently represents an integer of 0 to 20, preferably 0 to 10, more preferably ◦ to 5 And more preferably an integer of 0 to 3.

Here, a + b is usually 1-40, preferably 1-20, more preferably 1-5, and c + d is usually 1-40, preferably 1-20, more preferably 1 to 5. R ₇ represents a hydrogen atom or a phosphate protecting group. Examples of the phosphate protecting group include, but are not particularly limited to, a methyl group, a 2-cyanoethyl group, a 2-trimethylsilylethyl group, and a 4-oxypentyl group.

1 _{1 3}及Pi 1 _{1 4} is preferably a direct bond.

R ₅ ′ is preferably one NH—CO— and R ₆ ′ is preferably one CO—NH—.

 The divalent aromatic group L is not particularly limited, but is preferably a highly hydrophobic divalent aromatic group, preferably a substituted or unsubstituted phenanthrylene group, fluorenylene group, naphthylene group, anthrylene group or pyrenylene group, Particularly, a naphthylene group and an anthrylene group are exemplified. More specifically, substituted or unsubstituted 2,6-naphthylene group, 1,4-naphthylene group, 1,5-naphthylene group, 2,7-naphthylene group, 2,6-anthrylene group, 1, 8—anthrylene group, 9,10—antrylene group, 1,5—antrylene group, 2,7—phenanthrylene group, 2,8—phenanthrylene group, 1,5—phenanthrylene group Len, 1,6-phenanthrylene, 1,7-phenanthrylene, 1,8-phenanthrylene, 1,7-9H-fluorenylene, 1,6-9H-fluorenylene, 2, Examples include a 7-pyrylene group, a 2,6-pyrenylene group, and a 1,8-pyrenylene group. By adopting the aromatic group as described above, it is possible to suppress a decrease in the solubility of oligonucleotides bonded to these aromatic groups in water with an increase in the number of rings. Further, the detection of the target gene can be easily performed without the probes being entangled by the hydrophobic interaction between the probes immobilized on the carrier.

The invention also relates to intermediate compounds for synthesizing oligonucleotide probes. In one embodiment, the intermediate of the present invention has a structure in which the oligonucleotide portion is a phosphoramidite in the oligonucleotide probe. Is a compound having Therefore, in one embodiment, the intermediate compound of the present invention is represented by the following general formula 5.

In the formula, B represents a reactive functional group or a protected form thereof, D ′ represents a divalent organic group having at least one aromatic group, O represents an oxygen atom, and P represents a phosphorus atom. And R ₈ represents a phosphate protecting group, R ₉ and ₁₁ . Is an organic group, and may form a ring together with the nitrogen atom to which they are bonded.

1 ₉ and ₁ 1. Is not particularly limited, but is preferably a hydrocarbon group, more preferably an alkyl group having 1 to 5 carbon atoms. For example, a methyl group, an ethyl group, a propyl group, a butyl group, an isoptyl group, a pentyl group, and an isopentyl group are exemplified.

Alternatively, R ₉ and R ₁₀ may be taken together with the nitrogen atom to which they are attached to form a ring group. The ring is R ₉ and i. May further contain a hetero atom in addition to the nitrogen atom to which is bonded. Such a ring is preferably a ring having a ring member of 5 to 8, preferably 6, and includes, for example, a morpholine ring, a piperidine ring, a piperazine ring, a thiomorpholine ring and the like, and preferably a morpholine ring. .

 Here, the phosphate protecting group may be any one used in the phosphoramidite method, and is preferably a methyl group, a 2-cyanoethyl group, a 2-trimethylsilylethyl group, a 4-oxypentyl group, or the like. It may be included as a group.

—In an embodiment, the oligonucleotide probe of the present invention can be prepared using an intermediate compound in which D ′ in Formula 5 is equal to the above D. For example, an oligonucleotide probe of the general formula 1 in which D is represented by the general formula 2 can be prepared using an intermediate compound in which D ′ in the general formula 5 is equal to D. In addition, the oligonucleotide probe of the general formula 1 in which D is represented by the general formula 2 ′ uses an intermediate compound in which the D ′ in the general formula 5 is represented by the following general formula 6. Can be created

 Rl5

 0

 I

 ^ 13

— R ”— L— R ₁₂ — C— R ₄ — (6)

Wherein, L is a divalent aromatic group, 1 ^ represents a hydrogen atom or a substituent, R "R _{1 2,} 1 _{1 3}及Pi 1 _{1 4} Ari in as defined above, ₅ hydroxyl Represents a protecting group As the hydroxyl protecting group, a protecting group used for protecting the ribose at the 5-position in DNA synthesis can be used, for example, an acetyl group, 5′—O—4, 4 ′ , 4,,, — tris (4-benzoyloxy) trityl group and dimethoxytrityl group, and a dimethoxytrityl group is preferred. In the general formula 6, 1 is bonded to 8, and R ₁₄ is bonded to an oxygen atom. Specific examples of preferred intermediate compounds are shown in FIG.

 The oligonucleotide probe of the present invention can be synthesized by linking the above-mentioned intermediate compound with an oligonucleotide. Introduction of the intermediate compound into the oligonucleotide can be carried out on the automatic DNA synthesizer at the same time as the oligonucleotide synthesis.

After the introduction of the intermediate compounds of general formula 5 in which D 'is represented by the general formula 6 to the oligonucleotide, further by performing oligonucleotide synthesis, sediment Gonuku Reochido is linked to R _{1 3}及Pi R _{1 4} Oligonucleotide probes can be manufactured. In addition, by repeatedly introducing an intermediate compound of the general formula 5 in which D 'is represented by the general formula 6 into the oligonucleotide and synthesizing the oligonucleotide, an oligonucleotide probe containing a plurality of intermediate compounds, that is, Oligonucleotide probes having a number of aromatic groups can also be synthesized. The oligonucleotide probe of the present invention and the above-mentioned intermediate compound can be synthesized and used in any of D-form and L-form, or may be a mixture thereof. The present invention also relates to a carrier having the oligonucleotide probe immobilized thereon. The carrier is not particularly limited as long as it has a functional group capable of covalently bonding with the reactive functional group of the oligonucleotide probe of the present invention on its surface. Examples of the base material of the carrier include glass such as quartz glass, borosilicate glass and soda lime glass, silicon, fiber, wood, paper, ceramics, and plastics (eg, polyester resin, polyethylene resin, polypropylene resin,

ABS resin (Acrylonitrile Butadiene Styrene resin), Nylon, Atalinole resin, Fluororesin / Polycarbonate resin, Polyurethane resin, Methylpentene resin, Phenol resin, Melamine resin, Epoxy resin, Vinyl chloride resin). In the present invention, it is preferable to use glass, silicon, ceramics, and plastic. The oligonucleotide probe of the present invention is immobilized by using a substrate in which a functional group is introduced on the surface of the substrate as a carrier. When the reactive functional group of the oligonucleotide probe is protected, it is preferable to remove the protecting group before immobilization.

 Examples of the functional group capable of covalently bonding to the reactive functional group of the oligonucleotide probe include, for example, an active ester group, an epoxy group, an amino group, a dye group, a disulfide group, an aldehyde group, a maleimide group, and a carpoimide group. Groups, isothiocyanate groups, isocyanate groups, and the like.

 When immobilizing an oligonucleotide probe having an amino group or a protected form thereof, a carrier into which an active ester group, an epoxy group, an aldehyde group, a carbodiimide group, an isothiocyanate group, or an isocyanate group has been introduced. When an oligonucleotide probe having a mercapto group or a protected form thereof is immobilized, a carrier into which a maleimide group or a disulfide group is introduced is preferably used.

 The shape of the carrier is not particularly limited, and examples thereof include a base, a thread, a sphere, a bead, a polygon, a powder, and a porous form. In the present invention, the base is preferable.

 The oligonucleotide probe of the present invention can be bound to a label such as biotin and a fluorescent dye. Examples of the fluorescent dye include CyDye such as Cy3 and Cy5, FITC, RITC, rhodamine, Texas Red, TET, TAMRA, FAM, HEX, ROX, GFP, and the like. The oligonucleotide probes of the present invention can also be conjugated to medicaments.

In the present invention, when a nucleic acid such as an oligonucleotide is immobilized on a carrier, an aromatic group is placed between the immobilized nucleic acid and a reactive functional group necessary for binding to the carrier. Can efficiently immobilize the nucleic acid on the carrier. In addition, the oligonucleotide probe of the present invention has higher binding efficiency to a target nucleic acid than a conventional probe. Third, the oligonucleotide probe of the present invention is easy to synthesize and purify. BEST MODE FOR CARRYING OUT THE INVENTION ''

 Hereinafter, the present invention will be described more specifically with reference to Examples, but the scope of the present invention is not limited thereto.

 An intermediate compound (hereinafter, referred to as an amidite compound) for synthesizing the oligonucleotide probe of the present invention was synthesized, introduced into an oligonucleotide, and the ability of the obtained oligonucleotide probe was evaluated.

 Units for introducing aromatic groups into oligonucleotides (amidite compounds: Y2, Υ3, Υ4, Υ5, Υ6, Υ7, Υ8, Υ9, Υ10, Υ11) Was synthesized by the methods shown in FIGS.

 Υ2 is an amidite compound having only an aromatic group without an amino group. DN 導入 Introduction of Y2 into an oligonucleotide by an automatic synthesizer, followed by commercial N-monomethoxytrityl-6-amino. An amino group was introduced using a xyl phosphoramidite compound or a trifluoroacetyl-6-aminohexyl phosphoramidite compound (Glen Research), and an amino group and an aromatic group were added to the end of the oligonucleotide. An oligonucleotide probe consisting of 50 bases having an aromatic group (X 2 -S p; FIG. 8) was synthesized.

The amidite compound of Y3, Υ5, Υ6, Υ7, Υ8, Υ9, Υ10, and Y11 has an amino group in the molecule. Therefore, after introducing the synthetic amidite compound into the oligonucleotide, it is not necessary to introduce an amino group using a separately available amino group-bonded phosphoramidite compound, and the synthesis of the oligonucleotide probe is one step shorter than before. have. Υ3 and Υ5 differ in the structure of the linking site between the amino and aromatic groups, and 、 6 introduces a longer linear linker between the amino and aromatic groups than Υ5 And the distance of the oligonucleotide probe from the surface of the carrier can be maintained. Υ7 is an amidite compound in which the aromatic group of Υ6 is an anthryl group instead of a naphthyl group. Y8 is an amidite compound in which the introduction site of the linear linker of Y5 is different, and an amino group and an aromatic group are close to each other. Oligonucleotide probes having these at the 5 'end were synthesized by a DNΑ automatic synthesizer (X3-Sp, X5-Sp, X6-Sp, X7-Sp, X8-Sp, respectively). , X 9 -S p; FIG. 8).

 As the oligonucleotide probe having no aromatic group, the above-mentioned commercially available amino group-bonded phosphoramidite compound was used, and an amino group was introduced at the end of the oligonucleotide (X1-Sp; FIG. 8). An oligonucleotide probe having no aromatic group between the two (X4_Sp; FIG. 8) was used as a comparative example.

 The synthesized oligonucleotide was purified to a high degree of purity using a reversed-phase column, dissolved in a spot solution for the preparation of an oligo chip at a certain concentration, spotted on a glass substrate, and immobilized.

 After immobilization on the substrate, the 3 ′ end of the immobilized oligonucleotide probe was fluorescently labeled, and the fluorescence intensity was measured to quantify the amount of each oligonucleotide probe immobilized on the substrate. The experimental results show that oligo probes (X 2—Sp, X 3—Sp, X 5—Sp, X 6—Sp, X 8 -S p) was found to be highly immobilized (Fig. 9a).

 Next, in order to examine the reaction efficiency of each oligonucleotide probe with the active ester group in the solution, the reaction was performed with fluorescein isothiocyanate and Cy 3 succinimidyl ester. As a result, the oligonucleotide probe having an aromatic group of the present invention exhibits higher reactivity with any of the fluorescent dyes than the conventional oligonucleotide probe, and improves the reactivity with a chemical substance even in a solution. (Fig. 9 b, c;).

 The Y9 amidite compound is a derivative that can be introduced into the end of the oligonucleotide or into the chain (FIG. 7). Oligonucleotides in which the Y9 amidite compound was introduced at the terminal (X9-Sp25) and in the chain (X9-Sp35) were synthesized. As with other amidites, their reactivity with fluorescent dyes (Fig. 9c) and immobilization efficiency on glass substrates (Fig. 12) were examined.

The synthesis method of each amidite compound and oligonucleotide probe and The test method is specifically described.

 (Example 1) Synthesis of amidite compound

 Thin layer chromatography was performed on Kieselsegel60F254 plates (Merck). For column chromatography, Wakoge1C-200 (Wako Pure Chemical Industries) was used. The UV-visible spectrum was measured using a Shimadzu UV-2,500 PC spectrophotometer.

¹ H—NMR was measured using J EOL J NM—EX 270 with tetramethylsilane as an internal standard. ³¹ P-NMR was measured using J EOL J NM-EX 270 using inorganic phosphoric acid as an internal standard.

 (1) Synthesis of amidite compound (Y 2) (Figure 2)

 (R) -1-0- (1-naphthylmethyl) glycerol (compound.)

 Under an argon atmosphere, 1.40 ml (16.0 mmo 1) of 1- (chloromethyl) naphthalene (compound a) and (S) — (+) — 2,2-dimethyl-1,3-dioxolan-141-methanol ( Compound b) 1.85 ml (15.0 mmo 1) was dissolved in 90 ml of a mixed solution of toluene and dioxane (2: 1), and 4.5 g of powdered potassium hydroxide was added. And stirred at 120 ° C for 2.5 hours. After the reaction solution was cooled to room temperature, 300 ml of ethyl acetate was added, and the mixture was washed four times with 100 ml of water and once with 100 ml of saturated saline, and the organic layer was dried over sodium sulfate. The solution was concentrated under reduced pressure, and the obtained yellow oily substance was dissolved by adding 100 ml of an 80% aqueous acetic acid solution, followed by stirring at room temperature for 15 hours. The reaction mixture was concentrated under reduced pressure, acetic acid was removed by azeotropic distillation with toluene, and the residue was purified by silica gel column chromatography (elution solvent: ethanol-one-mouth form) to give the title compound.

(Compound c) 3.24 g (yield 93%) was obtained as a white solid substance.

JH NMR (270 MHz, DMSO-d ₅ ) δ ': 8.12-8.09 (m, 1 H), 7.95-7.86 (m, 2 H), 7.59-7.44 (ra, 4 H), 4.93 (s, 2 H ), 4.67 (d, 1 H, J = 5.3 Hz), 4.8 (t, 1 H, J = 5.5 Hz), 3.66 (ddddd, 1 H, J = 3.5, 4.8, 5.2, 5.3, 5.9 Hz) , 3.56 (dd, 1 H, J = 4.8, 9.7 Hz), 3.45 (dd, 1 H, J = 3.5, 9.7 Hz), 3.39 (ddd, 1 H, J = 5.2, 5.5, 10.9 Hz), 3.34 ( ddd, 1 H, J = 5.5, 5.9, 10.9 Hz).

(S) _— 1— O—Dimethoxytrityl-3— O— (1-Naphthylmethyl) Serol (compound d)

Under an argon atmosphere, 2.20 g (9.50 mmo 1) of (R) -1-0- (1-naphthylmethyl) glycerol (compound c) was dissolved in 80 ml of pyridine. Toxotrityl (3.90 g, 1.2 equivalents) was added, and the mixture was stirred at room temperature for 1 hour. After the reaction was stopped by adding 1 Om1 of ethanol, the solvent was distilled off under reduced pressure. The residue was dissolved in 300 ml of ethyl acetate, washed once with 100 ml of a saturated aqueous solution of sodium hydrogencarbonate, twice with 100 ml of water, and once with 100 ml of a saturated saline solution. The layer was dried with sodium sulfate. The solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (eluent: ethyl acetate-hexane) to give 4.59 g (yield 90%) of the title compound (Compound d) as a pale yellow foam. As obtained. ^! H NMR (270 MHz, DMS0-d ₆ ) δ: 8.03-7.86 (m, 3 H), 7.55-7.19 (ra, 13 H), 6.85-6.81 (m, 4 H), 4.94 (d, 1 H , J = 5.6 Hz), 4.91 (s, 2 H), 3.82 (dddt, 1 H, J = 4.9, 5.3, 5.6, 5.9 Hz), 3.71 and 3.71 (each s, each 3 H), 3.59 (dd, 1 H, J = 4.9, 9.9 Hz), 3.54 (dd, 1 H, J = 5.9, 9.9 Hz), 2.98 (dd, 1 H, J = 5.3, 9.2 Hz), 2.94 (dd, 1 H, J = (5.9, 9.2 Hz).

 (S) _ 1 — O—Dimethoxytrityl-3- (1-naphthylmethyl) glycerol 2-O— (2-cyanoethyl-1-N, N-diisopropylphosphoramidite) (Compound Y 2)

 Under an argon atmosphere, (S) —1—O—dimethoxytrityl-3—0— (1-naphthylmethinole) glycerol (I-drug compound d) 270 mg (0.50 mmo1) was converted to methylene chloride 10 m Dissolve in 1 and add 0.26 ml (3 equiv.) Of N, N-diisopropylethylamine and 0.22 m 1 (2 equiv.) Of 2-cyanoethyl-N, N-diisopropylchlorophosphoroamidite The mixture was stirred at room temperature for 30 minutes. To the reaction mixture was added 60 ml of form, and the mixture was washed once with 25 ml of a saturated aqueous sodium hydrogen carbonate solution, once with 25 ml of water, and once with 25 ml of saturated saline, and the organic layer was washed. Was dried over sodium sulfate. The solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (neutral silica gel, elution solvent: ethyl acetate / hexane) to afford the title compound (Compound Y 2) 27 1 mg (yield 7 4%) as a white foam.

3 ¹ P NMR (109 MHz, DMS0-d ₆ ) δ: 149.06, Γ48.64. (2) Synthesis of amidite compound (Y 3) (Figure 3)

 (S) -1 1-Azido 3- (1-naphthylmethoxy) propan-2-ol (Compound e)

 Under an argon atmosphere, dissolve 1.90 g (8.18 mmo 1) of (R) -111- (1-naphthylmethyl) glycerol (compound c) in 80 m1 of pyridine. Tosyl (2.32 g, 1.5 equivalents) was added, and the mixture was stirred at room temperature for 4 hours. Excess reagent was decomposed by adding 1 Oml of ethanol to the reaction solution. After distilling off the solvent under reduced pressure, the residue was dissolved in 300 ml of ethyl acetate, twice with 100 ml of water, once with 100 ml of a saturated aqueous solution of sodium hydrogencarbonate and 100 ml of water. The extract was washed once with 100 ml of a saturated saline solution, and the organic layer was dried over sodium sulfate. After concentrating the solution under reduced pressure, the obtained oily substance was dissolved in 80 ml of dimethylformamide under an argon atmosphere, and 1.6 g (3 equivalents) of sodium azide and 1.75 g of ammonium chloride (3 g) were added. (4 equivalents) was added and the mixture was heated and stirred at 80 ° C for 2 hours. After the reaction solution was cooled to room temperature, 300 ml of ethyl acetate was added, and the mixture was washed five times with 100 ml of water and once with 100 ml of saturated saline, and the organic layer was dried over sodium sulfate. The solution is concentrated under reduced pressure, and the residue is purified by silica gel chromatography (elution solvent: ethyl acetate-hexane) to give 1.30 g (yield 62%) of the title compound (compound e) as colorless Obtained as an oil.

^J H NMR (270 MHz, DMS0-d ₆ ) δ: 8.11-8.06 (ra, 1 H), 7.96-7.87 (m, 2 H), 7.59-7.44 (m, 4 H), 5.29 (d, 1 H) , J = 5.3 Hz), 4.94 (s, 2 H), 3.83

(dddt, 1 H, J = 3.6, 5.3, 6.3, 6.4 Hz), 3.51 (dd, 1 H, J = 5.3, 9.9

Hz), 3.46 (dd, 1 H, J = 6.3, 9.9 Hz), 3.29 (dd, 1 H, J = 3.6, 12.6 Hz),

3.21 (ddd, J = 6.4, 12.6 Hz).

 (S) 1-Amino-3- (1-naphthylmethoxy) propan-1-ol (Compound f)

(S)-1-Azido 3- (1-naphthylmethoxy) propan-2-ol (Compound e) Dissolve 1.30 g (5.05 mmo1) in 60 ml of ethanol and add palladium 330 mg of carbon (10%) was added, and the mixture was stirred at room temperature under a hydrogen atmosphere at room temperature for 15 hours. After removing the palladium catalyst by celite filtration, the solution was concentrated under reduced pressure to obtain 1.17 g (yield: 100%) of the title compound (compound f). This compound was used for the subsequent reaction without further purification.

 (S) 13- (1-Naphthylmethoxy) 1-1-N- [6- (Trifluoroacetamide) hexanoyl] aminopropane-12-ol (Compound g)

 Under an argon atmosphere, N-trifluoroacetyl-6-aminocaproic acid (disulfide compound f) 360 mg (1.3 equivalents) and 1,1'-carboerdiimidazole 23.5 mg (1.2 Was dissolved in 1 ml of dimethylformamide and stirred at room temperature for 2 hours. To this reaction mixture was added a solution of (S) -1-amino-3- (1-naphthylmethoxy) propan-2-ol (Compound f) 280 mg (1.21 mmo1) in dimethylformamide (5m l) was added, and the mixture was further stirred at room temperature for 16 hours. 70 ml of ethyl acetate was added to the reaction solution, and the mixture was washed four times with 25 ml of water and once with 25 ml of saturated saline, and the organic layer was dried over sodium sulfate. The solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (elution solvent: ethanol chloroform) to obtain 4 17 mg (yield: 79%) of the title compound (Compound g) as a white solid substance. .

XH NMR (270 MHz, DMSO-d ₆ ) δ: 9.39 (br t, 1 H, J = 4.6 Hz), 8.12-8.08 (m, 1 H), 7.96-7.86 (m, 2 H), 7.73 (br t, 1 H, J = 5.6 Hz), 7.59-7.44 (ra, 4 H), 4.94 (br s, 1 H), 4.93 (s, 2 H), 3.69 (m, 1 H), 3.45—3.42 ( m, 2 H), 3.21 (dt, 1 H, J = 5.6, 13.3 Hz), 3.17 (dt, 2 H, J = 4.6, 7.0 Hz), 3.00 (ddd, 1 H, J = 5.6, 6.6, 13.3 Hz), 2.06 (t, 2H, J = 7.Hz), 1.52-1.41 (m, 4H), 1.22 (m, 2H).

 (S) — 3— (1-naphthylmethoxy) 1-1-N— [6- (trifluoroacetamide) hexanoyl] aminopropane-12-ol 2 -— (2-cyanoethyl-N, N-diisopropylphosphoramidite ) (Compound Y 3)

Under an argon atmosphere, (s) —3- (1-naphthylmethoxy) 1-1N— [61- (trifluoroacetamide) hexanoyl] aminopropan-1-ol (compound g) 8 8 1 mg (2 (0.0 mmo 1) in 20 ml of methylene chloride, and 1.27 ml (2.0 equivalents) of 2-cyanoethyltetraisopropyl phosphorodiamidite, acetonitrile solution of 1H-tetrazole 4. 9 ml (0.451.1 equivalents) was added, and the mixture was stirred at room temperature for 1 hour. To the reaction solution was added 100 ml of chloroform, and once with 40 ml of a saturated aqueous sodium hydrogen carbonate solution, saturated saline was added. 7666 Washed once with 40 ml of water, and the organic layer was dried over sodium sulfate. The solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (neutral silica gel, elution solvent: ethyl acetate-hexane-1% triethylamine) to obtain 83 1 mg of the title compound (Compound Y3) (yield 6 5%) as a colorless oily substance.

³¹ P NMR (109 MHz, DMS0-d ₆ ) δ: 148.79.

 (3) Synthesis of amidite compound (Υ5) (Figure 4)

 (R) — 2— Ο— (tert—butyldimethylsilyl) 1 1—〇1 (1-naphthylmethyl) glycerol (Compound h)

 Under an argon atmosphere, dissolve 1.16 g (5.0 mmo 1) of (R) -111- (1-naphthylmethyl) glycerol (compound) in 35 ml of dimethylformamide, 2.26 g (3 equivalents) of tert-butyldimethylchlorosilane and 2.04 g (6 equivalents) of imidazole were added, and the mixture was stirred at room temperature for 21 hours. After adding 5 ml of ethanol to the reaction mixture to decompose excess reagent, add 200 ml of ethyl acetate, wash four times with 70 ml of water and once with 70 ml of saturated saline, and wash the organic layer. The layer was dried with sodium sulfate. After concentrating the solution under reduced pressure, the obtained oily substance was dissolved in 75 ml of methylene chloride, cooled to 0 ° C, and 2.1 ml of trifluoroacetic acid (90% aqueous solution) was added. The mixture was stirred at C for 1 hour. To the reaction solution was added 80 ml of a saturated aqueous solution of sodium hydrogencarbonate, and the mixture was returned to room temperature. The organic layer was washed once with 8 Om 1 of a saturated aqueous solution of sodium hydrogencarbonate and once with 8 Om 1 of a saturated saline solution, and dried over sodium sulfate. The solution is concentrated under reduced pressure, and the residue is purified by silica gel column chromatography (elution solvent: ethyl acetate / hexane) to give 1.7 g (yield 98%) of the title compound (Compound h) as a colorless oil. Obtained as a solid.

! H NMR (270 MHz, DMSO— d ₆ ) δ: 8.10—8.07 (m, 1 H), 7.95—7.85 (m, 2 H), 7.54-7.43 ′ (m, 4 H), 4.95 (d, 1 H, J = 12.3 Hz), 4.90 (d, 1 H, J = 12.3 Hz), 4.60 (t, 1 H, J = 5.6 Hz), 3.79 (dddd, 1 H, J = 4.0, 5.6, 6.0, 6.3 Hz), 3.58 (dd, 1 H, J = 4.0, 9.9 Hz), 3.44 (dd, 1 H, J = 6.3, 9.9 Hz), 3.36 (ddd, 1 H, J = 5.6, 6.0, 11.1 Hz), 3.31 (dt, 1 H, J = 5.6, 11.1 Hz), 0.83 (s, 9 H), 0.02 and 0.00 (each s, each 3 H). 2005/007666

(S) 12-1- (tert-butyldimethylsilyl) 13-1-◦ (111-naphthylmethyl) 111- [N— [6- (trifluoroacetamide) hexyl] carpamoyl] glycerol ( Compound i)

Under an argon atmosphere, (R) — 2-〇- (tert-butyldimethylsilyl)-1-0-(1- naphthylmethyl) glyceronole (compound h) 6995 mg (2.0 mmO 1) and 50 mg (0.2 eq) of DMA P is dissolved in 35 ml of dimethylformamide, and 1,1'-canoleponinoleisimidazonole (195 mg, 0.6 eq) is added. And stirred at room temperature. Two hours later, 1,1'-carbodiimidazole (195 mg, 0.6 equivalent) was added, and the mixture was further stirred for 2 hours. To this reaction solution was added 1.16 g (5 equivalents) of Γ, 6-hexanediamine, and the mixture was stirred at room temperature for 15 hours. 150 ml of ethyl acetate was added to the reaction solution, and the mixture was washed four times with 60 ml of water and once with 60 ml of saturated saline, and the organic layer was dried over sodium sulfate. The solution was concentrated under reduced pressure, the resulting residue was dissolved in methanol ^{3 5} m 1, by adding Torifuruoro acetic acid Echiru 1. 1 9m l (5 equivalents) and Toryechiruamin 1. 3 9 m 1 (5 eq), The mixture was stirred at room temperature for 14 hours. The reaction solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (elution solvent: ethyl acetate-hexane) to give 1.0 g (yield 92%) of the title compound (Compound i) as pale yellow Obtained as an oily substance.

^X H NMR (270 MHz, DMSO-d ₆ ) δ: 9.37 (br s, 1 H), 8.09-8.05 (m, 1 H), 7.95-7.86 (m, 2 H), 7.55-7.43 (m, 4 H), 7.06 (t, 1 H, J = 5.6 Hz), 4.96. (D, 1 H, J = 12.2 Hz), 4.91 (d, 1 H, J = 12.2 Hz), 4.03—3.87 (ra, 3 H), 3.56-3.46 (m, 2 H), 3.15 (t, 2 H, J = 6.9 Hz), 2.93 (q, 2 H, J = 6.5 Hz), 1.47-1.34 (m, 4 H), 1.23 (m, 4 H), 0.81 (s, 9 H), 0.15 and one 0.01 (each s, each 3 H).

 (S) -3-O- (1-naphthylmethyl) 1-11 O— [N— [6— (trifluoroacetamide) hexyl] potumbamoyl] glycerol (Compound i)

Under an argon atmosphere, (S) — 2-p- (tert-butyldimethylsilyl) -3-0- (1-naphthylmethyl) -1- 1—O— [N— [6- (trifluoroacetamide) hexyl] force Rubamoyl] Glycerol (compound i) (1.0 g, 1.71 mmo1) was dissolved in 35 ml of tetrahydrofuran, cooled with ice and 2.57 ml (1.0 M tetrahydrofuran solution, 1.5 equivalents) of tetrabutylammonium fluoride solution was added. After the reaction solution was returned to room temperature, it was stirred for 1 hour. The reaction mixture was neutralized by adding 0.15 ml (1.5 equivalents) of acetic acid, and the reaction mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (elution solvent: ethanol / chloroform / ethanol). Thus, 334 mg (yield: 91%) of the title compound (Compound I) was obtained as a colorless oily substance.

^J H NMR (270 MHz, DMSO-d ₆ ) δ: 9.38 (br s, 1 H), 8.10-8.06 (ra, 1 H), 7.96-7.84 (m, 2 H), 7.58-7.4 (ra , 4 H), 7.10 (t, 1 H, J = 5.6 Hz), 5.00 (br s, 1 H), 4.93 (s, 2 H), 3.96 (dd, 1 H, J = 4.6, 10.6 Hz), 3.85 (dd, 1 H, J = 5.9, 10.6 Hz), 3,83 (ra, 1 H), 3.50 (m, 2 H), 3.15 (dt, 2 H, J = 5.6, 7.0 Hz), 2.94 ( q, 2 H, J = 6.4 Hz), 1.48-1.35 (m, 4 H), 1.24 (m, 4 H).

 (S) -3 -O- (1 _naphthylmethyl) 1-11 O— [N— [6— (trifluoroacetamide) hexyl] carpamoyl] glycerol 2-—one (2-cyanoethyl-N, N- (Diisopropyl phosphoramidite) (Compound Y 5) (S) — 3 _0 — (1 -naphthylmethyl) 1 1 1 O — [N — [6-(Trifluoroacetamide) hexyl] under argon atmosphere Dissolving 134 mg (0.28 mmo 1) of glycerol (compound j) in 6.0 m 1 of methylene chloride, 0.1 ml of 2-cyanoethyltetraisopropyl phosphorodiamidite (1.3 equivalents) and 0.76 ml of a solution of 1 H-tetrazole in acetonitrile (0.45 M, 1.2 equivalents) were added, followed by stirring at room temperature for 1 hour. 3 Oml of chloroform was added to the reaction solution, and the mixture was washed once with 10 ml of a saturated aqueous solution of sodium hydrogencarbonate and once with 1 ml of saturated saline, and the organic layer was dried over sodium sulfate. The solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (eluting solvent: ethyl acetate-hexane-1% triethylamine) to obtain 153 mg of the title compound (I-dye Y5) (yield 8 2%) was obtained as a colorless oil.

3 ¹ P NMR (109 MHz, DMS0-d ₆ ) δ: 149.53.

 (4) Synthesis of amidite compound (Υ6) (Figure 4)

(S) -2-O- (tert-butyldimethylsilyl) 1-3-O- (1-naphthylmethyl) 1-111- [N- [13-trifluoroacetamide 4,7. 1 0— trioxatridecanyl] —lubamoyl Ί glycerol (compound k) Under an argon atmosphere, (R) 12-〇- (tert-butyldimethylsilyl) 11-O- (1-naphthylmethyl) glycerol ( Compound h) 790 mg (228 mmo 1) and 56 mg (0.2 equivalents) of DMAP were dissolved in 35 ml of dimethylformamide, and 1,1 ' 22 mg (0.6 equivalent) of imidazole was added, and the mixture was stirred at room temperature. After 1.5 hours, 22 mg (0.6 equivalent) of 1,1′-carbonyldiimidazole was added, and the mixture was further stirred for 2.5 hours. To this reaction solution was added 2.57 ml (5 equivalents) of 4,7,10-trioxa-11,13-tridecandamine, and the mixture was stirred at room temperature for 20 hours. To the reaction solution, 200 ml of ethyl acetate was added, and the mixture was washed four times with 70 ml of water and once with 70 ml of saturated saline, and the organic layer was dried over sodium sulfate. After the solution was concentrated under reduced pressure, the resulting residue was dissolved in 40 ml of methanol, and 1.36 ml (5 equivalents) of ethyl trifluoroacetate and 1.59 ml (5 equivalents) of triethylamine were added. In addition, the mixture was stirred at room temperature for 24 hours. The reaction mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (eluting solvent: ethyl acetate-hexane) to give 1.44 g (yield 92%) of the title compound (Compound k) as a colorless oily substance As obtained.

^J H NMR (270 MHz, DMSO-d ₆ ) δ: 9.36 (br s, 1 H), 8.09-8.05 (m, 1 H), 7.96-7.84 (m, 2 H), 7.55-7.43 (m, 4 H), 7.05 (t, 1 H, J = 5.6 Hz), 4.96 and 4.90 (each d, each 1 H, J = 12.2 Hz), 4.06-3.86 (m, 3 H), 3.50-3.34 (m, 14 H), 3.22 (t, 2H, J = 7.1 Hz), 3.00 (q, 2H, J = 6.6 Hz), 1.69 (m, 2H), 1.59 (m, 2H), 0.81 (s, 9 H), 0.12 and —0.01 (each s, each 3 H).

 (S) -3 -O- (1-naphthylmethyl) 111- [N- [13-trifluoroacetamide-4,7,10-trioxatridecane]] (Compound 1)

Under an argon atmosphere, (S) -2-0- (tert-butyldimethylsilyl) —3- (1-naphthylmethyl) 1-1-O— [N— [13-trifluoroacetamide 4,7,1 Dissolve 1.32 g (1.92 mmo 1) of trioxatridecanyl] poterbamoyl] glycerol (compound k) in 35 ml of tetrahydrofuran, cool with ice, and add tetrabutyl fluoride. Ammonium solution 2.90 m 1 (1.0 M tetrahydrofuran solution, 1.5 equivalents) was added. After the reaction solution was returned to room temperature, it was stirred for 2 hours. After neutralizing with 0.17 ml (1.5 equivalents) of acetic acid, the reaction solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (eluting solvent: ethanol-chloroform) to give the title compound ( Compound 1) (1.07 g, yield 97%) was obtained as a colorless oily substance.

^J H NMR (270 MHz, DMSO- d ₆ ) δ 9.36 (br s, 1 H), 8.10—8.06 (m, 1 H), 7.96—7.87 (ra, 2 H), 7.58-7.44 (m, 4 H ), 7.09 (t, 1 H, J = 5.5 Hz), 4.99 (d, 1 H, J = 4.9 Hz), 4.94 (s, 2 H), 4.00-3.77 (m, 3 H), 3.51- 3, 35 (ra, 14 H), 3.23 (q, 2 H, J = 6.6 Hz), 3.01 (q, 2 H, J = 6.4 Hz), 1.70 (m, 2 H), 1.61 (ra, 2 H).

 (S) — 3—〇1- (1-naphthylmethyl) -1-1 O— [N— [13-Trifluoroacetamide-1,4,7,10—trioxato lidecanyl] dirubamoyl] glycerol 2-—〇 1 (2-Cyanoethyl-N, N-diisopropylphosphoamidite) (Compound Y 6)

 Under an argon atmosphere, (S) -3-O- (1-naphthylmethyl) -1-O- [N- [13-trifluoroacetamide-1,4,7,10-trioxatolidenyl] carpamoyl] Glycerol (Compound 1) 260 mg (0.45 mmo 1) was dissolved in methylene chloride 1 Om 1 and 2-cyanoethylte trisopropyl phosphorodiamidite 0.19 m 1 (1.3 equivalents) A solution of 1.H-tetrazole in acetonitrile (1.20 ml, 0.45 M, 1.2 equivalents) was added, and the mixture was stirred at room temperature for 1 hour. To the reaction mixture was added 30 ml of chloroform, and the mixture was washed once with 10 ml of a saturated aqueous sodium hydrogen carbonate solution and once with 10 ml of a saturated saline solution, and the organic layer was dried over sodium sulfate. did. The solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (elution solvent: ethyl acetate-hexane-1% triethylamine) to give 226 mg (yield 64%) of the title compound (Compound Y6) as a colorless solid. Obtained as a gill.

3 ^I P NMR (109 MHz, DMSO—d ₆ ) δ: 149.54.

 (5) Synthesis of amidite compound (Υ7) (Figure 5)

 (R) — 11- (9-anthrylmethyl) glycerol (compound η)

Under an argon atmosphere, 91- (chloromethyl) anthracene (compound m) 1.3 6 g (6.0 mm o 1) and (S) — (+) — 2,2-dimethyl 1,3-dioxolan-1-4-methanol (compound b) 0.8 2 ml (0.66 mm o 1) was dissolved in 60 ml of a mixed solution of toluene and dioxane (2: 1), and 2.0 g of powdered potassium hydroxide was added. The mixture was heated and stirred at 120 for 1.5 hours. did. After cooling the reaction solution to room temperature, 200 ml of ethyl acetate was added, and the mixture was washed three times with 70 ml of water and once with 7 ml of saturated saline, and the organic layer was dried over sodium sulfate. The solution was concentrated under reduced pressure, and the resulting yellow oily substance was dissolved by adding 80% aqueous acetic acid solution (6 Om1), followed by stirring at room temperature for 18 hours. The reaction solution was concentrated under reduced pressure, acetic acid was removed by azeotropy with toluene, and the residue was purified by silica gel column chromatography (eluting solvent: ethanol-chloroform) to give 1.4 lg (yield) of the title compound (compound n). 83%) as a pale yellow solid.

Ή NMR (270 MHz, DMSO-d ₆ ) δ: 8.62 (s, 1 H), 8.45-8.42 (m, 2 H), 8.12- 8.09 (m, 2 H), 7.62-7.50 (m, 4 H) , 5.46 (s, 2 H), 4.70 (d, 1 H, J = 5.0 Hz), 4.50 (t, 1 H, J = 5.7 Hz), 3.69--3.54 (ra, 3 H), 3.36 (ddd, 1 H, J = 4.9, 5.7, 11.2 Hz), 3.31 (ddd, 1 H, J = 5.3, 5.7, 11.2 Hz).

 (S) — 3—0— (9—anthrylmethyl) 1 l—O— (dimethoxytrityl) glyceronole

Under an argon atmosphere, dissolve 1.25 g (4.43 mmo1) of (R) -1-1O- (9-anthrylmethyl) glycerol (compound n) in 35 ml of pyridine, and add dimethoxytrityl chloride 1 .80 g (1.2 equivalents) was added, and the mixture was stirred at room temperature for 1.5 hours. After stopping the reaction by adding 5 ml of ethanol, the solvent was distilled off under reduced pressure. The residue was dissolved in 200 ml of ethyl acetate, washed once with a saturated aqueous solution of sodium hydrogen carbonate 7 Om1, twice with 70 ml of water, and once with 70 ml of saturated saline, and the organic layer was washed with sodium sulfate. Dried. The solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (eluent: ethyl acetate-hexane) to give 2.47 g (yield 95%) of the title compound (Compound o) as a pale yellow foam. Was. Ή NMR (270 MHz, DMS0-d ₆ ) δ 8.63 (s, 1 H), 8.39-8.36 (m, 2 H), 8.12- 8.08 (m, 2 H), 7.54-7.46 (m, 4 H), 7.34—7.15 (m, 9 H), 6.78—6.73 (m, 4 H), 5.45 (s, 2 H), 4.92 (d, 1 H, J = 5.3 Hz), 3.79 (m, 1 H), 3.72 —3.66 (m, 2 H), 3.69 and 3.68 (each s, each 3 H), 2.93 (dd, 1 H, J = 5.3, 9.3 Hz), 2.88 (dd, 1 H, J = 5.6, 9.3 Hz).

 (R) -1 -O- (9-anthrylmethyl) — 2—0— (triisopropylsilyl) glycerol (compound p)

Under an argon atmosphere, (S) -3-0- (9-anthrylmethyl) 1-1-O- (dimethoxytrityl) glycerol (compound o) 760 mg (1.30 mmo1) was added to dimethylformamide The mixture was dissolved in 10 ml, tri'isopropylsilyl chloride 0.71 ml (2.5 equivalents) and imidazole 450111 _§ (5 equivalents) were added, and the mixture was stirred at room temperature for 2 days. After adding 5 ml of ethanol to the reaction solution to decompose excess reagent, add 200 ml of ethyl acetate, wash four times with 70 ml of water and once with 70 ml of saturated saline, and separate the organic layer. Dried over sodium sulfate. After the solution was concentrated under reduced pressure, the obtained oily substance was dissolved in 10 ml of chloroform and added with 80% acetic acid aqueous solution 2 Oni 1 and stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure, and the residue was purified by silylation gel column chromatography (elution solvent: ethyl acetate-hexane) to obtain 52 mg (yield: 92%) of the title compound (compound p). Obtained as a pale yellow foam.

NMR (270 MHz, DMS0-d ₆ ) 88.62 (s, 1 H), 8.44-8.41 (m, 2 H), 8.12-8.06 (m, 2 H), 7.59-7.49 (m, 4 H) , 5.49 and 5.44 (each d, each 1 H, J = 11.5 Hz), 4.59 (t, 1 H, J = 5.4 Hz), 3.81-3.71 (m, 2 H), 3.61 (dd, 1 H, J = 5.3, 9.7 Hz), 3.37 (dd, 2 H, J = 5.4, 5.6 Hz), 0.91-0.84 (m, 21 H).

 (S) 1 3— O— (9—anthrylmethyl) 1 1—〇-1 [N— “13—Trifluoroacetamide 4,7,10—trioxatridecanyl] potumbamoyl Ί-2 -0 -(Triisopropylsilyl) glycerol '(compound q)

Under an argon atmosphere, (R)-1-0-(9-anthrylmethyl). 1-2- (triisoprovirsilyl) glycerol (compound p) 5 20 mg (1.18 mm o 1) and DM 30 mg (0.2 equivalent) of AP was dissolved in 20 ml of dimethylformamide, and 120 mg (0.6 equivalent) of 1,1, monocarbonyldiimidazole was added thereto, followed by stirring at room temperature. Two hours later, 1,1′-carbonyldiimidazole (120 mg, 0.6 equivalent) was added, and the mixture was further stirred for 2 hours. To this reaction solution was added 4,7,10-trioxa-1,1,13-tridecandamine 1.30 m 1 (5 ) And stirred at room temperature for 20 hours. 13 Om 1 of ethyl acetate was added to the reaction solution, and the mixture was washed four times with 5 Oml of water and once with 50 ml of a saturated saline solution, and the organic layer was dried over sodium sulfate. After the solution was concentrated under reduced pressure, the resulting residue was dissolved in methanol (2 Oml), and 0.71 ml (5 equivalents) of ethyl trifluoroacetate and 0.84 ml (5 equivalents) of triethylamine were added. For 24 hours. The reaction mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (elution solvent: ethyl acetate-hexane) to give the title compound (Compound q), 773 mg

(84% yield) as a pale yellow oil.

! H NMR (270 MHz, DMS0_d ₆ ) δ: 9.36 (br s, 1 H), 8.63 (s, 1 H), 8.43-8.40 (m, 2 H), 8.12-8.08 (ra, 2 H), 7.59 —7.50 (m, 4 H), 7.01 (t, 1 H, J = 5.6 Hz), 5.8 (s, 2 H), 3.99-3.88 (m, 3 H), 3.69 (dd, 1 H, J = 4.9, 9.9 Hz), 3.64 (dd, 1 H, J = 4.6, 9.9 Hz), 3,51-3.35 (m, 12 H), 3.23 (t, 2 H, J = 6.9 Hz), 3.00 (q , 2 H, J = 6.6 Hz), 1.70 (m, 2 H), 1.60 (m, 2 H), 0.90-0.83 (m, 21 H).

 (S) -3 -O- (9-anthrylmethyl) _ l—0— [N— [13-Trifluoroacetamide—4,7,10—trioxatridecanyl] pothamoi] glycerol (With compound)

 Under an argon atmosphere, (S) — 3--1- (9-anthrylmethyl) 1-1--1 [N— [13-trifluoroacetamide 4,7,10-trioxatride dynyl] dilvamoyl ] — 2—0— (triisopropylsilyl) glycerol (Compound q) 500 mg (0.64 mmo 1) is dissolved in 12 ml of tetrahydrofuran, cooled with ice, and tetrabutylammonium fluoride is dissolved. 0.96 ml (1.0 M tetrahydrofuran solution, 1.5 equivalents) was added. After the temperature of the reaction solution was returned to room temperature, the mixture was stirred for 1 hour. After neutralization by adding 55 ^ 1 (1.5 equivalents) of acetic acid, the reaction solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (elution solvent: ethanol-chloroform) to give the title compound (compound) 383 mg (95% yield) was obtained as a pale yellow oil.

^{J H NMR (270 MHz, DMS0} - d 6) δ: 9.37 (br s, 1 H), 8.63 (s, 1 H), 8.44- 8.41 (m, 2 H), 8.12-8.09 (m, 2 H) , 7.61-7.50 (m, 4 H), 7.09 (t, 1 H, J = 5.6 Hz), 5.47 (s, 2 H), 5.00 (d, 1 H, J = 4.6 Hz), 3.95 (m, 1 H), 3.89-3.79 (m, 2 H), 3.64 (m, 2 H), 3.50-3.36 (m, 12 H), 3.23 (q, 2 H, J = 6.6 Hz), 3.01 (q, 2 H, J = 6.5 Hz), 1.70 (ra, 2 H), 1.61 (m, 2 H).

(S) 1-3-1- (9-anthrylmethyl) 1-1-O— [N— [13-trifluoroacetamido 4,4,7,10-trioxatridecanyl] carpamoyl] glycerol 2— O— (2-cyanoethynole N, N-diisopropylphosphoramidite) (Compound Y 7)

 Under an argon atmosphere, (S) -3-0- (9-anthrylmethyl) -111 O- [N- [13-trifluoroacetamide- 1,4,7,10-trioxatolide] Dissolve 350 mg (0.56 mmo 1) of glycerol in 0.5 ml of methylene chloride and add 2-cyanoethyltetraisopropyl phosphorodiamidite. 2 1 ml (1.2 equivalents) and 1.38 ml (0.45 M, 1.1 equivalents) of a solution of 1 H-tetrazole in acetonitrile were added, and the mixture was stirred at room temperature for 1.5 hours. To the reaction mixture was added 60 ml of chloroform, and the mixture was washed once with 25 ml of a saturated aqueous sodium hydrogen carbonate solution, once with 25 ml of water, and once with 25 ml of a saturated saline solution. The organic layer was dried with sodium sulfate. The solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (eluent: ethyl acetate-hexane-1% triethylamine) to give 293 mg (64% yield) of the title compound (Compound Y7). Obtained as a yellow oil.

3 ¹ P NMR (109 MHz, DMSO—d ₆ ) δ: 149.51, 149.43.

 (6) Synthesis of amidite compound (Υ8) (Figure 6)

 (S) 1-3- (1-naphthylmethoxy) 1-1-trifluoroacetamidopropan-1-ol (Compound s)

Under an argon atmosphere, (s) - 1 one amino-3- (1-Nafuchirume butoxy) profile Nono ⁰ Hmm 2- Onore (Compound f) 9 0 0 mg (3. 8 9 mm o 1) the methanol 5 Om l , 0.93 ml (2 equivalents) of ethyl trifluoroacetate and 1.09 ml (2 equivalents) of triethylamine were added, and the mixture was stirred at room temperature for 3 hours. The reaction solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (eluent: ethyl acetate-hexane) to give 860 mg (yield 68%) of the title compound (compound s) as a white solid. Obtained as material.

'Η NMR (270 MHz, DMSO-d ₆ ) δ: 9.34 (br t, 1 H, J = 5.7 Hz), 8.12-8.08 (m, 1 H), 7.96-7.87 (m, 2 H), 7.59-7.45 (m, 4 H), 5.12 (d, 1 H, J = 5.3 Hz), 4.94 (s, 2 H), 3.83 ( dddt, 1 H, J = 4.6, 5.3, 5.6, 7.7 Hz), 3.50 (dd, 1 H, J = 5.3, 9.9 Hz), 3.45 (dd, 1 H, J = 5.6, 9.9 Hz), 3.32 (ddd , 1 H, J = 4.6, 5.7, 13.2 Hz), 3.17 (ddd, 1 H, J = 6.1, 7.7, 13.2 Hz).

 (S) 1 2— [N— (6'-hydroxyhexynole) Cano-Bamoinole] oxy 1 3 1 (1 1-naphthylmethoxy) 1 1-Trifluoroacetamidopropane (Compound t)

 Under an argon atmosphere, (S) —3— (1-naphthylmethoxy) 1-1—trifluoroacetamidopropan-1-ol (compound s) 5 10 mg (1.56 mmo 1) and DMAP 3 8 mg ( (0.2 equivalent) was dissolved in 20 ml of dimethylformamide, and 190 g (0.75 equivalent) of 1,1′-canolevonyldiimidazole was added thereto, followed by stirring at room temperature. Two hours later, 1,1′-carbonyldiimidazole (190 mg, 0.75 equivalent) was added, and the mixture was further stirred for 2 hours. To this reaction solution was added 6-amino-11-hexanol (550 mg, 3 equivalents), and the mixture was stirred at room temperature for 2 hours. To the reaction solution was added ethyl ethyl acetate (15 ° m 1), and the mixture was washed four times with 5 Oml of water and once with 50 ml of saturated saline, and the organic layer was dried over sodium sulfate. The solution was concentrated under reduced pressure, and purified by silica gel column chromatography (elution solvent: ethyl acetate-hexane) to obtain 487 mg (yield 67%) of the title compound (compound) as a white solid substance.

^X H NMR (270 MHz, DMS0_d ₆ ) δ: 9.48 (br s, 1 H), 8.09—8.06 (m, 1 H), 7.96-7.88 (ra, 2 H), 7.59-7.44 (m, 4 H) , 7.17 (br t, 1 H, J = 5.6 Hz), 5.01 (m, 1 H), 4.97 (d, 1 H, J = 11.9 Hz), 4.91 (d, 1 H, J = 11.9 Hz), 4.33 (t, 1 H, J = 5.2 Hz), 3.68-3.57 (m, 2 H), 3.42-3.34 (m, 4 H), 2.93 (dt, 2 H, J = 5.6, 6.9 Hz), 1.2 -1.33 (m, 4H), 1.27-1.20 (m, 4H). (S)-2-[N- (6, -hydroxyhexyl) dirubamoyl] oxy 3-(1-naphthyl methoxy) 1 1-Trifluoroacetamidopropane 6, -0- (2-cyanoethyl-1-N, N-diisopropyl phosphoramidite) (Compound Y 8)

Under an argon atmosphere, (S) — 2— [N-'(6' —hydroxyhexyl) Bamoyl] oxy-3- (1-naphthylmethoxy) 1-1-trifluoroacetamidopropane (Compound t) Dissolve 188 mg (0.40 mmo 1) in 8 ml of methylene chloride and add 2-sia Add 0.15 ml (1.2 equivalents) of monoethyltetraisopropyl phosphorodiamidite and 0.98 ml (0.45M, 1.1 equivalents) of 1H-tetrazole in acetonitrile, and add 20 ml at room temperature. For a minute. To the reaction mixture was added 30 ml of mouth-mouthed form, and the mixture was washed once with a saturated aqueous sodium hydrogen carbonate solution once with 10 ml, once with 10 ml of water, and once with 10 ml of saturated saline, and then washed with an organic solvent. The layer was dried with sodium sulfate. The solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (eluent: ethyl acetate-hexane-1% triethylamine) to give 17 Omg (yield 63%) of the title compound (compound Y8) in white. Obtained as a solid.

³¹ P picture (109 MHz, DMS0-d ₆ ) δ: 147.21.

 (7) Synthesis of amidite compound (Υ9) (Figure 7)

 (R) 1-111-tosyl-3- 3-dimethoxytrityldaricerol (Compound u)

Under an argon atmosphere, (S) — (+) —2,2-dimethyl 1,3-dioxolan-14-methanol (compound b) 1.24 ml (10.0 mmo 1) was converted to 50 ml of pyridine. After dissolution, 3.81 g (2.0 equivalents) of tosyl chloride was added, and the mixture was stirred at room temperature for 17 hours. 15 ml of water was added to the reaction solution to decompose excess reagent. After evaporating the solvent under reduced pressure, the residue was dissolved in ethyl acetate (350 ml), once with 100 ml of water, once with 100 ml of saturated aqueous sodium hydrogencarbonate solution, and once in 100 ml of water. The extract was washed once with 1 and once with 100 ml of a saturated saline solution, and the organic layer was dried over sodium sulfate. After the solution was concentrated under reduced pressure, the obtained oily substance was dissolved by adding 70 ml of an 80% aqueous acetic acid solution, followed by stirring at room temperature for 20 hours. The reaction solution was concentrated under reduced pressure, acetic acid was removed by azeotrope with toluene, and azeotrope with pyridine. The residue was dissolved in 60 ml of pyridine under an argon atmosphere, and 4.07 g (1.2 equivalents) of dimethoxytritin chloride was added, followed by stirring at room temperature for 2 hours. After the reaction was stopped by adding 1 Om1 of ethanol, the solvent was distilled off under reduced pressure. The residue was dissolved in 350 ml of ethyl acetate, once with 100 ml of water, once with 100 ml of saturated aqueous sodium hydrogencarbonate solution, once with 100 ml of water, and once with 100 ml of saturated saline. Wash once with 1 and wash the organic layer with sodium sulfate. Dried. The solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (eluent: ethyl acetate-xan) to give 4.51 g (yield 82%) of the title compound (Compound u) as a white foam. Obtained as material.

¾ NMR (270 MHz, DMSO— d ₆ ) δ: 7.74 (m, 2 H), 7.45 (ra, 2 H), 7, 29—7.13 (m, 9 H), 6.88-6.84 (, 4 H), 5.28 (d, 1 H, J = 5.6 Hz), 4.04 (dd, 1 H, J = 3.6, 9.6 Hz), 3.96 (dd, 1 H, J = 5.4, 9.6 Hz) ', 3.78 (m, 1 H ), 3.74 (s, 6 H), 2.94 (dd, 1 H, J = 5.3, 9.2 Hz), 2.83 (dd, 1 H, J = 6.9, 9.2 Hz), 2.39 (s, 3 H).

 (R) 13-Dimethoxytrityloxy 1-azidopropan-12-ol (Compound V)

 Under an argon atmosphere, (R) — 1 — O — Tosyl-3-O — dimethoxytrityl glycerol (compound u) 93 mg (1.70 mmo1) was dissolved in dimethylformamide 20 ml. , Sodium azide (440 mg, 4 equivalents) and ammonium chloride (455 mg, 5 equivalents) were added, and the mixture was heated with stirring at 80 ° C for 2 hours. After the reaction solution was cooled to room temperature, 150 ml of ethyl acetate was added, and the mixture was washed four times with 50 ml of water and once with 50 ml of saturated saline, and the organic layer was dried over sodium sulfate. The solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (eluent: ethyl acetate-hexane) to give 690 mg (yield 96%) of the title compound (Compound V) as a yellow oil. Obtained.

! H NMR (270 MHz, DMSO— d ₆ ) δ: 7.41—7.18 (m, 9 H), 6.91—6.86 (m, 4 H), 5.31 (d, 1 H, J = 5.3 Hz), 3.81 (dtdd , 1 H, J = 3.6, 5.3, 6.3, 6.6 Hz), 3.73 (s, 6 H), 3.36 (dd, 1 H, J = 3.6, 12.5 Hz), 3.28 (dd, 1 H, J = 6.3, 12.5 Hz), 3.00 (dd, 1 H, J = 5.3, 9.2 Hz), 2.88 (dd, 1 H, J = 6.6, 9.2 Hz).

 (R) — 3-Dimethoxytrityloxy 1 —aminopropan-1-ol (Compound w)

(R) — 3-Dimethoxytrityloxy 1-azidopropan-12-ol (Compound V) 62 mg (1.48 mmo 1) was dissolved in 20 ml of ethanol, and palladium-carbon (1 (0%) 120 mg was added, and the mixture was stirred at room temperature under a hydrogen atmosphere at room temperature for 6 hours. After removing the palladium catalyst by filtration through ceralite, the solution was After concentration under reduced pressure, 548 mg (yield 94%) of the title compound (compound w) was obtained as a white foam. This compound was used for the subsequent reaction without further purification. ] H NMR (270 MHz, DMS0-d ₆ ) δ: 7.42-7.21 (m, 9 H), 6.90-6.86 (m, 4 H), 4.71 (br s, 1 H), 3.73 (s, 6 H) , 3.55 (dddd, 1 H, J = 4.0, 5.3, 6.0, 6.9 Hz), 2.94 (dd, 1 H, J = 5.3, 8.9 Hz), 2.83 (dd, 1 H, J = 6.0, 8.9 Hz), 2.68 (dd, 1 H, J = 4.0, 12.8 Hz), 2.46 (dd, 1 H, J = 6.9, 12.8 Hz).

 6— {N- C (R) — 3 '—Dimethoxytrityloxy-1,2-hydroxypropynole] Rivalmoyl} Naphthalene-2-carboxylic acid pentafluorophenyl ester (Compound X)

 Under an argon atmosphere, 2,6-naphthalenedicarboxylic acid dipentaphnoleophthalene phenol ester 82 2 mg (1.5 mmo 1) and N, N-diisopropylethylenoleamine 0.70 ml (4.0 mm o 1) Is dissolved in 70 ml of tetrahydrofuran, and (R)-3-dimethoxytrityloxy-1-aminopropane-2-ol (compound w) 52 mg (1.32 mmo1) of tetrahydrofuran is added to this solution. The solution (10 ml) was added dropwise over 10 minutes. After stirring at room temperature for another 1 hour, the solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (elution solvent: ethyl acetate-hexane) to yield 64 mg of the title compound (Compound X) (67% yield). ). Was obtained as a white foam.

JH NMR (270 MHz, DMSO- d ₆ ) δ · ■ 9.01 (m, 1 H), 8.65 (br t, 1 H, J = 5.6 Hz), 8.51 (m, 1 H), 8.32 (d, 1 H , J = 8.6 Hz), 8.26 (d, 1 H, J = 8.6 Hz), 8.19 (dd, 1 H, J = 1.7, 8.6 Hz), 8.02 (dd, 1 H, J = 1.7, 8.6 Hz), 7.45-7.42 (m, 2 H), 7.31-7.17 (m, 7 H), 6.87—6.83 (m, 4 H), 5.12 (d, 1 H, J = 5.6 Hz), 3.94 (m, 1 H) , 3.69 (s, 3 H), 3.68 (s, 3 H), 3.56 (m, 1 H), 3.29 (m, 1 H), 3.05-2.96 (m, 2 H).

 6-{N— C (R) — 3 '—Dimethoxytrityloxy 2' —Hydroxypip pill] carpamoyl} — 2— {N-[N- (trifluoroacetyl) -13, '-aminopropyl] force Rubamoyl} naphthalene (Compound V)

Under an argon atmosphere, 6— {N — [(R) -3'—dimethoxytrityloxy-2'—hydroxypropyl} Hydroxypropyl} Naphthalene-1-2-Norevonic acid ぺ Dissolving 64 mg (0.84 mmo 1) of antafluoropheninoleestenole (compound X) in 20 ml of dimethylformamide, and adding 0.7 ml (10 equivalents) of 1,3-propanediamine And stirred at room temperature for 30 minutes. To the reaction solution was added 150 ml of ethyl acetate, and the mixture was washed 5 times with 50 ml of water, and the organic layer was concentrated under reduced pressure. The obtained residue was dissolved in 15 ml of methanol under an argon atmosphere, and 0.5 ml (5 equivalents) of trifluoroacetic acid ethanol and 0.59 ml (5 equivalents) of triethylamine were added. For 14 hours. The reaction mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (eluent: ethyl acetate-^-xane) to give 44 mg (yield 70%) of the title compound (Compound y) in white. Obtained as a foam.

NMR (270 MHz, DMSO-d ₆ ) δ: 9.46 (br s, 1 H), 8.72 (br t, 1 H, J = 5.6 Hz), 8.55 (br t, 1 H, J = 5.6 Hz), 8 7 (ra, 1 H), 8.41 (m, 1 H), 8.09-8.05 (ra, 2 H), 7.99-7.91 (m, 2 H), 7.44-7.41 (m, 2 H), 7.31-7.16 (m, 7 H), 6.86-6.82 (m, 4 H), 5.10 (d, 1 H, J = 5.3 Hz), 3.93 (m, 1 H), 3.68 (s, 3 H), 3.67 (s, 3 H), 3.53 (m, 1 H), 3.41-3.23 (m, 5 H), 2.99 (m, 2 H), L 81 (m, 2 H).

 6-1- {N — [(R) _3'—Dimethoxy lithioxy 2'—Hydroxypro-pinole] -l-bamoyl}-2- {N- [N- [N- (trifluorescetyl) 1 3 '' —- amino-propyl] carpamoyl} Naphthalene 2 '— O— (2-cyanoethyl-N, N-diisopropyl phosphoramidite) (Compound Y 9)

Under an argon atmosphere, 6 — {N-[(R) -3'dimethoxytrityloxy-2'-hydroxypropyl] carbamoyl} —2— {N— [N— (trifluoroacetyl) 1 3 ', 2-Aminopropyl] potassium rubamoyl} Naphthalene (Compound y) 298 mg (0.40 mmo 1) was dissolved in methylene chloride 10 m 1, and 2-cyanoethyltetraisopropyl phosphorodiamidite 0.15 m 1 (1.2 equivalents) and 1H-tetrazole in acetonitrile solution 0.98 ml (0.45 M, 1.1 equivalents) were added, and the mixture was stirred at room temperature for 2 hours. To the reaction solution was added 30 ml of chloroform-form, and the mixture was washed twice with 15 ml of a saturated aqueous sodium hydrogen carbonate solution and once with 15 ml of a saturated saline solution, and the organic layer was dried over sodium sulfate. The solution is concentrated under reduced pressure, and the residue is purified by silica gel column chromatography (elution solvent: ethyl acetate-hexane-1% triethylamine) to give the title compound (compound Y 9) 2 55 mg (68% yield) were obtained as a white foam.

3 ¹ P NMR (109 MHz, DMS0-d ₆ ) δ: 149.20, 148, 95.

 (8) Synthesis of amidite compounds (Υ10 and Υ11) (Figure 13)

 (S) -1-(Monomethoxytrityl) amino-3- (1-naphthylmethoxy) propane-2-ol (compound α)

Under an argon atmosphere, (S) — 1-amino-3 — (1-naphthylmethoxy) pent-1-ol (compound f) 1.82 g (7.85 mmo 1) was added to pyridine 75 ml 1 After dissolution, 3.15 g (1.3 equivalents) of monomethoxytrityl chloride was added, and the mixture was stirred at room temperature for 7 hours. After stopping the reaction by adding 15 ml of ethanol, the solvent was distilled off under reduced pressure. The residue was dissolved in 200 ml of ethyl acetate, and once with 70 ml of water, once with 70 ml of aqueous sodium hydrogencarbonate solution, once with 70 ml of water, and 70 ml of saturated saline. After washing once, the organic layer was dried over sodium sulfate. The solution is concentrated under reduced pressure, and the residue is purified by silica gel column chromatography (neutral silica gel, eluent: ethyl acetate-hexane) to obtain 2.80 g of the title compound (compound _α ) (71% yield). Was obtained as a white foam.

^J H NMR (270 MHz, DMSO- d ₆ ) δ: 8.03-8.00 (m, 1 H) '7.94-7.85 (m, 2 H), 7.54-7.34 (ra, 8 H), 7.28-7.12 (m, 8H), 6.82—6.77 (m, 2 H), 4.94 (d, 1 H, J = 12.2 Hz), 4.88 (d, 1 H, J = 12.2 Hz), 4.80 (d, 1 H, J = 5.3 Hz), 3.82 (m, 1 H), 3.70 (s, 3 H), 3.51 (m, 2 H), 2.39 (br dd, 1 H, J = 7.0, 8.6 Hz), 2.17 (ddd, 1 H, J = 4.6, 8.6, 11.5 Hz), 1.97 (ddd, 1 H, J = 6.6, 7.0, 11.5 Hz).

 (S) I2 -— [N- (6'-hydroxyhexyl) carpamoyl] oxy1-1- (monomethoxytrityl) amino-3- (1-naphthylmethoxy) propane (compound β)

Under an argon atmosphere, (S) —1— (monomethoxytrityl) amino-3- (1-naphthylmethoxy) propan-2-ol (compound) 2.62 g (5.20 mm o 1) and DMAP 130 mg (0.2 equivalent) was dissolved in 55 ml of dimethylformamide, 63 mg (0.75 equivalent) of 1,1′-carbonyldiimidazole was added, and the mixture was stirred at room temperature. Two hours later, 1,3′-carbonyldiimidazole (630 mg, 0.75 equivalent) was added, and the mixture was further stirred for 3 hours. this To the reaction solution was added 1.83 g (3 equivalents) of 6-amino-11-hexanol, and the mixture was stirred at room temperature for 16 hours. To the reaction solution, 300 ml of ethyl acetate was added, and the mixture was washed four times with 100 ml of water and once with 100 ml of saturated saline, and the organic layer was dried over sodium sulfate. The solution was concentrated under reduced pressure, and purified by silica gel column chromatography (neutral silica gel, elution solvent: ethyl acetate-hexane) to obtain 3.07 g of the title compound (compound) 3 (91% yield). Was obtained as a white foam.

NMR (270 MHz, DMSO- d ₆ ) δ: 8.00-7.85 (m, 3H), 7.53-7.33 (m, 8H), 7.28-7.12 (m, 9H), 6.81-6.77 (m, 2H ), 4.95 (d, 1 H, J = 12.0 Hz), 4.95 (m, 1 H), 4.88 (d, 1 H, J = 12.0 Hz), 4.30 (t, 1 H, J = 5.1 Hz), 3.72 -3.68 (m, 5 H), 3.36 (m, 2 H), 2.96 (m, 2 H), 2.38 (t, 1 H, J = 8.1 Hz), 2.18 (m, 2 H), 1.41-1.33 ( m, 4 H), 1.26-1.22 (ra, 4 H).

 (S) —2 -— [N- (6,1-hydroxyhexyl) pothambamoyl] oxy-1-1- (mono-methoxytrityl) amino-3— (1-naphthyl-methoxy) propane 6'-O- (2-cyanoethyl-N , N-diisopropinole phosphoramidite) (Compound Y10)

 Under an atmosphere of anoregon, (S) —2— [N— (6, -hydroxyhexynole) benzomamoyl] oxy-1- (monomethoxytrityl) amino-3-((1-naphthylmethoxy) propane (compound i3) 3 23 mg (0.50 mm o 1) was dissolved in 10 m 1 of methylene chloride, and N, N-diisopropylethylamine 0.52 m 1 (6 equivalents), 2-cyanoethyl-N, N 0.13 ml (1.2 equivalents) of diaminochlorophosphoramidite was added, and the mixture was stirred at room temperature for 30 minutes. Add 50 ml of chloroform to the reaction solution and wash once with 20 ml of saturated aqueous sodium hydrogen carbonate solution, once with 20 ml of water and once with 20 ml of saturated saline, and the organic layer is washed. Dried over sodium sulfate. The solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (neutral silica gel, elution solvent: ethyl acetate-hexane-1% triethylamine) to obtain 310 mg of the title compound (Compound Y10). (73%) was obtained as a colorless candy-like substance.

3 ¹ P thigh R (109 MHz, DMS0-d ₆ ) δ: 147.27.

(S) — 3— (1—naphthylmethoxy) 1 1—tritylaminopropane 1 2—ol (compound) Starting from (S) -1-amino-3- (1-naphthylmethoxy) propan-2-ol (compound f) and using trityl chloride instead of monomethoxytrityl chloride, the (S) -1— (monomer The title compound (compound γ) was obtained by treating in the same manner as in the synthesis of (toxitrityl) amino-3- (1-naphthylmethoxy) propan_2-ol (compound α).

 (S) — 2--(6,1-Hydroxyhexyl) dirubamoyl] oxy-3- (1-Naphthylmethoxy) 1-111 Tritylaminopropane (compound δ)

 Starting from (S) 13_ (1-naphthylmethoxy) 1-1_tritylaminopropane121-ol (compound), (S) —2— [Ν— (6, -hydroxyhexyl) The title compound (compound δ) was obtained in the same manner as in the synthesis of 1- (monomethoxytrityl) amino-3- (1-naphthylmethoxy) propane (compound).

 (S) 1-2-[Ν-(6, 1-hydroxyhexyl) dirubamoyl] oxy 1-3- (1-naphthylmethoxy) 1-1 -tritylaminopropane 6 '-0-(2-cyanoethyl 1, Ν—Diisopropyl phosphoramidite) (Compound Y 11)

 (S) 1-2-[Ν-(6, 1 -hydroxyhexyl) carpamoyl] oxy 1-3-(1-naphthylmethoxy)-1-1 Starting with tritylaminopropane (compound δ), (S)- 2— [Ν- (6,1-Hydroxyhexyl) potamyl] oxy-11- (monomethoxytrityl) amino-3— (1-naphthylmethoxy) propane 6, -0- (2-cyanoethyl-Ν, Ν —Diisopropinolefosphoramidite) (compound Υ10) was treated in the same manner as in the synthesis of the title compound (compound Υ11).

 (Example 2) Synthesis and purification of oligonucleotide probe

 Oligonucleotide synthesis was performed on an Applied Biostems type 394 DNA / RNA synthesizer.

The analysis was performed using a Waters 996 photodiode array detector using a Gison son apparatus for HP LC. Waters ^ Bondasphere C 183 00 A (internal diameter 3.9 mm x length 150 mm) as a column for reversed-phase analysis, GL Science Inertsi as a column for reversed-phase separation 1 ODS-3C18 (8.0 mm ID x 300 mm length), Tosoh T SK—GE LDE AE—2 SW (4.6 mm ID × 250 mm length) for anion exchange analysis used. As the mobile phase, in the case of reverse phase, 0.1M triethylammonium acetate buffer (TEAA, pH 7.0) in acetonitrile, and in the case of anion exchange, concentration gradient of ammonium formate in 20% acetonitrile in water '.

Synthesis of oligonucleotide probes

 The following oligonucleotide probes were prepared from doxynucleoside 3'-phosphoramidite (purchased from Nippon Techno Service Co., Ltd.) and used as an automatic DNA synthesizer (Model 394A; PerkinElmer Japan, Inc. 'Applied Dubai) (Manufactured by Systems Division) at 0.2 or 1 μmo 1 scale.

X n - S p (n = l~8): 5 '-Xn-TCTTC CAAGCAATTC C AATGAAAGCCATGACCACATGGACGACGATGATG- 3 5 ( SEQ ID NO: 1)

Cy5-AS-Sp: 5'-Cy5-ATCGTCATCATCGTCGTC CATGTGGTCATGGCAAACATTGGAATTGCTTGGAA GAGTTTC—3 '(SEQ ID NO: 2)

 N-monomethoxytrityl-6-aminohexyl phosphoramidite (Glen Research) was used for the amino group introduced at the 5 'end of the X1-Sp and X4-Sp oligonucleotides. X 2 — Sp, X 3 — Sp, X 5 — Sp, X 6 — Sp, X 7 — Sp, X 8 — Sp The introduction of the amino group of Y 2, Υ 3, Υ 5 , Υ6, Υ7, and Υ8 were performed using phosphoramidite compounds. FIG. 8 shows the structures of the synthesized oligonucleotide probes X 1 — Sp to X 8 — Sp.

After completion of the synthesis, the oligonucleotide probe was treated and purified as follows. The oligonucleotide probe was cut out from CPG (Controlled Glass) with concentrated aqueous ammonia, and then 50. Heated at C for 12 hours. After distilling off the solvent and dissolving in deionized water, C18 (manufactured by Waters) open force column chromatography was performed (column size 0.8 x 18 cm: 5-50% acetate etol. 1M triethylammonium acetate (hereinafter referred to as “TEAA”) eluted with a linear concentration gradient using an aqueous solvent. About 3 Fractions eluted with 0% acetonitrile were collected, 2 ml of an 80% aqueous acetic acid solution was added, and the mixture was stirred for 60 minutes. Acetic acid was distilled off under reduced pressure, and the aqueous layer was washed with ethyl acetate. After evaporating the solvent, the residue was dissolved in 1 ml of sterile water.

 Xn-Sp (n = 1-8) was fractionated and purified by reversed-phase HPLC. The conditions for reversed phase HP LC were as follows:

 For Xn-Sp (n = l ~ 6), use a force ram: Inertsil ODS-3 (C-18) column Φ 8.0 x 300 mm (GL Science).

 For X n-S p (n = 7, 8), use a column: μ-bonder sphere (C- 18) force ram 3.9 x 150 mm (Waters).

table 1

Ori: Γ'nucleotide retention time Βsolution concentration (%)

 1 ° mouth-f, (min) (0 min → 20 min)

 X1-SP 9.99 10- → 70%

 X2-SP 8.79 20- → 80%

 X3-SP 11.31 20- → 50%

 X6-SP 7.92 30- → 50%

 X5-SP 6.83 30- → 50%

 X4-SP 13.9 30- → 50%

 X7-SP 10.3 20-→ 60%

 X8-SP 16.0 40- → 60% solution 1

 Α solution 5% acetonitrile 0.1 M TEAA (pH 7.0)

B solution 50% acetonitrile Z 0.1 M TEAA (pH 7.0)

Column temperature: 50 degrees

Solution 2

 A solution 5% acetonitrile 0.1 M TEAA (pH 7.0)

B solution 25% acetonitrile / 0.1 M TEAA (pH 7.0)

Column temperature: 50 degrees

 (Example 3) Reaction between oligonucleotide probe and fluorescent dye

Synthesis of C V 5— X I— AS— Sp

XI—AS—Sp: 5 '-Xl -ATCGTCATCATCGTCGTCCA 2005/007666

G T TT C— 3 '

 1-3-3- is an oligonucleotide complementary to X 1 —Sp. First, it was synthesized as an oligonucleotide probe having an amino group introduced thereinto similar to the X 1 -Sp described above. Was purified.

Column: I n e r t s i 1 O D S—3 (C—18) column Φ 8.0 x 300 mm (GL Sci e nce)

 Reaction of X I — A S — Sp with Cy 5 — succinimidyl ester

 Oligonucleotide probe (XI-AS-Sp) (1 nmo1) and Cy5-succinimidyl ester (Pharmacia) (500 nmol) were added to 10% (v / v) dimethylformamide, 0% The solution was dissolved in a 25 M carbonate buffer solution (total volume: 100 L), and the reaction was carried out at 35 ° C under light shielding. Sixteen hours after the start of the reaction, desalting was performed with NAP10 (Pharmacia). Thereafter, fractionation was performed with reversed-phase HPLC. Column: μ—bonder sphere (C-18) column Φ3.9 x 150 mm (ゥ made by Otters)

Table 2

 Rico * nucleotide 'retention time B solution concentration change solution

 H. 0-7 * (minutes) (0 minutes → 20 minutes)

 X1-AS-Sp 10.3 10 → 80% 1

 Gy5-X1-AS-Sp 12.5 0--70% 1 Solution 1

 A solution 5% acetonitrile / 0.1 M T EAA (pH 7.0);

 B solution 50% acetonitrile / 0.1 M T E AA (pH 7.0)

Column temperature: 50 degrees

Reaction with Fluorescein Isothiocyanate '(FITC)

 Oligonucleotide probe (Xn—Sp: n = l to 8) (lnmol)

FITC (500 nm o 1) to 10% (v / v) dimethylformamide, 0.

After dissolving in 25 M carbonate buffer solution (100 L in total), the reaction was started at 40 C with shielding from light. At any time from 30 minutes to 4 hours after the start of the reaction, weigh 15 μL,

Desalted with NA P 5 (Pharmacia). Then, it was analyzed by reversed-phase HPLC. Reverse-phase HPLC of each oligonucleotide probe bound to fluorescein. Table 3 shows the analysis conditions and results.

Table 3

Ori: Γnucleotide retention time B solution concentration (° / c) solution

 H 'Mouth-H,' (min) (0 min → 20 min)

 X1-SP 9.1 0 → 100

 X2-SP 10.9 0 → 100

 X3-SP 11.2 0 → 100

 X4-SP 8.7 0 → 100

 X5-SP 12.3 0 → 100

 X6-SP 12.2 0 → 100

 X7-SP 16.6 0 → 70

 X8-SP 15.8 o → 70 Solvent 1

A solution 5% acetonitrile / 0.1 M T E AA (pH 7.0);

B solution 50% acetonitrile / 0.1 M T E AA (pH 7.0); Column temperature: 50 degrees

 The results are shown in FIG. 9b.

 (Example .4) Binding reaction with oligonucleotide probe spot on slide glass

 Slide glass (20 pieces) was immersed in a 10% aqueous sodium hydroxide solution (200 mL) for 15 minutes, and then water (twice with 200 mL) and a 1% aqueous hydrochloric acid solution (200 mL) were used. L) followed by water (twice with 200 mL). It was immersed in methanol (200 mL), subjected to ultrasonic cleaning for 5 minutes, dried by centrifugation, and further dried at 180 degrees for 3 hours.

Subsequently, the dried slide glass was immersed in 3-aminotrimethoxysilane (13 mL), water (8 mL), and methanol (380 mL), and stirred at room temperature for at least 5 hours. Thereafter, the slide glass was taken out, washed three times with methanol (200 mL), centrifuged, and dried at 180 degrees for 3 hours. In advance, 1,4-phenylenediisothiocyanate (1400 mg) was dissolved in a 10% pyridine.dimethylformamide solution (220 mL), and the slide glass which had been subjected to the above aminosilane diluting was dissolved in the solution. The mixture was stirred at room temperature for 16 hours. Sly Dogara And then washed twice with dimethylformamide (200 mL), dichloromethane (200 mL), acetone (200 mL), and methanol (200 mL) in that order, dried at room temperature under reduced pressure, and isothiocyanated. The obtained slide glass was obtained.

 Subsequently, an isothiosinate slide glass is spread on a glass container, and a 20 or 30% tris (3-aminopropyl) amine (methanol solution (130 μL)) is added dropwise thereto, and the mixture is sealed and sealed at 37 ° C. For 5 hours. Thereafter, the slide glass was washed twice with methanol (200 mL) and once with acetone (200 mL). After drying at room temperature under reduced pressure for 1 hour, 1,4-phenylene diisothiocyanate (1400 mg) was dissolved in 10% pyridine 'dimethylformamide solution (220 mL) in advance. The slide glass was put therein and stirred at room temperature for 16 hours. Take out the slide glass, wash twice with dimethylformamide (200 mL), dichloromethane (200 mL), acetone (200 ml) and methanol (200 mL) in that order, dry under reduced pressure at room temperature, and dry the second layer. An isothiocyanated slide glass was obtained, which was used as an oligonucleotide spot.

 A 50-base oligonucleotide probe (Xn-Sp) (50-300 pmo1) is dissolved in sterile water (51), and a spot solution (5 µl; 1M carbonate buffer (ρΗ9.0)) is dissolved. And spotted on a coated slide glass coated with 1,4-phenylenediisocarbonate by a spotter (SPBI〇2000, manufactured by Hitachi Software Engineering Co., Ltd.). After spotting, filter paper was spread on a tight box, and a 300 mM aqueous solution of sodium hydrogen phosphate was wetted. A slide glass that had been spotted was added to prevent the solution from sticking. After 16 hours, remove the slide glass from the tight box, and remove the slide glass with 0.1% Triton X (200 mL) for 5 minutes at room temperature, and with a 0.02% aqueous hydrochloric acid solution (200 mL) for 2 minutes at room temperature, 0.1 M The plate was washed with potassium chloride (200 mL) for 10 minutes at room temperature and sterilized water (20 OmL) for 1 minute at room temperature.

Subsequently, the glass was immersed in a 1M aqueous solution of ethanolamine (20 OmL), and stirred at room temperature for 1 hour to perform blocking. After washing three times with sterile water, dry in the draft It was dried and refrigerated.

 (Example 5) Confirmation of immobilization of oligonucleotide probe on slide glass

40 ^ Μ Texas Red-dd ATP (2 zL), dimethinoresulfoxide (10; uL), 25 mM coparte chloride solution (10 L), reaction buffer solution (x5, 1 M potassium potassium codylate, 125 mM Tris-HCl, 1.25 mg / ml BSA, pH 6.6; 20 μL), sterilized in terminal transfer ferment (l Ai L; 400 units) Immediately after preparing a reaction solution having a total volume of 80 I by adding water, the entire volume was dropped on the slide glass of Example 4. A cover glass was placed on the reaction solution and left at 37 ° C. After 15 minutes 1 Wash with XSSC buffer (0.15M NaCl, 0.1M 3M citrate dihydrate), 0.1% SDS solution at 60 ° C, 10 minutes, Millimeter water wash Then, it was washed with ethanol aqueous solution, dried and measured with a detector (scan array) (Fig. 9a).

 (Example 6) Hybridization on carrier

 Add 20 XSSC (0.6 μ1), 10% SDS (1.2 μ1), and sterilized water to Cy5-Xl -AS-Sp (4.8 pmo 1), and add total volume 2 A 4 µl probe solution was prepared. After the probe D solution was gently placed on the DNA chip prepared in Example 4, a cover glass was placed on the solution, and placed in a tight box covered with a Kim towel moistened with 4 XSSC solution. Or at 60 degrees for 16 hours.

 After hybridization, place the chip in 0.1 XSSC—0.1% SDS solution (200 mL) for 5 minutes, and then in 0.05 × SSC—0.1% SDS solution (200 mL). Each was washed with 0,05 x SSC (200 mL) at room temperature for 0 minutes. After drying, it was detected by a chip scanner (trade name of ScanAray, ApAccardBiosccienceCompany). The results are shown in FIG.

 From the results of the hybridization, it was revealed that the oligonucleotide probe of the present invention can be detected with higher sensitivity than X 1 —Sp or X 4 —Sp.

(Example 7) Synthesis of 25 base oligonucleotide Xn-Sp25 (n = l, 3-9) and X9-Sp35 were synthesized and purified in the same manner as Xn-Sp (n = l-S).

 The conditions for each reversed phase HPLC were as follows:

 Table 4

 Rico 'nucleotide' retention time B solution concentration (Q / o) solution column

 H 'Mouth-H' (min) (0 min-20 min)

 XI-Sp25 8.47 20 → 40% 2

 X3-Sp25 10.31 25 → 55% 1

 X4-Sp25 12.19 30 → 50% 2

 X5-Sp25 9.47 30 → 70%

 X6-Sp35 13.41 35 → 60% 1

 X7-Sp25 12.88 20 → 60% 1

 X8-Sp25 17.16 40 → 60% 2

 X9-Sp25 12.8 15 → 35% 2

 X9-Sp35 13.97 15 → 35% 2 Solution 1

 A solution 5% acetonitrile 0.1 M T E AA (pH 7.0)

 B solution 50% acetonitrile 0.1 M T E AA (pH A 7AAA ABBBB .0)

Column temperature: 50 degrees

Solution 2

 A solution 5% acetonitrile Z 0.1 M T EAA (pH 7.0)

 B solution 25% acetonitrile Z 0.1 M T E AA (pH 7.0)

Column temperature ^: 50 degrees

Column A: μ-bonder sphere (C-18) column Φ3.9 x 150 mm '(Waters)

Column B: I n e r t s i OD S—3 (C—18) column Φ 8.0 x 300 mm (GL Sci e nce)

X n-S p 25 (n = l, 3-9):

 5 '-X n-T C T T C C AA G C AA T T C C AA T GAAAG C-3' (SEQ ID NO: 3)

 X 9-S p 35:

5 'single AG CAAGAAAC- X n- TC TT C CAAG CAAT TC CAA T GAAAG C - 3 5 ( SEQ ID NO: 4) (Example 8) Reaction of 25 base oligonucleotide probe with fluorescent dye Reaction with fluorescein isothiocyanate (FITC)

 Oligonucleotide probes (Xn—Sp25: n = 1, 3 to 9; X9-Sp35) (1 nm01) and FITC (500 nmo1) were 10% (v / v) Dimethylformamide was dissolved in a 0.25 M carbonate buffer solution (100 L in total), and the reaction was started at 40 ° C under light shielding. At any time from 30 minutes to 4 hours after the start of the reaction, 15 / iL was weighed and desalted with NAP5 (Pharmacia). Thereafter, analysis was performed using reversed-phase HPLC. The analysis conditions of each oligonucleotide probe by reversed-phase HPLC are shown below. The results of the FITC generation rate are shown in FIG. 9c.

H P L C condition

Solvent

 A solution 5% acetonitril / 0.1 M TE AA (pH 7.0);

B solution 50% acetonitrile / 0.1 M TEAA (pH 7.0);

Column temperature: 50 degrees

Column: μ—bonder sphere (C—18) column Φ3.9 x 150 mm (ゥ made by Otters)

 (Example 9)

A 25-base oligonucleotide probe (Xn-Sp25; n = 1, 5, 9) (50 or 100 pmo1) was sterilized on the slide glass whose surface was coated in the same manner as in Example 4. Dissolve in water (5μ1), mix with spot solution (51; 1Μ carbonate buffer (ρΗ9.0)), and spotter (SPB1020000, manufactured by Hitachi Software Engineering Co., Ltd.) Was spotted on a coated slide glass coated with 1,4-phenylenediisothiocyanate. After spotting, filter paper was spread on a tight box, moistened with a 300 mM aqueous solution of sodium phosphate, and a slide glass with spots was added to prevent the solution from sticking. After sealing, the glass was allowed to stand at room temperature. After 16 hours, remove the slide glass from the tight box, and remove the slide glass with 0.1% Triton X (200 mL) for 5 minutes at room temperature, and with a 2% aqueous hydrochloric acid solution (200 mL) for 2 minutes at room temperature. The plate was washed with 1 M lithium chloride (200 mL) for 10 minutes at room temperature and with sterile water (200 mL) for 1 minute at room temperature. Subsequently, the glass was immersed in a 1 M aqueous ethanolamine solution (200 mL), and stirred at room temperature for 1 hour to perform blocking. After washing three times with sterile water, the mixture was dried in a draft and stored refrigerated.

 (Example 10) Confirmation of immobilization of oligonucleotide probe on slide glass

 40 μΜ Texas Red-dd ATP (2 μL), dimethyl sulfoxide (10 μL), 25 mM cobalt chloride solution (10 μL), reaction buffer solution (χ5, 1 Potassium potassium codylate, 125 mM Tris-HCl, 1.25 mg / ml BSA, pH 6.6; 20 μL), terminal sterilized in terminal transfer (li L; 400 units) Immediately after preparing a reaction solution having a total volume of 800 1 by adding water, the entire volume was dropped on the slide glass of Example 9. A cover glass was placed on the reaction solution and left at 37 ° C. After 15 minutes 1 XSSC buffer (0.15 M NaCl, 0.03 M citrate dihydrate), 0.1% SDS solution at 60 ° C, 10 minutes, water supply Washing, washing with an ethanol aqueous solution, drying, and measurement with a detector (scan array) (Fig. 12).

 (Example 11) Synthesis of oligonucleotide (X10—Sp25) and deprotection experiment under mild conditions

 Using the amidite compound (Y10) synthesized in Example 1, X10-Sp25 was synthesized and purified in the same manner as Xn-Sp (n =:!-8). .

X n— S p (n = 8, 1 0)

 5 '-X n-T C T T C C AAG C AA T T C C AA T GAAAG C-3' (SEQ ID NO: 3)

 The conditions for each reversed phase HPLC were as follows:

Table 5

 Orico "nucleotide" retention time B solution concentration (%) solution column

 H. Vi- (min) (0 min → 20 min)

 X10-Sp25 22.8 0 → 100% 1 A

 X8-Sp25 11.8 0 → 100% 1 A solution 1

A solution 5% acetonitrile / 0.1 MT EAA (pH 7.0) B solution 50% acetonitrile Z 0.1 M TEAA (pH 7.0) Column temperature: 50 degrees

 Column A: I—bonder sphere (C-18) column Φ3.915 mm (Waters)

 X 10 -Sp 25 has an amino group protected by a monomethoxytrityl group (MMT r). A 10% aqueous solution of acetic acid (I mL) was added to the oligonucleotide, and the mixture was treated at room temperature for 5 minutes. The reaction solution was concentrated under reduced pressure, and water was added, and the mixture was azeotroped under reduced pressure. After three azeotropes, the residue was dissolved in 1 mL of sterile water and analyzed by reversed-phase HPLC (Fig. 14b, c). From the above, it can be seen that X 10 — Sp 25 was deprotected under mildly acidic conditions, resulting in the same structure as X 8 — Sp 25 (Fig. 14a).

 All publications, patents and patent applications cited in the present specification are incorporated herein by reference in their entirety. Industrial potential

 The present invention makes it possible to reduce the cost of DNA chips, and is expected to contribute to the widespread use of DNA chips as a means of gene diagnosis technology. Sequence listing free text

SEQ ID NOs: 1-4 Synthetic oligonucleotides

Claims

R 2 Scope of request R c R—— I

 1. One-31 general formula 1:

 B— D— A (1)

 Wherein A represents an oligonucleotide, D represents a divalent organic group having at least one aromatic group, and B represents a reactive functional group or a protected form thereof. Oligonucleotide probe. '

 2. The oligonucleotide probe according to claim 1, wherein the aromatic group is a substituted or unsubstituted monocyclic to pentacyclic aromatic hydrocarbon group.

 3. The oligonucleotide probe according to claim 2, wherein the aromatic group contains a substituted or unsubstituted phenanthrene ring, fluorene ring, naphthalene ring, anthracene ring or pyrene ring.

 4. Claims 1 to 3 wherein D is a linear or branched, substituted or unsubstituted divalent hydrocarbon group optionally containing a heteroatom, and has at least one aromatic group. The oligonucleotide probe according to any one of the above items.

 5. The oligonucleotide probe according to any one of claims 1 to 4, wherein D contains a divalent aromatic group in the main chain.

 6. The oligonucleotide probe according to any one of claims 1 to 4, wherein D has an aromatic group in a side chain.

 7. The oligonucleotide probe according to claim 6, wherein D is represented by the general formula 2:

R ₂ '— 2)

(In the formula, L represents an aromatic group, 1 represents a hydrogen atom or a substituent, and R ₂ , R ₂ ′ and R ₃ each independently may contain a direct bond or a hetero atom. Represents a substituted or unsubstituted divalent hydrocarbon group).

8. R ₂ is of the general formula 3:

One _{R 4 - (CH 2) m} -R 5 - (CH 2) n - (3)

 R

Represented by 2

R ₃ is the general formula 4 R cR—— I. •

 1 ：

 One one

 Three

One (CH ₂ ) _t -R (CH ₂ ) _w- (4)

 Four

Represented by

R ₄ is a direct bond or one (CH ₂ ) i — (〇CH ₂ CH ₂ ) _q —〇, and R ₅ and R ₆ are each independently a direct bond or a group shown below:

 Person o

H N

m and t each independently represent an integer from 0 to 20,

n, w, i, and q each independently represent an integer of 1 to 20,

R ₇ represents a hydrogen atom or a phosphate protecting group,

8. The oligonucleotide probe according to claim 7, wherein:

9. The oligonucleotide probe according to claim 7, wherein L is a substituted or unsubstituted phenanthryl group, fluorenyl group, naphthyl group, anthryl group or pyrenyl group.

 10. The oligonucleotide probe according to any one of claims 1 to 6, wherein D has an additional oligonucleotide on a side chain.

11. The oligonucleotide probe according to claim 5, wherein D is represented by the general formula 2 ′.

Α '

Rn-I (2 ') (Wherein L represents a divalent aromatic grave, represents a hydrogen atom or a substituent, and R ₁₂ , R ₁₃ and R ₁₄ each independently include a direct bond or a heteroatom. Represents a substituted or unsubstituted divalent hydrocarbon group, and A ′ represents a hydroxyl group or an oligonucleotide).

12. A carrier on which the oligonucleotide probe according to any one of claims 1 to 11 is immobilized.

 13. General formula 5:

(In the formula, D ′ represents a divalent organic group having at least one aromatic group, B represents a reactive functional group or a protected form thereof, O represents an oxygen atom, and P represents a phosphorus atom. And R ₈ represents a phosphate protecting group, and shaku ₉ and _1. are organic groups, which may form a ring together with the nitrogen atom to which they are attached.) The compound represented.

 14. The compound according to claim 13, wherein the aromatic group is a substituted or unsubstituted monocyclic to pentacyclic aromatic hydrocarbon group.

 15. The compound according to claim 14, wherein the aromatic group contains a substituted or unsubstituted phenanthrene ring, fluorene ring, naphthalene ring, anthracene ring or pyrene ring.

 16. The method according to any one of claims 13 to 13, wherein D 'is a linear or branched substituted or unsubstituted divalent hydrocarbon group which may contain a heteroatom and has at least one aromatic group. 15. The compound according to any one of the above items 15.

 17. The compound according to any one of claims 13 to 16, wherein D 'contains a divalent aromatic group in the main chain.

18. D ⁵ are compounds according to any one of claims first three terms - a first section 6 having an aromatic group in a side chain.

19. The compound according to claim 18, wherein D 'is represented by the general formula 2.

(Wherein L represents an aromatic group,! ^ Represents a hydrogen atom or a substituent, and R ₂ , R 2 and R ₃ each independently represent a direct bond or a substituent which may contain a hetero atom. Or an unsubstituted divalent hydrocarbon group).

20. R ₂ is of the general formula 3:

One _{R 4 - (CH 2) m} -R 5 - (CH 2) n - (3)

Represented by

R ₃ has the general formula 4:

One (CH ₂ ) _t -R _6- (CH ₂ ) _w — (4)

Represented by

R ₄ is a direct bond or one (CH ₂ ) _; — (O CH ₂ CH ₂ ) _q — O—, and R ₅ and R ₆ are each independently a direct bond or a group shown below:

H-HH ^ II _m A _M

 — N- — O— — C— N— —— N— C— — O-P-O— N N——

 I H H

OR ₇

Represents

m and t each independently represent an integer of 0 to 20;

n, w, i, and q each independently represent an integer of 1 to 20,

R ₇ represents a hydrogen atom or a phosphate protecting group,

10. The compound according to claim 19.

21. The compound according to claim 19 or 20, wherein L is a substituted or unsubstituted phenanthryl group, fluorenyl group, naphthyl group, anthryl group or pyrenyl group. '

22. The compound according to claim 17, wherein D ′ is represented by the general formula 6.

(Wherein, L is a divalent aromatic group, Shakue represents a hydrogen atom or a substituent, R _12, 1 _{1 3} and 1 _{1 4} each independently comprise a direct bond or a hetero atom Represents a substituted or unsubstituted divalent hydrocarbon group, and R ₁₅ represents a hydroxyl-protecting group).