WO2005097090A2 - Agent interrompant l'interaction psd95 nnos, compositions les contenant, et utilisations therapeutiques associees - Google Patents

Agent interrompant l'interaction psd95 nnos, compositions les contenant, et utilisations therapeutiques associees Download PDF

Info

Publication number
WO2005097090A2
WO2005097090A2 PCT/US2005/011774 US2005011774W WO2005097090A2 WO 2005097090 A2 WO2005097090 A2 WO 2005097090A2 US 2005011774 W US2005011774 W US 2005011774W WO 2005097090 A2 WO2005097090 A2 WO 2005097090A2
Authority
WO
WIPO (PCT)
Prior art keywords
pain
nnos
psd95
compound
group
Prior art date
Application number
PCT/US2005/011774
Other languages
English (en)
Other versions
WO2005097090A3 (fr
Inventor
Christine Loh Janosky
Yvonne Yee-Wen Lai
Joel S. Hayflick
Original Assignee
Icos Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Icos Corporation filed Critical Icos Corporation
Publication of WO2005097090A2 publication Critical patent/WO2005097090A2/fr
Publication of WO2005097090A3 publication Critical patent/WO2005097090A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4192—1,2,3-Triazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/13—Amines
    • A61K31/135—Amines having aromatic rings, e.g. ketamine, nortriptyline
    • A61K31/136—Amines having aromatic rings, e.g. ketamine, nortriptyline having the amino group directly attached to the aromatic ring, e.g. benzeneamine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/357—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having two or more oxygen atoms in the same ring, e.g. crown ethers, guanadrel
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4164—1,3-Diazoles
    • A61K31/4184—1,3-Diazoles condensed with carbocyclic rings, e.g. benzimidazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A61P29/02—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID] without antiinflammatory effect

Definitions

  • the present invention relates to agents that disrupt interaction between neuronal nitric oxide synthase (nNOS) and the Post Synaptic Density Protein 95 (PSD95) and related proteins, and to compositions containing such a disrupting agent.
  • nNOS neuronal nitric oxide synthase
  • PSD95 Post Synaptic Density Protein 95
  • the present invention also relates to methods of treat- ing a disease or condition wherein disruption of PSD95-nNOS interaction provides a benefit.
  • the present invention relates to methods of treating acute and chronic pain, opiate tolerance, ischemic brain damage, neurological diseases, psychiatric disorders, and neurodegenerative diseases, for example, muscular dystrophy, Parkinson's disease, epilepsy, seizures, Hunting- ton's disease, Alzheimer's disease, and amyotrophic lateral sclerosis, by administration of a therapeu- tically effective amount of a PSD95-nNOS disrupting agent to a mammal in need thereof .
  • NO nitric oxide
  • nitric oxide mediates diverse physiological functions associated with neurons.
  • NO acts as a neuromodulator to control behavioral activity, influence memory formation, and intensify responses to painful stimuli (J.E. Brenman et al . , Cur. Opin . in Neurobiol . , 7, 374-378 (1997); Z.D. Luo et al . , Curr. Rev. Pain, 4:459-466 (2000)).
  • NO biosynthesis in excitable tissues is regulated by increases in intracellular calcium, which activates NOS through enzyme dependence upon calmodulin. Although small amounts of NO synthesized during neural and skeletal muscle activity mediates physiological functions, an excessive pro- * duction of NO can mediate tissue injury.
  • NO neurodegeneration in other conditions, such as Parkinson's disease, amyotrophic lateral sclerosis, and Huntington's disease (see reviews by Brenman and Luo, supra; also K.S. Christopherson et al., J " . Clin . Invest . , 100:2424-2429 (1997)).
  • NO signaling also is perturbed in various muscle diseases, particularly in Duchenne muscular dystrophy. Excessive amounts of NO are generated according to the following NMDA receptor-PSD95-nN0S pathway. The pathway also shows the effects of an increase in NO generation.
  • NMDA receptor activation ⁇ activation of PSD95- coupled nNOS ⁇ increased NO production ⁇ increases in cGMP (vasodilation) , increases in neurotoxicity (neuronal damage) , and increases in hypersensitivity of neurons (pain hyper- algesia) .
  • NMDA N-methyl-D- aspartate
  • PSD95 mediates the coupling of nNOS to NMDA receptors in the central nervous system (CNS) .
  • NNDAR NMDA receptor
  • Fig. 1 shows that tails of the NMDA receptor interact with PSD95.
  • PSD95 is a multidomain protein with three PDZ repeats, a Src homology (SH3) domain, and a 190-amino acid sequence having homology to yeast guanylate kinase (S.E. Cravin et al . , Cell , 53: 95- 498 (1998); K.S. Christopherson et al . , J. Biol .
  • nNOS targets nNOS to postsynaptic sites by binding to PDZ domains in PSD95.
  • NMDA receptors also occur at postsynaptic densities through binding to PSD95.
  • PSD95 thereby functions as a molecular scaffold to physically link nNOS to NMDA receptors.
  • NMDA receptor activity couples NMDA receptor activity to the production of nitric oxide (NO) , a signaling molecule that mediates NMDA receptor-dependent excitotoxicity.
  • NO nitric oxide
  • PSD95, and nNOS provides investigators various targets for reducing or eliminating an excessive production of NO, and thereby reducing the excitotoxicity of NMDA receptors.
  • One target is the NMDA receptors, which mediate calcium- ion (Ca 2+ ) influx into neurons. It is known that NMDA receptors contribute to the neu- ronal processes mediating prolonged nociceptive behaviors in pain models.
  • NMDA-type glutamate receptors play a pivotal role in the transmission of excitatory signals from primary sensory neurons to the brain through the spinal cord. Inhibiting excitation, or activation, of the NMDA receptors can disrupt the NMDA receptor- PSD95-nNOS pathway. For example, neuropathic pain in man can occur following an injury to the periph- eral or central nervous system arising from causes such as chemotherapy, traumatic injury, and herpes zoster infection. These neuropathies can be persistent, and are particularly problematic because they often are managed poorly by conventional opiate analgesics and nonsteroidal antiinflammatory drugs (NSAIDS) .
  • NSAIDS nonsteroidal antiinflammatory drugs
  • NMDA receptor antagonists have been used in the treatment of neu- ropathic pain (CG. Parsons, Bur. J " . Pharm. , 429 : 71- 78 (2001) ) .
  • Effective NMDA receptor antagonists include various familiar drugs that also have NMDA antagonist properties, e.g., dextromethorphan, dextrorphan, memantine, ketamine, and amantadine .
  • NMDA antagonists have been used to treat pain in patients, and particularly chronic and recurrent pain that has not responded to traditional therapies, such as opioids (CN. Sang, ⁇ J. Pain Symptom Manage . , 15:S21-S25 (2000); D.J. Heweitt,
  • NMDA antagonists also have been used to reduce various types of neuropathic pain, including glossopharyngeal neuralgia, postherpetic neuralgia, central pain caused by spinal cord injury, stump pain, phantom limb pain, neuropathic cancer pain, limb pain after traumatic sciatic nerve injury, and surgery-induced nerve injury (see reviews: C G . Parsons et al . , Neurophar acology, 38 : 735 - 767 (1999); CG. Parsons, (2001), supra) .
  • the opiate- tolerant patient has a central sensitization-like hyperalgesia.
  • NMDA receptor antagonists block sensitization to amphetamine and cocaine, as well as tolerance and dependence to ethanol and opiate analgesics in animal models (K. Elliott et al . , Neuropsychopharmacology, 13:347-356 (1995); Z. Wiesenfeld-Hallin, Drugs, 55:1-4 (1998); D.D. Price et al . , J. Pain Symptom Manage . , 19 : _7 - Sll (2000) ) .
  • NMDA receptor antagonists not only are able to prevent the development of morphine tolerance, but also reverse an established tolerance even in the continuing presence of this opiate analgesic, and prevent the expression of withdrawal symptoms. Although some evidence exists that NMDA antagonists may synergize opiate analgesics, it also has been observed to be a mere additive, rather than synergistic, analgesic effect. The above-described adverse side effects associated with present-day NMDA receptor antagonists precluded their widespread clinical use in the treatment of chronic pain, and other conditions and diseases associated with the above-described NMDA receptor-PSD95-nNOS pathway. However, specific inhibitors of NMDA receptor subtypes have proven beneficial in circum- venting some side effects of broad spectrum NMDA receptor antagonists.
  • Functional NMDA receptors are composed of heteromers containing NR1 subunit with one or more of the different NR2 subunits.
  • PSD 5 predominantly binds to the NR2B receptor subunit (H.C. Kornau et al . , Science, 269 : 1737- 17 -0 (1995); Christopherson et al . (1999) ) .
  • NR2B subunit has a more restricted localization than NR2A subunit, with higher concen- tration in forebrain and dorsal horn, areas that are important for nociception (S. Boyce et al . , Neuro- pharmacology, 38 : 611-623 (1999)). Indeed, selective NR2B receptor antagonists have been shown to be efficacious in various animal pain models without motor dysfunction (S. Boyce et al . (1999); B.A. Chizh et al . , Trends Pharmacol . Sci . , 22:636-642 (2001); M. Zhuo, Drug Discov. Today, 7:259-267 (2002) ) .
  • NMDA receptor-PSD95-nNOS pathway Another available target for disruption of the NMDA receptor-PSD95-nNOS pathway is the Post Synaptic Density Protein 95 (PSD95) . It is known that NMDA receptor activity is unaffected by genetically disrupting PSD95 in vivo or by suppressing PSD95 expression in vitro . However, PSD95 deletion dissociates NMDA receptor activity from NO production and suppresses excitotoxicity.
  • PSD95 appeared to be a promising target for disrupting the NMDA receptor-PSD95-nNOS pathway either (a) by mutation, depletion, or elimination of PSD95, thereby eliminating the NMDR receptor-nNOS link, or (b) by disrupting the NMDR receptor-PSD95 interaction.
  • This hypothesis was based on studies that showed suppression of PSD95 expression protected neurons against excitotoxicity produced by NMDA receptor activation, and PSD95 mRNA and protein are enriched in the spinal cord and selectively distributed in the superficial dorsal horn, where PSD95 overlapped with NMDA receptors. It also was found that PSD95 was required for NMDA receptor- mediated thermal hyperalgesia (K.F. Kitto et al . , Neurosci .
  • PSD95 imparts signaling and neurotoxic specificity to NMDA receptors through the coupling of receptor activity to nNOS.
  • Targeting the PSD95 protein represents an attractive therapeutic approach for diseases that involve NMDA receptor excitotoxicity because eliminating the PSD95 eliminates NMDA receptor coupling to nNOS, and as a result, excessive NO formation is precluded.
  • eliminating PSD95 does not adversely affect other, beneficial functions of the NMDA receptors.
  • NMDA receptors mediate ischemic brain damage, for example, and totally blocking NMDA receptors is deleterious to mammals.
  • NMDA receptor function was unaffected because receptor expression, NMDA currents, and Ca 2+ loading were unchanged.
  • a third target for disrupting the NMDA re- ceptor-PSD95-nNOS pathway is to inhibit NO formation by nNOS .
  • NO acts as a neuromodulator in the CNS and participates in the regulation of diverse physiological processes including brain development, pain perception, neuronal plasticity, memory, and behavior. When produced in an excessive amount, however, NO transforms from a physiological neuromodulator to a neurotoxic effector. Overproduction of NO may occur from nNOS following persistent stimulation of excitatory amino acid receptors mediating glutamate toxicity. NO is a short-lived free radical, and regulation of signaling occurs largely at the level of NO biosynthesis (K.S. Christopherson et al . , (1997), supra) .
  • NOS genes Three mammalian NOS genes have been identified, and each forms NO from the guanidine nitrogen of L-arginine in a unique cytochrome P-450- type reaction that consumes reduced nicotinamide adenine dinucleotide phosphate (NADPH) . Because NO is membrane permeant, cells cannot sequester and regulate local NO concentration. Thus, unlike conventional transmitters that are stored in synaptic vesicles, the actions of which are mediated by binding to their receptors, and terminated by either reuptake mechanisms or enzymatic degradation, NO is produced on demand, directly reacts with an intracellular substrate, and terminates after the chemical reaction.
  • NADPH nicotinamide adenine dinucleotide phosphate
  • nNOS neuronal NO
  • eNOS endothelial
  • iNOS inducible
  • Neuronal NOS is expressed in highly ramified neurons throughout the brain, including cerebellum, cerebral cortex, hippocampus, amygdale, and substantia nigra. Endothelial NOS is primarily localized in endothelial cells, although it has been detected in a small population of neurons. Inducible NOS is not found in healthy tissues, but can be expressed after brain insult in astrocytes, neurons, and endothelial cells. The use of NOS inhibitors or mutant mice lacking all NOS isoforms provided evidence of the injurious effects of NO derived from the nNOS or iNOS isoforms in neurological diseases.
  • nNOS inhibitors showed promising results in limiting ischemia-induced acute neuronal damage (P.E. Chabrier et al . , Cell Mol . Life Sci . , 55:1029-35 (1999)).
  • NOS inhibitors often results in suppression of hyperalgesia induced by tissue injury or chemical stimulations.
  • neuron-derived NO plays a major role in regulation of blood flow.
  • neuronal NO activity is associated with an increase in local blood flow. This response would be prevented by nNOS inhibitors. Therefore, total inhibition of nNOS would have a deleterious effect.
  • no clinically effective nNOS inhibitors are known.
  • WO 03/029185 discloses compounds purported to be in- hibitors of iNOS and/or nNOS. SUMMARY OF THE INVENTION
  • the present invention is directed to agents that disrupt PSD95- nNOS interaction as a means to eliminate excessive NO production, and thereby treat a variety of diseases and conditions, particularly chronic pain. More particularly, the present invention is directed to disrupting agents that dislocate nNOS from PSD95 and related proteins, and thereby interfere with the NMDA receptor-PSD95-nNOS pathway.
  • the agents useful according to the invention are specific for disruption of PSD95-nNOS interaction and need not (and preferably do not) affect the catalytic activity of nNOS or the catalytic activity of other NOS isoforms.
  • Disrupting agents of the present invention are expected to be excellent therapeutic agents in methods of treating pain, opiate tolerance, stroke, neurological diseases, neurodegenerative diseases, and other diseases and conditions wherein selective disruption of the NMDA receptor-PSD95-nNOS pathway provides a benefit.
  • the present invention is directed to agents that disrupt interaction between PSD95 (and related proteins) and nNOS, and to compositions containing one or more of the agents.
  • the present invention is directed to methods of treating mammals, including humans, suffering from a disease or condition wherein dis- ruption of PSD95-nNOS interaction provides a benefit/ Accordingly, one aspect of the present invention is to identify selective disrupting agents of PSD95-nNOS interaction, and thereby use the disrupting agents to reduce or eliminate the generation of excessive NO that adversely affects NMDA receptor-mediated pathways . Another aspect of the present invention is to provide selective disrupting agents of PSD95-nNOS interaction selected from the group consisting of compounds of general structural formula (I) , natural product extracts, peptides, and fusion proteins.
  • Yet another aspect of the present inven- tion is to provide a method of treating nociceptive pain, neuropathic pain, opiate tolerance, ischemic brain damage, a neurological disease, a neurodegenerative disease, or a psychiatric disorder, by administering a therapeutically effective amount of PSD95-nNOS disrupting agent to a mammal including humans, in need thereof.
  • Examples of specific diseases and conditions that are treatable include, but are not limited to, Parkinson's disease, epilepsy, seizures, stroke, chronic pain, acute pain, Huntington's disease, amyotrophic lateral sclerosis, neuropathic pain, hyperalgesia, allodynia, traumatic brain injury, and muscular dystrophy, including Duchenne (or pseudohypertrophic) muscular dystrophy, Becker muscular dystrophy, limb-girdle muscular dystrophy, and fascioscapulohumoral muscular dystrophy.
  • Another aspect of the present invention is directed to administration of a PSD95-nNOS disrupting agent, alone or in combination with an opiate analgesic, to treat acute or chronic pain.
  • an opiate analgesic in combination with a PSD95-nNOS disrupting agent potentiates the analgesic effect of the opiate analgesic, and, therefore, lowers the dose of opiate analgesic required to provide a desired pain-reducing effect.
  • the reduced amount of opiate analgesic required to provide a desired pain-reducing effect also reduces the severity of various adverse side effects associated with opiate analgesic treatment.
  • a PSD95-nNOS disrupting agent also can be used alone, either to treat chronic pain or to treat opi- ate tolerance attributed to excessive NO generated by the NMDA receptor-PSD95-nNOS pathway.
  • Still another aspect of the present invention is to provide a composition comprising an opiate analgesic, e.g., morphine, and a PSD95-nNOS dis- rupting agent for use in methods of treating pain.
  • the present invention also is directed to providing a method of reducing or reversing tolerance to an opiate analgesic in an individual undergoing an opiate analgesic therapy by administering a PSD95-nNOS disrupting agent to the individual.
  • the opiate analgesic dose may have no effect, e.g., hyperalgesia, and/or would have to be increased over time to achieve the same pain-re- ducing effect.
  • PSD95-nNOS disrupting agent allows the opiate analgesic to be administered at a constant, or reduced, dose to achieve a desired pain treatment .
  • the constant or reduced amount of opiate analgesic required to pro- vide a desired pain-reducing effect thus reduces the severity of various adverse side effects associated with opiate analgesic treatment, and reduces the possibility of opiate analgesic dependence.
  • the present invention also provides a method for improved pain treatment.
  • the present invention is directed to methods of using an opiate analgesic and a PSD95-nNOS disrupting agent to prevent and/or treat pain.
  • the present invention is directed to com- positions containing morphine and a PSD95-nNOS disrupting agent, and to use of an opiate analgesic and a PSD95-nNOS disrupting agent, administered simultaneously or sequentially, in methods of treating pain and reducing or reversing opiate analgesic tolerance and dependence.
  • Another aspect of the present invention is to provide a method and composition for ameliorating chronic or acute pain or a sensation thereof, while reducing the occurrence or severity of adverse side effects associated with opiate analgesic treatment .
  • Another aspect of the present invention is to reduce the problem of dependence and addiction associated with present opiate analgesics used to treat pain.
  • Still another aspect of the present invention is to provide a method of reducing or reversing opiate analgesic tolerance in an individual undergoing an opiate analgesic therapy by administering a therapeutically effective amount of a PSD95-nNOS disrupting agent to the individual .
  • Yet another aspect of the present invention is to provide an article of manufacture for human pharmaceutical use, comprising (a) a package insert, (b) a container, and either (cl) a packaged composition comprising an opiate analgesic and a PSD95-nNOS disrupting agent or (c2) a packaged composition comprising an opiate analgesic and a packaged composition comprising a PSD95-nNOS disrupting agent.
  • Fig. 1 is an illustration summarizing the interactions between an NMDA receptor, PSD95, and nNOS;
  • Fig. 2 is a graph of % control vs. log of concentration of compound (1) to determine the in vi tro IC 50 value for compound (1) ;
  • Fig. 3 is a graph of % control vs. concentration ( ⁇ M) of compound (1) showing the effect of compound (1) on NMDA vs. sodium nitroprusside (SNP) - induced cGMP elevation in cultured rat hippocampal neurons ;
  • Fig. 4 is a graph of % neuroprotection vs. treatment showing the effect of compound (1) on ischemic-induced cell death in organotypic hippocampal slice cultures;
  • Fig. 1 is an illustration summarizing the interactions between an NMDA receptor, PSD95, and nNOS;
  • Fig. 2 is a graph of % control vs. log of concentration of compound (1) to determine the in vi tro IC 50 value for compound (1)
  • FIG. 5 is a graph of normalized V max (mOD/- sec) vs. log of inhibition (M) showing the effect of compound (1) on rat brain nNOS
  • Fig. 6 is a graph of % inhibition vs. concentration of compound (1) (fmoles/mouse) showing the effect of compound (1) on thermal hyperalgesia induced by NMDA in a mouse tail-flick model and an NMDA-induced scratching and biting behavior
  • Fig. 7 is a graph of % maximum possible antihyperalgesic effect vs. compound dose (nmoles) for compound (1) and 7-nitroindazole (7-Ni) showing the effect of compound (1) on a model of chronic visceral hypersensitivity
  • FIG. 8 and 9 contain plots of mechanical pressure threshold for paw withdrawal (grams) vs. time (minutes) of the administration of compound (1) to illustrate the effect of vehicle (Fig. 8) and compound (1) (Fig. 9) on mechanical allodynia in neuropathic rats;
  • Fig. 10 is a graph of % control vs. concentration of Tat-nNOS (1-299) ( ⁇ M) showing the effect of Tat-nNOS (1-299) on the PSD95-nNOS interaction in vi tro;
  • Fig. 11 is a graph of % NMDA stimulation of cGMP level vs. log concentration of Tat-nNOS (1- 299) (M) showing the effect of Tat-nNOS (1-299) on NMDA-induced cGMP;
  • Fig. 10 is a graph of % control vs. concentration of Tat-nNOS (1-299) ( ⁇ M) showing the effect of Tat-nNOS (1-299) on the PSD95-nNOS interaction in vi tro
  • FIG. 12 is a graph of % inhibition vs. concentration of Tat-nNOS (1-299) (fmoles/mouse) showing the effect of Tat-nNOS (1-299) on thermal hyperalgesia induced by NMDA in a mouse tail-flick model and on NMDA-induced scratching and biting behavior;
  • Fig. 13 contains plots of pressure (grams) vs. time (minutes) showing the effect of Tat-nNOS (7 nmol i.t.) on mechanical allodynia;
  • Fig. 14 contains plots of % inhibition vs. concentration of compound (1) administered intra- thecally to mice showing tail flick latency and motor impairment five minutes after administration;
  • Fig. 15 contains plots of % inhibition vs.
  • Fig. 16 contains plots of % inhibition vs. time (post injection) for administration of compound (1) intrathecally and intraperitoneally to mice, followed by intrathecal NMDA administration, for tail flick latency.
  • nNOS neuronal
  • eNOS endo- thelial
  • iNOS inducible
  • nNOS binds to PSD95 and ⁇ l-syntrophin, which are scaffolding pro- teins expressed only in neurons and skeletal muscle, respectively.
  • Disrupting neuron-specific PSD95-nNOS interaction provides an alternative approach to selectively inhibiting nNOS. Therefore, agents that disrupt PSD95-nNOS interaction can be excellent therapeutic agents for various diseases and conditions, such as stroke, neurological diseases, neurodegenerative diseases, pain, and opiate tolerance, for example .
  • Disrupting agents of interaction between PSD95 ⁇ and nNOS Illustrate the role of nNOS in ⁇ the treatment of pain, opiate tolerance, and other diseases and conditions mediated by excitotoxicity of NMDR receptors .
  • nNOS inhibitors known to date exhibit only 10- to 30-fold inhibition selectivity for nNOS over the other two NOS forms.
  • disrupting agents to dislocate nNOS from PSD95, and thereby interfere with the NMDA receptor- PSD95-nNOS pathway, the result is specific disruption of nNOS function, without affecting its cata- lytic activity, or the catalytic activity of other NOS isoforms.
  • Such selective disrupting agents are excellent therapeutic agents in the treatment of neurological diseases, neurodegenerative diseases, neuropathic pain, and opiate tolerance, for example.
  • the test results presented herein clearly demonstrate that disrupting agents of PSD95-nNOS interaction not only inhibit nNOS function in cells, but also in animal models.
  • PSD95 Post Synapatic Density Protein 95 and related proteins. Accordingly, the term encompasses PSD95 (also known as Synapse Associated Protein 90 kDa or SAP-90) and its related protein, such as PSD93/- chapsyn-110, SAP97/hdlg, and SAP-102. See S.N. Gomperts, Cell , 84:659-662 (1996) and C.C. Garner et al . , (2000)). Each of these proteins mediates the coupling of nNOS to NMDA receptors in the central nervous system (CNS) .
  • CNS central nervous system
  • IC 50 value of a compound is de- fined as the concentration of the compound required to produce 50% inhibition of biological or enzymatic activity.
  • pharmaceutically acceptable carrier is defined as to compounds suitable for use in contact with recipient animals, preferably mammals, and more preferably humans, and having a toxicity, irritation, or allergic response commensurate with a reasonable benefit/risk ratio, and effective for their intended use.
  • alleviate is defined as lessening, relieving, and/or mitigating pain. As such, pain experienced by an individual is made more bearable, but is not necessarily completely eliminated.
  • treating and “treatment” is defined as preventing, lowering, stopping, or reversing the progression or severity of the condition or symptoms being treated.
  • the terms “treating” and “treatment” include both medical therapeutic and/or prophylactic administration, as appropriate.
  • the term “container” is defined as any receptacle and closure therefore suitable for storing, shipping, dispensing, and/or handling a pharmaceutical product .
  • the term “insert” is defined as information accompanying a product that provides a description of how to administer the product, along with the safety and efficacy data required to allow the physician, pharmacist, and patient to make an in- formed decision regarding use of the product.
  • the package insert typically is prescribed by a regula- tory agency as part of the approval or licensing of the medicine, and generally is regarded as the "label" for a pharmaceutical product.
  • reducing or reversing opiate analgesic tolerance is defined as the ability of a compound to reduce the dosage of an opiate analgesic administered to an individual to maintain a level of pain control previously achieved using a greater dosage of opiate analgesic.
  • sensing and “sensation” of pain are defined as an awareness of pain in an individual due to stimulation of a sense organ.
  • nociceptive pain is defined as pain caused by an injury to a body tissue.
  • nociceptive pain examples include, but are not limited to, postoperative pain, cancer pain (e.g., pain from a tumor invading bones or organs, or pain resulting from cancer treatments, such as surgery or radiation therapy) , or pain resulting from tissue damage (e.g., degenerative joint disease or fractures).
  • cancer pain e.g., pain from a tumor invading bones or organs, or pain resulting from cancer treatments, such as surgery or radiation therapy
  • tissue damage e.g., degenerative joint disease or fractures.
  • the term "neuropathic pain” is defined as pain caused by abnormalities in the nerves, spinal cord, or brain. In most types of neuropathic pain, indications of an original injury are gone and the reported pain is unrelated to an observable injury or condition. With neuropathic pain, certain nerves continue to send pain messages to the brain, even though there is no ongoing tissue damage.
  • Neuropathic pain also may be caused by changes in neuron- al connections or chemistry in the central nervous system. Neuropathic pain is different from nocicep- tive pain caused by an underlying injury. Neuropathic pain is a type of chronic pain, but usually has distinct features from chronic pain of a muscu- loskeletal nature. Neuropathic pain may be felt as a burning or tingling sensation, or as a hypersensi- tivity to touch or cold. Neuropathic pain includes, but is not limited to, such syndromes as phantom limb pain, carpel tunnel syndrome, postherpetic neuralgia, reflex sympathic dystrophy, and causalgia.
  • acute pain is defined as a pain lasting less than about three to about six months, or a pain that is directly related to tissue damage, e.g., pain experienced from an incision or needle prick.
  • chronic pain is defined as a pain that lasts more than about three to about six months, or beyond the point of tissue healing.
  • chronic pain problems i.e., chronic pain due to an identifiable pain generator (e.g., an injury) and chronic pain with no identifiable pain generator (e.g., the injury has healed) .
  • Chronic pain usually is less directly related to identifiable tissue damage and structural problems.
  • Nonlimiting examples of chron- ic pain include, but are not limited to, chronic back pain without a clearly determined cause, failed back surgery syndrome (i.e., continued pain after the surgery has completely healed) , and fibromy- algia.
  • the term "inflammatory pain” is defined as a pain associated with the soft tissues, joints, and bones of an individual .
  • the cause of inflammatory pain can be, for example, osteoarthritis, rheumatoid arthritis, inflammatory myopathies, and muscle, tendon, or ligament injury due to sports or exercise.
  • hypoalgesia is defined as a shift of the pain stimulus-response function wherein an individual senses an excessive sensitivity to pain in relation to the intensity of the stimulus, i.e., an increased or exaggerated response to a normally painful stimulus.
  • the term “hyperalgesia” is used for cases wherein an individual senses an increased pain response at a normal threshold, or at an increased threshold, e.g., in patients with neuropathy.
  • allodynia is defined as a condition wherein an ordinarily nonpainful stimulus evokes pain, i.e., a sensation of pain in response to a stimulus that normally does not provoke a pain sensation.
  • Allodynia involves a change ⁇ in the qual- ity of a sensation, whether tactile, thermal, or of any other sort, wherein the original response to a stimulus was not a pain sensation, but the present response is a pain sensation.
  • hyperalgesia represents an augmented pain response to a normally painful stimulus.
  • a compound of formula (I), or a physiologically acceptable salt or solvate thereof, can be administered as the neat compound, or as a pharmaceutical composition con- taining either entity.
  • a "therapeutically effective dose” refers to that amount of an active compound that, pursuant to a given mode of administration, results in achieving the desired effect.
  • Toxicity and thera- Commissionic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD 50 (the dose lethal to 50% of the population) and the ED 50 (the dose therapeutically effective in 50% of the population) .
  • the ratio between a toxic and a therapeutically affective does is termed the therapeutic index."
  • Compounds which exhibit high therapeutic indices are preferred.
  • Such data can be used in formulating a range of dosages for use in humans or other animals.
  • the dosage of such compounds preferably lies within a range of circulating concentrations that include the ED 50 with little or no toxicity.
  • the dosage can vary within this range depending upon the dosage form employed, and the route of administration utilized.
  • Disrupting agents, and pharmaceutical compositions containing the same, suitable for use in the present invention include those wherein the active ingredient is administered in an amount effective to achieve its intended purpose. More specifically, a "therapeutically effective amount” means an amount, pursuant to a given mode of administration, that is effective to prevent development of symptoms, or to alleviate the existing symptoms of, in the subject being treated. Determination of an effective amount of a given active compound is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
  • One class of compounds found to be effective in the selective disruption of PSD95-nNOS interaction has a general structural formula (I) :
  • R 2 is hydro or OH;
  • R a independently, is selected from the group consisting of hydro, C ⁇ _alkyl, aryl, and het- eroaryl; and n is an integer 0 through 4, wherein two R 1 groups can be taken together with the carbon atoms to which they are attached to form an optionally substituted 5- to 7-member
  • alkyl includes straight chained and branched hydrocarbon groups containing the indicated number of carbon atoms, typically methyl, ethyl, propyl, and butyl groups.
  • halo is defined herein to include fluoro, bromo, chloro, and iodo .
  • aryl alone or in combination, is defined herein as a monocyclic or polycyclic aromatic group, preferably a monocyclic or bicyclic aromatic group, e.g., phenyl or naphthyl .
  • an "aryl” group can be unsubstituted or substituted, for example, with one or more, and in particular one to four, halo, alkyl, trifluoromethyl, trifluoromethoxy, hydroxyalkyl , alkoxy, alkoxyalkyl, haloalkyl, nitro, amino, alkylamino, acylamino, alkylthio, and alkylsulfonyl .
  • Exemplary aryl groups include phenyl, naphthyl, tetrahydronaphthyl, and the like, both unsubstituted and substituted.
  • heteroaryl is defined herein as a monocyclic or bicyclic ring system containing one or two aromatic rings and containing at least one nitrogen, oxygen, or sulfur atom in an aromatic ring, and which can be unsubstituted or substituted, for example, with one or more, and in particular one to four, substituents, like halo, alkyl, trifluoromethyl, trifluoromethoxy, hydroxy, hydroxyalkyl, alkoxy, alkoxyalkyl, haloalkyl, nitro, amino, alkyl- amino, acylamino, alkylthio, and alkylsulfonyl .
  • heteroaryl groups include thienyl, furyl, pyridyl, oxazolyl, quinolyl, isoquinolyl, indolyl, triazolyl, isothiazolyl, isoxazolyl, imid- izolyl, benzothiazolyl, pyrazinyl, pyrimidinyl, thiazolyl, and thiadiazolyl, both unsubstituted and substituted.
  • hydro is defined as -H.
  • hydroxy is defined as -OH.
  • alkoxy is defined as -OR, wherein R is C ⁇ _. 6 alkyl .
  • amino is defined as -NH 2
  • alkylamino is defined as -NR 2 , wherein at least one R is C ⁇ - 6 alkyl and the second R is Cx-gal yl or hydrogen.
  • alkylthio is defined as -SR, wherein R is C; ⁇ . _. 6 alkyl .
  • alkylsulfonyl is defined as RS0 2 -, wherein R is alkyl.
  • trifluoromethyl is defined as -CF 3 .
  • trifluoromethoxy is defined as
  • cyano is defined as -CN.
  • hydroxyalkyl is defined as a hydroxy group appended to a C ⁇ _ 6 alkyl group .
  • alkoxyalkyl is defined as a
  • haloalkyl is defined as a C-salkyl group substituted with one or more halo groups.
  • nitro is defined as -N0 2 .
  • n is 0 to 3;
  • two R 1 groups are taken together to form a 5- or 6-membered heteroaryl group, for example:
  • two R 1 groups are taken together, with the phenyl ring to which they are attached, to form a bicyclic aromatic ring system, for example, naphthalene, indene, benzoxazole, benzothiazole, benzisoxazole, benzimidazole, quin- oline, indole, benzothiophene, or benzofuran; or two R 1 groups are taken together to form
  • p is 1 or 2
  • G independently, is C(R a ) 2 , O, S, or NR a .
  • p is 1 or 2
  • G independently, is C(R a ) 2 or O.
  • Additional compounds of structural formula (I) that can be used as an effective disruptor of the PSD95-nNOS interaction include, but are not limited to:
  • salts of the compounds of formula (I) also can be used. These salts include acid addition salts formed with pharmaceutically acceptable acids. Examples of suitable salts include, but are not limited to, the hydro- chloride, hydrobromide, sulfate, bisulfate, phos- phate, hydrogen phosphate, acetate, benzoate, suc- cinate, fumarate, maleate, lactate, citrate, tar- trate, gluconate, methanesulfonate, benzenesul- fonate, and p-toluenesulfonate salts.
  • suitable salts include, but are not limited to, the hydro- chloride, hydrobromide, sulfate, bisulfate, phos- phate, hydrogen phosphate, acetate, benzoate, suc- cinate, fumarate, maleate, lactate, citrate, tar- trate, gluconate, methanesulfonate, benzen
  • the compounds of formula (I) also can provide pharmaceutically acceptable metal salts, in particular alkali metal salts and alkaline earth metal salts, with bases. Examples include the sodium, potassium, lithium, magnesium, and calcium salts.
  • a compound of structural formula (I) also can be administered as a prodrug.
  • pro- drug refers to compounds that are rapidly transformed in vivo to a compound having structural formula (I), for example, by hydrolysis. Prodrug design is discussed generally in Hardma et al. (eds.), Goodman and Gilman's The Pharmacological Basis of Therapeutics, 9th ed. , pp. 11-16 (1996). A thorough discussion is provided in Higuchi et al . , Prodrugs as Novel Delivery Systems, Vol . 14 , ASCD
  • prodrugs can be converted into a pharmacologically active form through hydro- lysis of, for example, an ester or amide linkage, thereby introducing or exposing a functional group on the resultant product.
  • the prodrugs can be designed to react with an endogenous compound to form a water-soluble conjugate that further enhances the pharmacological properties of the compound, for example, increased circulatory half-life.
  • prodrugs can be designed to undergo covalent modification on a functional group with, for example, glucuronic acid, sulfate, glutathione, amino acids, or acetate. The resulting conjugate can be inactivated and excreted in the urine, or rendered more potent than the parent compound.
  • PSD95-nNOS disrupting agents of general structural formula (I) generally have an IC 50 value of less than about 200 ⁇ M, preferably less than about 100 ⁇ M, even more preferably less than about 50 ⁇ M, and usually from about 0.005 to 60 ⁇ M. Most preferably, a present PSD95-nNOS disrupting agent has an IC 50 value of less than about 60 ⁇ M.
  • various natural product extracts have been shown to successfully disrupt the PSD95-nNOS interaction.
  • PSD95 In addition to the compounds of structural formula (I) and natural product extracts that disrupt the protein-protein interaction between nNOS and PSD95, peptide inhibitors based on the C-ter- minal sequence of proteins that bind PSD95 also are useful.
  • the PSD95 family of proteins is responsible for cell-surface clustering of Shaker-subfamily K + channels. This interaction is mediated by direct binding of the C-terminal cytoplasmic tails of the K + channel subunits to two PDZ domains in the PSD95 protein.
  • Yeast dihybrid analysis and in vi tro bind- ing showed that the C-terminal 11 residues of K + channel, vl.4C, are sufficient to interact with PSD95, and that the last 5 amino acids (i.e., VETDV, SEQ ID NO: 1) are essential (E. Kim et al . , Nature, 378:85-88 (1995); K.S. Christopherson, (1999), supra) reported that a peptide containing the last nine residues of the Kvl.4C channel can inhibit the protein-protein interaction between nNOS and PSD95. Peptide inhibitors based on the last nine residues of Kvl.4C were generated and tested for their ability to inhibit nNOS-PSD95 interaction.
  • Results are summarized in Table 1.
  • This peptide when attached to the antennapedia sequence, has been reported to inhibit the protein-protein interaction of nNOS-PSD95 with similar potency to that for nNOS and syntrophin (an anchoring protein found in muscle) .
  • the critical region for the inhibitory activity of the nNOS-PSD95 interaction also was found to lie in the last five residues of Kvl.4C protein (VETDV) .
  • This short five amino acid (aa) peptide was found to be a potent inhibitor (IC 50 value of about 2 ⁇ M) , with a greater than 150-fold selectivity for the nNOS-PSD95 interaction over that for the nNOS-syntrophin interaction.
  • the peptide inhibitors synthesized from this series all demonstrated a high selectivity for disruption of the nNOS-PSD95 interaction.
  • Structure-activity findings showed that the valine residue beginning the sequence VETDV may be N-acetylated, changed to proline, linked to the Tat protein, or deleted entirely, while retaining the ability of the pentapeptide to inhibit nNOS-
  • PSD95 interaction Inhibition is further maintained when the second acidic residue, i.e., glutamate, is replaced by the acidic homolog aspartate or the neutral amide analog glutamine, but not when replaced by the basic amino acids histidine or lysine.
  • the threonine at the center of the sequence may be required for inhibition of the interaction of nNOS- PSD95 because conservative changes to serine or valine led to loss of activity. The exchange of threonine and its adjacent aspartate also eliminates activity.
  • the acidic aspartate in the fourth posi- tion can be altered to the neutral residue aspar- agine, the basic residue histidine, or the homologous acidic amino acid glutamate (if the second residue is changed from glutamate to aspartate) , but not replaced with the hydrophobic amino acid leu- cine.
  • the C-terminal valine residue can be replaced with other hydrophobic amino acids, such as leucine and isoleucine with maintenance of some activity. However, substitutions with glycine or alanine re- suit in inactive peptides. Neutralization of the C- terminal carboxyl group by formation of the amide leads to no inhibition of nNOS-PSD95 interaction.
  • N-terminal valine residue of VETDV can be deleted with only a ten-fold loss in potency
  • a peptidomimetic drug design strategy starting with the simpler tetrapep- tide ETDV (SEQ ID NO: 2) should provide inhibitors of the nNOS-PSD95 interaction.
  • the ability to simultaneously neutralize two acidic residues with only a ten-fold loss in potency also is notable from a drug design standpoint. It further is anticipated that the stereochemistry of the amino acids at the backbone and in the side chains can affect potency and selectivity.
  • A-B-C-D-E wherein A is null, Pro, or Val, having a terminal NH 2 group that optionally can be acetylated or linked to Tat; B is Glu, Gin, or Arg; C is Thr; D is Asp, Asn, or His; E is Val, Leu, or lie having a terminal -C0 2 H group; and wherein B can be Asp, if D is Glu.
  • the Tat sequence also can be attached to any of these peptides to facilitate entry into cells.
  • Tat peptides (based on the VETDV sequences shown in Table 1) that disrupt the nN0S-PSD95 interaction are envisioned to disrupt NMDA-increased cGMP production in primary neuronal cultures and to inhibit NMDA-nNOS dependent hyperalgesia in animal pain models.
  • Another approach to disrupting PSD95-nN0S protein-protein interaction is to administer a catalytically inactive nNOS that retains the PSD95 binding region.
  • the first 300 residues of nNOS (1- 299) contain the three PDZ binding regions critical for interacting with the PDZ domains of PSD95.
  • nNOS nNOS
  • the Tat sequence S.R. Schwarze et al . , Science, 285 : 1569-1572 (1999)
  • HIV protein therefore is fused with nNOS (1-299) to generate Tat-nNOS (1-299) .
  • This fusion protein is envisioned to enter cells and displace the wild type catalytically active nNOS from binding to PSD95. This displacement disrupts the nNOS targeting to PSD95, uncouples nNOS from NMDA receptor, and thus inhibits the NMDA receptor-PSD95-nNOS pathway.
  • nNOS (1-299) is inserted into pRSET vector with the Tat sequence already engineered to generate an N-terminal Tat se- quence to the resulting fusion protein.
  • This fusion protein inhibited in vi tro binding of nNOS to PSD95 with an IC 50 value of 1 ⁇ M. It also inhibited NMDA- increased cGMP production in primary cultures of hippocampal neurons with an EC 5Q value of 3 ⁇ M.
  • Tat-nNOS was administered intrathecally (i.t.) into mice, it inhibited NMDA-induced hyperalgesia with EC 50 value of pmole/mouse .
  • nNOS region for binding PSD95 resides in amino acids 16-130 (Christopherson et al . , (1999)). Deletion of residues N- or C-terminal to this region results in loss of binding. It is envisioned that Tat-nNOS (16-130) will inhibit NMDA- nNOS-dependent pathways in cell cultures and in animal models, while Tat-nNOS sequences that do not inhibit the nNOS-PSD95 interaction will have no effect. The same applies for mutations on nNOS that would disrupt nNOS-PSD95 interactions. Mutations of residues E108, T109, T110, or Fill, i.e., residues on nNOS that are critical for PSD95 binding (H.
  • PSD95-nNOS disrupting agents are of interest for use in therapy, specifically for the treatment of a variety of conditions where selective inhibition of the NMDA-PSD95-nNOS pathway is considered to be beneficial.
  • Disruption of PSD95 ⁇ nNOS interaction is a particularly attractive target to attenuate excitotoxicity of NMDA receptors .
  • a potent and selective disruption of PSD95-nNOS interaction reduces or eliminates the production of excessive amounts of NO in the NMDA receptor-PSD95-nNOS pathway, which is beneficial in the treatment of various disease states .
  • An especially important use is the treatment of acute and chronic pain. Excessive production of NO in the NMDA receptor-PSD95-nNOS pathway increases neurotoxicity and hypersensitivity of neurons, which leads to hyperalgesia. Opiate anal- gesics are marginally effective, or ineffective, in the treatment of such pain states, thus the condi- tion has a natural tolerance to opiate analgesics.
  • PSD95- nNOS disrupting agents of the present invention are useful in the treatment of acute and chronic pain conditions, including neuropathic pain.
  • a disrupt- ing agent of the present invention can be used, either alone to reduce hyperalgesia and opiate tolerance, or in combination with an opiate analgesic such that the amount of the opiate analgesic dose can be reduced to achieve a predetermined reduction in pain.
  • pain indications have been grouped in two ways, i.e., (a) acute, chronic, and neuropathic pain, wherein neuropathic pain is considered either a subset of chronic pain or distinct from it) , and (b) grouping pain indications by where the pain is felt.
  • the present invention is useful in the treatment of pain originating from soft tissues, joints, and bones, for example, acute and postoperative pain; osteoarthritis; rheumatoid arthritis; and pain of muscles, tendons, and ligaments (including, but not limited to, trauma and sports/exercise injuries, inflammatory myopathies, muscle cramps, myalgia of neurogenic origin, drug-induced myalgia, myalgic encephalomyelitis and muscle pain of uncer- tain cause) ; chronic back pain; upper extremity pain; and fibromyalgia.
  • the present invention also is useful in the treatment of deep and visceral pain including, but not limited to, abdominal pain (including chronic abdominal pain, for example) , pain from acute appendicitis, mesenteric lymphadenitis, Crohn's disease, tubo-ovarian disorders, renal disorders, acute and chronic pancreatitis, peritonitis, AIDS, intestinal obstruction, opiate withdrawal, atypical gastro-oesophageal reflux disorders, gastric ulcer, irritable bowel syndrome, constipation) ; heart, vascular, and haemopathic pain; chronic pelvic pain; obstetric pain; and genitourinary pain.
  • abdominal pain including chronic abdominal pain, for example
  • the invention also can treat pain in the head area, for example, orofacial pain (including dental pain, periodontal pain, gingival pain, and mucosal pain) ; trigeminal, eye, and ear pain; and headache (including migraine and headache associated with head trauma, vascular disorders, substance withdrawal, or a metabolic disorder) .
  • Nerve and root damage pain also can be treated by the present invention.
  • Additional pain states treatable by the present invention include central nervous system pain, e.g., central pain or spinal cord injury, and cancer pain, attributed either to the cancer or a treatment for the cancer.
  • Specific pain types and pain syndromes treatable by the present invention include, but are not limited to, chronic and acute arthritis pain; chronic and acute back pain; cancer pain; failed back syndrome; fibromyalgia; herpes zoster (shingles) ; intercostal pain; myofascial pain dysfunction syndrome; neck, arm, and shoulder pain; neuralgias/neuropathy; occipital neuralgia; phantom limb pain; postherpetic neuralgia; postoperative pain; reflex sympathetic dystrophy; thoracic pain; sacroiliac "SI" joint pain; headaches (including migraine) ; posttrauma pain; sciatica; facial pain (trigeminal neuralgia) ; musculoskeletal pain; complex regional (reflex sympathetic dystrophy or causalgia) ; degenerative
  • PSD95-nNOS disrupting agents of the present invention are envisioned primarily for the treatment of pain in mammals, they also can be used for the treatment of other disease states.
  • a further aspect of the present invention is to provide a PSD95-nNOS disrupting agent for use in the treatment of neurological disorders and neurodegenerative disorders, or other disorders mediated by the NMDA receptor-PSD95-nNOS pathway.
  • Conditions and diseases treatable by the present invention include, but are not limited to, ischemic brain damage, stroke, Parkinson's disease, Hunting- ton's disease, seizures, epilepsy, amyotrophic lateral sclerosis, psychiatric disorders, Duchenne (or pseudohypertrophic) muscular dystrophy, traumatic brain injury, Becker muscular dystrophy, limb-girdle muscular dystrophy, and fascioscapulohumeral muscu- lar dystrophy.
  • a PSD95-nNOS disrupting agent can be used alone, or in combination with a second therapeutic agent useful in the treatment of the disease or condition.
  • Therapeutic agents useful in the treatment of a particular disease or condition are well known to persons skilled in the art.
  • the present invention is directed to the simultaneous or sequential administration of an opiate analgesic and a PSD95-nNOS disrupting agent to prevent and/or treat pain.
  • the administration of morphine and a PSD95-nNOS disrupting agent potentiates the analgesic effect of morphine, and, therefore, the dose of morphine can be reduced, while providing an analgesic effect equivalent to administering a higher dose of morphine alone .
  • the reduced dose of morphine also reduces adverse side effects associated with morphine administration, and can significantly reduce the addiction potential of morphine in susceptible individuals.
  • the present invention also is directed to the administration of a PSD95-nNOS disrupting agent to an individual to reduce or reverse opiate analgesic tolerance in the individual.
  • an opi- ate analgesic can be used in the treatment of hyperalgesia.
  • administration of a PSD95-nNOS disrupting agent allows the dose of opiate analgesic to remain constant, or to be reduced, while maintaining the desired pain-reducing effect.
  • the occurrence of adverse side effects attributed to the opiate analgesic can be reduced, and the possi- bility of opiate analgesic dependence is reduced-
  • the analgesic and disrupting agent can be administered simultaneously or sequentially to achieve the desired effect of pain treatment or reduction or reversal of opiate analgesic tolerance.
  • An opiate analgesic utilized in the present invention can be one or more opium alkaloid or semisynthetic opiate analgesic.
  • Specific opiate analgesics include, but are not limited to, (a) opium; (b) opium alkaloids, such as morphine, morphine sulfate, codeine, codeine phosphate, codeine sulfate, diacetylmorphine, morphine hydrochloride, morphine tartrate, and diacetylmorphine hydrochloride; and (c) semisynthetic opiate analgesics, such as dextromethorphan hydrobromide, hydrocodone bi- tartrate, hydromorphone, hydromorphone hydrochloride, levorphanol tartrate, oxymorphone hydrochloride, and oxycodone hydrochloride.
  • opioids include, but are not limited to, fentanyl, meperi- dine, methodone, alfentanil, remifentanil, sul- fentanil, and propoxyphene .
  • an opiate analgesic is present in a composition, or is administered, with a PSD95-nNOS disrupting agent in a weight ratio of analgesic-to-antagonist of about 0.01:1 to about 100:1, preferably about 0.02:1 to about 50:1, and most preferably about 0.1:1 to about 10:1. This ratio depends upon the type and identity of opioid analgesic and disrupting agent being used.
  • the ratio of analgesic-to-disrupting agent that is ad- ministered is dependent upon the particular analgesic and disrupting agent, and the origin and severity of the pain being treated. This ratio can be readily determined by a person skilled in the art to achieve the desired reduction in pain.
  • the opiate analgesic and disrupting agent can be administered to mammals in methods of treating pain.
  • the opiate analgesic and disrupting agent can be formulated in suitable excipients for oral administration, or for parenteral administration. Such excipients are well known in the art .
  • the active agents typically are present in such a composition in an amount of about 0.1% to about 75% by weight, either alone or in combination.
  • compositions containing the active agents are suitable for administration to humans or other mammals.
  • the pharmaceutical compositions are ster- ile, and contain no toxic, carcinogenic, or mutagen- ic compounds that would cause an adverse reaction when administered.
  • the method of the invention can be accomplished using the active agents as described above, or as a physiologically acceptable salt, prodrug, or solvate thereof.
  • the active agents, salts, pro- drugs, or solvates can be administered as the neat compounds, or as a pharmaceutical composition containing either or both entities.
  • the active agents can be administered by any suitable route, for example by oral, buccal, inhalation, sublingual, rectal, vaginal, intracis- ternal through lumbar puncture, transurethral, nasal, percutaneous, i.e., transdermal, or parenteral (including intravenous, intramuscular, subcutane- ous, and intracoronary) administration.
  • Parenteral administration can be accomplished using a needle and syringe, or using a high pressure technique, like POWDERJECTTM.
  • Administration of the active agents can be performed before, during, or after the onset of pain. The exact formulation, route of administration, and dosage is determined by an individual physician in view of the patient's condition.
  • Dosage amounts and intervals can be adjusted individ- ually to provide levels of active agents that are sufficient to maintain therapeutic or prophylactic effects.
  • the amount of active agents administered is related to the subject being treated, on the subject's weight, the severity of the affliction, the manner of administration, and the judgment of the prescribing physician.
  • oral dosages of an opiate analgesic and PSD95- nNOS disrupting agent individually generally are about 10 to about 200 mg daily for an average adult patient (70 kg) , typically divided into two to three doses per day.
  • individual tablets or capsules contain about 0.1 to about 200 mg opioid analgesic and about_ 0_._1 to about 50 mg disrupting agent, in a suitable pharmaceutically acceptable carrier, for administration in single or multiple doses, once or several times per day.
  • Dosages for intravenous, buccal, or sublingual administration typically are about 0.1 to about 10 mg/kg per single dose as required.
  • the physician determines the actual dosing regimen that is most suitable for an individual patient, and the dosage varies with the age, weight, and response of the particular patient.
  • the above dosages are exemplary of the average case, but there can be individual instances in which higher or lower dosages are merited, and such are within the scope of this invention.
  • the active agents of the present invention can be administered alone, or in admixture with a pharmaceutically acceptable carrier selected with regard to the intended route of administration and standard pharmaceutical practice.
  • Pharmaceutical compositions for use in accordance with the present invention thus can be formulated in a conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries that facilitate processing of the active agents into preparations that can be used pharmaceutically.
  • These pharmaceutical compositions can be manufactured in a conventional manner, e.g., by conventional mixing, dissolving, granulating, dragee- making, emulsifying, encapsulating, micronizing, en- trapping, or lyophilizing processes. Proper formulation is dependent upon the route of administration chosen.
  • the composition typically is in the form of a tablet, capsule, powder, solution, or elixir.
  • the composition can additionally contain a solid carrier, such as a gelatin or an adjuvant.
  • the tablet, capsule, and powder contain about 5% to about 95% of an active agent of the present invention, and preferably from about 25% to about 90% of an active agent of the present invention.
  • a liquid carrier such as water, petroleum, or oils of animal or plant origin, can be added.
  • the liquid form of the composition can further contain physiological saline solution, dextrose or other saccharide solutions, or glycols.
  • the composition When administered in liquid form, the composition contains about 0.5% to about 90% by weight of active agents, and preferably about 1% to about 50% of an active agents.
  • a therapeutically effective amount of an active agent When a therapeutically effective amount of an active agent is administered by intravenous, cutaneous, or subcutaneous injection, the composition is in the form of a pyrogen-free, parenterally acceptable aqueous solution.
  • the preparation of such parenterally acceptable solutions having due regard to pH, isotonicity, stability, and the like, is within the skill in the art.
  • a preferred composition for intravenous, cutaneous, or subcutaneous injection typically contains, in addition to a com- pound of the present invention, an isotonic vehicle. Suitable active agents can be readily combined with pharmaceutically acceptable carriers well-known in the art.
  • Such carriers enable the active agents to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated.
  • Pharmaceutical preparations for oral use can be obtained by adding the active agents with a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients include, for example, fillers and cellulose preparations. If desired, disintegrating agents can be added.
  • the active agents can be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
  • Formulations for injection can be presented in unit dosage form, e.g., in ampules or in multidose containers, with an added preservative.
  • the compositions can take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and can contain formulatory agents, such as suspending, stabilizing, and/or dispersing agents.
  • Pharmaceutical compositions for parenteral administration include aqueous solutions of the active agent in water-soluble form. Additionally, suspensions of the active agents can be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils or synthetic fatty acid esters.
  • Aqueous injection suspensions can contain substances which increase the viscosity of the suspension.
  • the suspension also can contain suitable stabilizers or agents that increase the solubility of the compounds and allow for the preparation of highly concentrated solutions.
  • a present composition can be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
  • the active agents also can be formulated in rectal compositions, such as suppositories or retention enemas, e.g., containing conventional suppository bases.
  • the active agents also can be formulated as a depot preparation. Such long-acting formulations can be administered by implantation (for example, subcutaneously or intramuscularly) or by intramuscular injection.
  • the active agents can be formulated with suitable polymeric or hydrophobic materials (for example, as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • the active agents can be administered orally, buccally, or sublingually in the form of tablets containing excipients, such as starch or lactose, or in capsules or ovules, either alone or in admixture with excipients, or in the form of elixirs or suspensions containing flavoring or coloring agents.
  • excipients such as starch or lactose
  • capsules or ovules in capsules or ovules, either alone or in admixture with excipients, or in the form of elixirs or suspensions containing flavoring or coloring agents.
  • Such liquid preparations can be prepared with pharmaceutically acceptable additives, such as suspending agents.
  • An active agent also can be injected parenterally, for example, intravenously, intramuscularly, subcutaneously, intrathecally, intracisternally, or intracoronarily.
  • the active agent is best used in the form of a sterile aqueous solution which can contain other substances, for example, salts, or monosaccharides, such as mannitol or glucose, to make the solution isotonic with blood.
  • the active agents are administered as a suitably acceptable formulation in accordance with normal veterinary practice. The veterinarian can readily determine the dosing regi- men and route of administration that is most appropriate for a particular animal.
  • Example 1 Expression and Purification of Recombinant nNOS and PSD95 PDZ-Binding Regions Construction of Recombinant GST-nNOS
  • nNOS containing the PSD95 binding domains, but lacking the catalytic domain was expressed in E. coli as a GST-fusion protein, and purified for use in the in vi tro nNOS-PSD95 binding assay.
  • the coding sequence of human nNOS (accession No. D16408) was amplified from the human rat brain library (Clontech) according to the manufacturer ' s protocol , and subcloned into pCR2.1 for sequencing.
  • nucleotides 1-897 of the ORF (corresponding to amino acids (aa) 1-299) were amplified using the following primers :
  • Antisense primer (CCG) 5' CTC GAG CCT AGG GGC TGC CAT TC Xhol aa 299 (SEQ ID NO: 27)
  • the primers also served to introduce EcoRI and Xhol cloning sites into the 5 ' and 3 ' flanking regions respectively.
  • this sequence (“nNOS (1-299)”) was subcloned using standard recombinant techniques into the EcoRI-Xhol sites of pGEX 4T3 , such that the clone was in frame with the GST tag of the vector (“GST-nNOS").
  • Bacterial cultures expressing GST-nNOS were grown in LBM/Carb overnight at 37°C.
  • the cultures were diluted 1:25 into 1 liter of LB medium (Luria-Butani medium) /50 ⁇ g/mL carbenicillin and grown at 37°C until a final OD 6 oo of 0.6.
  • the cultures then were induced with 0.2 mM IPTG (isopropyl ⁇ -D-thiogalactopyranoside) for 2 hrs (hours) at 37°C before the cells were harvested by centrifugation at 5000 rpm for 10 min (minutes) at 4°C.
  • IPTG isopropyl ⁇ -D-thiogalactopyranoside
  • Bacterial cultures expressing GST-nNOS were harvested, and the GST-protein purified according to the manufacturer's instruction (Pharmacia) . Briefly, the bacterial cell pellet was lysed with calcium- and magnesium- free phosphate buffered saline (CMF-PBS) , 0.5% TRITON 8 X-100 (50 mL per 1 liter of culture) , and 50 ⁇ L of 100 mg/mL hen egg lysozyme (Sigma) . After incubation on ice for 45 min, the lysate was sonicated 3 times for 10 sec (seconds) , then centrifuged at 10,000 rpm for 15 min at 4°C.
  • CMF-PBS calcium- and magnesium- free phosphate buffered saline
  • TRITON 8 X-100 50 mL per 1 liter of culture
  • hen egg lysozyme Sigma
  • Soluble super- natant was applied to 50% glutathione SEPHAROSE ® 4B (Pharmacia) bead slurry (1 mL per 1 liter of culture) previously blocked for 1 hr in 2% milk, 0.1% BSA (bovine serum albumin) , lx CMF-PBS and washed with CMF-PBS. After three bed volume washes using CMF-PBS/0.5% TRITON ® X-100, the resin was washed again with CMF-PBS. nNOS (1-299) was eluted directly from the column by cleaving the protein off of GST resin with thrombin (50 units; Pharmacia) diluted in CMF-PBS.
  • the resin was rotated for 4 hr at room temperature before eluate was' collected.
  • a single peak containing cleaved nNOS (1-299) was eluted and analyzed by SDS-polyacrylamide gel elec- trophoresis. This cleaved nNOS (1-299) then was used in the plate binding assay to measure the interaction between nNOS (1-299) and PSD95.
  • PDZ domains 1-3 of PSD95 were used in the nNOS-PSD95 binding assay.
  • human PSD95 accession no. NM 001365
  • Recombinant PSD95 (PDZ 1-3, aa 1-435) was PCR-amplified from pCR2.l/PSD95 using the following oligonucleotides:
  • Antisense primer 5" AAGCTTCTACTGAGCAATGATCGTGAC (SEQ ID NO: 29) Hindlll
  • the PCR-amplified fragment again was cloned into pCR2.1, digested with Ncol and Hind-III, then ligated into similarly-digested pPinArab (referred to as Biotin expression plasmid in U.S. Patent No. 6,107,104, example 13) to make an in- frame fusion with the biotin acceptor peptide.
  • the ligated vector and insert then were transformed into TOP10 cells (Stratagene, Torrey Pines, CA) and plas- mid DNA was isolated with the QiAprep 8 miniprep kit (Qiagen, Thousand Oaks, CA) .
  • Neuronal NOS (1-299) was subcloned into pRSET-B vector (Invitrogen, CA) with Tat, and 3E9 sequences inserted upstream to the open reading frame of nNOS (1-299) .
  • pRSET-B vector Invitrogen, CA
  • 3E9 sequences inserted upstream to the open reading frame of nNOS (1-299) .
  • Sense oligonucleotide Sense oligonucleotide:
  • Antisense oligonucleotide
  • the oligonucleotides were annealed by heating to 94°C for 3 min, and then slowly cooled to room temperature (one degree per min) to form an oligonucleotide double-stranded cassette.
  • the cassette had 5' overhangs for subcloning into the pRSET-B vector.
  • the resulting annealed oligonucleo- tides have the following (sense) sequence (SEQ ID NO: 32) that codes for the peptides or amino acids indicated below the nucleotide sequence . Restriction enzyme sites are indicated in italics:
  • pRSET/Tat-3E9 Plasmid construction for Tat-nNOS (1-299)
  • nNOS nNOS 1-299
  • the coding sequence for nNOS (1-299) was PCR-amplified using GST-nNOS (1-299) as a template with the following oligonucleotides:
  • Antisense oligonucleotides with Xho I site 5' GGCCTCGAGCCTAGGGGCTGCCAT TCT TTG (SEQ ID NO: 34) Xho I Stop
  • nNOS (1-299) sequence was subcloned using standard recombinant techniques into the EcoR I-Xho I sites of pRSET/Tat- 3E9 vector, such that the clone was in frame with both Tat and 3E9 sequences.
  • Bacteria expressing pRSET/nNOS (1-299) (or Tat-nNOS) were grown in LBM/Carb overnight at 37°C. Cells then were diluted 1:250 into 1 liter of LB/- Carb and grown to an OD 60 o of 0.6. Cells were induced with 0.5 M IPTG for 2 hrs at 37°C. Cells were harvested by centrifugation and lysed with 8 M urea, 100 mM NaH 2 P0 4 , and 10 mM Tris, pH 8.0.
  • Tat- nNOS was batch purified using Ni-NTA (nickel-nitril- otriacetic acid) affinity chromatography (Qiagen) at room temperature under denaturing conditions according to manufacturer's directions with modifications from N.A. Lissy et al . (1998, Immuni ty, 8 : 57-65 ) . After His-tagged proteins were bound to Ni-NTA resin, the resin was washed with the lysis buffer at pH 6.3 and 20 mM imidazole. This tagged Tat-nNOS then was eluted first with lysis buffer at pH 5.9 and 250 mM imidazole, then with the same buffer but at pH 4.5.
  • Ni-NTA nickel-nitril- otriacetic acid affinity chromatography
  • PSD95 Bacterial cultures expressing PSD95 (PDZ 1-3) were grown in the presence of 4 ⁇ M biotin to allow endogenous biotinylation of proteins. Expres- sion of PSD95 was induced with addition of 0.5% arabinose (overnight incubation at 30 °C) . The cells were harvested, resuspended in buffer A: 50 mM Tris, pH 8, 50 M NaCl (sodium chloride), 2 mM EDTA (ethylenediaminetetraacetic acid) , 4 mM DTT (11- dithiothreitol) , and 10% glycerol.
  • buffer A 50 mM Tris, pH 8, 50 M NaCl (sodium chloride), 2 mM EDTA (ethylenediaminetetraacetic acid) , 4 mM DTT (11- dithiothreitol) , and 10% glycerol.
  • the lysate was centrifuged at 48,000 x g for 45 min. The supernatant then was added to avidin resins (Pierce) which had been preblocked with 2 mM d-biotin in CMF-PBS, washed with 100 mM glycine, pH 2.8, and equilibrated with lysis buffer. After rotating the resins with the cell lysate for 4 hr at 4°C, the resins were spun down at 3600 rpm for 15 min at 4°C in a table- top centrifuge. The resins were washed to baseline with CMF-PBS.
  • Biotinylated proteins were eluted by incubation with 4 mL of buffer A and 5 mM biotin in CMF-PBS for 1 hr with rotation. To collect the elu- ate, the resin was spun at 3600 rpm for 15 min at 4°C. A second incubation was repeated, and the elu- ate again was collected by centrifugation. Both eluates containing biotinylated PSD95 (PDZ 1-3, >90% pure) were combined and dialyzed into CMF-PBS and concentrated using a Millipore CENTROCON filter. Proteins were stored at -70°C in CMF-PBS and 10% glycerol .
  • a high throughput screen of a diverse chemical library was performed using an in vi tro plate binding assay to identify inhibitors of the nNOS-PSD95 protein-protein interaction.
  • the binding between the two proteins was quantified using time- delayed fluorescence (similar to that described in U.S. Patent No. 6,107,104).
  • nNOS (1-299) was diluted to 0.14 ⁇ M in CMF-PBS.
  • nNOS (1-299) (50 ⁇ L/well) then was pas- ® sively captured onto high binding IMMULON 384 well plates and incubated overnight at 4°C. Excess protein was removed by repeated washing with CMF-PBS/- ®
  • nNOS and PSD95 bind to one another in a specific and saturable manner, with an estimated Ka of about 40-200 nM.
  • Nonbiotinylated PSD95 competed with nNOS/biotinylated PSD95 binding with an IC 50 of about 800 nM.
  • Percent binding was determined by measuring the amount of biotinylated PSD95-nNOS (1- 299) complex in each well in the presence of pooled compounds compared to the amount of biotinylated complex measured in the absence of any inhibitor. Using these criteria, 32 pooled master wells were selected for deconvolution, based on the above criteria. At 22 compounds per well, a total of 704 compounds then were assayed individually at 40 ⁇ M for inhibition of nNOS-biotinylated PSD95 binding. From these assays, fourteen compounds were found to inhibit nNOS-PSD95 binding with an IC 50 value between 26 nM-100 ⁇ M. Nine of these compounds then were tested in secondary in vi tro and cell- based assays to identify PSD95-nNOS inhibitors that are specific, efficacious, and nontoxic.
  • Example 3 Cell-Based Efficacy Assays Efficacy in Cell-Based Assay
  • Compound (1) also is effective in cell- based assays.
  • compound (1) inhibited NMDA-induced guanosine 3', 5 '-cyclic monophosphate (cGMP) elevation in primary cultures of rat hippo- campal neurons with an EC 50 value of about 5 ⁇ M.
  • primary neuronal cultures were preincu- bated with dimethyl sulfoxide (DMSO) or various concentrations of compound (1) for 15 minutes, then treated with a medium containing 5 ⁇ M sodium nitro- prusside (SNP, an NO donor) , or 100 ⁇ M NMDA for 15 minutes .
  • DMSO dimethyl sulfoxide
  • SNP sodium nitro- prusside
  • cGMP was measured by radioimmunoassay (RIA) and the results are expressed as a percent of control (control is defined by NMDA-induced cGMP in cultures treated with DMSO) .
  • Toxicity was assessed by measuring the levels of calcein (Molecular Probes) taken up by the neurons following a two-hour exposure to compound (1) .
  • compound (1) did not inhibit NO donor-induced cGMP elevation, indicating that molecule does not block pathways downstream of NMDA-activated nNOS.
  • compound (1) is nontoxic up to 50 ⁇ M, which is ten times the allowable efficacy to toxicity ratio.
  • the inhibitors were expected to inhibit the NMDA receptor-PSD95-nNOS pathway.
  • NMDA binds to NMDA receptors to activate nNOS, and thus NO production, in primary neuronal cells, resulting in neurotoxicity. NO production can be measured by increases in cGMP level (quantitated by RIA) in the cultured cells.
  • Antisense PSD95 inhibited this NMDA-dependent pathway, suggesting that nNOS-PSD95 interaction is critical .
  • Neonatal rat hippocampi were cultured using the method of Brewer et al . (J " Neurosci Meth . , 71:143-58 (1997)).
  • NEUROBASALTM-A medium NEUROBASALTM-A medium
  • Gibco-BRL NEUROBASALTM-A medium
  • Cells were plated at 2 x 10 5 cell/mL in 24-well plates (Corning) , previously coated for 16-24 hr with 1 mg/mL poly D-lysine (Sigma) in water. Two days after plating, the cells were treated with 5 ⁇ M ara- C (Sigma) for 2-3 days before feeding with fresh supplemented NBM-A.
  • HBSS Hanks ' s balanced saline solution
  • Ice-cold ethanol was added to extract cyclic nucleotides.
  • the ethanol extract was dried by Speedvac .
  • cGMP levels in the samples were determined by radio- immunoassay (RIA kit purchased from Perkin Elmer/New England Nuclear, MA) according to manufacturer's instructions .
  • Toxicity of the compounds also was assessed using neuronal cultures. The cultures were incubated in the presence of compounds or vehicle as described above. Cultures then were gently washed twice with 1 x HBSS and incubated in 2 ⁇ M calcein (Molecular Probes) in 1 x HBSS at 37°C for 30 min.
  • Compound (1) did not inhibit cGMP production induced by the NO-donor sodium nitroprusside, suggesting that compound (1) does not block pathways downstream of NMDA-activated nNOS. Compound (1) also was found to be nontoxic up to 50 ⁇ M. Whereas compound (1) lost some of its inhibitory activity in the presence of 50% serum when assayed for effect on NMDA-induced cGMP elevation, the EC 50 for compounds (2) and (3) were not signifi- cantly changed.
  • NMDA receptor-PSD95-nNOS pathway also is important for hypoxia-induced damage in neurons.
  • Organotypic culture thus was used ' to test whether inhibitors of nNOS-PSD95 in blocking this pathway would also prevent hypoxia-induced cell death.
  • Organotypic hippocampal slices were cultured as described in (L. Stoppini et al . , J " . Neurosci . Meth . , 37:173-82 (1991)). Briefly, cultures were prepared from day 5 to 7 neonatal rats (Sprague- Dawley, Bantin and Kingman Inc., Fremont, CA) .
  • FIG. 4 illustrates that compound (1) significantly reduced NMDA-induced neurotoxicity in this organotypic slice culture assay. (Each bar in Figure 4 represents 11 slice cultures.) Treatment of the cultures with compound (1) at 0.5 and 1 ⁇ M inhibited >90% of ischemia-induced cell death. The extent of neuroprotection was comparable to that observed with MK-801-treated cultures. It is believed that disrupting nNOS-PSD95 interaction allows for uncoupling of NMDA activation of nNOS, and that this mechanism assists in protecting against ischemia- induced cell death.
  • Example 5 nNOS Enzymatic Assays
  • Inhibitors of PSD95-nNOS protein-protein interaction should not affect the catalytic activity of nNOS. Indeed, the nNOS protein used in the bind- ing assay contains only the PDZ-binding domains, and does not contain the catalytic domain. Because NOS enzymatic function is critical for many cellular functions, it is preferred that inhibitors of PSD95- nNOS have little to no effect on NOS catalytic activity, in order to avoid impairing the function of other NOS enzymes, e.g., eNOS . To test whether nNOS targeting inhibitors have any effect on the catalytic activity of NOS, a NOS enzymatic assay, based on (J. Dawson et al . , Meth . Mol . Biol . , 100 :237 -42 (1998)), was used.
  • Rat brain nNOS was purified using a combination of adenosine 2 ' , 5 ' -bisphosphate (2 ',5'- ADP) -Sepharose and calmodulin affinity chromatog- raphy (modification of H.H. Schmidt et al . , Proc.
  • Neuronal NOS enzymatic activity assays were performed essentially as described by J. Dawson et al . , supra, with the exception that the final assay concentration of HEPES was 50 mM instead of 100 mM, and the reference inhibitor stocks (N 5 - timino (methylamino) methyl] -L-ornithine (L-NMMA) and N G -nitro-L-arginine methyl ester hydrochloride (L-
  • NAME NAME
  • HEPES 25% DMSO/50mM HEPES, pH 7.4. All buffers, inhibitors, plates, and equipment were prewarmed to 37°C prior to assaying.
  • 200 ⁇ L of 1.25 x assay buffer consisting of HEPES, pH 7.4, DTT, CaCl 2 , oxyhemoglobin, cofactor cocktail (NADPH, FMN, FAD, calmodulin) and BH4 ( (6R) -5, 6 , 7, 8- tetrahydrobiopterin dihydrochloride
  • the assay was initiated by addition of 20 ⁇ L of 12.5 x partially purified rat brain nNOS (previously diluted into 50 mM HEPES, pH 7.4) . After mixing the reaction for 15 sec, continual measurements at 405 nm and 420 nm were collected for 30-60 min at the shortest interval possible (usually 10-20 sec) on a SpectraMax 250 (Molecular Devices) .
  • Figure 5 shows that compound (1) did not inhibit the catalytic activity of nNOS, even at 200 ⁇ M.
  • Inhibitors of the nNOS-PSD95 interaction are expected to disrupt the NMDA receptor-PSD95-nNOS pathways.
  • the small molecule inhibitors and Tat-nNOS were tested on various animal pain models where the NMDA receptor-PSD95-nNOS pathway has been shown to be important .
  • Antmociceptive effect was calculated as percent maximum possible effect by the formula: (postdrug latency-predrug latency) / (12-predrug latency) x 100%. Experiments were performed under conditions where the control or tested inhibitors were blinded. Eight to ten mice were used for each dose point, and data were calculated as mean ⁇ SEM. Compound (1) initially was dissolved in 5% DMSO and 1 mole equivalent of NaOH, then diluted with 5% DMSO in saline. The corresponding vehicle control used the same diluent . Compound (1) and NMDA were coadministered intrathecally (i.t.) into mice, and tail flick latency to warm water was measured before and 5 min. after administration.
  • NMDA administered i.t. into mice induces a thermal hypersensitivity, which requires the activation of NOS.
  • Compound (1) dose-dependently and fully reversed thermal hyperalgesia (hypersensitivity) induced by NMDA.
  • the EC 50 was ⁇ 0.03 fmole/mouse (Fig. 6) .
  • NOS catalytic enzyme inhibitors such as L-NAME or 7-Ni, inhibited NMDA-induced hyperalgesia with EC 50 about 1 nmole/mouse.
  • Compound (1) at higher concentrations (1-300 nmole/mouse) , prolonged the thermal latency of tail flick to about 200% of the latency of na ⁇ ve mice. This demonstrates that compound (1) also can be analgesic at higher concentrations .
  • (b) NMDA-Dependent, nNOS-Independent Scratching and Biting Behavior
  • NMDA receptor antagonists such as MK801 (Fairbanks et al .
  • NMDA-induced nociceptive behavior In order to separate an effect of a test compound on NMDA receptor-requiring action from effects on an action requiring nNOS, NMDA-induced nociceptive behavior, motor impairment, and thermal hypersensitivity were measured in the same animal and in the same experiment after intrathecal admin- istration of NMDA and targeting inhibitors.
  • Compound (1) had no effect on the NMDA-induced itching/scratching behavior or NMDA-induced motor impairment, consistent with effects seen by nNOS inhibitors, such as 7-Ni.
  • Formalin injected subplantarly induced two phases of paw licking behavior that are considered models of acute and inflammatory pain, respectively.
  • compound (1) in PBS and 5% DMSO, was injected i.t. into mice.
  • formalin (5% solution) was injected subplantarly in a volume of 0.02 mL.
  • the induced hind paw licking time was recorded during the first inflammatory phase (0-5 min) and second inflammatory phase (20-30 min) periods after formalin challenge.
  • Example 8 Chronic visceral pain model Visceral hypersensitivity, a subset of chronic neuropathic pain, can be studied in animals as a model for irritable bowel syndrome . It can be induced by intracolonic administration of 0.6% acetic acid (B. Greenwood van Meerveld, unpublished data) . One to four weeks after the acetic acid priming (or saline pretreat ent) , intracolonic injection of capsaicin was used as a stimulus. In animals that have been pretreated with saline, capsaicin (0.6% solution) will evoke 40-50 scratching and biting behaviors directed to the perineum over a 20 min period.
  • acetic acid priming or saline pretreat ent
  • nNOS targeting inhibitors in chronic neuropathic pain model, the rat model of G.J. Bennett et al . , Pain, 33:87-107 (1988) was used.
  • the Bennett et al . procedure induces a painful peripheral mononeuropathy produced by chronic constriction injury (CCI) of the sciatic nerve, and then measures alterations of behavior in relation to putative analgesic treatments.
  • CCI chronic constriction injury
  • This CCI model often referred to as the Bennett model, was the first animal model to demonstrate that NMDA receptor antagonists relieve neuropathic pain, and currently is the standard model used to validate efficacy of preclinical candidates in neuropathic pain.
  • the animals were given a lethal dose of pentobarbital (50 mg, i.p.) and transcardially perfused with for- malin.
  • a saturated solution of Fast Green dye (10 uL) then was injected into the catheters followed by 10 uL saline.
  • the spinal cord was exposed and the position of the catheter tip and the location of the dye were noted.
  • the ideal location of the catheter tip is where the thoracic and lumbar segments meet. Animals in which the catheter tip deviated from this location by more than about 1 cm or were unresponsive to i.t. morphine were excluded from the study.
  • MDCK Canine Kidney assay.
  • HBSS 2% DMSO
  • transport assay donor solutions consisted of 200. ⁇ M of compound (1) in transport medium. An aliquot from the receiver compartment was assayed at 1 and 3 hours. An aliquot from the donor compartment was assayed at the three-hour timepoint.
  • Tat-nNOS fusion protein (1-299) contains a region that is critical to binding PSD95, but does not contain the catalytic domain. This fusion protein is envisioned to enter cells and displace the wild type catalytically active nNOS, thus acting as a nNOS targeting inhibitor.
  • Figure 10 shows that the Tat- nNOS fusion protein inhibited PSD95-nNOS in vi tro binding with an IC 50 of about 0.2 ⁇ M.
  • primary hippocampal neuron cultures were incubated with various concentrations of purified Tat-nNOS for 30 minutes prior to treatment with 100 ⁇ M NMDA for 15 minutes.
  • Tat-nNOS inhibited NMDA- induced cGMP elevation in primary hippocampal cul- tures with an EC 50 of 500 nM, similar to that of compound (1) .
  • Fig. 12 shows that Tat-nNOS fusion protein also fully reversed the thermal hyperalgesia induced by NMDA with ah EC 50 of 0.2 fmole/mouse and at higher concentrations (>10 fmoles/mouse) showed analgesic effects similar to those found for compound (1) .
  • Tat-nNOS tested (at 0.225, 2.25, and 22.5 fmole/mouse) in the absence of NMDA, also showed analgesic activity, illustrating that nNOS targeting disruptors also can be anal- gesics.
  • Tat-nNOS was also tested in the Bennett Chronic pain rat model described in Example 9. Tat- nNOS (at 7 nmole/rat) reversed the mechanical allodynia associated with neuropathic pain (Fig 13) . The onset of reversal was fast and the effect lasted for 150 min.
  • Example 12 Side Effect Profile of Inhibitors of nNOS-PSD95 Interactions
  • NMDA receptor antagonists have a narrow efficacy to toxicity ratio. Side effects of NMDA receptor antagonists can be measured by motor impairment in mice using the rotarod measurement.
  • Compound (1) was administered i.t. into na ⁇ ve mice (in the absence of NMDA) , and the amount of time the mice remained on the rotarod was measured.
  • the ability of the compound to change "normal pain sensation" i.e., exhibit analgesia, also was measured in the same mice using tail flick.
  • Compound (1) was found to impair motor movement only at the highest concentrations of greater than 3 pmole/mouse. At that dose, compound (1) also blocked "normal" pain sensation, which can be attributed to a motor impairment because the two dose responses overlap (see Fig. 14) .
  • the concentration of compound (1) required to inhibit motor movement is much greater than the concentration required to inhibit NMDA-induced hypersensitivity, as shown in Fig. 14.
  • the efficacy of compound (1) i.e., antihyperalgesia
  • adverse side effects i.e., motor impairment
  • compound (1) or MK801 NMDA receptor antagonist
  • Example 13 Systemic Administration of Disruptors of nNOS-PSD95 Interaction
  • compound (1) was administered systemically.
  • compound (1) was administered intraperitoneally (i.p.), then NMDA was administered i.t. after one hour. Tail flick latency was measured 5 minutes after NMDA administration.
  • Intraperitoneal administration of compound (1) in mice fully and dose-dependently reversed NMDA induced hypersensitivity (Fig. 15) . When motor impairment was measured in the same mice, compound
  • Example 14 Efficacy of a PSD95-nNOS Interaction Disruptor Over Time
  • com- pound (1) was administered i.p. or i.t. for various times before i.t. administration of NMDA.
  • Tail flick latency was measured 5 minutes after i.t. administration of NMDA.
  • the effects of compound (1) were observed after 30 minutes of i.p. administra- tion, whereas the effects of i.t. administration were observed much more quickly.
  • the effects of both i.p. and i.t. administration lasted for more than 100 minutes. Vehicle control had no effect.
  • compound (1) was administered either i.t. (o , 1 pmole/mouse) or i.p.
  • Examples 12-14 show the systemic efficacy of a PSD95-nNOS interaction disruptor, as exemplified by compound (1) . These experiments were designed to determine whether compound (1) crosses the blood-brain barrier by using the pain model as a bioassay. It was found that i.p. administration of compound (1) potently reversed NMDA-induced hyperalgesia as measured by tail flick latency, by exhibiting an ED 50 of about 0.1 mg/kg, with full efficacy at 1 mg/kg with minimal motor impairment (as measured by rotarod) .

Landscapes

  • Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne des agents pouvant interrompre une interaction entre l'oxyde nitreux synthase neuronale (nNOS) et la protéine de densité post-synaptique 95 (PSD95). Lesdits agents comportent de petits composés moléculaires, des extraits de produits naturels, des peptides, et des protéines de fusion. L'invention concerne également des compositions contenant les agents d'interruption, et l'utilisation de ces agents d'interruption dans le traitement de mammifères souffrant d'états dans lesquels l'interruption de l'interaction nNOS PSD95 se révèle intéressante. Les états pouvant être traités sont notamment la douleur, la tolérance aux opiacés, les lésions cérébrales ischémiques, les troubles neurologiques, les troubles neurodégénératifs, la maladie de Parkinson, l'épilepsie, les crises, la maladie de Huntington, la maladie d'Alzheimer, la sclérose latérale amyotrophique, et les troubles psychiatriques.
PCT/US2005/011774 2004-04-05 2005-04-04 Agent interrompant l'interaction psd95 nnos, compositions les contenant, et utilisations therapeutiques associees WO2005097090A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US55949104P 2004-04-05 2004-04-05
US60/559,491 2004-04-05

Publications (2)

Publication Number Publication Date
WO2005097090A2 true WO2005097090A2 (fr) 2005-10-20
WO2005097090A3 WO2005097090A3 (fr) 2006-07-27

Family

ID=35125598

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/011774 WO2005097090A2 (fr) 2004-04-05 2005-04-04 Agent interrompant l'interaction psd95 nnos, compositions les contenant, et utilisations therapeutiques associees

Country Status (1)

Country Link
WO (1) WO2005097090A2 (fr)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007091107A1 (fr) * 2006-02-10 2007-08-16 Summit Corporation Plc Traitement de la dystrophie musculaire de duchenne
WO2009019505A3 (fr) * 2007-08-03 2009-05-22 Summit Corp Plc Combinaisons de médicaments pour le traitement de la dystrophie musculaire de duchenne
US7709519B2 (en) 2004-06-04 2010-05-04 Astellas Pharma Inc. Benzimidazolylidene propane-1,3 dione derivative or salt thereof
US7960562B2 (en) 2005-03-31 2011-06-14 Astellas Pharma Inc. Propane-1,3-dione derivative or salt thereof
WO2012065182A3 (fr) * 2010-11-12 2012-07-26 University Of Massachusetts Modulation de l'ubiquitination de protéines synaptiques pour le traitement de troubles neurodégénératifs et psychiatriques
AU2006332535B2 (en) * 2005-12-30 2013-03-14 Nono Inc. Small molecule inhibitors of PDZ interactions
WO2013163562A2 (fr) 2012-04-27 2013-10-31 Indiana University Research And Technology Corporation Compositions et méthodes de traitement de l'espt et de maladies associées
US8633160B2 (en) 2005-12-30 2014-01-21 Nono Inc. Small molecule inhibitors of PDZ interactions
JP2016199553A (ja) * 2008-05-16 2016-12-01 ノノ インコーポレイテッド てんかんの治療
EP3524257A4 (fr) * 2016-10-10 2020-07-01 Biocells (Beijing) Biotech Co., Ltd. Utilisation d'un polypeptide associé à une lésion nerveuse excitatrice dans la prévention, l'atténuation ou le traitement de la douleur
CN117126252A (zh) * 2023-09-07 2023-11-28 湖南中晟全肽生化有限公司 一种psd-95抑制剂及其用途

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001087285A2 (fr) * 2000-05-12 2001-11-22 The Johns Hopkins University Inhibition de l'interaction de l'antisens psd93 et psd95 avec des recepteurs de nnos et nmda

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001087285A2 (fr) * 2000-05-12 2001-11-22 The Johns Hopkins University Inhibition de l'interaction de l'antisens psd93 et psd95 avec des recepteurs de nnos et nmda

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BRENMAN J E ET AL: "Interaction of nitric oxide synthase with the postsynaptic density protein PSD-95 and alpha1-syntrophin mediated ny PDZ domains" CELL, CELL PRESS, CAMBRIDGE, NA, US, vol. 84, 8 March 1996 (1996-03-08), pages 757-767, XP002104701 ISSN: 0092-8674 *
FANG MING ET AL: "Halothane Inhibits Protein Interactions within the NMDA Receptor Signaling Complex." ANESTHESIOLOGY ABSTRACTS OF SCIENTIFIC PAPERS ANNUAL MEETING, no. 2001, 2002, pages Abstract No. A-121 URL, XP009056960 & 2001 ANNUAL MEETING OF THE AMERICAN SOCIETY OF ANESTHESIOLOGISTS; NEW ORLEANS, LA, USA; OCTOBER 13-17, 2001 *
JAFFREY S R ET AL: "CAPON: a protein associated with neuronal nitric oxide synthase that regulates its interaction with PSD95" NEURON, CAMBRIDGE, MA, US, vol. 20, no. 1, 23 January 1998 (1998-01-23), pages 115-124, XP002104610 *

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7709519B2 (en) 2004-06-04 2010-05-04 Astellas Pharma Inc. Benzimidazolylidene propane-1,3 dione derivative or salt thereof
US7960562B2 (en) 2005-03-31 2011-06-14 Astellas Pharma Inc. Propane-1,3-dione derivative or salt thereof
AU2006332535B2 (en) * 2005-12-30 2013-03-14 Nono Inc. Small molecule inhibitors of PDZ interactions
US8633160B2 (en) 2005-12-30 2014-01-21 Nono Inc. Small molecule inhibitors of PDZ interactions
WO2007091107A1 (fr) * 2006-02-10 2007-08-16 Summit Corporation Plc Traitement de la dystrophie musculaire de duchenne
WO2009019505A3 (fr) * 2007-08-03 2009-05-22 Summit Corp Plc Combinaisons de médicaments pour le traitement de la dystrophie musculaire de duchenne
JP2016199553A (ja) * 2008-05-16 2016-12-01 ノノ インコーポレイテッド てんかんの治療
WO2012065182A3 (fr) * 2010-11-12 2012-07-26 University Of Massachusetts Modulation de l'ubiquitination de protéines synaptiques pour le traitement de troubles neurodégénératifs et psychiatriques
WO2013163562A2 (fr) 2012-04-27 2013-10-31 Indiana University Research And Technology Corporation Compositions et méthodes de traitement de l'espt et de maladies associées
EP3524257A4 (fr) * 2016-10-10 2020-07-01 Biocells (Beijing) Biotech Co., Ltd. Utilisation d'un polypeptide associé à une lésion nerveuse excitatrice dans la prévention, l'atténuation ou le traitement de la douleur
CN117126252A (zh) * 2023-09-07 2023-11-28 湖南中晟全肽生化有限公司 一种psd-95抑制剂及其用途
CN117903259A (zh) * 2023-09-07 2024-04-19 湖南中晟全肽生物科技股份有限公司 一种psd-95抑制剂及其用途
CN117126252B (zh) * 2023-09-07 2024-05-07 湖南中晟全肽生物科技股份有限公司 一种psd-95抑制剂及其用途

Also Published As

Publication number Publication date
WO2005097090A3 (fr) 2006-07-27

Similar Documents

Publication Publication Date Title
WO2005097090A2 (fr) Agent interrompant l'interaction psd95 nnos, compositions les contenant, et utilisations therapeutiques associees
ES2273849T3 (es) Composiciones farmaceuticas que comprenden compuestos ciclicos peptidometicos con giro beta.
US8114896B2 (en) Method and composition for potentiating an opiate analgesic
JP6039553B2 (ja) エンドモルフィンのμオピオイド受容体アゴニスト類似体
US8058230B2 (en) Neurotensin receptor agonists and opioid receptor agonists
US7863416B2 (en) Nociceptin-based analgesics
US10988506B2 (en) Cyclic tetrapeptide stereoisomers
US10919939B2 (en) Mu opioid receptor agonist analogs of the endomorphins
US20240018188A1 (en) Compounds for selective disruption of protein-protein interactions
Bihel Opioid adjuvant strategy: improving opioid effectiveness
EP1644022A1 (fr) Utilisation de peptides agonistes du recepteur de la melanocortine-3 (mc3r)
US5049555A (en) Antagonists of specific excitatory amino acid receptors as neuroprotectants and anxiolytics
WO2002058687A2 (fr) Inhibition de la erk reduisant ou prevenant a la fois la tolerance et la dependance aux analgesiques opioides et sensibilisation apres stimulation douloureuse
AU2010241564B2 (en) Novel therapeutic treatments using centhaquin
EP3965769B1 (fr) Utilisation de quinazoline 2-phényl-6-(1h-imidazol-1-yl) pour le traitement de maladies neurodégénératives, de préférence la maladie d'alzheimer
WO2013163562A2 (fr) Compositions et méthodes de traitement de l'espt et de maladies associées
Ferraro et al. Emerging evidence for neurotensin receptor 1 antagonists as novel pharmaceutics in neurodegenerative disorders
US6767897B2 (en) Therapeutic uses of tri-, tetra-, penta-, and polypeptides
Zhang et al. Analgesic effects of receptin, a chemically modified cobratoxin from Thailand cobra venom
US20220056075A1 (en) Method for treating opioid use disorder
Rossoni et al. NCX 4016, a nitric oxide‐releasing aspirin, modulates adrenergic vasoconstriction in the perfused rat tail artery
JP7492733B2 (ja) ドーパミンｄ２受容体・ドーパ受容体相互作用阻害ペプチド
CN114601834A (zh) 线粒体分裂抑制剂和包含其的组合的用途
US20050187239A1 (en) Synergistic l-methadone compositions and methods of use thereof
WO2011000564A1 (fr) Eltoprazine pour le traitement de la pharmacodépendance

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase