WO2005102039A1

WO2005102039A1 - Human retrovirus-sensitive transgenic nonhuman animal cell and human retrovirus-sensitive transgenic nonhuman animal model

Info

Publication number: WO2005102039A1
Application number: PCT/JP2005/000498
Authority: WO
Inventors: Hisatoshi Shida; Takashi Ohashi; Yoshiyuki Hakata; Ryo Takayanagi
Original assignee: Hokkaido Technology Licensing Office Co., Ltd.
Priority date: 2004-04-20
Filing date: 2005-01-17
Publication date: 2005-11-03
Also published as: WO2005103246A1

Abstract

A transgenic nonhuman animal cell that is highly sensitive to human retroviruses, such as HIV virus and HTLV-1 virus; and a human retrovirus-sensitive transgenic nonhuman animal model. There is provided a human retrovirus-sensitive transgenic nonhuman animal, having human CRM1 gene introduced in form capable of expression. Further, there is provided a human retrovirus-sensitive transgenic nonhuman animal cell, having human CRM1 gene introduced in form capable of expression.

Description

Specification

Human retrovirus-sensitive transgenic non-human animal cells and human retrovirus-sensitive transgenic non-human animal models

Technical field

The present invention has introduced a non-human animal cell with high sensitivity to retroviruses such as human immunodeficiency virus (HIV) and human leukemia virus (HTLV-1) into which the human CRM1 gene has been introduced, and the human CRM1 gene. It relates to a retrovirus-susceptible non-human animal model.

Background art

[0002] Currently, human retrovirus infections are on an expanding trend. For example, the AIDS virus (HIV) has infected a cumulative total of 70 million people, of which 40 million have survived, and last year about 5 million new infections. In particular, infections are rapidly expanding in neighboring countries, such as China and Indonesia, and the number of infected people is increasing in Japan (as it is, it is expected that more than 20 million people will be infected in Asia by 2010). Also, it has become clear that AIDS treatments have shown a life-span effect of several years, but nothing more. Therefore, there is an urgent need to develop new treatments, infection prevention and therapeutic vaccines.

[0003] One of the difficulties in developing vaccines and therapies for human retroviruses such as the human immunodeficiency virus (HIV) is that there is no animal model for infection. Mouse and rat are suitable as model animals because they can breed large numbers and can carry out genetic manipulation. However, HIV does not efficiently infect rodents with a narrow host range. The cause is that rodents lack host factors that support viral infection or that they have inhibitors. As a method for solving this problem, for example, an attempt has been made to create a model animal by transplanting human cells capable of infecting a virus into an immunodeficient mouse.

Since the transplanted cells disappeared in a relatively short period of time and the virus did not infect the model animal itself, it could not be a true model animal.

[0004] Therefore, if a transgenic animal (or knockout / knockdown animal) expressing the above-mentioned factor and expressing the corresponding human factor was prepared, it was expected that a good infected animal would be obtained. [0005] In mice, as a barrier between species for HIV infection,

CD4 and CCR5, human cyclin T1 required for transcription were identified. However, transgenic (Tg) mice expressing them failed to grow HIV. Another human factor is needed. On the other hand, it is reported that the interspecies of rats is less strict than that of mice. In HIV infection, it is reported that CD4 and CCR5 are proliferated, albeit slightly, if they are expressed (Japanese Translation of PCT Application No. 2002-533130). Gazette). It is necessary to grow a sufficient amount of virus in order to use it as a model animal, and it is necessary to create a rat expressing another human factor for sufficient growth. Was.

Disclosure of the invention

Problems to be solved by the invention

An object of the present invention is to provide a transgenic non-human animal cell highly susceptible to a human retrovirus such as an HIV virus or an HTLV-1 virus, and a human retrovirus-sensitive transgenic non-human animal model.

Means for solving the problem

[0007] The present inventors have found that the rat factor rCRMl, which should support the viral regulator Rev required for viral mRNA formation, does not function, which is one of the causes of the inefficiency of HIV proliferation.

[0008] In order for HIV protein enveloping protein, Gag protein, and reverse transcriptase messenger RNA to be transported to the cytoplasm with nuclear power, the virus itself requires the Rev protein encoded by the virus itself. Rev is also needed to carry genomic RNA. Therefore, it is essential that Rev works efficiently in order for the virus to multiply. Rev is known to work in concert with the cellular factor CRM1. CRM1 is a device that transports proteins and RNA to the nuclear cytoplasm, and is an essential factor for the survival of cells that are well preserved in yeast. Regarding CRM1, it has been reported that even the yeast CRM1 supports the function of Rev, and that Rev functions in rat cells (Keppler et al, J. virol. Vol. 75; 8063-8073, 2001).

[0009] Previous reports that Rev works in rat cells used a plasmid consisting of the 3 'half sequence of the HIV genome as a reporter for measuring Rev activity. In contrast, The authors used a plasmid pCRRE A Rev (a structure in which the active Rev could not be expressed by changing the rev sequence of pCRRE in Fig. 1) as a reporter, A certain pSR a Rev was introduced into rat cells, and the activity of Rev was measured. As a result, it was found that Rev did not work in rat cells.

[0010] Thus, the present inventors have found that introduction of human CRMl (hCRMl) into rat cells allows Rev to work efficiently and enhances production of HIV Gag protein. In addition, the present inventors have prepared an ER1 cell line that constitutively expresses hCRMl using the retroviral vector pMX, and transfected these plasmids with the plasmid pNL43-2 capable of producing infectious HIV. The researchers then examined whether infectious progeny viruses could be made and found that rat cells could produce HIV.

[0011] That is, by expressing hCRMl in rat cells that are originally insensitive to retroviruses such as HIV, it has been found that the rat cells become HIV-sensitive and can efficiently produce HIV. Thus, the present invention has been completed.

[0012] The present invention is as follows.

[1] [1] A transgenic non-human animal susceptible to human retrovirus, into which a human CRM1 gene has been introduced so that it can be expressed,

[2] the transgenic non-human animal of [1], wherein the human CRM1 gene contains an untranslated region;

[3] [1] The transgenic non-human animal according to [2], wherein the transgenic non-human animal is infected with a human retrovirus,

[4] Human retrovirus is HIV or HTLV-I [1] to [3]!

[5] the non-human animal is a rodent; [1] to [4], a non-human animal, [6] a non-human animal is a rat, [5] a non-human animal,

[7] A cell isolated from the non-human animal according to any one of [1] to [6], wherein the human CRM1 gene has been introduced so that it can be expressed,

[8] transgenic non-human animal cells susceptible to human retrovirus, transfected with the human CRM1 gene,

[9] Human retrovirus in which the transgenic non-human animal cell of [8] is infected with a human retrovirus Virus infected non-human animal cells,

[10] The non-human animal cell of [9], wherein the human retrovirus is HIV or HTLV-I,

[11] the non-human animal cell according to [9] or [10], wherein the non-human animal is an animal belonging to a rodent;

[12] The non-human animal cell of [11], wherein the non-human animal is a rat, and

[13] A non-human animal according to any one of [1] to [6] or a non-human animal according to any of [7] to [12], wherein the candidate substance is administered to cells, and propagation of the human retrovirus in the cells or animals is performed. A method for screening for a prophylactic agent for human retrovirus infection or a therapeutic agent for human retrovirus infection, comprising determining whether or not the disease is suppressed.

The invention's effect

[0014] The non-human animal cell or transgenic non-human animal model incorporating the human CRM1 gene of the present invention is highly sensitive to retroviruses such as HIV. As shown in the Examples, infectious viruses can grow and provide a viable retroviral hypersensitive non-human animal cell and transgenic non-human animal model that does not exist before. The non-human cells and transgenic non-human animals of the present invention can be used as experimental animals for research on retrovirus infection and the like, and can also be used for screening for retrovirus infection or growth inhibitors.

[0015] This description includes part or all of the contents as disclosed in the description and / or drawings of Japanese Patent Application No. PCT / JP2004 / 005607, which is a priority document of the present application.

Brief Description of Drawings

FIG. 1 is a diagram showing the structure of a reporter used.

FIG. 2A is a view showing enhancement of synthesis of a virus constituent protein by Rev in human cells and rat cells, and is a view showing expression levels of Gag and Env.

FIG. 2B is a photograph showing the result of a Western blot showing the amount of Rev protein in human cells and rat cells.

FIG. 3A is a diagram showing enhancement of Gag production by expressing hCRMl in rat cells, and showing expression of Gag from pCRRE and pdpol.

FIG. 3B is a diagram showing the enhancement of Gag production by expressing hCRMl in rat cells, showing the expression of Gag from pNLe-r-Luc. FIG. 4 is a photograph showing the results of a Western blot of rat cells expressing human CRM1 (ER-1 cells).

FIG. 5 is a view showing production of Gag protein from pNLe-r-Luc introduced into various cells.

FIG. 6 shows the expression of human CRM1 in transgenic rats. Tg rats (N0.6 / T) or normal rats (N0.8 / T) were also extracted from spleen (S), thymus (T), and lung (L) and analyzed by SDS-PAGE for 50 ug of protein per lane. did. After the electrophoresis, the DNA was transferred to a nitrocellulose membrane and subjected to Western blotting using an anti-human CRM1 antibody (ahCRMl) or an anti-rat CRM1 antibody (arCRMl). Arrows indicate CRM1 bands. Jurk indicates the human T cell line Jurkat, and REF5 indicates the rat cell line Ref52.

FIG. 7 is a graph showing the HTLV-1 producing ability of human CRM1-expressing Tg rat-derived T cells. Thymus (Thy) or spleen (Spl) of F344 (Wt) or Tg rat (Tgl8 or Tg27) force.Infect HTLV-1 by co-culture of isolated T cells and mitomycin-treated MT2 cells. And immortalized by culture for about 3 months. lxlO ⁵ cells were cultured for 3 days, and HTLV-1 pl9 protein released into the culture was quantified by ELISA. MT4 indicates HTLV-1-producing human T cells.

BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described in detail.

[0018] In the non-human animal cell with high susceptibility to the human retrovirus of the present invention, the human retrovirus is an RNA virus having a reverse transcriptase and a virus having Rev, which is a regulatory gene that controls own virus growth. For example, HIV, HTLV-1, HTLV-2 and the like can be mentioned.

[0019] Highly sensitive to a retrovirus means that the retrovirus easily invades a cell or that the invading virus can grow in the cell. Normally, human retrovirus does not grow in rodent cells such as rats and mice because the Rev protein does not function. For this reason, rodent cells are insensitive to human retrovirus. Non-human animal cells highly sensitive to the human retrovirus of the present invention can express human CRM1 so that the Rev protein can function. Non-human animals refer to animals other than humans, preferably rodents such as rats, mice and hamsters, and more preferably rats. Cell lines of these animals can be used.Examples of rodent cells include rat cells such as ER-1, Nb2, C58 and Rat2, and mouse cells such as NIH3T3 and EL4. .

[0020] The non-human animal cells highly susceptible to the human retrovirus of the present invention have been introduced so that the human CRM1 gene (hCRMl) can be expressed. CRM1 (Chromosome region maintenance 1, also called exportin 1) is a protein having homology to the importin 13 family one protein reported as a transporter, and is a nuclear exporter that controls nuclear export. The DNA sequence of the human CRM1 gene is shown in SEQ ID NOS: 1 and 5, and the amino acid sequence of the human CRM1 protein is shown in SEQ ID NO: 2. In the present invention, the human CRM1 gene to be introduced into a non-human animal cell so that it can be expressed is hybridized under stringent conditions to DNA having the sequence shown in SEQ ID NO: 1 or DNA complementary to the DNA having the sequence shown in SEQ ID NO: 1. And the encoded protein has the activity of CRM1 protein. Here, the stringent condition means that after performing hybridization at 68 ° C in the presence of 0.7-1.0 M NaCl using a filter on which DNA is immobilized, 0.1- to 2-fold concentration of SSC A condition that can be identified by washing with a solution (1x concentration of SSC consisting of 150 mM NaCl and 15 mM sodium citrate) at 68 ° C. Alternatively, DNA is transferred onto a nitrocellulose membrane by the Southern blotting method, immobilized, and then subjected to hybridization buffer [50% formamide, 4 × SSC, 50 mM HEPES (pH 7.0), 10 × Denhardtz (Denhardt). The DNA of the present invention also includes a DNA capable of forming a hybrid by a 晚 reaction at 42 ° C. in a solution (100 sg / ml salmon sperm DNA).

[0021] Further, among these DNAs, a partial DNA fragment encoding a CRM1 protein fragment having the activity of the CRM1 protein may be used. Examples of the activity of the CRM1 protein include an activity capable of supporting the function of the Rev protein. Whether the DNA to be used has the activity of the protein encoded by the CRM1 protein can be determined, for example, by incorporating the plasmid containing the HIV genome into the appropriate rat ER-1 cells and the DNA encoding the protein to be used. It can be evaluated by using as an index whether or not the HIV Gag protein and Env protein are expressed.

[0022] Non-human animal cells into which the human CRM1 gene has been introduced so that they can be expressed can be obtained by incorporating the human CRM1 gene into an appropriate animal cell expression vector and transfecting the animal cells with the vector. Can be obtained. Vectors that can be used to produce the transfectants of the present invention include DNA viruses or RNA viruses such as detoxified retrovirus, adenovirus, adeno-associated virus, herpes virus, SV40, and immunodeficiency virus (HIV). Are listed. In order to insert the gene of the present invention into a vector, first, the purified DNA is cleaved with an appropriate restriction enzyme, inserted into an appropriate restriction site or a multicloning site of the vector DNA, and ligated to the vector. Adopted. The gene of the present invention needs to be inserted into a vector so that the function of the gene is exhibited. Thus, the vector of the present invention includes, in addition to the promoter and the gene of the present invention, cis elements such as enhancer, if desired, the splice donor site located at the 5 'end of the intron, and the 3' end of the intron. A splice acceptor that is present at the site and contains a splicing signal, a polyA addition signal, a ribosome binding sequence (SD sequence), and the like can be ligated. At this time, the effect of the introduced human CRM1 may not appear due to the dominant inhibitory effect of endogenous rat CRM1. Therefore, human CRM1 may be expressed in such an amount as to cancel the dominant inhibitory effect of rat CRM1. In addition, endogenous rat CRM1 protein may not be expressed.For example, a ribozyme that specifically cleaves rat CRM1 mRNA or a DNA that produces RNAi that renders rat CRM1 mRNA incapable of being introduced into cells. You can. The DNA that produces these RNAs may be introduced into a vector containing the human CRM1 gene! /, And a vector into which the DNAs producing these RNAs have been introduced is separately prepared. Cotransfatate may be added to the cells. In addition, the human CRM1 gene may be linked downstream of the rat endogenous CRM1 gene expression regulatory region.In this case, human CRM1 is expressed in synchronism with rat CRM1 expression, which may adversely affect rat development. It is unlikely that it will be given. Further, the human CRM1 gene may be introduced such that all or a part of the rat CRM1 gene is replaced with the human CRM1 gene. As described above, in order to introduce the human CRM1 gene into a specific position, a gene targeting technique such as a known homologous recombination method may be used. For example, "Gene Targeting", Gene Geneting, written by Shin-ichi Aizawa, Biomedical Series 8, Experimental Medicine Supplement, can be carried out according to the description of sheep and others. Furthermore, a gene encoding a protein that can be a target when human retrovirus invades cells may be introduced. Such a protein Examples of white matter include chemokine receptors such as human CD4 and CCR5. PMX, pSRa, pcDNA3, pcDNAI, pCDM8, pRc / CMV ゝ pRc / RSV, pREP4, pREP7, pREP8, pREP9, pREP10, pCEP4, pCI-neo, pZeoSV ゝ pDEST (Invitrogen, STRATAGENE, etc.) And other commercial vectors can also be used.

[0023] Examples of the method for introducing the thread-recombinant vector into animal cells include a microinjection method, a calcium phosphate method, an electoral poration method, a lipofection method, a particle gun method, and the like.

[0024] The transgenic non-human animal into which the human CRM1 gene has been introduced can be prepared by a known method. For example, it can be prepared according to the description in “New Animal Experiment Course Animal Experiment Method”, edited by The Japanese Biochemical Society, Tokyo Chemical Dojin, 1991.

[0025] Specific methods for producing transgenic animals include pronuclear microinjection (US Patent No. 4,873,191) and retrovirus-mediated gene transfer into the germ line (Van der Putten et al., Proc. Natl. Acad. Sci. USA, 82: 6148, 1985), Gene targeting to embryonic stem cells (Thompson et al., Cell, 56: 313, 1989), Erect-mouth poration of embryos (Lo, Mol. Cell. Biol, 3: 1803, 1983), in vitro somatic cell transformation and subsequent nuclear transfer (Wilmut et al., Nature, 385 (6619): 810-813, 1997; Wakayama et al, Nature, 394: 369-374, 1998) and the like, and the non-human animal model of the present invention can be prepared by these techniques.

[0026] For example, as described above, the human CRM1 gene is incorporated into an appropriate expression vector, and a vector incorporating the gene is constructed. At this time, the human CRM1 gene may be one in which only the coding region is linked to a promoter or the like so that it can be expressed, or a sequence containing the entire control region including the promoter or the like. For example, a sequence containing all or at least the coding region of SEQ ID NO: 1 or 5 may be used. In addition, in order to obtain a human CRM1 gene containing a wide range of control regions, a BAC clone was used to obtain a 100 kb or more BAC clone containing the human CRM1 gene, using an appropriate fragment of the nucleotide sequence of the human CRM1 gene as a probe. The entire sequence contained in the clone may be used. When producing the above transformed cells, DNAs containing these sequences may be used.

[0027] The vector thus obtained is inserted into the male pronucleus or embryo of a fertilized egg of a non-human animal. It may be injected or injected into non-human animal embryonic stem cells (ES cells). The vector may be injected by a microinjection method, an electoral poration method, an HIV vector method, or the like. At this time, as in the case of the gene transfer into the cells described above, a DNA producing ribozyme RNAi may be introduced so as to destroy the mRNA of rat CRM1, and the human retrovirus may enter the cells. A DNA encoding a protein that can be a target at that time may be introduced. The transgenic chimeric non-human animal is produced by implanting the fertilized egg or embryonic stem cell thus obtained into the oviduct of the surrogate mother. By crossing the chimeric animals, transgenic non-human animals homozygous for the human CRM1 gene can be produced.

[0028] Whether the obtained transgenic non-human animal has the human CRM1 gene can be confirmed by Southern blotting or PCR. In addition, when the human CRM1 gene is expressed in a transgenic non-human animal, a retrovirus such as HIV can be infected.Therefore, the retrovirus is directly infected, and the retrovirus multiplies in the cells of the transgenic animal. Make sure that.

[0029] The present invention further relates to a non-human animal cell which has been made susceptible to a human retrovirus by introducing these human CRM1 genes and a virus-infected cell obtained by infecting a non-human animal with the retrovirus. Includes virus-infected animals. The virus-infected animal can be used as a retrovirus-infected animal model, that is, a human retrovirus-infected animal model, when it is infected with a retrovirus and multiplied in the body.

[0030] Using a human CRM1 protein-expressing non-human cell or transgenic non-human animal, a prophylactic agent for retroviral infection and a therapeutic agent for infectious disease, or a substance that suppresses the growth of retrovirus can be screened.

[0031] A candidate substance is administered to the human CRM1 protein-expressing non-human cell or transgenic non-human animal of the present invention, and it is determined whether or not the proliferation of the retrovirus in the cell or animal is suppressed. Good. For example, by measuring the amount of retrovirus, it is possible to screen for a substance that reduces the amount of retrovirus, ie, a prophylactic and / or therapeutic agent for retroviral infection or a substance that suppresses the growth of retrovirus. At this time, the retrovirus may be infected before administering the candidate substance to the animal cells or animals to be used. Alternatively, it may be infected after administration.

Example

Next, the present invention will be described specifically with reference to examples.

Example 1 Enhancement of synthesis of virus-constituting proteins by Rev in human cells and rat cells In order to examine the efficiency of Rev to produce Gag and Env proteins in rat cells, lxlO ⁶ cells / well in a ^6-well plate were examined. Human CD4-HeLa or rat ERlneol cells were wound and cultured at 37 ° C for 1 hour. 1.4 g of pCRRE A Rev (see Mann DA et al., J. Mol. Biol. Vol. 241, 193-207, 1994) and various amounts of pSR a Rev (Hakata et al.) As shown in FIG. , J. Virol. Vol. 76 8079-8089, 2002) was introduced using the Transfection Reagent LT1. In addition, pHl-Luc (a plasmid with a luciferase gene linked downstream of the LTR of HIV, to correct errors due to variations in transfection efficiency by measuring Rev-independent expression, Tokushima University 0.2 g) (provided by Dr. Akio Adachi) was added to all samples. The total plasmid amount was adjusted to 2 μg with pSRa296. Two days later, the medium was collected, and the amount of Gag was measured by ELISA (using RETROtek manufactured by ZeptoMetrix). The cells were collected in 0.1 ml of CAT ELISA lysis buffer (Boehringer), and the amount of Env was measured by ELISA (see Hakata et al J. Virol. Vol. 72 6602-6607, 1998). In addition, the luciferase activity in the cells was measured using a Noreminometer (ArvoSX, manufactured by Wallac) using a Steady Glo luciferase assay system (manufactured by Promega). The results are shown in FIG. 2A. In FIG. 2A, the value obtained by dividing the amount of Gag and Env by the luciferase activity was used as the Y axis of the graph. The value of a sample obtained by transfection of 0.1 μg of pSR a Rev was 100 / !. When Rev was not present in both human CD4-HeLa and rat ER1 cells, little Gag or Env protein was produced. Therefore, when pSR a Rev, a Rev expression plasmid, was introduced by transfection, CD4-HeLa was able to synthesize a large amount of both Gag and Env with a plasmid amount of 0.025 μg or more. On the other hand, in ER1 cells, production of these proteins was observed, but was about 1/100 of that of CD4-HeLa.

[0034] Furthermore, in order to measure the amount of Rev protein, a cell lysate containing an equal amount of luciferase activity (containing about 10 µg of protein) was electrophoresed on a 12% SDS-polyacrylamide gel. Anti-Rev antibody (see Hakata et al., J. Virol. Vol. 76 8079-8089, 2002) Was analyzed by Western blotting (Fig. 2B). As shown in Fig. 2B, when the same amount of pSR a Rev was transfected, the amount of Rev in ER1 cells was smaller than that of CD4-HeLa, but the amount of Rev when g pSR a Rev was transfected to ER1. Production was greater than with 0.025 μg transfection on CD4-HeLa. However, the production of Gag and Env was higher in CD4-HeLa. This indicates that Rev works efficiently in rat cells! / ヽ

Example 2 Enhancement of Gag Production by Expressing hCRMl in Rat Cells

LxlO in a ^6-well plate For ⁶ CD4-HeLa or ER1 cells, add 1.2 μg of pCRRE or pdeltapol (indicated as pdpol in the figure) to 0.2 μg of pHlluc and various amounts of pSR a hCRMl or pSR a rCRMl And cotransfection by the method of Example 1. Two days later, Gag in the medium and luciferase activity in the cells were measured. The results are shown in FIG. 3A. In FIG. 3A, the value of Gag / Luc is plotted assuming that the value of the sample without pSR ahCRM1 is 1, as shown in FIG.

[0036] ER1 cells were cotransfected with 1.2 µg of pNLe-r-Luc and 0.2 µg of pHlluc and various amounts of pSR ahCRMl or pSR a rCRMl in the above method. Two days later, Gag in the medium and luciferase activity in the cells were measured. Gag / Luc values were plotted with the value of the sample to which pSR a hCRMl was not added as 1. The results are shown in FIG. 3B.

[0037] As shown in Fig. 3A and Fig. 3B, introduction of hCRMl into ER1 cells increased the amount of Gag by 5 to 10 times using any of the reporters. On the other hand, the introduction of rCRMl did not change much. The introduction of hCRMl into CD4-HeLa also did not increase Gag production. This may be due to a sufficient amount of endogenous hCRMl. These results indicate that transfection of hCRMl into rat cells enabled Rev to work efficiently and enhanced Gag protein production.

Example 3 Generation of Human CRM1-Expressing Rat Cells (ER-1 Cells)

Construction of retro vector expressing human hCRMl

By cutting pSR a hCRMl with AaTII and Xhol, 4/5 portion of the 3 'side of hCRMl cDNA was cut out. pSR a hCRMl was made into type III, and PCR was carried out using ccgaattctctctggtaatctatgccagcaa (SEQ ID NO: 3) and caagttgggtcagatgacgtctt (SEQ ID NO: 4) as primers to amplify the 1/5 part of the hCRMl cDNA on the 5 'side. It was cut with EcoRI and AaTII to give cohesive ends. pMXneo (Tokyo University (Graduated by Dr. Toshio Kitamura) was cut with EcoRI and Xhol to isolate a 6 kb fragment on agarose gel. These three were ligated to construct pMXneohCRMl. Next, pMXneohCRMl was transfected into the Plat-E cells, which are packaging cells, using Fugene 6.After 2 days, the culture solution was collected, and the supernatant obtained by centrifugation at 3,000 rpm for 15 minutes was used as the hCRMl-introduced retrovector (vMXneohCRMl). Was.

[0039] Construction of hCRMl-expressing ER1 cells

lxlO to ^five ER1 cells vMXneohCRMl solution 0. ⁵ ml were infected in the presence 10 mu g / ml Poripuren (polybrene). VMXneo was used as a control. G418 resistant cells were selected by culturing the cells in the presence of 300 g / ml G418. There is also a cell clone (ERlhcrml (7) -4).

[0040] Output of hCRMl

Anti-hCRMl antibody (see Hakata et al., J. Virol. Vol. 75: 11515-11525 2001), after cell extraction containing approximately 10 μg of protein was separated by 8% SDS-polyacrylamide gel electrophoresis. Was detected by Western blotting. The hen KJurkat cell extract was used for comparison.

FIG. 4 shows the results. As shown in FIG. 4, these strains expressed both rCRMl and hCRMl.

Example 4 Production of Gag protein from pNLe-r-Luc introduced into various cells

2 μg of the plasmid pNLe-r-Luc having an HIV-like genome was transfused into human HeLa cells, rat ER-1 cells, and human CRM1 expressing ER-1 cells using LT1. Two days later, Gagp24 released into the culture was measured by ELISA. Figure 5 shows the results. As shown in FIG. 5, these cells produced 50-70 Gag when the HeLa cells were taken as 100.

Example 5 Production of Infectious HIV in Various Cells

Plasmid containing full-length HIV genome in various cells 0.5 μg of pNL43-2 (Adachi A et al., J Virol. Vol. 59: 284-291, 1986) and 0.05 μg of pHl—Luc to lipofectamine plus (Invitrogen Co.). Two days later, 25 μl of TZM-bl cells (5-10 ⁴ cells / 24 well plate) (Derdeyn CA et al., J. Virol. Vol. 74: 8358- 8367, 2000) in the presence of 40 μg / ml DEAE dextran. Two hours later, the medium was added, and after culturing for another two days, the luciferase activity was measured. This value is called infectivity did. On the other hand, luciferase activity in the cells was measured in order to standardize the transfetate efficiency.

Table 1 shows the results. As shown in Table 1, ER-1 cells expressing hCRM were found to be capable of producing 60-75% of HIV from HeLa cells. These results indicate that expression of hCRMl allows rat cells to efficiently produce HIV, and that transgenic (Tg) rats expressing the human counterpart hCRMl are good animal models for infection. Show that.

[Table 1] Production of infectious HIV in various cells

Production of infectious HIV in rat cells

Cells Infectivity / Luc

HeLa 100%

ER1 6.8

ERlneol 6.7

ERlhcrml⑦ 4 24

ERlhcrml 2 75

ERlhcrml 4 61

Example 6 Production of Trans CRM Rats Expressing Human CRM1

(1) Production of hCRMl transgenic (Tg) rat

In order to obtain a BAC clone containing the entire coding region and expression control region of hcrml, a human BAC library (Genome Systems From the company). The resulting clone contained a human genomic region of about 150 kb. The rudimentary analysis revealed that at least 70 kb of DNA was present upstream of the 5 'probe and at least 6 kb downstream of the 3' probe. From this, it was considered that this BAC clone sufficiently contained the structural gene and the regulatory gene of hcrml! /.

[0046] This BAC was microinjected into about 400 fertilized eggs of rat F344 (obtained from Wyeth Laboratories). Exceeded. Analysis of approximately 50 born rats revealed that two had the complete hcrml genome. One of the hcrml genomes was inherited by offspring. This Tg rat

It was named F344 / DuCrj-Tg (hCRMl) lHik. Analysis of Tg rats was performed by the following method. That is, the tail DNA of 50 born rats was extracted, and the presence of the human crml genome was confirmed by PCR using primers specific to the human crml genome. The primers used were the following two sets.

[0047] Forward / 5,-TTATGTGGCTGCAGTTGTGAA-3, (SEQ ID NO: 6)

Reverse / 5, -ACATACCAGGGTTCTCTGGA-3, (SEQ ID NO: 7), and

Forward / 5'-GTCACCTGATGTCGGGAGTT-3 '(SEQ ID NO: 8)

Reverse / 5 '-GGATTACAGGTGTGAGCCAC-3' (SEQ ID NO: 9)

(2) hCRMl protein expression

The spleen, thymus, and lungs of this Tg rat and a normal F344 rat were removed, and the expression of hCRMl and endogenous rCRMl was examined by Western blotting. As a result, both CRMs 1 were highly expressed in the thymus (Fig. 6). In FIG. 6, spleen (S), thymus (T) and lung (L) were excised from Tg rat (No. 6 / T) or normal rat (No. 8 / T), and 50 g of protein per lane was analyzed by SDS. -PAGE analysis. After the electrophoresis, the DNA was transferred to a nitrocellulose membrane and subjected to Western blotting using an anti-human CRM1 antibody (ahCRMl) or an anti-rat CRM1 antibody (arCRMl). An anti-human rat CRM1 antibody was prepared by binding human CRM1 peptide ¹⁰²⁴ EFAGEDTSDLFLEEREIALR 1 ^M3 (SEQ ID NO: 10) to a carrier protein (KLH) and immunizing -PET. (Obtained from Iwaki Glass Co., Ltd.). The anti-rat CRM1 antibody is peptide ^{1 of} rat CRM1. ⁴ ° TALRQAQEEKHKLQMSVP ^{1 () 57} (SEQ ID NO: 11) was conjugated to a carrier protein (KLH) and prepared by immunizing a egret. In FIG. 6, arrows indicate bands of CRM1. Jurk indicates human T cell line Jurkat, REF5 indicates rat cell line Ref52. Because the spleen has many resting lymphocytes and the thymus contains many proliferating immature lymphocytes, this result suggests that hCRMl is weakly expressed in quiescent human peripheral lymphocytes and in activated lymphocytes. This is consistent with high expression. Therefore, it was suggested that hCRMl was expressed in the present Tg rat in the same manner as in the natural state.

(3) Proliferation of HTLV-1 in T cells derived from Tg rats Tg rats and spleen or thymus gland from normal rats are also isolated from T cells and co-cultured with mitomycin-treated ΜΤ2 cells (human ΤLV-1 cell line that produces HTLV-1). Infected. The cells were immortalized by HTLV-1 after continued culture. The amount of HTLV-1 antigen ρ19 produced was measured by ELISA (FIG. 7). In Fig. 7, HTLV-1 was obtained by co-culture of T cells isolated from thymus (Thy) or spleen (Spl) of F344 (Wt) or Tg rat (Tgl8 or Tg27) and MT2 cells treated with mitomycin. Infected and immortalized by approximately 3 months of culture. HTLV-1 pl9 protein released into the culture medium after culturing 1 × 10 ⁵ cells for 3 days was quantified by ELISA. In FIG. 7, MT4 represents HTLV-1-producing human T cells. Normally, rat-derived T cells did not produce any force 19. On the other hand, T cells derived from Tg rats usually produced HTLV-1 more than 100 times higher than rat T cells. In addition, they produced more HTLV-1 than MT4 cells, which are typical human T cells that produce HTLV-1. This result predicts that HIV will grow efficiently in the Tg rats of the present invention.

All publications cited herein are hereby incorporated by reference in their entirety. It will be readily understood by those skilled in the art that various modifications and alterations of the present invention are possible without departing from the technical concept and the scope of the invention described in the appended claims. The present invention is intended to cover such modifications and variations.

Claims

The scope of the claims

[I] A transgenic non-human animal susceptible to human retrovirus, into which the human CRM1 gene has been introduced so that it can be expressed.

[2] The transgenic non-human animal according to claim 1, wherein the human CRM1 gene contains a non-translated region.

[3] A human retrovirus-infected non-human animal obtained by infecting the transgenic non-human animal according to claim 1 or 2 with a human retrovirus.

[4] The non-human animal according to any one of [1] to [3], wherein the human retrovirus is HIV or HTLV-I.

[5] The non-human animal according to any one of claims 1 to 4, wherein the non-human animal is an animal belonging to a rodent.

[6] The non-human animal according to claim 5, wherein the non-human animal is a rat.

[7] A human retrovirus-sensitive cell, isolated from the non-human animal according to any one of claims 1 to 6, into which a human CRM1 gene has been introduced so that it can be expressed.

[8] Transgenic non-human animal cells susceptible to human retrovirus, into which human CRM1 gene has been introduced so that it can be expressed.

[9] A human retrovirus-infected non-human animal cell obtained by infecting the transgenic non-human animal cell according to claim 8 with a human retrovirus.

[10] The non-human animal cell according to claim 9, wherein the human retrovirus is HIV or HTLV-I.

[II] The non-human animal cell according to claim 9 or 10, wherein the non-human animal is an animal belonging to a rodent.

[12] The non-human animal cell according to claim 11, wherein the non-human animal is a rat.

[13] The non-human animal according to any one of claims 1 to 6, or any one of claims 7 to 12

The method according to claim 1, comprising administering the candidate substance to the non-human animal cell and determining whether the growth of the human retrovirus in the cell or the animal is suppressed or not. A method for screening a therapeutic agent for retroviral infection.