WO2005097991A1

WO2005097991A1 - Rna sequence, rna and dna construction, pharmaceutical composition that inhibits the proliferation of the virus that causes type c hepatitis (hcv), and applications thereof

Info

Publication number: WO2005097991A1
Application number: PCT/ES2005/070034
Authority: WO
Inventors: Cristina ROMERO LÓPEZ; Alicia Barroso Del Jesus; Elena PUERTA FERNÁNDEZ; Alfredo Berzal Herranz
Original assignee: Consejo Superior De Investigaciones Científicas
Priority date: 2004-03-25
Filing date: 2005-03-23
Publication date: 2005-10-20
Also published as: ES2270656B1; ES2270656A1

Abstract

The invention relates to: an RNA sequence that inhibits the replication of the HCV virus by binding to the IRES region, RNA and DNA constructions, pharmaceutical compositions containing same, and the application thereof in methods for the prevention and treatment of infections caused, in particular, by the HCV. The aforementioned RNA sequences are advantageous in that it is a product that is synthesised naturally by cells and, as such, does not produce any type of toxic effect. In addition, the fact that the IRES region is highly conserved between the different HCV strains makes possible the development of more effective therapeutic tools against said viruses which have a good mutagenesis capacity, thereby enabling same to evade antiviral treatments.

Description

RNA SEQUENCE, RNA AND DNA CONSTRUCTION, AND INHIBITING PHARMACEUTICAL COMPOSITION OF THE PROLIFERATION OF THE VIRUS CAUSING THE TYPE C HEPATITIS (HCV), AND ITS APPLICATIONS

TECHNICAL SECTOR The invention provides new products for the specific inhibition of HCV IRES and consequently has a high incidence in the areas of Biomedicine, Human and Animal Health, as well as Basic Research and Biotechnology due to the possibility of the development of modulation systems of the gene expression of industrial, agri-food interest, etc., controlled by the activity of IRES. Of the possible applications, the most immediate may be the use as therapeutic agents against HCV infection, although it has additional projections for use as inhibitors of other viruses of interest in livestock and agricultural holdings.

STATE OF THE TECHNIQUE Hepatitis C virus (HCV) is primarily responsible for hepatitis of post-transfusion origin. Chronic infection with this virus is a progressive disease that can lead to liver cirrhosis and hepatocellular carcinoma (Seef, 1997. Natural History of hepatitis C. Hepatology 26, Supp. 1, 21-28). It is the main cause of liver diseases in the world, with more than 170 million infected, most of them are in Afrecha and Asia, and affects 2% of the population of the western world (WHO report, 2000 www. cdc.gov). There is no vaccine for this disease and the therapeutic agent that offers the best results is interferon alpha (non-specific antiviral agent) used in combination with ribavirin, but the efficacy of these current treatments is low, achieving only lower overall maintained response rates. 50%, being especially low for patients infected with HCV genotype 1b (McHutchinson et al., 1998. Interferon alpha-2b alone or in combination with ribavirin as initial treatment for chronic hepatitis C. N England J Med 339, 1485-1492; Neumann et al., 1998. Hepatitis C viral dynamics in vivo and the antiviral efficacy of interferon-alpha therapy Science 282, 103-107; Poynard et al., 1998. Randomized trial of interferon alpha2b plus ribavirin for 48 weeks or for 24 weeks versus interferon alpha2b plus placebo for 48 weeks for treatment of chronic infection with hepatitis C virus. International Hepatitis Interventional Therapy Group (IHIT). Lancet 352, 1426-1432). The virus genome consists of a positively polar RNA molecule of 9,400 nucleotides. This RNA is in turn genome and messenger of the virus being translated in one of the earliest stages of viral infection, to a single polyprotein, which is subsequently processed by the action of viral and cellular proteases. At the 5 'end of the viral genome there is a 341 nucleotide region that is not coding (Purcell, 1997. The hepatitis C: Overview. Hepatology 26, Supp. 1, 11-14). This region precedes the open reading pattern of the viral polyprotein, and is sufficient to direct its translation in a manner independent of Cap, indicating that in this region there is an internal ribosome entry site, known as IRES (" internal ribosome entry site ") that extends up to 30 nucleotides in 3 'of the initiation codon (Wang et al., 1993. Translation of human hepatitis C RNA virus in cultured cells is mediated by an internal ribosome-binding mechanism. J. Viral 67, 3338-3344; Reynols et al., 1995. Unique features of internal initiation of hepatitis C virus RNA translation. EMBO J. 14, 6010-6020). Like other RNA viruses, HCV has great gene variability, the 5 'non-coding region being the most conserved genome. In turn, this region has a complex and especially stable structure that is essential for its biological function, and therefore for the viability of the virus. The structure consists of four double-chain domains closed by single-chain fragments (stem-loop structures I to IV in fig. 1; Gallego and Varini, 2002. The hepatitis C virus internal ribosome-entry site: a new target for antiviral research, Biochemical Society Transactions 30, 140-145); tertiary interactions that define other structural motifs have also been identified (Lyons et al., 2001. Hepatitis C virus internal ribosome entry site RNA contains a tertiary structural element in a functional domain of stem-loop II. 29, 2535-2541; Spahn et al., 2001. Hepatitis C virus IRES RNA-induced changes in the conformation of the 40S ribosomal subunit. Science 291, 1959-1962). In the Figure 1 shows a schematic representation of the secondary and tertiary structures proposed for the IRES domain of HCV. The different domains and subdomains are identified by I, II, Illa, b, c, d, e, f and IV. AUG represents the translation initiation site (Figure adapted from Honda et al., 1999. Natural variation in translational activities of the 5 'nontranslated RNAs of hepatitis C virus genotypes 1a and 1b: evidence for a long-range RNA-RNA interaction outside of the internal ribosomal entry site. J. Viral 73, 4941-51). The lack of efficiency of currently available therapies necessitates the development of new antiviral strategies, on the one hand we are working on the development of drugs that act on the essential activities of the life cycle of the virus (viral proteases, helicase, polymerase) and on the other in the development of strategies that allow direct action on the viral genome. In recent years, several works have been published that describe the use of nucleic acids as viral inhibitors: 1.- Antisense oligonucleotides, there is a patent application for the design, synthesis and use of antisense oligonucleotides as inhibitors of hepatitis virus activity C. (Anderson, KP; Hanecak, RC, Nozaki, C, Dorr, FA, Kwoh, TJ Compositions and methods for treatment of hepatitis C virus-associated diseases. US Patent Application, September 11, 2003). Antisense oligonucleotides are defined as nucleic acids of variable length and sequence perfectly complementary to the target (DNA or RNA) against which they are directed. 2.- Ribozymes: They are RNA molecules endowed with catalytic activity (Welch et al., 1996. A potential therapeutic application of hairpin ribozymes: in vitro and in vivo studies of gene therapy for hepatitis C virus infection. Gene Therapy 3, 994- 1001; Sakamoto et al., 1996. Intracellular cleavage of hepatitis C virus RNA and inhibition of viral protein translation by hammerhead ribozymes. J Clin. Invest. 98, 2720-2728; Lieber et al., 1996. Elimination of hepatitis C virus RNA in infected human hepatocytes by adenovirus-mediated expression of ribozymes. J. Viral. 70, 8782-8791; Macejak et al., 2000. Inhibition of hepatitis C virus (HCV) -RNA-dependent translation and replication of a chimeric HCV poliovirus using synthetic stabilized ribozymes Hepatology 31, 769-776), in all these works the capacity of certain RNA molecules cut other RNA molecules or targets thereof. 3.- Atamers: Nucleic acids that are capable of efficiently binding to another molecule, either a nucleic acid, protein, etc., and whose activity is determined by their structure and the presence of specific nucleotides at specific positions through which is carried out the interaction with the target. Recently, the use of RNA aptamers that specifically bind to IRES domain II of HCV has been published (Kikuchi, et al., 2003. RNA aptamers targeted to domain II of Hepatitis C virus IRES that bind to its apical loop region. J Biochem. 133, 263-270). These strategies have been combined with the inclusion of chemical modifications in RNA molecules that give them greater stability and thus greater efficiency. There is a patent for a product that acts as an HCV inhibitor consisting of an RNA molecule that carries a ribozyme directed against the IRES region and a second domain that specifically binds to the NS3 viral protease (Nishikawa, R., Fukuda, K ., Nishikawa, F., Uragami, S. and Funaji, K. RNA molecule targeting IRES and NS3 protease of hepatitis C virus. JP2002165594. June 11, 2002). Current interferon strategies aimed at curbing HCV infection have proved ineffective. They are tremendously aggressive treatments for the patient because of the side effects they entail, they are also very expensive for health, which has driven the need to develop alternative treatments. In the context of the use of nucleic acids as HCV inhibitors, the present invention is framed, RNA molecules selected for specific binding to the IRES region of the virus, and which specifically inhibit its activity and consequently viral translation. These molecules have a defined structure necessary for their activity and require the presence of a series of nucleotides in specific positions. DESCRIPTION OF THE INVENTION

- Brief description The invention provides an RNA sequence inhibiting the replication of the HCV virus by its binding to the IRES region, as well as RNA constructs that contain it, DNA constructs that allow the expression of said RNA sequence, pharmaceutical compositions that they contain them, and their application in procedures of prevention and treatment of infections produced, preferably by HCV. The advantage of such RNA sequences is that it is a product that synthesizes cells naturally, so no toxic effect is expected due to their administration for non-infected cells that will eliminate them like any other RNA derived from their own gene activity In addition, the fact that this IRES region is highly conserved among the different strains of HCV, as well as in other related viruses, for example, bovine diarrhea virus or even classical swine fever, will allow the development of more effective therapeutic tools against these viruses that have a high capacity for mutagenesis, which allow them to escape antiviral treatments.

- DETAILED DESCRIPTION OF THE INVENTION The invention faces the problem of providing new effective and safe pharmaceutical compounds against the virus causing hepatitis C (HCV). The solution provided by this invention is based on the fact that the inventors have observed that inhibition of HCV replication is possible through the use of a specific sequence RNA molecule that specifically binds to highly conserved regions of the 5 'non-translatable domain of the virus genome, the IRES region of HCV involved in the onset of translation. This RNA sequence can be used, for example, for therapeutic purposes, for example, as a therapeutic compound in the preparation of pharmaceutical compositions to protect mammals, preferably humans, from infection caused by viruses, preferably HCV. The RNA inhibitor sequences of the present invention, of approximately 25 nucleotides in length, they have been specifically selected for their binding to the IRES region of HCV, and have been shown to block or inhibit the biological activity of the virus and consequently its ability to proliferate. On the other hand, they have the advantage that being RNA molecules is a product that synthesizes cells naturally, so no type of toxic effect is anticipated for non-infected cells that will eliminate them like any other RNA derived from Your own gene activity. In addition, the fact that this IRES region is highly conserved among the different strains of HCV (Martell et al., 1992. Hepatitis C virus (HCV) circulates as a population of different but closely related genomes: quasispecies nature of HCV genome distribution. J Viral, 66 (5): 3225-9) as well as in other related viruses, for example, bovine diarrhea virus or even classical swine fever, allows, on the one hand, the development of more effective therapeutic tools against these viruses that have a high capacity for mutagenesis, which allow them to escape antiviral treatments; and on the other hand, these sequences will be useful in pharmacology for use as serial heads for the development of new antivirals against HCV or other viruses that share with the HCV the existence of an IRES region essential for its viability (Brown et al ., 1992. Secondary structure of the 5 'nontranslated regions of hepatitis C virus and pestivirus genomic RNAs. Nucleic Acids Res. 20 (19): 5041-5). Similarly, the products described in the invention may be used to block the activity of HCV IRES in applications of biotechnological interest, or basic research, processes in which a gene of interest is expressed under the control of IRES. Accordingly, an object of the present invention is an RNA sequence (also called aptamer) inhibiting the proliferation of the virus causing hepatitis C (HCV), hereinafter RNA sequence of the invention, characterized in that it is constituted by an RNA sequence that specifically binds to regions of the 5 'non-translatable domain of the virus genome, the IRES (Intemal Ribosome Entry Site) region of HCV and because it is forming a structure defined by a double-chain region that exposes nucleotides single chain RNA, through which it specifically binds to the RNA of the IRES region of HCV. The term "HCV", as used in the present invention, refers to the different strains of HCV belonging to any of the genotypes (by way of illustration, see Simmonds, P. 1993. Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS-5 region. J Gen Viral. 74 (11): 2391-9). It also refers to the quasi-species that infects an individual (Martell et al., 1992. Hepatitis C virus (HCV) circulates as a population of different but closely related genomes: quasispecies natura of HCV genome distribution. J Viral, 66 (5 ): 3225-9). As used in the present invention, the term "IRES" refers to the HCV RNA sequence (NC_004102), as well as sequences with this same function (Gallego, J. 2002. Intemal initiation of translation by viral and cellular IRESs : a new avenue for specific inhibition of protein synthesis? Curr Opin Drug Discov Devel. 5 (5): 777-84). A particular object of the present invention is the RNA sequence of the invention characterized in that it belongs, among others, to one of the following families of defined sequences based on consensus domains of the defined IRES binding sequence:

Family 1: 5 '(N) _m X _k CCAACX _z (N) _p 3'

Family 2: 5 '(N) _m X _k UAUGGCUX _z (N) _p 3'

Family 3: 5 '(N) _m X _k CCACGXz (N) _p 3'

Family 4: 5 '(N) _m X _k RUUCGYRAX _z (N) _p 3'

Family 5: 5 '(N) _m X _k CUYGUUYX _{z (} N) _p 3'

Family 6: 5 '(N) _m X _k UYRUGGX _z (N) _p 3'

Family 7: 5 'N) _m X _k YGAGACYX _z (N) _p 3'

Family 8: 5 '(N) _m X _k AUUAGX _z (N) _p 3'

Family 9: 5 '(N) _m X _k AUUCAGX _z (N) _p 3'

Where: A, Adenine C, Cytosine G, Guanine U, Uracil N and X is any nucleotide R, purine nucleotide (Adenine or Guanine) Y, pyrimidine nucleotide (Cytosine or Uracil) m, p, k and z any integer from 0 onwards. The sequences (N), of length m in 5 'will interact with the sequences (N) of length p in 3' forming a double-chain region (not necessarily perfect) that exposes the consensus sequences of each One of the groups.

On the other hand, particular embodiments of the RNA sequence of the invention are part of the invention, belonging to one of the previous families, belong, among others, for illustrative purposes and without limiting the scope of the present invention, to the following group:

and, more preferably, to the following group:

Another object of the present invention is an RNA construct, hereinafter referred to as the RNA construct of the invention, characterized in that it is constituted in addition to the IRES binding RNA sequence of the invention itself by a nucleotide sequence that allows the addition or Increase in the inhibitory activity of HCV replication of the RNA sequence of the invention. As referred to in the present invention, the term "genetic construction of RNA" refers, among other possibilities, by way of illustration and without limiting the scope of the present invention, to constructions containing, in addition to the RNA sequence of the invention. , an antisense oligonucleotide (Anderson, KP; Hanecak, RC, Nozaki, C, Dorr, FA, Kwoh, TJ Compositions and methods for treatment of hepatitis C virus-associated diseases. US Patent Application, September 11, 2003), a ribozyme ( Welch et al., 1996. A potential therapeutic application of hairpin ribozymes: in vitro and in vivo studies of gene therapy for hepatitis C virus infection. Gene Therapy 3, 994-1001; Sakamoto et al., 1996. Intracellular cleavage of hepatitis C RNA virus and inhibition of viral protein translation by hammerhead ribozymes. J Clin. Invest. 98, 2720-2728; Lieber et al., 1996. Elimination of hepatitis C RNA virus in infected human hepatocytes by adenovirus-mediated expression of rib ozymes J. Viral. 70, 8782-8791; Macejak et al., 2000. Inhibition of hepatitis C virus (HCV) -RNA-dependent translation and replication of a chimeric HCV poliovirus using synthetic stabilized ribozymes. Hepatology 31, 769-776) or an aptamer (Kikuchi, et al., 2003. RNA aptamers targeted to domain II of Hepatitis C virus IRES that bind to its apical loop region. J. Biochem. 133, 263-270). A particular embodiment of the present invention is an RNA construct of the invention consisting of the RNA sequence of the invention and ribozyme 363 (see Example 2) capable of inhibiting the translation of HCV and belonging, among others, to the following group : RNA sequence HH 363-24, HH 363-31, HH 363-16, HH 363-10, HH 363-50, HH 363-17 and HH 363-18, encoded by the DNA sequences SEQ ID NO 60, 61, 62, 63, 64, 65 and 66, respectively. Likewise, RNA sequences can be made that are constituted or that comprise more than one of the RNA sequences of the invention in such a way that the ability to inhibit the replication of the virus from all of them is added. Accordingly, another particular object of the invention is an RNA construct of the invention characterized in that it is constituted by, or because it contains, any one of the possible combinations of two or more IRES binding RNA sequences of the present invention with a binding domain or not between said sequences. In addition, any of the RNA sequences and constructions of the invention described above that are subject to modifications, preferably chemical, leading to greater stability against the action of ribonucleases and thereby greater efficiency, form part of the present invention. without supposing the alteration of its mechanism of action that is the specific union to the IRES. As used herein, the term "chemical modifications" refers to the introduction of chemically modified nucleotides into the RNA sequence of the invention, for example, S groups replacing O in the phosphodiester chain, or the inclusion of 5 methylcytosines. , which allow to increase the efficiency of the same (to confer greater resistance against degradation, to favor its entry into the cells, etc.), as well as any modification in the pentose or in the nitrogen base (Brown and Brown, 1991. Modern machine-aided methods of oligodeoxyribonucleotide synthesis, in Oligonucleotides and Analogues: a practical approach.pag 1-48; Heidenreich et al., 1993. Chemically modified RNA: approaches and applications.Faseb J. 7 (1): 90-6; Usman and Cedergren, 1992 Exploiting the chemical synthesis of RNA Trends Biochem Sci. 17 (9): 334-9). The preparation of the RNA sequence of the invention is easy for a person skilled in the art, it can be done by chemical synthesis which also allows the incorporation of chemical modifications both in the different nucleotides of the product and the incorporation of other chemical compounds in any of the extremes. The synthesis can also be done enzymatically using any of the available RNA polymerases.

(Struhl et al., 2002. DNA-dependent RNA polymerases. 1: 3, 3.8.2). Enzymatic synthesis also allows some chemical modification of the products or

RNAs inhibitors (Theissen G et al. 1989. Degree of biotinylation in nucleic acids estimated by a gel retardation assay. Anal Biochem. 179 (1): 98-10). Another object of the present invention is a genetic DNA construct, hereinafter referred to as a genetic DNA construct of the invention, characterized in that it allows in vitro or intracellular transcription of the RNA sequence or RNA construct of the invention and because it is constituted by a of the sequences belonging to the following group: a) DNA nucleotide sequence, preferably double stranded, comprising at least the sequence coding for the RNA sequence or the RNA construct of the invention for in vitro transcription, and, b) DNA nucleotide sequence, preferably double stranded, characterized in that it is a gene expression system or vector comprising the coding sequence of the RNA sequence of the invention with at least one promoter that directs the transcription of said nucleotide sequence of interest, to which it is operatively linked, and other sequences necessary or appropriate for the transcription and its appropriate regulation in time and place, for example, start and end signals, cut sites, polyadenylation signal, origin of replication, transcriptional activators (enhancers), transcriptional silencers (silencers), etc. Examples of appropriate expression vectors can be selected according to the conditions and needs of each particular case among bacterial plasmids or eukaryotic expression (eg pcDNA3), bacmids, artificial yeast chromosomes (YACs), artificial bacterial chromosomes (BACs), artificial chromosomes based on bacteriophage P1 (PACs), cosmids, or viruses, which may also contain an origin of bacterial or yeast replication so that it can be amplified in bacteria or yeasts, as well as a usable marker to select transfected cells different from the gene or genes of interest. Multiple of these systems or expression vectors can be obtained by conventional methods known to those skilled in the art [Sambrook, J., Fritsch, EF, and Maniatis, T. (1989). Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory] and are part of the present invention]. A particular embodiment of the present invention is the DNA construction of the present invention characterized in that it is a coding sequence of an RNA sequence of the invention (item a) above, belonging, inter alia, by way of illustration and without limiting the Scope of the invention, to the following group (see Example 1): SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55, SEQ ID NO 56, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59. Other Particular embodiment of the present invention is the DNA construct of the present invention characterized in that it is a coding sequence of an RNA construct of the invention (item a) above), inter alia, by way of illustration and without limiting the scope of the invention, to the following group (see Example 2): SEQ ID NO 60, SEQ ID NO 61, SEQ ID NO 62, SEQ ID NO 63, SEQ ID NO 64, SEQ ID NO 65, SEQ ID NO 66. Other object Additional of the present invention are constituted by cells, in among others and by way of illustration, prokaryotic and eukaryotic cells containing the genetic construction of DNA of the invention and where the RNA sequence of the invention can be adequately expressed. These cells can be transformed, infected or transfected by said DNA construction by genetic engineering techniques known to a person skilled in the art. [Sambrook, J., Fritsch, EF, and Maniatis, T. (1989). Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory] and are part of the present invention]. These cells may be useful for carrying out assessments of inhibitory activity of said sequence in virus infection assays, preferably HCV, for expression conditioned by an IRES region of proteins of commercial interest, for amplification and obtaining said genetic DNA construct, preferably the vector of expression, for later use in gene therapy, etc. Another object of the invention is the use of the RNA sequence, of the RNA construction and of the genetic construction of DNA of the invention in the preparation of a pharmaceutical composition, for example, a medicament, a vector for gene therapy, a reagent or laboratory compound, etc. Said pharmaceutical composition is useful for protecting humans and animals against diseases caused by certain RNA viruses. In a particular embodiment, said pharmaceutical composition is especially useful for protecting humans against infection caused by HCV. The RNA sequence, the RNA construct and the genetic DNA construct of the invention may be used independently or combined with each other as part of a mixture of sequences (RNA and / or DNA) that are applied together in the preparation of said therapeutic composition. In this way, the mixture could be constituted by any of the possible combinations of the different RNA sequences, the RNA construct and the genetic DNA constructs that are part of the present invention. In the same way they can be used in combination with products other than those described here and existing in the state of the present and future art, e.g. interferon, antiviral drugs, etc; also in this case as part of a single product or a mixture, as a combination therapy. Finally, the invention provides a pharmaceutical composition comprising a therapeutically effective amount of the RNA sequence and / or RNA construct and / or DNA genetic constructs of the invention, together with, optionally, one or more pharmaceutically adjuvant and / or vehicles. acceptable. In a particular embodiment, said pharmaceutical composition is a medicine intended to confer protection or to the treatment of human or animal diseases caused by RNA viruses. In another particular embodiment, said pharmaceutical composition is a medicament for the prophylaxis or treatment of human diseases caused by HCV. In another particular embodiment, said pharmaceutical composition is a medicament for the prophylaxis or treatment of animal diseases caused by viruses, such as, for example, bovine diarrhea virus or even classical swine fever. In another particular embodiment, said medicament is an expression vector for therapeutic methods of gene therapy that require the insertion of a therapeutic DNA into the mammalian genome. In another particular embodiment, said pharmaceutical composition is a laboratory reagent for use in biotechnological applications and in basic research as blocking agents for the translation of genes arranged under the control of the HCV IRES, as tools to functionally or structurally characterize the IRES, or subdomains thereof, as well as its possible interactions with other domains or viral molecules or cellular factors. In the sense used in this description, the term "therapeutically effective amount" refers to the amount of RNA sequence of the invention or the amount of a gene construct that allows its calculated intracellular expression to produce the desired effect and, in general, It will be determined, among other causes, by the characteristics of said sequences and constructions and the therapeutic effect to be achieved. The pharmaceutically acceptable adjuvants and vehicles that can be used in said compositions are the adjuvants and vehicles known to those skilled in the art and commonly used in vaccine production. In a particular embodiment, said composition is prepared in the form of an aqueous solution or suspension, in a pharmaceutically acceptable diluent, such as saline, phosphate buffered saline (PBS), or any other pharmaceutically acceptable diluent. The pharmaceutical composition provided by this invention may be administered by any appropriate route of administration that gives as The result is a protective therapeutic response against infection of the virus, preferably HCV, for which said composition will be formulated in the pharmaceutical form appropriate to the route of administration chosen. In a particular embodiment, the administration of the composition provided by this invention is carried out parenterally, for example, intraperitoneally, subcutaneously, etc.

DESCRIPTION OF THE FIGURES

Figure 1.- Schematic representation of the secondary and tertiary structures proposed for the IRES domain of HCV. The different domains and subdomains are identified by I, II, Illa, b, c, d, e, f and IV. AUG represents the translation start site.

Figure 2.- Schematic representation of the theoretical secondary structure presented by the inhibitory RNA sequences of the invention distributed in each of the selected families.

Figure 3.- In vitro translation inhibition assay by the inhibitory RNA sequence of the invention. The relative amount of luciferase protein is represented with respect to the amount of the Cat protein used as a control, in the presence of increasing amounts of the various aptamers. Luciferase is translated under the control of HCV IRES while Cat protein is independent of it. In solid circles the inhibition of the translation of luciferase produced by aptamer 24 representative of group 1 is represented. In empty circles the inhibition produced by aptamer 31 representative of group 2 is represented. With solid triangles the inhibition produced by the aptamer is represented. 16 belonging to group 3. Empty triangles represent the inhibition produced by aptamer 10 belonging to group 4. With solid squares the inhibition obtained by aptamer 50 representing both group 5 and 6 is represented, since it simultaneously contains the domains that define both groups With empty squares, the inhibition obtained by aptamer 17 representing group 7 is represented. Solid rhombs are used to represent the inhibition obtained by aptamer 18 representative of group 8. Figure 4.- Inhibition assay of the activity of HCV-IRES mediated by chimeric inhibitory RNA constructs of the invention carrying a ribozyme and an aptamer of the invention. Luciferase is translated under the control of HCV IRES while Cat protein is independent of it. In solid circles the inhibition of the translation of luciferase produced by ribozyme 363 is represented. In empty circles the inhibition produced by the inhibitory RNA carrying ribozyme 363 and aptamer 24. is represented. With solid triangles the inhibition produced by the RNA inhibitor that carries ribozyme 363 and aptamer 18. Empty triangles represent the inhibition produced by the inhibitor RNA that carries ribozyme 363 and aptamer 16. Solid inhibition represents the inhibition obtained by the inhibitor RNA that carries ribozyme 363 and aptamer 17. With empty squares the inhibition obtained by the inhibitory RNA carrying ribozyme 363 and aptamer 10 is represented. Solid rhombs are used to represent the inhibition obtained by the inhibitory RNA carrying ribozyme 363 and aptamer 50.

EXAMPLES OF EMBODIMENT OF THE INVENTION

Example 1.- Design, elaboration and selection of the inhibitory RNA sequence of the invention. The invention was carried out by applying a strategy of selective amplification of molecules capable of binding to IRES (aptamers). This strategy was applied to a population of RNA sequences resulting from the random combination of the four nucleotides (Adenine, Cytosine, Guanine and Uracil) in 25 consecutive positions. This strategy is applicable to obtain inhibitors of causative agents of other pathologies. In vitro selection of the aptamers or RNA sequences of the invention The internally biotinylated HCV IRES (SEQ ID NO 1) was immobilized to a streptavidin column (HiTrap Streptavidin HP column, Amersham Biosciences). The population of inhibitory RNA sequences used was obtained by in vitro transcription of a population of DNA that was constructed from the pairing of two complementary deoxyoligonucleotides (SEQ ID NO 2 and SEQ ID NO 3). Double stranded DNA The resulting consisted of a random 25 nucleotide region flanked at 5 'by a known sequence containing the T7 phage promoter and at 3' by a known sequence that would be used in the amplification and cloning steps. In vitro transcription of said DNA with the enzyme T7 RNA polymerase (Barroso-del Jesús et al., 1999. Comparative kinetic analysis of structural variants of the hairpin ribozyme reveal further potential to optimize its catalytic performance. Antisense Nucleic Acid Drug Dev. 9 (5): 433-40) generated a population of RNA molecules that were subjected to the following in vitro molecular selection process. This population was incorporated into the column and incubated for 30 minutes at room temperature. After that time the column was subjected to 10 steps of TMN buffer washing (10 mM Tris-Acetic pH 7.5, 10 mM magnesium acetate, 100 mM sodium chloride), which eluted the population molecules that had not been bound to the HCV IRES. To collect the retained molecules, the RNA contained in the column was denatured by heating it at 95 ° C and subsequent washing with TMN buffer at 65 ° C. The molecules collected in the first four elution steps were used for the retro-transcription and amplification reaction with a thermostable DNA polymerase enzyme, Tth (Promega), following the manufacturer's instructions. As oligonucleotide primers were used SEQ ID NO 4 and SEQ ID NO 5. A fraction of the DNA generated after amplification was destined for in vitro transcription (Barroso-deIJesus et al., 1999. Comparative kinetic analysis of structural variants of the hairpin ribozyme reveal further potential to optimize its catalytic performance Antisense Nucleic Acid Drug Dev. 9 (5): 433-40), the resulting RNA being integrated into the next selection cycle. The process was repeated six times, six cycles of selection. To increase the selective pressure from the fourth cycle, the incubation time of the association reaction was reduced and the temperature increased to 37 ° C. The different independent sequences resulting from the sixth selection cycle were analyzed by sequencing, obtaining a collection of products (SEQ ID NO 6 to SEQ ID NO 36) that were grouped, according to certain defined sequence domains, in the different families of the RNA sequences and structures that are integrated into the RNA sequence of the invention and which are listed below: Family 1: 5 '(N) _m X _k CCAACX _z (N) _p 3' Family 2: 5 '(N) _m XkUAUGGCUX _z (N) _p 3' Family 3: 5 '(N) _m XkCCACGX _z (N) _p 3' Family 4: 5 '(N) _m XkRUUCGYRAX _z (N) _p 3' Family 5: 5 '(N) _m XkCUYGUUYX _z (N) _p 3' Family 6: 5 '(N) _m XkUYRUGGX _z (N) _p 3' Family 7: 5 '(N) _m XkYGAGACYX _z (N) _p 3' Family 8: 5 '(N) _m XkAUUAGX _z (N) _p 3' Family 9 : 5 '(N) _m XkAUUCAGX _z (N) _p 3'

Where: A, Adenine C, Cytosine G, Guanine U, Uracil N and X is any R nucleotide, purine nucleotide (Adenine or Guanine) Y, pyrimidine nucleotide (Cytosine or Uracil) m, p, kyz any integer from 0 onwards. The secondary structure prediction of the selected inhibitory RNAs was made using the Mfold program. Figure 2 shows a schematic representation of the theoretical secondary structure presented by the inhibitory RNAs of each of the selected groups, where the sequences that define each group are exposed in a single chain region flanked by a double chain region represented for nucleotides N (any sequence) the length of the double chain region is variable and is represented by m nucleotides in the 5 'strand and p nucleotides in the 3' strand, where myp are integers from 0 onwards. The single chain zone further includes a variable number of nucleotides k in 5 'and z in 3' flanking the fixed sequences represented by X which can be any nucleotide, kyz representing an integer from 0 onwards. The RNA sequences of the invention identified bind IRES to through the consensus sequence that defines each family most likely in the following positions of the viral RNA: Atamers belonging to group 1, for example AP24, SEQ ID NO 19, to positions 263 to 268; Aptamers belonging to group 2, for example AP31 SEQ ID NO 21, at positions 80 to 87; Aptamers belonging to group 3, for example AP16, SEQ ID NO 13, at positions 282 to 286; Aptamers belonging to group 4, for example AP10, SEQ ID NO 9, to positions 305 to 312; Aptamers belonging to group 5, for example AP50, SEQ ID NO 33, to positions 18 to 23; Aptamers belonging to group 6, for example AP50, SEQ ID NO 33, to positions 340 to 2345; Aptamers belonging to group 7, for example AP17, SEQ ID NO 14, to positions 322 to 328; Atamers belonging to group 8, for example AP18, SEQ ID NO 15, not determined; Atamers belonging to group 9, for example AP53, SEQ ID

NO 34, at positions 305 to 312. It should be noted that these IRES binding positions are presented as guidance without intending to establish any model that may limit the scope of the present invention. Inhibition of in vitro translation by means of the RNA sequences of the invention The anti-HCV activity of these RNA sequences of the invention can easily be assayed in a laboratory in transcription-translation or translation cell extracts using appropriate plasmid DNAs in which The translation of a gene whose activity is easily quantifiable is expressed under the control of the IRES region of HCV. To carry out these tests the previously selected inhibitory RNA sequences of the invention were synthesized by in vitro transcription using oligonucleotides (SEQ ID. NO 37, SEQ ID NO 38, SEQ ID NO 39, SEQ ID NO 40, SEQ ID NO 41 , SEQ ID NO 42, SEQ ID NO 43). Hybridization of each of these previous oligonucleotides with oligonucleotide SEQ ID NO 52 allowed the generation of a series of genetic DNA constructs that were used as a suitable template for the in vitro transcription reaction (Barroso-del Jesús et al., 1999. Comparative kinetic analysis of structural variants of the hairpin ribozyme reveal further potential to optimize its catalytic performance Antisense Nucleic Acid Drug Dev. 9 (5): 433-40). Then the genetic constructions of DNA developed are indicated: DNA Ap 24 (SEQ ID NO 53): Oligo SEQ. ID. NO 52 with SEQ ID NO 37, DNA Ap 18 (SEQ ID NO 54): Oligo SEQ. ID. NO 52 with SEQ ID NO 38, DNA Ap 31 (SEQ ID NO 55): Oligo SEQ. ID. NO 52 with SEQ ID NO 39, - DNA Ap 16 (SEQ ID NO 56): Oligo SEQ. ID. NO 52 with SEQ ID NO 40, DNA Ap 17 (SEQ ID NO 57): Oligo SEQ. ID. NO 52 with SEQ ID NO 41, DNA Ap 10 (SEQ ID NO 58): Oligo SEQ. ID. NO 52 with SEQ ID NO 42, and DNA Ap 50 (SEQ ID NO 59): Oligo SEQ. ID. NO 52 with SEQ ID NO 43.

In vitro translation inhibition assays were carried out using used rabbit reticulocyte (Alt et al., 1995. Specific inhibition of hepatitis C viral gene expression by antisense phosphorothioate oligodeoxynucleotides. Hepatology. 22 (3): 707-717 ). 50 ng of a plasmid DNA containing the coding sequence for the Cat protein (Chloramphenicol acetyl transferase) was used under the T7 phage promoter, followed by the HCV genomic sequence, from nucleotide +1 to +585 (in this region the IRES of the virus is found as well as the coding region of the viral capsid component protein) (AF009606). This viral region controls the translation of the 3 'encoded luciferase protein mRNA thereof. After 60 minutes of incubation at 30 ° C in the presence or absence of the different inhibitory RNA sequences of the invention, the products of the reactions were resolved by electrophoresis in denaturing polyacrylamide gels with SDS and subsequently quantified by means of a fluorescence scanner (Storm , Molecular Dinamycs). The results of the inhibition of the biological activity of HCV IRES as a ribosome entry site by the inhibitory RNA sequences of the invention corresponding to the different groups described above are shown in Figure 3. All aptamers tested demonstrated a decrease in protein synthesis of up to 85%, even achieving a 100% inhibition when the ap10 sequence was tested. Table 1 shows the IC ₅₀ levels obtained with sequences of RNA of the invention representative of several of the families described above. The IC ₅₀ value represents the inhibitory RNA sequence concentration capable of achieving a 50% decrease in protein levels. This value was obtained from the inhibition data detailed in Figure 3. Table 1.- IC ₅₀ levels of each inhibitor tested

Example 2.- Inhibition of translation in vitro by means of the RNA sequences of the invention linked to a ribozyme The aptamers or RNA sequences of the invention described can also be used in combination with other inhibitory agents. As an example of its use, chimeric RNA constructs have been developed that carry an aptamer and a catalytic domain, a hammerhead ribozyme designed to cut the IRES of HCV at position 363 (Lieber et al., 1996. Elimination of hepatitis C virus RNA in infected human hepatocytes by adenovirus-mediated expression of ribozymes. J Virol. 70 (12): 8782-91). The construction of these new RNA inhibitor constructs (HH 363-Ap.) Was carried out by hybridization of two complementary oligonucleotides: - SEQ. ID. NO 44 with SEQ ID NO 45 (RNA Construction HH 363-24), - SEQ. ID. NO 44 with SEQ ID NO 46 (RNA Construction HH 363-31), - SEQ. ID. NO 44 with SEQ ID NO 47 (RNA Construction HH 363- 16), - SEQ. ID. NO 44 with SEQ ID NO 48 (RNA Construction HH 363-10), - SEQ. ID. NO 44 with SEQ ID NO 49 (RNA Construction HH 365-50), - SEQ. ID. NO 44 with SEQ ID NO 50 (RNA Construction HH 363-17), and - SEQ. ID. NO 44 with SEQ ID NO 51 (RNA Construction HH 363-18); and its subsequent extension with Taq DNA polymerase (Biotools) thus generating a genetic double stranded DNA construct that was used as a template for the in vitro transcription reaction. The following are the genetic DNA constructs developed: - SEQ. ID. NO 60: coding for the construction of RNA HH 363-24, - SEQ. ID. NO 61: coding for the construction of RNA HH 363-31, - SEQ. ID. NO 62: coding for the construction of RNA HH 363-16, - SEQ. ID. NO 63: coding for the construction of RNA HH 363-10, - SEQ. ID. NO 64: coding for the construction of RNA HH 363-50, - SEQ. ID. NO 65: coding for the construction of RNA HH 363-17, and - SEQ. ID. NO 66: coding for the construction of RNA HH 363-18.

The genetic construction of DNA was done so that the catalytic domain is 5 'from the aptamer. The constructs of inhibitory RNAs (HH 363-24 / 31/16/10/50/17 and 18) were purified and their IRES-dependent translation inhibitory action of HCV tested in in vitro translation assays using rabbit reticulocyte used as described above. The results of inhibition of HCV-IRES activity mediated by the different inhibitory RNA constructs (chimeras) carrying a ribozyme and an aptamer are shown in Figure 4, and compared with the inhibition exerted by the ribozyme independently. Luciferase is translated under the control of HCV IRES while Cat protein is independent of the same. The suppressive effect obtained by the chimeric RNA constructs was in all cases superior to that exerted by the HH363 ribozyme, which reports a substantial improvement of these chimeric molecules with respect to the classic RNA inhibitors. Table 2 shows the IC ₅₀ levels obtained with the chimeric inhibitors. This value was obtained from the inhibition data detailed in Figure 4.

Example 3.- Test of the antiviral activity of inhibitory RNAs. The antiviral activity of the RNA sequence of the invention can be evaluated in cellular models, although the impossibility of culturing HCV makes it necessary to resort to indirect measures by using marker genes whose translation takes place under the control of the IRES region of HCV. and whose product is easily quantifiable, for example, luciferase. A specific embodiment consists in the use of viruses, for example, hybrids derived from the polio virus to which the IRES region has been replaced by that corresponding to the HCV IRES together with the 5 'region of the protein gene of the HCV capsid (PV-HCV). In these hybrid viruses, viral translation and consequently their proliferative capacity is dependent on the activity of the HCV IRES. Such constructs and assays can be carried out as described above (Das et al., 1998. A small Yeast RNA blocks Hepatitis C virus internal Ribosome Entry site (HCV-IRES) -mediated Translation and inhibits replication of a chimeric poliovirus under translational control of the HCV IRES element. J. Virology 72, 5638-5647). Hepatocorcinoma cell lines (Huh-7) that stably produce any one of the specific embodiments of the RNA sequence of the invention are constructed. For this, they will be transfected with an expression vector, for example an appropriate plasmid in which the DNA sequence encoding said RNA sequence is included. This DNA sequence will be cloned under the control of a polll promoter (for example, the CMV promoter). Cells that produce the inhibitory RNA sequence will be exposed to infection by the PV-HCV hybrid viruses. Three days after infection, cell extracts are prepared to re-infect HeLa cells in monolayer. After three days of incubation at 37 ° C, staining with violet crystal is performed to determine the lysis plaques resulting from the viral infection. Those cells in which the synthesis of the RNA sequence of the invention achieves inhibition of virus replication will not occur lysis.

Claims

1.- RNA sequence that inhibits the proliferation of the virus causing hepatitis type C (HCV) characterized in that it consists of an RNA sequence that specifically binds to regions of the 5 'non-translatable domain of the virus genome, IRES region of the HCV, and because it is forming a structure defined by a double-chain region that exposes single-stranded nucleotides of RNA, through which it specifically binds to the RNA of the IRES region of HCV.

2. RNA sequence according to claim 1 characterized in that it belongs, among others, to one of the following families of sequences defined as a function of consensus defined IRES binding sequence domains:

Family 1: 5 '(N) _m X _k CCAACX _z (N) _p 3'

Family 2: 5 '(N) _m XkUAUGGCUX _z (N) _p 3'

Family 3: 5 '(N) _m XkCCACGX _z (N) _p 3' Family 4: 5 '(N) _m XkRUUCGYRAX _z (N) _p 3'

Family 5: 5 '(N) _m XkCUYGUUYX _z (N) _p 3'

Family 6: 5 '(N) _m XkUYRUGGX _z (N) _p 3'

Family 7: 5 '(N) _m XkYGAGACYX _z (N) _p 3'

Family 8: 5 '(N) _m XkAUUAGX _z (N) _p 3' Family 9: 5 '(N) _m XkAUUCAGXz (N) _p 3' where: A, is Adenine C, is Cytosine G, is Guanine U, is Uracil N and X is any R nucleotide, it is a purine nucleotide (Adenine or Guanine) Y, it is a pyrimidine nucleotide (Cytosine or Uracil) m, p, k and z is any integer from 0 onwards.

3. RNA sequence according to claims 1 and 2, characterized in that it belongs, among others, to the following group: SEQ ID NO 6, GGCUCGUUCAAGUGUCCCAACCACC SEQ ID NO 7, GGAACGAUCAGAGCAACCAACUGCC SEQ ID NO 8, GGAUGCAAUCUUGAGACCAACCUCC SEQ ID NO 9, UUCUGAGA NOU IDUUCA NOCU 10 GGUACCAGCGCGAGUUCCCAACACC SEQ ID NO 11 GGAUAUGGCUACGCUAAAACCCCC SEQ ID NO 12 GGAGCCUCCACCGGUAACCAACUCC SEQ ID NO 13 CUCGUUUCCACGACCUCACGAGACC SEQ ID NO 14 CGUCGCCACAUGAGACUUUACCCAC SEQ ID NO 15 GGAUUAGCUUCGGAUUAUGGCUGCC SEQ ID NO 16 AUGGCUAGCCUCAAUCCCACGGCCC SEQ ID NO 17 AUGGCUCGCCUUCCCUCACCAACCC SEQ ID NO 18 UCCUAAGUAUGGCUAUUAGGCAACC SEQ ID NO 19 GCCGUCCGAGCAGGUCCCCAACACC SEQ ID NO 20 GCGUGACCAACCACGCUACCAAACC UAGAAGGUAUGGCUCCUUCUUGCC SEQ ID NO 21 SEQ ID NO 22 SEQ ID NO 23 GCAUUCGCGAUUGGUAACCAACUAC UGCUCUUCACCGCCCGAUCCACGC UGGACCAGCAUGGCUAACUCCUCCC SEQ ID NO 24 SEQ ID NO 25 SEQ ID NO 26 GGUUCUACCUGGUGUCCCAACCACC UCCUAAGUAUGGCUAUUAGGCAACC GGCACACCUAUUGUCGUGAACCUGC SEQ ID NO 27 SEQ ID NO 28 UGUGACCAACCAC AUAACCACCCC GUGUUCGCAAGCUAACCCAACUAG SEQ ID NO 29 SEQ ID NO 30 SEQ ID NO 31 ACACUGCCCCAACCGGUGUAUGCC GGCUUGACACUGACCAACCAGUGC GCGGUCCGACAGUUUCCCAACGGC SEQ ID NO 32 SEQ ID NO 33 SEQ ID NO 34 GCUUGUUCUACAUCAUGGGUAGAGC GUGAUUCAGCUUUUCUUCCCACGCC CGAGAUGUAUGGCUCUCUUGAGGUC SEQ ID NO 35 SEQ ID NO 36 GGGUCUCUCCUCUGUAACCAACUAC

4. RNA construction characterized in that it is constituted in addition to the RNA sequence according to claims 1 to 3 by a nucleotide sequence that allows the addition or increase of the inhibitory activity of HCV replication.

5. RNA construction according to claim 4 characterized in that it is a construction that contains an antisense oligonucleotide, a ribozyme or an aptamer as a sequence that adds the inhibitory activity.

6. RNA construction according to claim 5 characterized in that the ribozyme is ribozyme 363 and because it belongs, among others, to the following group: RNA sequence HH 363-24, HH 363-31, HH 363-16, HH 363- 10, HH 363-50, HH 363-17 and HH 363-18, encoded by the DNA sequences SEQ ID NO 60, 61, 62, 63, 64, 65 and 66, respectively.

7. RNA construction according to claim 4 characterized in that it is constituted by, or because it contains, any one of the possible combinations of two or more RNA sequences according to one of claims 1 to 3 with a binding domain or not between these sequences.

8. RNA sequence and RNA construction according to claims 1 to 3 and 4 to 7, respectively, characterized in that they have modifications, preferably chemical, which lead to greater stability against the action of ribonucleases and thereby a greater efficiency, without supposing the alteration of its mechanism of action that is the specific union to the IRES.

9. Genetic construction of DNA characterized in that it allows in vitro or intracellular transcription of the RNA sequence or RNA construction according to any one of claims 1 to 7 and because it is constituted by one of the sequences belonging to the following group: a) DNA nucleotide sequence, preferably double stranded, comprising at least said sequence encoding the RNA sequence or the RNA construct for in vitro transcription, and, b) DNA nucleotide sequence, preferably double chain, characterized in that it is a gene expression system or vector comprising the sequence coding for the RNA sequence of the invention with at least one promoter that directs the transcription of said sequence of nucleotides of interest, to which it is operatively linked, and other sequences necessary or appropriate for transcription and its appropriate regulation in time and place.

10. - DNA genetic construction according to claim 9 characterized in that it is a sequence coding for an RNA sequence (point a)) belonging, among others, to the following group: SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55 , SEQ ID NO 56, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59.

11. - DNA genetic construction according to claim 9 characterized in that it is a coding sequence of an RNA construction (point a)) belonging, among others, to the following group: SEQ ID NO 60, SEQ ID NO 61, SEQ ID NO 62 , SEQ ID NO 63, SEQ ID NO 64, SEQ ID NO 65, SEQ ID NO 66.

12.- Cell, preferably, prokaryotic and eukaryotic cells, characterized in that it contains and in which the genetic construction of DNA is properly expressed according to claims 9 through 11.

13. Use of the RNA sequence, RNA construction and the genetic construction of DNA according to claims 1 to 11 in the preparation of a pharmaceutical composition, for example, a medicament, a vector for gene therapy, and a reagent or laboratory compound.

14. Pharmaceutical composition characterized in that it comprises a therapeutically effective amount of the RNA sequence and / or RNA construct and / or DNA gene constructs according to claims 1 to 11, together with, optionally, one or more adjuvants and / or pharmaceutically acceptable vehicles.

15. Pharmaceutical composition according to claim 14 characterized in that it is a medicament for the prophylaxis or treatment of human or animal diseases caused by RNA viruses.

16. Pharmaceutical composition according to claim 15 characterized in that it is a medicament for the prophylaxis or treatment of human diseases caused by HCV.

17. Pharmaceutical composition according to claim 15 characterized in that it is a medicament for the prophylaxis or treatment of animal diseases caused by viruses, such as, for example, bovine diarrhea virus or even classical swine fever.

18. Pharmaceutical composition according to claim 15 characterized in that the medicament is an expression vector for therapeutic methods of gene therapy that require the insertion of therapeutic DNA into the mammalian genome.

19. Pharmaceutical composition according to claim 14 characterized in that it is a laboratory reagent for use in biotechnological applications and in basic research as blocking agents for the translation of genes arranged under the control of IRES of HCV, as tools for characterizing functionally or structurally IRES, or subdomains thereof, as well as its possible interactions with other domains or viral molecules or cellular factors.