WO2005095447A2

WO2005095447A2 - Low molecular weight forms of foxp1 proteins and splice variants thereof

Info

Publication number: WO2005095447A2
Application number: PCT/GB2005/001149
Authority: WO
Inventors: Alison Banham; Sally Ashe; Phillip J. Brown
Original assignee: Isis Innovation Limited
Priority date: 2004-03-29
Filing date: 2005-03-29
Publication date: 2005-10-13
Also published as: WO2005095447A3

Abstract

The present invention is based on the discovery that low molecular weight forms of the FOXP1 protein are expressed at high levels in activated B-cells and in a certain subtype of diffuse large B-cell lymphoma (DLBCL). The invention relates to a novel FOXP1 splice variant, the protein encoded by the splice variant and methods of detection and diagnosis based upon detecting the novel splice variant. Also provided are reagents including siRNA molecules which can down regulate the transcript of the splice variant, as well as methods of treatment of diseases associated with an activated B-cell state and pharmaceutical compositions.

Description

New FOXPl Proteins

Technical field

The present invention is based on the discovery that low molecular weight forms of the FOXPl protein are expressed at high levels in activated B-cells and in a certain subtype of diffuse large B-cell lymphoma (DLBCL) .

Introduction Diffuse large B-cell lymphoma (DLBCL) accounts for 30-40% of all adult non-Hodgkin¹ s lymphomas and is heterogeneous in terms of its morphology and clinical features. Approximately 50% of patients relapse after treatment and their tumours frequently become resistant to therapy. The genetic abnormalities underlying DLBCL remain poorly understood and, in contrast to other lymphoma types (e.g. foUicular lymphoma or Burkitt's lymphoma), no single characteristic genetic alteration has been found.

Microarray based gene expression profiling studies have identified clinically relevant subtypes of DLBCL (Alizadeh et al . , 2000; Rosenwald et al . , 2002; Shipp et al . , 2002). One of these subtypes, the activated B-cell-like subtype (ABC) , correspond to DLBCL that have a gene expression profile similar to that of in vi tro activated peripheral blood B cells (Alizadeh et al . , 2000). Patients with this ABC subtype have a worse prognosis (which is comparable to the poor prognosis of the third subtype, type 3) than those with a germinal centre B-cell-like (GC) phenotype (Alizadeh et al . , 2000; Rosenwald et al . , 2002). It is clinically important to identify markers that can be used routinely to distinguish these subtypes, identify high-risk patients at diagnosis and improve the definition of specific gene expression pathways for novel therapeutic intervention.

Rosenwald and colleagues have used gene-expression profiling to formulate a molecular predictor of survival that is a prognostic indicator independent of the IPI score (Rosenwald et al . , 2002) . This is based on four different gene expression signatures (GC B-cell, MHC class II, lymph node, proliferation) , together with BMP-6 mRNA expression, as there is no single gene whose expression accurately predicted the outcome for all patients (Alizadeh et al . , 2000; Rosenwald et al . , 2002). However, few centres performing routine lymphoma diagnosis have access to microarray gene expression profiling and most lymphoma diagnosis is performed on paraffin embedded tissues, without the availability of fresh/frozen samples. Therefore, it is important that reagents, such as antibodies, are developed to enable the routine identification of disease subtypes using routinely fixed clinical samples. Immunohistochemical staining of tissue microarrays (TMAs) of these cases with three monoclonal antibodies, CD10, MUM1 and BCL-6, has recently been reported to be sufficient to identify GC and non-GC subtypes (grouping the ABC and type 3 cases together) of DLBCL. This predicts survival with an accuracy similar to that achieved with microarrays, although a few cases are classified differently using the two approaches (Hans et al. , 2004) .

One of the markers whose mRNA expression profile was reported to distinguish between the ABC and GC subtypes of DLBCL was the forkhead transcription factor FOXPl (Shaffer et al . , 2002) . The inventors had previously identified the FOXPl gene (Banham et al . and WO 01/40303 Al) describing the identification of this molecule and its potential diagnostic use in distinguishing clinically relevant subtypes of DLBCL. Further collaborative studies using the FOXPl monoclonal antibody (JC12) , produced by the inventors, have yielded conflicting data on the association between FOXPl protein expression and the survival of DLBCL patients. Two studies found that FOXPl expression was associated with poor survival (Brown et al . , 2003; Barrans et al . , 2004; Banham et al . , 2005) while another study found no association with survival (Hans et al . , 2004) . Significantly, the study by Hans et al (2004) incorporated cases where the subtype of the cases, identified by gene expression profiling, were already known. The results obtained with gene expression profiling were compared to those obtained using three immunohistochemical markers, CD10, BCL-6 and MUM1, to subtype cases into two prognostically relevant groups, good prognosis GC and poor prognosis non-GC DLBCL. These subtypes were as clinically relevant as those identified by gene expression profiling. FOXPl protein was expressed in the nucleus of more than 30% of the tumour cells in 48% of the GC group and 71% of the non-GC group. This study concluded that FOXPl protein expression evaluated by immunostaining with the JC12 monoclonal antibody did not assist the prognostic subtyping of DLBCL (Hans et al . , 2004) .

Description of the invention

The present invention is based upon the discovery that low molecular weight forms of the FOXPl protein are expressed at high levels in activated B-cells and in cell lines with gene expression profiles of the activated B-cell-like subtype (ABC) of diffuse large B-cell lymphoma (DLBCL) .

Accordingly, in a first aspect of the present invention there is provided a method of diagnosing a disease associated with expression of high levels of low molecular weight forms of FOXPl comprising contacting a sample with a reagent which allows identification of the presence of the low molecular weight forms of FOXPl in the sample and detecting the presence of the low molecular weight forms of FOXPl .

The expression of the low molecular weight forms of FOXPl has generally been found to be less abundant than the expression levels of the full length FOXPl protein. Thus low levels of expression of the low molecular weight forms of FOXPl, in relation to the full length protein, may not be relevant for diagnosing specific disease conditions. The terms high and low expression level would be readily understood by one of skill in the art.

In one embodiment the disease associated with high levels of expression of low molecular weight forms of FOXPl is cancer. This includes any type of cancer, for example a cancer selected from diffuse large B-cell lymphoma (DLBCL) , Non

Hodgkin's lymphoma, leukaemia, cervical, prostate, stomach, colon, head and neck, renal, breast or lung cancer.

In a most preferred embodiment the disease which is diagnosed by the method of the invention is the activated B- cell-like subtype (ABC) of diffuse large B-cell lymphoma (DLBCL) . As aforementioned, this particular subtype of DLBCL has poor prognosis when compared to the germinal B- cell-like (GC) subtype of DLBCL. Early detection is, therefore, important to ensure that early and specific, directed treatment can be provided in order to maximise the chances of survival . The routine subtyping of DLBCL patients enables the identification of those that do not respond to current treatment regimens and allows improved treatment management. In particular the ABC-like subtype of DLBCL may benefit from therapies targeting NF-kB activation (Davis et al . , 2001; Lam et al . , 2005).

A preferred means for carrying out the method of the invention comprises an immunostaining reaction. Such a method would include a monoclonal antibody which is specific for the low molecular weight forms of FOXPl. A secondary antibody may also be used which may be directed against the primary antibody. The immunostaining technique is extremely well defined in the art. Alternatively, samples may be immunostained with one antibody recognising the full length FOXPl protein, such as the JC12 antibody, and with another antibody recognising the N-terminal 100 amino acids that are absent in the smaller low molecular weight FOXPl proteins. This would enable one of skill in the art to distinguish whether high levels of FOXPl protein resulted from the expression of the lower molecular weight isoforms. An example of an antibody which recognises an epitope within the N terminal 100 amino acids is an affinity purified rabbit polyclonal antibody (AB/FOX330) to the peptide epitope QVSGLKSPKRNDKQP which is commercially available from Ce ines International. Forkhead transcription factor 1 (FOXPl) is described extensively in WO 01/40303, which reference is incorporated herein in its entirety. The FOXPl gene encodes a protein containing a winged helix motif which is widely expressed in both normal and neoplastic human cells. The protein also contains a Cys2-His2 zinc finger motif which can also bind nucleic acids. The protein is, accordingly, referred to as a winged helix/zinc finger protein. Various homologues of this protein, FOXP2, F0XP3 and FOXP4 have also been previously described.

In the context of the present invention the term "low molecular weight forms" is defined to comprise forms of FOXPl which are of lower molecular weight than the full length protein. The full length protein has a molecular weight of approximately 75-79 kDa. Preferably, the low molecular weight forms of FOXPl have a molecular weight of in the region of from around 64 to 66 kDa and 66 to 69 kDa, as calculated from a standard curve.

The sample in the method of the invention will comprise any suitable sample taken from a subject. In one embodiment, the method of the invention can include the step of obtaining the sample from the subject. Thus, there is provided a method of diagnosing a disease associated with expression of low molecular weight forms of FOXPl comprising (the steps of) obtaining a sample from a subject and contacting said sample with a reagent which allows identification of the presence of the low molecular weight forms of FOXPl in the sample and detecting the presence of the low molecular weight forms of FOXPl . In a preferred embodiment, the sample will be a tissue sample obtained from a subject. In a most preferred embodiment, the sample will be a tissue sample obtained from a DLBCL. In many cases the tissue sample under test will be paraffin embedded. However, the method of the present invention is equally applicable to fresh and frozen samples.

The sample may be of any size provided it contains sufficient material to allow identification of the low molecular weight forms of FOXPl.

The sample can be any suitable clinical sample. The sample may be obtained from any body fluid of the subject provided it potentially contains the low molecular weight versions of FOXPl necessary to assess the disease status of the subject. Typical samples which could be used, but which are not intended to limit the invention, include whole blood, serum, plasma, urine, chyle, stool, ejaculate, sputum, nipple aspirate, saliva etc. taken from a subject, most preferably a human subject.

Preferably, the method of the invention is performed on cells or tissues removed from a human subject. However, it is also within the scope of the invention to perform the method on cells or tissues removed from non-human mammals such as mouse or monkey by using a reagent, such as an antibody, which is cross-reactive against the low molecular weight forms of a homologous protein expressed in the non- human mammalian species, or primers where expression is determined at the nucleic acid level. In the context of the present invention a "reagent" is any molecule which can specifically detect low molecular weight forms of FOXPl. Preferably the reagent will be capable of binding to the low molecular weight form of FOXPl . In a preferred embodiment the reagent is an antibody. The antibody may be polyclonal but is most preferably a monoclonal antibody. Preferably the monoclonal antibody shows high specificity for the low molecular weight forms of FOXPl, and most preferably absolute specificity.

However, the present invention is not intended to be limited to only antibodies. Any other reagent specific for low molecular weight forms of FOXPl protein can be used. For example nucleic acid molecules, fluorescent molecules, binding proteins, small molecules, receptors, lectins etc. may all be used as a reagent provided that they allow specific identification of the low molecular weight forms of FOXPl . It is known that FOXPl binds nucleic acid sequences and therefore specific binding sequences could potentially be selected, in order to produce suitable nucleic acid based reagents .

Nucleic acid molecules include all natural and synthetic type of nucleic acid. Included within the definition is DNA, RNA, PNA and antisense molecules. Nucleic acid molecules can be single or double stranded, and may in certain situations be triple helices or comprise more than three strands.

It has now been discovered that the low molecular weight isoforms are encoded by a novel alternative splice variant of the FOXPl mRNA. The splice variant represents an N- terminally truncated version of FOXPl, which begins at exon 6b. The full length transcript does not include this exon.

The splice variant also includes at least exons 7, 8, 9 and 10. Exon 6 is shown in SEQ ID NO: 1, Exon 6b is represented in the cDNA sequence of SEQ ID No: 2, exon 7 is represented by the cDNA sequence shown in SEQ ID NO : 3 , exon 8 is shown in the cDNA sequence of SEQ ID NO: 4, exon 9 is represented in the cDNA sequence shown in SEQ ID NO: 5 and exon 10 is shown in the cDNA sequence of SEQ ID NO: 6. The full length sequence of FOXPl is well known in the art, see for example the disclosure of Banham et al . and WO 01/40303 Al .

The splice variant is also predicted to include exons 10 to 20. The full length sequence is set out in SEQ ID NO: 7.

Therefore, by detecting the nucleic acid of this alternative splice variant and most preferably the sequence of exon 6b, preferably also including detection of exons 8 and/or 9 it is possible to determine specifically the presence of the lower molecular weight isoforms of FOXPl.

As shown in the experimental section below, high levels of expression of low molecular weight isoforms of FOXPl appear to be associated with a general state of B-cell activation. It is, therefore, considered that the detection of the low molecular weight isoforms of FOXPl, including at least exons 6b and its juxtaposition to exons 7 to 10, may be indicative of a range of diseases caused by activation of NF-κB because activation of NF-KB occurs as a consequence of the activation of B-cells. The minimum novel sequence is that which includes exons 6b, 7, 8. Therefore, according to one aspect of the invention, there i-s provided a nucleic acid molecule comprising: (i) the sequence of SEQ ID NO: 11 (ii) the mRNA equivalent of (i) (iii) the complement of (i) or (ii) ; or (iv) sequences which hybridize to (i) , (ii) or (iii)

According to one embodiment of the invention, there is provided a nucleic acid molecule, which additionally includes exon 9, comprising: (i) the sequence of SEQ ID NO: 12 (ii) the mRNA equivalent of (i) (iii) the complement of (i) or (ii) ; or (iv) sequences which hybridize to (i) , (ii) or (iii)

According to an embodiment of the invention, there is provided a nucleic acid molecule comprising: (i) the sequence of SEQ ID NO: 7 (ii) the mRNA equivalent of (i) (iii) the complement of (i) or (ii) ; or (iv) sequences which hybridize to (i) , (ii) or (iii)

According to a further embodiment of the invention, there is provided a nucleic acid molecule consisting essentially of: (i) the sequence of SEQ ID NO: 7 (ii) the mRNA equivalent of (i) (iii) the complement of (i) or (ii) ; or (iv) sequences which hybridize to (i) , (ii) or (iii)

In one embodiment the nucleic acid molecule consists of (i) the sequence of SEQ ID NO: 7 (ii) the mRNA equivalent of (i) (iii) the complement of (i) or (ii) ; or (iv) sequences which hybridize to (i) , (ii) or (iii)

Preferably, hybridization occurs under conditions of high stringency which are well known in art, such as high temperature and high salt concentration. Examples of high stringency conditions include a hybridisation reaction at 42°C in a solution comprising 50% formamide, 5x SSC and 1% SDS or at 65°C in a solution comprising 5x SSC and 1% SDS, with a wash in 0.2x SSC and 0.1% SDS at 65°C.

The polypeptide encoded by this alternative splice variant has an amino acid sequence as set out in SEQ ID NO: 8, 9 and 10 depending upon which methionine is used to initiate translation. The protein represents an N-terminally truncated version of FOXPl.

As shown in the experimental section, the alternative splice variant produces a protein which is truncated at its N- terminus when compared to the full length FOXPl protein.

SEQ ID NO: 8 represents the amino acid sequence of the longest polypeptide encoded by the novel splice variant.

SEQ ID NO: 9 represents an alternative amino acid sequence when an additional downstream methionine is utilised to initiate translation.

SEQ ID NO: 10 shows a still further amino acid sequence when a further downstream methionine is used to initiate translation. Thus, the amino acid sequence of the low molecular weight isoforms corresponds to that of the full length FOXPl protein but without approximately the N-terminal 100 amino acids.

Accordingly, the invention also provides a polypeptide consisting essentially of or consisting of the amino acid sequence set out in SEQ ID NO: 8, a polypeptide consisting essentially of the amino acid sequence set out in SEQ ID NO: 9 and a polypeptide consisting essentially of the amino acid sequence set out in SEQ ID NO: 10.

Polypeptides which represent orthologues thereof and homologues may also be included in the scope of the invention, provided that they remain useful for diagnosing disease in accordance with the present invention. The homologues may have only conservative amino acid changes for example .

Additionally provided by the invention is a method of detecting a nucleic acid molecule consisting essentially of or consisting of: (i) the sequence of SEQ ID NO: 2 (ii) the mRNA equivalent of (i)

(iii) the complement of (i) or (ii) ; or (iv) sequences which hybridize to (i) , (ii) or (iii) comprising utilising at least a forward and reverse primer to amplify the nucleic acid molecule and detecting the product of amplification. Detection of exon 6b may be useful for diagnosis of diseases associated with an activated B-cell phenotype. Since the known splice variant including exon 6b does not appear to be expressed in cells lacking these isoforms, detection of exon 6b is specific for detecting the low molecular weight isoforms of FOXPl.

Preferably amplification occurs by PCR. However, alternative amplification methods may be utilised such as 3SR, NASBA or triamplification for example.

In one embodiment real-time quantitative PCR will be utilised. Techniques such as Taqman^®, Molecular Beacons^®, Scorpion^® and Amplifluor^® systems are all commercially available and routinely used to generate PCR products which can be detected in a homogeneous assay and in real-time.

If the mRNA is to be detected it is preferred to initially carry out a reverse transcription step followed by amplification. RT-PCR, including real-time quantitative

PCR, techniques are well defined in the art and commercially available.

According to a further aspect of the invention, there is provided a method of diagnosing a disease associated with activation of NF-κB in a subject, the method comprising; in a sample obtained from a subject, detecting

(i) the sequence of SEQ ID NO : 2

(ii) the mRNA equivalent of (i) (iii) the complement of (i) or (ii) ; or

(iv) sequences which hybridize to (i) , (ii) or (iii) wherein detection of the gene expression product indicates the presence of the disease.

The method may be used in both a diagnostic and prognostic sense. In one embodiment the method is used to detect B cell activation, which occurs through activation of NF-κB.

In a most preferred embodiment the method is used to diagnose activated B-cell (ABC) like subtype of DLBCL.

In a further embodiment the method is used to distinguish ABC-DLBCL from GC-DLBCL. This can be achieved according to the method described above because the germinal-cell subtype of DLBCL does not have high levels of expression of the low molecular weight isoforms of FOXPl, as encoded by the novel alternatively spliced gene expression product disclosed herein.

Additionally, the method may also be used to distinguish activated B-cell-like DLBCL from other subtypes of non- germinal centre-like DLBCL, for example type-3 DLBCL. Type-3 DLBCL is a third subtype identified using microarray studies that has a different gene expression profile to ABC-like or GC-like DLBCL and is associated with poor prognosis.

In a preferred embodiment the subject is human. It is possible, however, that the method may also have applicability to non-human animals.

Preferably, the sample used in the method is a tissue sample. In a most preferred embodiment the sample will be a tissue sample obtained from a DLBCL. In many cases the tissue sample under test will be paraffin embedded. However, the method of the present invention is equally applicable to fresh and frozen samples.

The sample may be of any size provided it contains sufficient material to allow identification of the gene expression product which is specific for the low molecular weight isoforms of FOXPl.

It is preferred that the method is carried out by taking advantage of nucleic acid amplification techniques which are well known in the art, such as PCR, NASBA, 3SR, tri- amplification etc. These examples are not intended to be limiting with respect to the same invention.

In a most preferred embodiment the method is carried out using the well known reverse transcriptase polymerase chain reaction (RT-PCR) . Thus, total mRNA is isolated and reverse transcribed to form cDNA. This cDNA may then be specifically amplified to detect the gene expression product which represents the novel splice variant of FOXPl disclosed herein for the first time. Most preferably the RT-PCR reaction is carried out in realtime. Also, it is preferred that quantitative results are obtained. Such real-time quantitative RT-PCR reactions are well known to one of skill in the art and kits are commercially available (see Gibson et al for an early example of the technique) , such as Amplifluour^® , Taqman^®, Molecular Beacons^®, Lightcycler^® and Scorpion^® systems for example .

Whilst the minimum amplification products include an appropriate part of exon 6b only, in a particular embodiment the amplification is carried out using a forward primer which binds to a nucleic acid molecule having the sequence of SEQ ID NO: 2 and a reverse primer which binds to a nucleic acid molecule having the sequence of SEQ ID NO: 4 or 5. Thus a PCR product containing sequence from exon 6b and exon 8 and/or exon 9 will be specifically amplified. This is particularly advantageous to distinguish the new variant from a previously identified splice variant which includes exons 6b, 7 and 10, but not exons 8 and 9.

However, this is not essential since the previously identified splice variant including exon 6b does not appear to be expressed at all in ABC-like DLBCL (see the experimental section below) . Thus, in a preferred embodiment, the amplification is carried out using a forward primer which binds to a nucleic acid molecule having the sequence of SEQ ID NO : 2 and a reverse primer which binds to a nucleic acid molecule having the sequence of SEQ ID NO: 3, since smaller products are more reliably formed from paraffin embedded samples. Furthermore, because the amplification product will be relatively small, such an amplification product is especially favourable when the sample being used in the method is paraffin embedded.

The amplification may be carried out using any reverse primer which binds 3 ^■ to exon 7 in combination with a forward primer binding within exon 6b, because any such amplification product is specific for the novel splice variant disclosed herein (because the previously identified splice variant including exon 6b does not appear to be expressed at all, see below) .

Alternative means of detection include binding with labelled probes, specific for either the mRNA or cDNA sequence. The labels may be fluorescent labels, radiolabels or mass labels (detectable by mass spectrometry) for example.

In addition, it is especially preferred to utilise cDNA microarrays in order to detect the new splice variant. Such microarrays are well known in the art and are commercially available, for example from Affymetrix. In fact, microarrays were originally utilised in order to identify the ABC subtype of DLBCL, see Alizadeh et al . Therefore, the detection of expression of the novel splice variant may be carried out in conjunction with determining expression of other genes which have previously been shown to be indicative of an activated B-cell phenotype .

According to a further aspect of the invention there is provided a cDNA microarray comprising a cDNA molecule comprising the sequence of SEQ ID NO: 2 immobilised thereon. Thus, a microarray is provided which can be utilised in order to detect expression levels of the alternatively spliced form of the FOXPl gene which gives rise to low molecular weight isoforms of FOXPl. Such a microarray is useful for distinguishing ABC-DLBCL from GC-DLBCL for example.

SEQ ID NO: 2 represents the sequence of exon 6b which is considered to be a useful probe or target for identifying the splice variant . The microarray may contain less than the full sequence of exon 6b immobilized thereon, provided that a sufficient length of sequence is present in order to allow specific binding of a cDNA probe thereto. The array may comprise a cDNA molecule consisting essentially of or consisting of the sequence of SEQ ID NO: 2. Preferably the cDNA probes are fluorescently labelled to aid with detection upon binding to the microarray. Fluorescent labels such as Cy5 and Cy3 are well known and commercially available.

Preferably, the cDNA molecule which is immobilized on the array consists essentially of or consists of the sequence of SEQ ID NO: 7, which represents the full cDNA sequence of the alternative splice variant.

Microarrays and their means of manufacture are well known and can be manufactured to order by commercial entities such as Affymetrix, for example.

The probes are the sequences which are immobilized onto the array, by known methods, and which represent selected sequences from the nucleic acid molecule of interest, in this case the novel FOXPl splice variant. Probe selection and array design lie at the heart of the reliability, sensitivity, specificity, and versatility of the microarrays of the invention. The methods for selecting suitable probes would be readily apparent for one of skill in the art and may involve optimization using data collected from multiple databases, bioinformatics tools, and experiment-trained computer models.

The key elements of probe selection and design are common to the production of all arrays, regardless of their intended application and as such would be well known to one of skill in the art. Strategies to optimize probe hybridization, for example, are invariably included in the process of probe selection. Hybridization under particular pH, salt, and temperature conditions can be optimized by taking into account melting temperatures and using empirical rules that correlate with desired hybridization behaviours.

The GeneChip arrays produced by Affymetrix involve a Perfect

Match/Mismatch probe strategy. For each probe designed to be perfectly complementary to a target sequence, a partner probe is generated that is identical except for a single base mismatch in its centre. These probe pairs, called the "Perfect Match probe (PM) " and the "Mismatch probe (MM)", allow the quantitation and subtraction of signals caused by non-specific cross-hybridization. The difference in hybridization signals between the partners, as well as their intensity ratios, serve as indicators of specific target abundance. Such an array design may be applicable to, and incorporated into, the arrays of the present invention. In order to ensure specificity of the probes in terms of accurately representing the novel splice variant of FOXPl, the microarray preferably comprises at least 10 probes representing the splice variant. However, other numbers of probes may be utilised provided that the expression of the splice variant can be accurately and specifically measured.

Each probe is preferably at least about 20 nucleotides in length such that a probe is of sufficient length to ensure sensitivity and specificity of hybridization is provided. However, any length of probe may be utilised within the scope of the invention, provided that accurate results are achieved in terms of detecting expression of the novel FOXPl splice variant. Possible lengths for the probes include at least 10 nucleotides and up to 250 nucleotides and preferably between about 20 and about 50 nucleotides.

In addition, it may be possible to utilise a number of different reagents in the methods of the invention at the same time. Furthermore, specific reagents may act in a complementary manner. For example, a primary antibody may be bound to the low molecular weight forms of FOXPl and then a secondary antibody raised against the primary antibody could be utilised. This secondary antibody may be labelled with a suitable fluorescent marker or another suitable conjugate. Such conjugates are well known in the art and include, by way of example, alkaline phopsphatase and horse radish peroxidase. Enzymes such as these can catalyze a reaction with a chemiluminescent substrate leading to emission of light at the reaction site. An x-ray film exposed to the signal provides a visual indication of potential primary antibody recognition. The action of horseradish peroxidase or alkaline phosphatase on a chemiluminescent substrate can give sensitivity down to the picomolar range. For example, a substrate chromogen commonly used in conjunction with alkaline phosphatase is 5- bromo, 4-chloro, 3-indolylphosphate (BCIP) . An additive such as iodoblue tetrazolium (INT) may also be used to enhance the final colour of the precipitate at the reaction sites, that is where the primary and secondary antibodies have bound to the antigen (which would be a yellow-brown colour for BCIP with INT) .

Horseradish Peroxidase (HRP) activity can be measured using many commercially available fluorogenic substrates. One example is Amplex Red Reagent (Molecular Probes) , 10-acetyl- 3 , 7-dihydroxyphenoxazine, which can react with H₂0₂ in a 1:1 stochiometry in the presence of HRP to produce highly fluorescent resorufin. An alternative substrate is scopoletin, where HRP catalyzes conversion of the fluorescent scopoletin to a nonfluorescent product. Such substrates are commonly included in ELISA kits to allow detection of sites where an antigen/analyte is present.

In a preferred method of the invention, immunostaining, both a primary and secondary antibody are used as standard. Prior to incubation with the primary antibody a blocking buffer may be used to prevent non-specific binding. Standard protocols for such methods can be found in various laboratory manuals and would be routine for one of skill in the art .

As shown in the experimental section, western blotting may also be used in order to distinguish low and high molecular weight forms of FOXPl because the proteins are separated on the basis of their size. This allows a reagent which does not discriminate between low and high molecular weight forms of FOXPl, such as the monoclonal antibody JC12 (which is obtainable from a hybridoma deposited in accordance with the provisions of The Budapest Treaty of 1977 with the European Collection of Cell Cultures, Centre for Applied Microbiology & Research, Salisbury, Wiltshire, SP4 OJG, UK, on 14 April 1999 under accession No. 99041425) to be used in the method of the invention in order to diagnose diseases associated with high levels of expression of low molecular weight forms of FOXPl.

In a further embodiment this method of the invention further comprises measuring the gene expression profiles of suitable markers. Specific markers have already been described in the art which may be suitable for contributing to distinguishing between subtypes of DLBCL. These include measuring BMP-6 mRNA expression for example.

The invention, in a further aspect, also relates to a reagent for use in the methods of the invention. A number of different types of reagent are discussed above. One reagent in the present invention is a monoclonal antibody, although other reagents are contemplated to fall within the scope of the present invention, in order to detect the low molecular weight forms of the FOXPl protein.

In a preferred aspect there is provided a primer (reagent) for use in the methods of the invention which when used in an amplification reaction together with another primer leads to amplification of a cDNA product comprising at least part of the sequence of SEQ ID NO: 7 or its complement.

Preferably, primer pairs are provided which specifically amplify the new splice variant, as defined in SEQ ID NO: 7. At least one primer in the primer pair should bind within the 6b exon (SEQ ID NO: 2) and preferably both members of the primer pair will bind within exon 6b.

The terms forward and reverse primer are well known to one of skill in the art.

At the basic level a primer pair which binds to and amplifies at least some of the sequence of exon 6b is preferred. However, whilst the forward primer is always required to bind within and direct amplification from exon 6b, the reverse primer may bind to any site downstream of exon 6b.

Preferably, the reverse primer binds to the complement of the sequence of any of SEQ ID NO: 3, 4, 5 or 6. Even more preferably, the primer binds to the complement of sequence of SEQ ID NO: 4 or 5.

The primer may be comprised of single or double stranded nucleic acid, but preferably single stranded nucleic acid. The primer will need to be treated to make it single stranded, by heating for example, for use in an amplification reaction. The primer may be composed of natural or synthetic nucleic acid, in terms of source. The preferred primer consists of single stranded DNA.

Primers will typically be around 5 to 30 base pairs in length although this exemplification is not intended to be limiting with respect to the present invention.

RNAi reagents (siRNA molecules) are also included within the scope of the invention and are discussed in detail below.

Proteins which interact with the low molecular weight FOXPl polypeptides of the invention may be discovered by identifying proteins which co-immunoprecipitate with the protein of the invention using a suitable antibody. For example, this may be the JC12 monoclonal antibody, although preferably this would be a monoclonal antibody which reacts only with the low molecular weight forms of FOXPl and not the full length protein (which JC12 does) . Alternatively, such interacting proteins may be identified by investigating protein-protein interactions using the two-hybrid vector system first proposed by Chien et al (1991), Proc. Natl. Acad. Sci. USA 88: 9578-9582.

This technique is based upon functional reconstitution of a transcription factor which activates a reporter gene. More particularly, the technique comprises providing an appropriate host cell with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA binding domain and an activating domain, expressing in the host cell a first hybrid DNA sequence encoding a first fusion of a fragment or all of a nucleic acid sequence encoding the low molecular weight versions of FOXPl and either said DNA binding domain or said activating domain of the transcription factor, expressing in the host at least one second hybrid DNA sequence, such as a library or the like, encoding putative binding proteins to be investigated together with the DNA binding or activating domain of the transcription factor which is not incorporated in the first fusion; detecting any binding of the proteins to be investigated with a low molecular weight form of the FOXPl protein by detecting for the presence of any reporter gene product in the host cell; optionally isolating second hybrid DNA sequences encoding the binding protein.

Methods for raising monoclonal antibodies are well known in the art. For example, techniques for raising monoclonal antibodies are extensively discussed in a number of laboratory manuals such as "Antibodies: a laboratory manual" by Harlow and Lane, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, United States, 1998, "Antibody engineering, 2nd ed." by Carl and Borrebaeck, W.H. Freeman and Company, New York, NY, United States, 1995, "Antibody engineering: A Practical Approach" by McCafferty, Hoogenbottom and Chiswell, IRL Press at Oxford Press, Oxford, England, 1996 and "Antibody Engineering Protocols" by Paul, Humana Press, Totowa, NJ, United States, 1995.

These manuals also discuss how antibodies can be engineered to produce derivatized antibodies which may contain portions from different species. The present invention includes not only complete antibody molecules but fragments thereof. Antibody fragments which contain the idiotype of the molecule can be generated by known techniques. For example, such fragments include but are not limited to the F(ab')₂ fragment which can be produced by pepsin digestion of the antibody molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab')₂ fragments and the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent. Chimeric humanized and fully humanized mAb can now be made by recombinant engineering. By addition of the human constant chain to F(ab^')₂ fragments it is possible to create a humanized monoclonal antibody which is useful in immunotherapy applications where patients making antibodies against the mouse Ig would otherwise be at a disadvantage. Breedveld F.C. Therapeutic Monoclonal Antibodies. Lancet 2000 Feb 26; 335, P735-40.

Further derivatized antibodies include single chain variable fragment antibodies (scFv) , which have shown promise as specifically targeted peptide antibodies, due in large part to their small size. scFv antibodies are well known in the art and libraries are commercially available. These antibodies may be used to target the function of the low molecular weight isoforms of FOXPl in an intracellular context (intrabodies) .

Once a monoclonal antibody has been raised against the low molecular weight forms of FOXPl its specificity and sensitivity can be confirmed using suitable processes such as by western blotting or immunostaining experiments for example. The reagents of the invention are most preferably reactive against the low molecular weight forms of the FOXPl protein but not the full length protein, in order to ensure that there is specificity and selectivity in the detection method of the invention. It is shown in the experimental section that an antibody such as JC12 which binds to both full length and low molecular weight forms of FOXPl can be useful in certain detection methods such as western blotting. However, in a clinical context it is preferred if the reagent is specific for the low molecular weight form and does not react with the full length FOXPl protein. This allows detection to become more routine, for example using immunohistochemical staining. Most centres performing routine lymphoma diagnosis would not wish to, or be capable of, carrying out a western blot reaction in order to achieve a diagnosis. The timescale and complexity of such a reaction makes it less practical than more rapid methods of diagnosis, such as immunohistochemical staining. Methods such as immunohistochemical staining are routine for one of skill in the art. Such immunohistochemical staining procedures are described using the JC12 antibody in WO

The reagent of one aspect of the invention specifically excludes the monoclonal antibody JC12 because this antibody does not distinguish between low molecular weight forms of FOXPl and the full length protein. However, JC12 labels both full length and low molecular weight isoforms of FOXPl. Thus, a reagent such as a monoclonal or polyclonal antibody to the N-terminal 100 amino acids that would only identify the full length FOXPl but not the low molecular weight isoforms may be used in conjunction with JC12 to distinguish cases having high level expression of FOXPl specifically due to the smaller isoforms. A suitable polyclonal antibody for this purpose is the affinity purified rabbit polyclonal antibody, AB/FOX330, which is commercially available from CeMines International.

Therefore, in a further aspect the invention also provides a method of diagnosing a disease characterised by expression of low molecular weight isoforms of FOXPl containing a N- terminal deletion in a subject comprising: contacting a sample obtained from the subject with a first reagent specific for the N-terminal region of FOXPl which is not found in the low molecular weight isoforms of FOXPl and also with a second reagent specific for the amino acids found in both low molecular weight and full length

FOXPl and comparing the binding patterns of the two reagents to detect relative expression of the low molecular weight isoforms of FOXPl containing an N-terminal deletion. (See SEQ ID NO: 8, 9 and 10)

By low molecular weight isoforms is meant those FOXPl isoforms encoded by the novel splice variant depicted in SEQ ID NO: 7.

SEQ ID NO: 8 represents the amino acid sequence of the longest polypeptide encoded by the novel splice variant. SEQ ID NO: 9 represents an alternative amino acid sequence when an additional downstream methionine is utilised to initiate translation.

SEQ ID NO: 10 shows a still further amino acid sequence when a further downstream methionine is used to initiate translation.

Thus, the amino acid sequence of the low molecular weight isoforms corresponds to that of the full length FOXPl protein but without the N-terminal 100 amino acids.

Therefore, a reagent which will bind specifically to the N- terminal amino acids of FOXPl will be able to distinguish between full length FOXPl and the low molecular weight isoforms. In addition, if a reagent is also utilised which binds to both full length and truncated FOXPl, the binding patterns may be compared in order to determine relative levels of the low molecular weight versions of FOXPl.

In a preferred embodiment this method is used to diagnose the activated B-cell-line (ABC) subtype of diffuse large B- cell lymphoma (DLBCL) . Principally the method will be used to distinguish ABC DLBCL from GC DLBCL, because ABC DLBCL is characterised by expression of low molecular weight FOXPl isoforms, unlike GC DLBCL.

The first reagent may be any reagent provided that it is specific for the N terminal region of FOXPl which is not found in the low molecular weight variants of FOXPl (see SEQ ID No's: 8, 9 and 10) . Examples of possible reagents include all of those described above, beginning on page 7, such as for example nucleic acid molecules, fluorescent molecules, binding proteins, small molecules, receptors, lectins etc. All of these may be used as a reagent provided that they allow specific identification of the full length version of FOXPl which contains the N terminal 100 or so amino acids. It is known that FOXPl binds nucleic acid sequences and therefore specific binding sequences could potentially be selected, in order to produce suitable nucleic acid based reagents.

Preferably, the first reagent is an antibody. Even more preferably, the antibody is a monoclonal antibody although polyclonal antibodies may be included within the scope of the invention.

A preferred first reagent is the affinity purified rabbit polyclonal antibody, AB/FOX330, which is commercially available from CeMines International.

The second reagent may, likewise, be any suitable reagent which binds to both full length and low molecular weight versions of FOXPl. All of the examples listed above may be utilised as the second reagent.

Preferably, however, the second reagent is an antibody, most preferably a monoclonal antibody. One example of such is the known JC12 monoclonal antibody.

In one embodiment the method which is utilised comprises immunohistochemistry, a technique which is routine for one of skill in the art and therefore is not detailed further herein; reference can be made to standard laboratory manuals.

In an additional aspect, the invention also provides a kit for use in the method of the invention which comprises a reagent which binds to low molecular weight forms of FOXPl in a sample, including at the nucleic acid level, but does not bind to high molecular weight forms of FOXPl. The kit will also preferably contain means for contacting said reagent with said sample.

Preferably, the kit is suitable for diagnosing the ABC subtype of DLBCL.

The reagent in the kit may include suitable primer molecules as described above. Thus, a preferred kit of the invention is a RT-PCR kit useful for detecting the novel low molecular weight alternative splice variants of FOXPl. Such a kit may include, in addition to primers, suitable buffers, RNase inhibitors and DNA isolation reagents, polymerase enzymes for amplification, etc.

The kit may also include, by way of example, a reverse transcriptase such as AMV reverse transcriptase for first strand cDNA synthesis. For second strand cDNA synthesis and subsequent amplification a DNA polymerase, such as Tfl or Taq DNA polymerase would be required. It is important in RT- PCR reactions that conditions are kept ribonuclease (RNase) free. Therefore an RNase inhibitor may be included in the kit to prevent degradation of the RNA samples.

DNA isolation reagents would be needed in order to purify DNA from samples. Such DNA isolation reagents are well known in the art, for example phenol-chloroform extraction is a commonly used technique. Kits may include phosphate buffered saline (PBS) for suspending cells and wash buffer (10 mM HEPES-KOH (pH=7.5); 1.5 mM MgCl₂; 10 mM KC1 ; 1 M dithiothreitol) . DNA may extracted using standard salt- chloroform techniques and therefore such reagents would be included in the kits of the invention. Ethanol precipitation may be used to obtain high molecular weight DNA, and such reagents used in this technique could be included within the scope of the invention. TE buffer (10 mM Tris; 1 mM EDTA (pH 8.0)) may also be included for dissolving DNA samples, alternatively, for example, distilled water could be used.

For real-time RT-PCR, suitable probes or labelled primers may be included in the kit. Generally the primers or probes will be fluorescently labelled. Any suitable fluorophore is included within the scope of the invention. Fluorophores that could possibly be used in the method of the invention include, by way of example, FAM, HEX™, NED™, ROX™, Texas Red™ etc. Similarly the kits of the invention are not limited to a single quencher. Quenchers, for example Dabcyl and TAMRA are well known quencher molecules that could be used in the methods and kits of the invention.

Suitable PCR enzymes, such as Taq polymerase in order to amplify the DNA sequences may be included in the kits of the invention.

The reagent in the kit may also be a suitable antibody for use in the methods as described above.

The kit may optionally include instructions for use of the reagent. Additionally, suitable buffers may also be provided which prevent degradation of the samples. Furthermore, the kit may include further reagents which prevent non-specific binding of the reagent. For example, milk protein is a non-specific binder which can be used to prevent non-specific antibody binding.

A blocking buffer may be included within a kit suitable for use in immunostaining. An immunostaining kit is a preferred kit of the invention. Such a kit may include, in addition to the primary antibody, a secondary antibody. The antibodies may be provided in appropriate diluent buffers. The secondary antibody may be conjugated with a suitable fluorophore or enzyme, such as alkaline phosphatase or horseradish peroxidase for example. Suitable substrates for these enzymes may also be included in the kits of the invention.

The kit may also include suitable rinsing buffers, such as PBS for example.

The reagents according to the present invention may advantageously be used in the treatment of the human or animal body or alternatively in the manufacture of a medicament for treating diseases associated with high level expression of low molecular weight forms of FOXPl . They may also be included in a pharmaceutical composition together with any suitable pharmaceutically acceptable carrier diluent or excipient therefor.

Expression of the low molecular weight FOXPl isoforms can be used to identify, in general, the state of B-cell activation and therefore determination of this expression can be used to distinguish both normal and malignant activated B-cells from non-activated B-cells. The smaller isoforms may be a target for reducing B-cell activation in general, which may be useful in the treatment of any disease or condition in which B-cell activation plays a role.

Accordingly, in an additional aspect the invention provides a method of treating a disease associated with expression of low molecular weight forms of FOXPl comprising administering to a subject in need thereof a reagent of the invention which can prevent the disease associated effects of the low molecular weight forms of the FOXPl protein.

For example, by binding to the low molecular weight versions of FOXPl, including at the mRNA level, the reagent may effectively prevent any disease associated function which the low molecular weight versions of FOXPl may display.

In one embodiment, the disease being treated is cancer. Any type of cancer may be treated provided the high levels of expression of low molecular weight forms of FOXPl have an association with the cancer. Such cancers include, by way of example only and which are not intended to limit the invention in any way, diffuse large B-cell lymphoma (DLBCL), Non-Hodgkin' s lymphoma, leukaemia, cervical, prostate, stomach, colon, head and neck, renal, breast or lung cancer.

In a most preferred embodiment according to this aspect of the invention, the disease is the activated B-cell-like subtype (ABC) of diffuse large B-cell lymphoma (DLBCL) .

This subtype of DLBCL has poor prognosis and is shown herein for the first time to have, as a characteristic feature, high levels of expression of low molecular weight forms of FOXPl caused by a newly identified alternative splicing event .

In a further aspect of the invention there is provided the use of a reagent according to the present invention in the treatment of disease. In one embodiment the disease being treated is cancer. Any type of cancer may be treated provided the high levels of expression of low molecular weight forms of FOXPl have an association with the cancer. Such cancers include, by way of example only and which are not intended to limit the invention in any way, diffuse large B-cell lymphoma (DLBCL), Non Hodgkin's lymphoma, leukaemia, cervical, prostate, stomach, colon, head and neck, renal, breast or lung cancer.

In a most preferred embodiment the disease is the activated B-cell-like subtype (ABC) of diffuse large B-cell lymphoma (DLBCL) .

As shown in the experimental section, ABC-like DLBCL appears to be linked to, or associated with, high levels of expression of low molecular weight forms of FOXPl. Therefore, therapy may be possible by providing reagents which bind selectively and specifically to the low molecular weight versions of FOXPl. For example, a monoclonal antibody, as defined and described above, may be used in order to bind to and effectively "quench" the low molecular weight versions of FOXPl which may contribute to ABC subtypes of DLBCL. By binding to the low molecular weight versions of FOXPl the reagent may effectively prevent any disease-associated function which the low molecular weight versions of FOXPl may display.

Preferably, therapy is achieved using specific nucleic acid molecules which can suppress expression of the novel splice variant of FOXPl which gives rise to the activated B-cell associated low molecular weight forms of FOXPl.

A method of preventing specifically the expression of the low molecular weight isoforms of FOXPl may have a number of therapeutic implications, as discussed above. With the discovery of a new splice variant giving rise to the low molecular weight isoforms of FOXPl there is the opportunity for specifically targeting this splice variant utilising RNAi interference. RNA interference (RNAi) is a sequence- specific post-transcriptional gene silencing mechanism, which is triggered by double-stranded DNA and causes degradation of mRNAs homologous in sequence to the dsRNA (Cogoni and Macino, 2000; Guru, 2000; Hammond et al . , 2001). In mammalian cells this work was originally hampered by a number of dsRNA-triggered pathways that non-specifically suppress gene expression. However, the use of short dsRNAs of approximately 21-nt has overcome this problem and has been shown to be an effective way of specifically silencing human genes in cultured somatic cells (Elbashir et al . ,

2001) . A tool for predicting target siRNA sequences within a specific gene and for designing DNA oligonucleotides for use with their siRNA construction kit is available at www. ambion . com.

The RNAi molecule may be designed to cross the new exon boundaries, such as those between exons 6b and 7. An RNAi molecule designed against an appropriate part of the sequence of exon 6b, which is not found in the full length FOXPl mRNA, may be useful for inhibiting expression only of low molecular weight forms which may be useful for treating diseases such as ABC DLBCL. Such RNAi molecules may be useful to treat any disease characterised by expression of low molecular weight versions of FOXPl.

Accordingly, an RNAi molecule which inhibits or prevents translation of the mRNA sequence of the novel splice variant of FOXPl corresponding to SEQ ID NO: 7 is provided.

The RNA duplex will preferably be less than 30 bp in length, since duplexes of greater than 30 bp may induce non-specific interferon-mediated effects when introduced into cells in vivo, and will preferably be at least 15 bp in length, more preferably at least 18 bp in length. RNA duplexes of 20-27 bp in length, 20-24 bp in length, or 21 bp in length are particularly suitable as RNAi reagents. The dsRNA may contain one or more substitute bases in order to optimise performance in RNAi. Substitution of even a single nucleotide may have a profound effect on activity of the RNAi duplex. It will be apparent to the skilled reader, how to vary each of the bases of the dsRNA in turn and test the activity of the resulting siRNAs (e.g. in a suitable in vitro test system) in order to optimise the performance of a given siRNA. The dsRNA may further contain DNA bases, non- natural bases or non-natural backbone linkages, for example to enhance stability in vivo or enhance resistance to degradation by nucleases. The dsRNA may also be flanked by single-stranded overhangs at one or both ends of the duplex. In a particularly preferred embodiment the dsRNA may contain 3 ' overhanging nucleotides, preferably two 3' overhanging thymidines (dTdT) or uridines (UU) . 3 ' TT or UU overhangs may be included in the RNAi duplex if the sequence of the target gene immediately upstream of the sequence included in double- stranded part of the RNAi duplex is AA. This allows the TT or UU overhang in the RNAi duplex to hybridise to the target gene.

Although a 3 ' TT or UU overhang may also be included at the other end of the RNAi duplex it is not essential for the target sequence downstream of the sequence included in double-stranded part of the RNAi duplex to have AA.

In a further embodiment rather than being formed of two separate RNA strands annealed together, the dsRNA may have a foldback stem-loop or hairpin structure, wherein the two strands of the dsRNA are covalently linked. RNAs having this structure are typical if the dsRNA is synthesised by expression in vivo or by in vitro transcription. The precise nature and sequence of the "loop" linking the two RNA strands is generally not material to the invention, except that it should not impair the ability of the double- stranded part of the molecule to mediate RNAi.

The double-stranded RNA will preferably comprise 20-27, 20- 24, or 21 consecutive nucleotides of the human mRNA sequence of the novel alternative splice variant of FOXPl, since duplexes of this length are particularly effective in RNAi. siRNA reagents which are RNA/DNA chimeras are also contemplated. These chimeras include, for example, the siRNA reagents comprising a double-stranded RNA with 3 ' overhangs of DNA bases (e.g. dTdT) , as discussed above, and also siRNA reagents comprising a double-stranded "RNA" in which one or more of the RNA bases, or even an entire strand, are replaced with DNA bases.

Preferred target sequences for RNAi and corresponding sense and antisense strands of preferred siRNA molecules are provided below. All sequences have been confirmed to be specific for FOXPl using appropriate BLAST searches against non-redundant databases.

Target sequences for RNAi to silence FOXPl exon 6b.

Target sequence 1: AACCGGCTCTGAATGTAGCTA (SEQ ID NO: 13)

Sense strand siRNA: CCGGCUCUGAAUGUAGCUAnn (SEQ ID NO: 14) Antisense strand siRNA: UAGCUACAUUCAGAGCCGGnn (SEQ ID NO: 15)

Target sequence 2: AATGTAGCTAACTCAACTGTC (SEQ ID NO: 16)

Sense strand siRNA: UGUAGCUAACUCAACUGUCnn (SEQ ID NO: 17) Antisense strand siRNA: GACAGUUGAGUUAGCUACAnn (SEQ ID NO:18)

Target sequence 3: AACTCAACTGTCAGAACTGCA (SEQ ID NO: 19)

Sense strand siRNA: CUCAACUGUCAGAACUGCAnn (SEQ ID NO: 20) Antisense strand siRNA: UGCAGUUCUGACAGUUGAGnn (SEQ ID NO: 21) Target sequence 4: AACTGTCAGAACTGCATGAAG (SEQ ID NO: 22)

Sense strand siRNA: CUGUCAGAACUGCAUGAAGnn (SEQ ID NO: 23) Antisense strand siRNA: CUUCAUGCAGUUCUGACAGnn (SEQ ID NO: 24)

Target Sequences for RNAi on FOXPl exon 6b/7 boundary

20nt either side of splice junction used as target because the preferred length for the siRNA molecule is approximately 21 nucleotides and at least one nucleotide difference is required for specificity of silencing

Target sequence 5: AACTGCATGAAGGACGGTTCC (SEQ ID NO:25)

Sense strand siRNA: CUGCAUGAAGGACGGUUCCnn (SEQ ID NO: 26) Antisense strand siRNA: GGAACCGUCCUUCAUGCAGnn (SEQ ID NO: 27)

Target sequence 6: AAGGACGGTTCCCGTGTCAGT (SEQ ID NO: 28)

Sense strand siRNA: GGACGGUUCCCGUGUCAGUnn (SEQ ID NO: 29) Antisense strand siRNA: ACUGACACGGGAACCGUCCnn (SEQ ID NO: 30)

In the siRNA' s above, n is preferably thymine (t) but may also be uracil (u) .

Variants of the siRNA' s described above are included within the scope of the invention. For example, it has recently been shown that synthetic RNA duplexes consisting of either 27-mer blunt or short hairpin (sh) RNAs with 29 bp stems and 2-nt 3' overhangs are more potent inducers of RNA interference than conventional 21-mer siRNAs. This is believed to be due to enhanced interaction with Dicer which processes the siRNAs and improves incorporation into RNA- induced silencing complex (RISC) . Thus, molecules based upon those above but being either 27-mer blunt or short hairpin (sh) RNA's with 29-bp stems and 2-nt 3 ' overhangs are also included in the invention. The skilled person, with knowledge of the target would be able to extend the 21-mers above to generate these molecules readily (see Williams, Nature Biotechnology Vol 23, 2, Feb 2005, 181 and Kim et al , Nature Biotechnology Vol 23, 2, Feb 2005, 222-229 and Siolas et al, Nature Biotechnology Vol 23, 2, Feb 2005, 227-231 which references are incorporated herein in their entirety) .

siRNAs according to the invention may be synthesised in vitro using chemical or enzymatic RNA synthesis techniques well known in the art. In one approach the two separate RNA strands may be synthesised separately and then annealed to form double-strands.

In a further embodiment, siRNAs may be synthesised by intracellular expression from a suitable expression vector. Thus, the invention further provides an expression vector encoding an siRNA according to the invention. A number of non-viral (e.g. plasmid) or viral expression vector systems for in vivo expression of short double-stranded RNAs for use as RNAi reagents (also referred to as small interfering RNAs, or siRNAs) are known in the art. Generally, siRNAs are expressed as stem-loops, which may be rapidly processed within the cell to produce the "free" siRNA (see review by Tuschl, Nature Biotechnology, Vol. 20(5), 446-448, 2002). Vector systems for expression of siRNAs are often based on RNA Pol III promoters, since these are particularly suited to accurate expression of very short RNA sequences. Suitable vector systems are described in Brummelkamp, T.R. et al., Science, Vol. 296, 550-553, 2002; Lee, N.S. et al . , Nature Biotechnology, Vol. 20, 500-505, 2002; Miyagashi, M & Taira, K. Nature Biotechnology, Vol. 20, 497-500, 2002; Paul, C.P. et al . , Nature Biotechnology, Vol. 20, 505-508, 2002, the contents of which are incorporated herein by reference.

For delivery into cells in vivo siRNAs may be formulated with a lipid-based carriers including, for example, oil-in water emulsions, micelles, and liposomes. Liposomes are the most preferred carriers, and their use is well known in the art. Liposomes are commercially available from Gibco BRL, for example, as LIPOFECTIN™ and OLIGOFECTAMINE™, which are formed of cationic lipids. Methods for making liposomes are well known in the art and have been described in many publications. Liposomes may be targeted to a particular tissue by coupling the liposome to a specific ligand, such as a monoclonal antibody, sugar, glycolipid or protein.

Liposomes may also be used to deliver vectors encoding double-stranded RNAs. In the field of human gene therapy it is well known to deliver expression vectors, such as plasmids, via nucleic acid-liposome complexes.

The reagent may be encapsulated and/or combined with suitable carriers in solid dosage forms for oral administration which would be well known to those of skill in the art or alternatively with suitable carriers for administration in an aerosol spray. Examples of oral dosage forms include tablets, capsules and liquids.

Alternatively, the therapeutic agent may be administered parenterally. Specific examples include intradermal injection, subcutaneous injection (which may advantageously give slower absorption of the therapeutic agent) , intramuscular injection (which can provide more rapid absorption) , intravenous delivery (meaning the drug does not need to be absorbed into the blood stream from elsewhere) , sublingual delivery (for example by dissolving of a tablet under the tongue or by a sublingual spray) , rectal delivery, vaginal delivery, topical delivery, transdermal delivery and inhalation.

In a still further aspect, the invention provides a pharmaceutical composition comprising a reagent according to the present invention.

In the pharmaceutical composition of the invention, preferred compositions include pharmaceutically acceptable carriers including, for example, non-toxic salts, sterile water or the like. A suitable buffer may also be present allowing the compositions to be lyophilized and stored in sterile conditions prior to reconstitution by the addition of sterile water for subsequent administration. The carrier can also contain other pharmaceutically acceptable excipients for modifying other conditions such as pH, osmolarity, viscosity, sterility, lipophilicity, somobility or the like. Pharmaceutical compositions which permit sustained or delayed release following administration may also be used. For use in human therapy, pharmaceutical compositions including the siRNAs of the invention will be administered to a patient in need of treatment in a "therapeutically acceptable amount" . A therapeutically acceptable amount is an amount of a pharmaceutical preparation that alone, or together with further doses, produces the desired response in the condition being treated.

Furthermore, as would be appreciated by the skilled practitioner, the specific dosage regime may be calculated according to the body surface area of the patient or the volume of body space to be occupied, dependent on the particular route of administration to be used. The amount of the composition actually administered will, however, be determined by a medical practitioner based on the circumstances pertaining to the disorder to be treated, such as the severity of the symptoms, the age, weight and response of the individual .

The term "treatment" may encompass prophylactic treatment aimed at preventing the appearance or lessening the severity of disease symptoms.

The invention will be further understood with reference to the following examples, together with the accompanying figures in which:

Figure 1 shows differential levels of FOXPl protein isoforms in cancer cell lines. Nuclear proteins were extracted from cell lines using the NE-PER nuclear and cytoplasmic reagents (PIERCE) according to the supplier's protocol. Proteins were resolved by electrophoresis using SDS PAGE in 20 cm 15% polyacrylamide gels. Proteins were transferred to PVDF membrane and immunoblotting was performed using monoclonal antibody, which has been shown to recognise Foxpl . Nuclear proteins were extracted from HepG2 (lane 3) , Jurkat (lane 4), OCI-Ly3 (lane 5), OCI-LylO (lane 6), SUDHL6 (lane 7), SUDHL10 (lane 8) , HLY-1 (lane 9) , LIB (lane 10) , DEAU (lane 11), MIEU (lane 12), DAUDI (lane 13), DB (lane 14) and FL18 (lane 15) . Molecular weight markers (Biorad) were run to show approximate sizes of FOXPl isoforms (lane 1) . Arrows 1 and 2 on the right indicate the high and low molecular weight forms of the FOXPl protein respectively.

Figure 2 FOXPl isoforms detected by Western blotting of

DLBCL-derived cell lines

Nuclear proteins were extracted from cell lines using the NE-PER kit from PIERCE according to the manufacturer's instructions. Equivalent amounts of total protein were electrophoresed through a 10% polyacrylamide gel and were then transferred to PVDF membrane. (A) Western blot analysis using anti-FOXPl mouse monoclonal antibody (JC12) showing FOXPl from (lane 1) OCILy3 (ABC-like) , (lane 2) OCILylO

(ABC-like), (lane 3) HLY1 (unknown), (lane 4) SUDHL6 (GC) , (lane 5) SUDHL10 (GC) , (lane 6) SUDHL4 (unknown) , (lane 7) DB (GC) , (lane 8) MIEU (unknown) , (lane 9) LIB (unknown) and (lane 10) Karpas 422 (foUicular lymphoma) . (B) Western blot analysis as in (A) except anti-beta actin mouse monoclonal antibody was used as a loading control.

Figure 3 FOXPl isoforms detected by Western blotting of B and T lymphoma derived cell lines

Nuclear proteins were extracted from cell lines using the NE-PER kit from PIERCE according to the manufacturer's instructions. Equivalent amounts of total protein were electrophoresed through a 10% polyacrylamide gel and were then transferred to PVDF membrane. (A) Western blot analysis using anti-FOXPl mouse monoclonal antibody (JC12) showing FOXPl from (lane 1) 0CILy3 (ABC-like DLBCL), (lane 2) Molt4 (T lymphocyte) , (lane 3) Jurkat (T lymphocyte) , (lane 4)

Karpas 299 (T lymphocyte) , (lane 5) SUDHL1 (T lymphocyte) , (lane 6) HUT78 (cutaneous T lymphocyte) , (lane 7) F118 (FoUicular B lymphocyte), (lane 8) Raj i (Burkitt's lymphoma) , (lane 9) Daudi (B lymphocyte) and (lane 10) KMH2 (Hodgkin's lymphoma). (B) Western blot analysis as in (A) except anti-beta actin mouse monoclonal antibody was used as a loading control .

Figure 4 FOXPl isoforms detected by Western blotting of additional cell lines

Nuclear proteins were extracted from cell lines using the NE-PER kit from PIERCE according to the manufacturer's instructions. Equivalent amounts of total protein were electrophoresed through a 10% polyacrylamide gel and were then transferred to PVDF membrane. (A) Western blot analysis using anti-FOXPl mouse monoclonal antibody (JC12) showing FOXPl from (lane 1) 0CILy3 (ABC-like DLBCL), (lane 2) HEPG2 (liver), (lane 3) H441 (lung adenocarcinoma), (lane 4) 293T (embryonic kidney) , (lane 5) SKNMC (neuroblastoma) , (lane 6)

IMR32 (neuroblastoma) and (lane 7) COS1 (monkey kidney) . (B)

Western blot analysis as in (A) except anti-beta actin mouse monoclonal antibody was used as a loading control.

Figure 5 FOXPl isoforms detected by Western blotting of breast and prostate cell lines

Nuclear proteins were extracted from cell lines using the NE-PER kit from PIERCE according to the manufacturer's instructions. Equivalent amounts of total protein were electrophoresed through a 10% polyacrylamide gel and were then transferred to PVDF membrane. (A) Western blot analysis using anti-FOXPl mouse monoclonal antibody (JC12) showing FOXPl from (lane 1) OCILy3 (ABC-like DLBCL) , (lane 2) MCF7 [Breast, estrogen receptor (ER) positive] , (lane 3) MDA MB 231 (Breast, ER negative), (lane 4) MDA MB 468 (Breast, ER positive) , (lane 5) MDA MB 435 (Breast, ER negative) , (lane 6) ZR751 (Breast, ER positive), (lane 7) T47D (Breast, ER positive) , (lane 8) SKBR3 (ER negative) , (lane 9) LNCAP (Prostate) , (lane 10) DU145 (Prostate) and (lane 11) PC3 (Prostate) . (B) Western blot analysis as in (A) except anti- beta actin mouse monoclonal antibody was used as a loading control .

Figure 6. Immunohistochemical staining of naive peripheral blood B-cells.

Cytospin preparations of purified naϊve B cells were immunoperoxidase labelled using antibodies to FOXPl (JC12) , CD20, CD25 or CD30 including MR12 as a negative control antibody as indicated on each panel. Figure 7. Immunohistochemical staining of IgM activated peripheral blood B-cells.

Cytospin preparations of purified naϊve B cells were activated using IgM and then immunoperoxidase labelled using antibodies to FOXPl (JC12), CD20, CD25 or CD30 including MR12 as a negative control antibody as indicated on each panel .

Figure 8. Immunohistochemical staining of IL2-SAC activated peripheral blood B-cells.

Cytospin preparations of purified naϊve B cells were activated using IL2/SAC and then immunoperoxidase labelled using antibodies to FOXPl (JC12), CD20, CD25 or CD30 including MR12 as a negative control antibody as indicated on each panel.

Figure 9. Immunohistochemical staining of the OCI-Ly3 DLBCL cell line.

Cytospin preparations of the ABC-like DLBCL cell line OCI- Ly3 were immunoperoxidase labelled using antibodies to FOXPl (JC12) , CD20, CD25 or CD30 including MR12 as a negative control antibody as indicated on each panel.

Figure 10. Western blotting of naϊve and activated peripheral blood B cells to detect the expression of FOXPl isoforms .

Purified naϊve B cells were stimulated under various conditions for 44 hours before total protein was extracted using 1 X RIPA buffer. Equivalent amounts of total protein were electrophoresed through a 10% polyacrylamide gel and were then transferred to PVDF membrane. (A) Western blot analysis using anti-FOXPl mouse monoclonal antibody (JC12) showing FOXPl from (lane 1) OCILy3 cells, (lane 2) un- sti ulated naϊve B cells (Naϊve B cells) , (lane 3) naϊve B cells stimulated with 50 ug/ml F(ab')2 goat antihuman IgM (IgM activated) and (lane 4) naϊve B cells stimulated with a combination of 1:20,000 wt/vol Staphylococcus aureus, Cowan's strain (SAC; Pansorbin cells) plus 5 ng/ml recombinant interleukin-2 (IL2 + SAC) . (B) Western blot analysis as in (A) except anti-beta actin mouse monoclonal antibody was used as a loading control.

Figure 11. FOXPl RT-PCR using cDNA derived from DLBCL cell lines .

The top FOXPl panel shows RT-PCR from the DLBCL cell lines indicated with the PJB020/PJB021 primer pair producing a 550bp FOXPl product that is restricted to the DLBCL cell lines that express the lower molecular weight FOXPl isoforms. The middle panel shows that all the samples contain cDNA that enabled amplification using an actin probe as a control for sample integrity. The bottom panel shows the FOXPl 3'UTR PCR product amplified by primers PJB022/PJB023.

Figure 12. Peroxidase immunostaining using a commercial FOXPl polyclonal antibody.

The top two panels illustrate staining of FOXPl transfected

COS cells with either JC12 or the FOXPl polyclonal antibody.

Staining of transfected cells is illustrated with arrows.

The lower panels show peroxidase immunostaining of the OCI- Ly3 DLBCL cell line with either JC12 or the FOXPl polyclonal antibody (AB/FOX330) . Weaker nuclear reactivity is observed with the polyclonal antibody (1/200 dilution) . This was still observed at a 1/100 dilution (data not shown) .

Experimental Part

The ABC subtype of DLBCL is distinguished by the high level expression of lower molecular weight forms of the FOXPl protein.

The expression of different molecular weight forms of the FOXPl protein was investigated by Western blotting using the JC12 monoclonal antibody in a range of cancer cell lines. The results are illustrated in Figure 1. These studies included five DLBCL cell lines that had microarray gene expression profiles reported to be characteristic of either the ABC-like (0CI-Ly3 and OCI-LylO) or GC-like (SUDHL6, SUDHL10, DB) subtypes of this disease (Alizadeh et al . , 2000; Rosenwald et al . , 2002).

This approach identified an unexpectedly high level expression of two smaller molecular weight forms of the FOXPl protein in the OCI-Ly3 and OCI-LylO cell lines. These smaller isoforms were not highly expressed in the GC-derived DLBCL cell lines (DB, SUDHL10 and SUDHL6) . This FOXPl protein expression pattern distinguished the ABC-like cell lines from the GC-like cell lines, including the FOXP1- positive GC-like DLBCL cell line DB . These data also suggest that the HLY-1 cell line may be derived from an ABC-like DLBCL. These lower molecular weight isoforms have been detected in other cell lines (e.g. the B-cell line Daudi) but not at these high levels of expression. The high level expression of specific lower molecular weight FOXPl isoforms in the ABC-like DLBCL cannot be distinguished from the high level expression of the larger isoform (seen here in the GC- like DB cell line) by immunohistochemistry using the JC12 monoclonal antibody. This is a possible explanation for why immunohistochemical labelling studies with JC12 provide conflicting data on the association between FOXPl expression and survival, as this will be affected by the proportion of GC cases in each series of cases that are FOXPl-positive.

The inventors have previously described different molecular weight forms of the FOXPl protein expressed from alternatively spliced mRNA transcripts and these might be the source of these smaller FOXPl proteins (Banham et al . , 2001) . Other possibilities also exist, for example proteolytic cleavage of the protein or genetic changes to DNA at the FOXPl locus.

The high level expression of these FOXPl isoforms can thus be used to distinguish ABC-derived DLCBL from GC-derived DLBCL cell lines. It is unlikely that Western blotting will be used routinely for diagnosis and therefore additional reagents, such as monoclonal antibodies, will be needed to distinguish these smaller 64-69 kDa FOXPl isoforms from the higher molecular weight 75-79 kDa isoform by immunohistochemistry. The production of these additional reagents should provide clinically important prognostic information in DLBCL. The abundance of these isoforms may also affect downstream gene expression pathways and thus there is the potential for novel therapeutic intervention. Materials and Methods

Cell culture

1.1 Adherent cell lines: e.g. MCF-7 and HepG2.

Cell monolayers were grown to confluence in T75 tissue culture flasks in RPMI 1640 media supplemented with 10% foetal calf serum (FCS) , 2 mM glutamine and antibiotics [streptomycin (50 μg/ml) and penicillin (50 U/ml) ] at 37°C and 5% C0₂. Cells were split into 150mm tissue culture plates and grown to confluence for protein extraction.

1.2 Suspension cell lines: e.g. Jurkat, 0CI-Ly3, OCI-LylO, SUDHL6, SUDHL10, HLY-1, LIB, DEAU, MIEU, DAUDI, DB and F 18, The OCI-Ly3, OCI-LylO (ABC-derived), SUDHL-6, SUDHL-10 and DB (GC-derived) DLBCL cell lines were a kind gift from Dr Eric Davis and Dr Andreas Rosenwald, Bethesda USA, and the LIB, MIEU, DEAU and HLY-1 DLBCL cell lines were generously provided by Dr Talal Al Saati, Toulouse, France. Cells were maintained in T75 tissue culture flasks in RPMI 1640 media supplemented with 10% FCS, 2 mM glutamine and antibiotics [streptomycin (50 μg/ml) and penicillin (50 U/ml) ] at 37°C and 5%C0₂.

2. Preparation of cytoplasmic and nuclear protein fractions

For adherent cell lines, proteins were extracted from one confluent 150mm tissue culture plate. For suspension cells, proteins were extracted from 2 x 10⁷ cells. Proteins were extracted using the NE-PER nuclear and cytoplasmic reagents (PIERCE) . All procedures were carried out at 40°C unless otherwise stated. Cells were isolated in a 1.5 ml microfuge tube by centrifugation at 1000 rpm for 2 minutes. The supernatant was removed and discarded leaving the pellet as dry as possible. 400 μl of ice cold CER I was added and the cell pellet was resuspended by vigorous vortexing for 15 seconds and then incubated for 10 minutes. 22 μl of CER II was added to the tube and vortexed for 5 seconds followed by a 1 minute incubation. The tube was again vortexed for 5 seconds followed by centrifugation for 5 minutes at maximum speed. The supernatant, which contained the cytoplasmic protein fraction, was transferred to a clean, pre-chilled microfuge tube. Resuspension of the insoluble (pellet) fraction was achieved by the addition of 200 μl ice cold NER I and vortexed for 15 seconds. The sample was returned to ice and was vortexed for 15 seconds every 10 minutes, for a total of 40 minutes. Sample was centrifuged at maximum speed for 10 minutes and the supernatant, which contained the nuclear fraction, was transferred to a clean pre-chilled microfuge tube. All extracts were stored at -80oC until further use.

3. Western analysis

3.1 Electrophoresis of proteins using SDS PAGE Electrophoresis was performed using 20 cm acrylamide resolving gels [1 mm thick, 10 % (w/v) acrylamide, 0.8 % (w/v) methylene-bisacrylamide, 0.375 M Tri-HCl pH 8.8, 0.1 % (w/v) SDS] . Polymerisation was initiated by the addition of 250 μl 10% (w/v) ammonium persulfate (APS) and 25 μl TEMED per 50 ml solution. Stacking gel [1 mm thick, 5 % (w/v) acrylamide, 0.13 % (w/v) methylene-bisacrylamide, 0.125 M Tri-HCl pH 6.8, 0.1 % (w/v) SDS] was cast on top of the resolving gel after the addition of 250 μl 10% (w/v) ammonium persulfate (APS) and 50 μl TEMED per 50 ml solution. All protein samples to be electrophoresed were solubilised in 1 x SDS loading buffer [50 mM Tris-HCl pH 6.8, 100 mM DTT, 2 % (w/v) SDS, 0.1 % (w/v) bromophenol blue, 5 % (v/v) glycerol] and heated at 100°C for 5 minutes before loading onto gel . Samples were loaded onto gel and electrophoresis was performed at 200 V in SDS running buffer [25 mM Tris, 250 mM glycine pH 8.3, 0.1 % (w/v) SDS] until the bromophenol blue had reached the gel front. l/8th of each protein sample was loaded onto the gel .

3.2 Transfer of gel fractionated proteins Gel fractionated proteins were transferred electrophoretically to Immobilon (Millipore) by conventional semi-dry blotting. PVDF membrane was wetted (10 seconds) in 100 % methanol and equilibrated in SDS transfer buffer [25 mM Tris, 250 mM glycine pH 8.3, 0.1 % (w/v) SDS, 10 % methanol] together with the SDS gel and 3MM paper for 5 minutes. After assembly of the blot, gel fractionated proteins were transferred to PVDF membrane at 11 V for 90 minutes .

3.3 Protein staining PVDF membrane was stained after transfer of proteins with

Ponceau S to give an indication of transfer efficiency. Membranes were stained in Ponceau S [0.5 % (w/v) Ponceau S, 1 % (v/v) acetic acid] for an appropriate length of time and then destained in 100 % methanol. Membrane was allowed to air dry for 20 minutes prior to immunoblotting.

3.4 Immunoblotting of proteins transferred to PVDF membrane All procedures were performed at room temperature. Membrane was removed from the transfer apparatus and washed extensively in distilled water followed by staining in Ponceau S (see section 3.3) . Membrane was wet (10 seconds) in 100 % methanol and equilibrated in 1 X PBS [10 PBS tablets (OXOID) dissolved in 1 litre Milli Q water] for 15 minutes. Membrane was incubated in blocking buffer [1 X PBS, 5 % (w/v) Marvel] for 1 hour followed by incubation with JC12 monoclonal antibody (at a 1 in 30 dilution) in blocking buffer for 90 minutes. Membrane was washed extensively in wash buffer [1 X PBS, 0.05 % (v/v) Tween] for 30 minutes with the wash buffer changed every 10 minutes. Incubation with species-specific horseradish peroxidase- (HRP-) conjugated secondary antibodies at a 1 in 1500 dilution was performed in blocking buffer for 90 minutes. Membrane was washed as before and proteins detected using the enhanced chemiluminescence (ECL) reagent (Amersham) .

1) Western blotting experiments to investigate the expression of FOXPl isoforms in other cell lines.

To determine whether the high level expression of low molecular weight FOXPl protein isoforms was restricted to the ABC-like DLBCL cell lines, additional FOXPl Western blotting experiments were performed using the methodology described for the DLBCL cell lines. Cell lines included DLBCL cell lines (Figure 2) additional T and B cell lymphoma cell lines (Figure 3) together with those from a range of solid tumours (Figure 4) , including breast and prostate tumours (Figure 5) . An antibody against actin was used as a sample loading control .

None of the cell lines tested showed comparable high level expression levels to those observed in the ABC-like DLBCL cell lines 0CI-Ly3 and OCI-LylO, indicating that this FOXPl expression pattern is indeed unusual. In this second experiment less FOXPl expression was observed in the HLY-1 cell line (Figures 1 and 2) , which while partly due to sample loading does demonstrate that this cell line does not express the FOXPl protein as highly as the gene expression profiled ABC-like DLBCL cell lines. However, several cell lines, the 293T embryonic kidney cell line, the estrogen receptor negative breast cancer cell line MDA MB 231, and the HUT78 cutaneous T cell lymphoma cell line did express reasonably high levels of the lower molecular weight isoforms of FOXPl. In each case these were at higher levels than expression of the full length FOXPl protein. These data suggest that the expression of lower molecular weight FOXPl isoforms is not itself specifically diagnostic for the ABC- subtype of DLBCL, although that does not exclude their use in distinguishing these from other DLBCL subtypes. There is also the possibility that the smaller FOXPl isoforms may provide prognostic information in other tumour types if their presence is found to correlate with clinical features such as survival or with the activation of signalling pathways that are targets for therapeutic intervention.

2) FOXPl nuclear protein expression is up-regulated on the activation of naϊve B cells purified from peripheral blood.

Methods

Reagents: Blood buffy coat preparations were obtained from the National Blood Service (Bristol, United Kingdom). Ficoll Paque^® and enhanced chemiluminescence (ECL) reagent were purchased form Amersham Biosciences (Amersham, United

Kingdom) . The naϊve B cell isolation kit was obtained from Miltenyi Biotech Ltd (Bisley, United Kingdom). F (ab')2 goat antihuman IgM was purchased from Cambridge Biosciences (Cambridge, United Kingdom), Staphylococcus aureus, Cowan's strain (SAC; Pansorbin cells) was obtained from Merck

Biosciences Ltd (Nottingham, United Kingdom) and recombinant interleukin-2 (rIL-2) was obtained from R & D Systems (Minneapolis, MN) . EDTA free protease inhibitors, Roche (Lewes, United Kingdom) . Anti-beta Actin mouse monoclonal antibody, Abeam (Cambridge, United Kingdom) . Polyvmylidene fluoride (PVDF) membrane (Immobilon-P) was purchased for Millipore (Watford, United Kingdom) . Horseradish peroxidase (HRP) - conjugated goat anti-mouse secondary antibody, the Envision™ kit, anti-Bcl6 and anti-CD138 antibodies, DAKO Cytomation (Ely, United Kingdom) . Anti-MUM-1 antibody was a kind gift from B. Falini from the Institute of Haematology and Internal Medicine (Perugia, Italy) . All other antibodies used were made by the LRF Immunodiagnostics Unit (Oxford, United Kingdom) .

Naϊve B cell purification and activation: Peripheral blood mononuclear cells (PBMCs) were purified by density gradient centrifugation over Ficoll Paque^® from a blood buffy coat. Naϊve B cells were purified from 60 x 10⁷ PBMCs using the naϊve B cell isolation kit according to the manufacturer's instructions, Miltenyi Biotech Ltd. From this experiment we obtained 4.6 x 10⁷ naϊve B cells. Naϊve B cells were activated as described in Allman et al . (1996). Essentially, purified naϊve B cells were cultured at 2 x 10⁶ cells /ml in RPMI containing 10% (v/v) fetal calf serum (FCS) , 1 μg/ml glutamine, 50 U/ml of penicillin and 50 μg/ml streptomycin, and 5 x 10-5 mol/1 2-mercaptoethanol for one hour at 37°C prior to activation. Purified naϊve B cells were then treated under the following conditions (i) un-stimulated (Naϊve) , (ii) stimulated with 50 μg/ml anti IgM (IgM) or (iii) 1:20,000 wt/vol SAC plus 5 ng/ml rIL-2 (IL2 + SAC).

Cells were incubated at 37°C, 5% C0₂ for 44 hours. After activation, cytospins were prepared from each individual stimulation and then total protein was extracted from the remaining cells using RIPA buffer.

Protein extraction: 200 μl of ice-cold 1 X RIPA buffer [10 mM Tris-HCl pH 8.0, 1 % (v/v) Triton-X-100 , 0.1 % (w/v) SDS, 0.1 % (w/v) sodium deoxycholate, 1 mM EDTA, 0.5 mM EGTA, 140 mM NaCl plus protease inhibitors) was added to the cells, vortexed extensively and left on ice for 30 mins with occasional vortexing. Samples were centrifuged at full speed for 15 mins at 4°C and the supernatant, which contained total soluble protein, was transferred to a clean eppendorf tube and stored at -20°C until required for subsequent analysis .

Immunohistochemistry: Cytospins were prepared from each individual stimulation, allowed to air-dry at room temperature and were then stored un-fixed at -20°C. Prior to immunostaining, cytospins were removed and allowed to air- dry at room temperature. Cytospins were fixed in acetone at room temperature for 10 minutes and then allowed to air-dry at room temperature for 20 mins. Immunostaining was performed using the Envision kit according to the manufacturer's instructions, DAKO Cytomation. Cytospins were immunostained with antibodies to FOXPl (JC12, 1 in 10 dilution) , CD25 (1 in 10 dilution) , CD30 (undiluted) , CD20 (undiluted) , Muml (1 in 2 dilution) , Bcl6 (1 in 5 dilution) , CD10 (undiluted) and rabbit immunoglobulin (MR12, 1 in 10 dilution) . Antibodies were diluted in 1 x PBS, 10 % (v/v) human serum.

Western analysis: Equivalent amounts of protein were solubilised in 1 x SDS loading buffer [50mM Tris pH 6.8, 2 % (w/v) SDS, 0.1 % (w/v) bromophenol blue, 5% (v/v) glycerol and lOOmM dithiothreitol] , boiled for 5 mins and resolved through 10% acrylamide gels in 1 x SDS running buffer [25 mM Tris, 250 mM glycine and 0.1 % (w/v) SDS] . After separation, proteins were transferred to PVDF membrane in transfer buffer (10 % Methanol, 1 x SDS running buffer) using conventional semi-dry transfer. Membranes were then immunoblotted with JC12 following the previously described protocol. Membranes were then stripped in stripping buffer (100 mM 2-mercaptoethanol, 2 % (w/v) SDS, 62.5 mM Tris-HCl pH 6.8) at 50°C for 30 minutes and then washed extensively in distilled H₂0. Membranes were then incubated in blocking buffer [5% (w/v) Marvel, 1 x phosphate buffered saline (PBS) ] for 1 hour and then incubated in blocking buffer with anti-beta actin mouse monoclonal antibody at a dilution of 1 in 20,000 for 30 mins at room temperature. Membranes were washed for 30 minutes in three changes of wash buffer (1 x PBS, 0.05% (v/v) Tween) and then incubated with a HRP - conjugated goat anti-mouse secondary antibody at a dilution of 1 in 1500 in blocking buffer for 30 mins at room temperature. Membranes were washed as before and proteins detected using ECL reagent.

Results and Conclusions

Naϊve B cells were purified from peripheral blood as described in the methods sections above. Cells were then continued in culture with or without the addition of either the activation reagents IgM or IL-2/SAC. Cytospin preparations of these cells were prepared for immunohistochemistry and the remaining cells were extracted for Western blotting as described above.

Immunoperoxidase labelling of the naϊve B-cells confirmed that they were CD20-positive, FOXPl-negative (JC12 antibody) and did not express the activation markers CD25 or CD30 (Figure 6) . Naϊve B cells that had been activated by IgM crosslinking were found to have increased nuclear FOXPl protein expression and some expression of the activation marker CD25 (Fig 7) . Those activated by IL2+SAC showed much higher levels of nuclear FOXPl expression, together with the expression of both the activation markers CD25 and CD30 (Fig 8) . These data confirmed the successful activation of the naϊve B cells. Immunostaining of cytospins from the OCI-Ly3 cell line demonstrated that these cells also had a similar immunophenotype and expressed the activation markers CD25 and CD30 (Figure 9) .

Samples of the naϊve and activated non-malignant peripheral blood B cells were analysed for FOXPl expression by Western blotting to investigate the molecular weight of the FOXPl isoforms (Figure 10) . The activated non-malignant B cells showed similar expression levels and abundance of FOXPl isoforms to the OCI-Ly3 cell line indicating that this pattern of FOXPl expression reflects the activation status of B cells rather than being a disease related abnormality.

These data demonstrate that the activation of both non- malignant B-cells (signalling pathway leads to NF-kB activation) and the activated phenotype characteristic of the ABC-like DLBCL (caused by constitutive NF-kB activation) results in high expression levels of FOXPl, including that of smaller FOXPl isoforms. If these FOXPl isoforms are found to play a critical role in the NF-kB activation pathway then specifically silencing their expression may represent a therapeutic target (eg specific silencing using RNAi) to modulate NF-kB activity in a range of diseases.

3) Investigation of the expression of 5 ' FOXPl splice variants in the DLBCL cell lines

One possible explanation for the smaller FOXPl protein isoforms is their generation through alternative splicing of the FOXPl mRNA. Several PCR primer pairs were designed around the known alternatively spliced 5' FOXPl exons to investigate the expression of alternatively spliced FOXPl transcripts in the DLBCL cell lines.

Synthesis of DLBCL cDNA: Cell pellets from the DLBCL cell lines were used for polyA mRNA isolation using the μMACS mRNA isolations system from Miltenyi Biotech Ltd, according to the manufacturers instructions. Then cDNA was generated from lOOng mRNA by reverse transcription as follows: 100 ng mRNA (in 3 μl) , 1.0 μl 100 ng μl^"1 random primers (500 μg ml^" ¹ (5x) stock, Promega), ddH20 to 16 μl . Heat 70 °C, 10 min, chill on ice. Then added, 5 μl 5 x FSB, 1 μl 10 mM dNTP, 1 μl 0.1 M DTT, 1 μl (Rnasin, 40 U ul^"1, Promega), 1 μl Superscript II (200 U μl^"1, Invitrogen) . Incubated at 42 °C for 50 min then inactivated at 70 °C for 15 min.

PCR amplification: Used 2 μl of the cDNA as template for PCR (included zero DNA control) using KOD Hot Start Polymerase (Novagen) + 30 μl dH₂0, 5 μl lOx KOD PCR Buffer, 5 μl dNTPs (2 M stock, KOD kit) [final 0.2 mM) , 2 μl MgS04 (25 mM stock, KOD kit) [final 1 mM) , 2 μl cDNAtemplate, 3 μl primer 1 (5 μM stock, [final 0.3 μM] ) , 3 μl primer 2 (5 μM stock, [final 0.3 μM] ) , 1 μl KOD Hot Start Pol (1 U μl^"1) . PCR conditions were 94 °C for 2 mins initial denaturation. Followed by 30 cycles of: 94 °C 15 sees, 60 °C 30 sees, 72 °C 30 sees. Then 72 °C for 10 mins and hold at 4 °C.

PCR primer sequences are as follows:

PJB020 5'-GTA GCT AAC TCA ACT GTC AGA ACT GC-3' PJB021 5'-AGG AGA CAC ATG TCG TGG TCA GAT CC-3'

PJB022 5'-TAC AGA AGG AAG GGA GTC CCA TCT-3'

PJB023 5'-GAA GGA TAT ATG CCA AGA TAA ACC-3' -Results and conclusions The PCR primers PJB020/PJB021 amplified a 550bp product from the DLBCL cell lines that was an unexpected size when compared to the product of 271bp expected from the known splice variant in pAB199 that contained the exon (6b) bound by the primer PJB020. More importantly this product was detected specifically in the 3 DLBCL cell lines that expressed the smaller FOXPl isoforms (Figure 11) . Although the DB DLBCL cell line expresses reasonable amounts of the full length FOXPl protein, and was shown to express other FOXPl isoforms (eg the 3'UTR probe), there was no PCR product observed with this PJB020/PJB021 primer pair. PCR with actin probes confirmed that all samples contained cDNA (Figure 11) and a zero DNA control showed no product (data not shown) .

Gene expression profiling studies have also claimed to distinguish quantitative FOXPl mRNA expression differences in GC-like and ABC-like DLBCL. The FOXPl cDNA clone on the Lymphochip is a small fragment from the 3' UTR. PCR primers PJB022/PJB023 were designed to amplify this C-terminal region from the DLBCL cell lines. While there did seem to be lower levels of the 3' FOXPl UTR derived PCR product in the SUDHL6 and SUDHLIO cell lines (Figure 11) , this region was not as effective in distinguishing the GC-like and ABC-like cell lines as the PJB020/PJB021 primer pair and would require quantitative PCR. In addition these primers did not distinguish a cell line with strong full length FOXPl protein expression, eg. DB, from those with the smaller FOXPl isoforms. Identification of the PJB020/PJB021 PCR product

As the PJB020/PJB021 FOXPl PCR product was an unexpected molecular weight, that did not correspond to the size predicted for the known splice variants, this PCR product was sequenced from all 3 DLBCL cell lines (in both directions) to confirm that it represented a novel FOXPl isoform.

PJBI-y3 - PJB021 'CAGAACTGCATGAAGGACGGTTCCCGTGTCAGTGGCTATGATGACACCTCAAGTTA

PJBH Y1-PJB021 'CAGAACTGCATGAAGGACGGTTCCCGTGTCAGTGGCTATGATGACACCTCAAGTTA

PJBLylO-PJB021 L'CAGAACTGCATGAAGGACGGTTCCCGTGTCAGTGGCTATGATGACACCTCAAGTTA.

PJBLylO-PJB020 .ACACCTCAAGTTA.

PJBHLY1-PJB020 .ACACCTCAAGTTA-

PJBLy3-PJB020 -ACACCTCAAGTTA

PJB y3-PJB021 59 .ACTCCCCAGCAAATGCAGCAGATCCTCCAGCAACAAGTG5t.TGAGCCCBTCAGCAGCTC<

PJBHLY1-PJB021 59 .ACTCCCCAGCAAATGCAGCAGATCCTCCAGCAACAAGTGCTGAGCCCHTCAGCAGCTCC PJBLylO-PJB021 61 :ACTCCCCAGCAAATGCAGCAGATCCTCCAGCAACAAGTGKTGAGCCCHTCAGCAGCTC(

PJBLylO-PJB020 16 ACTCCCCAGCAAATGCAGCAGATCCTCCAGCAACAAGTGCTGAGCCCΘTCAGCAGCTCt

PJBHI-Y1-PJB020 16 .ACTCCCCAGCAAATGCAGCAGATCCTCCAGCAACAAGTGCTGAGCCCHTCAGCAGCTCC

PJBLy3-PJB020 16 .ACTCCCCAGCAAATGCAGCAGATCCTCCAGCAACAAGTGCTGAGCCCBTCAGCAGCTCC

PJBLy3-PJB021 118 .GGTTCTCCTCCAGCAGCAGCAGGCCCTCATGCTTCAACAGCAGCAGCTTCAAGAGTTT^r. PJBH Y1-PJB021 118 ITTCTCCTCCAGCAGCAGCAGGCCCTCATGCTTCAACAGCAGCAGCTTCAAGAGTTT' PJB ylO-PJB021 12 AGGTTCTCCTCCAGCAGCAGCAGGCCCTCATGCTTCAACAGCAGCAGCTTCAAGAGTTT' PJBLylO-PJB020 76 GGTTCTCCTCCAGCAGCAGCAGGCCCTCATGCTTCAACAGCAGCAGCTTCAAGAGTTT¹: PJBHLY1-PJB020 75 'GGTTCTCCTCCAGCAGCAGCAGGCCCTCATGCTTCAACAGCAGCAGCTTCAAGAGTTT'i PJBLy3-PJB020 75 GGTTCTCCTCCAGCAGCAGCAGGCCCTCATGCTTCAACAGCAGCAGCTTCAAGAGTTT^r

PJBLy3-PJB021 178 TAAAAAACAACAGGAACAGTTGCAGCTTCAACTTTTACAACAACAACATGCTGGAAAAC

PJBHLY1-PJB021 178 TAAAAAACAACAGGAACAGTTGCAGCTTCAACTTTTACAACAACAACATGCTGGAAAAC

PJBLylO-PJB021 180 -TAAAAAACAACAGGAACAGTTGCAGCTTCAACTTTTACAACAACAACATGCTGGAAAAC

PJBLylO-PJB020 13 ATAAAAAACAACAGGAACAGTTGCAGCTTCAACTTTTACAACAACAACATGCTGGAAAAl

PJBHLY1-PJB020 135 .TAAAAAACAACAGGAACAGTTGCAGCTTCAACTTTTACAACAACAACATGCTGGAAAA'^"

PJBLy3-PJB020 135 TAAAAAACAACAGGAACAGTTGCAGCTTCAACTTTTACAACAACAACATGCTGGAAAAC

PJB y3-PJB021 238 GCCTAAAGAGCAACAGCAGGTGGCTACCCAGCAGTTGGCTTTTCAGCAGCAGCTTTTAC PJBH Y1-PJB021 238 3CTACCCAGCAGTTGGCTTTTCAGCAGCAG( _Myi_MlJ> PJBLyl0-PJB021 240 GCCTAAAGAGCAACAGCAGGTGGCTACCCAGCAGTTGGCTTTTCAGCAGCAGCTTTTAt

PJBLylO-PJB020 196 GCCTAAAGAGCAACAGCAGGTGGCTACCCAGCAGTTGGCTTTTCAGCAGCAGCTTTTAC

PJBH Y1-PJB020 195 GCCTAAAGAGCAACAGCAGGTGGCTACCCAGCAGTTGGCTTTTCAGCAGCAGCTTTTAC

PJBLy3-PJB020 195 GCCTAAAGAGCAACAGCAGGTGGCTACCCAGCAGTTGGCTTTTCAGCAGCAGCTTTTAt

PJBLy3-PJB021 298 GATGCAGCAGTTACAGCAGCAGCACCTCCTGTCTTTGCAGC jaaagsassrara

PJBH Y1-PJB021 298 .GATGCAGCAGTTACAGCAGCAGCACCTCCTGTCTTTGCAGCGCCKAGGCCTTCTGAC.

PJBLyl0-PJB021 3 DO mrnast sz s as m

PJB ylO-PJB020 256 GATGCAGCAGTTACAGCAGCAGCACCTCCTGTCTTTGCAGCGCC AGGCCTTCTGACA¹

PJBH Y1-PJB020 255 JATGCAGCAGTTACAGCAGCAGCACCTCCTGTCTTTGCAGCGCCQAGGCCTTCTGACA'

PJBLy3-PJB020 255 GATGCAGCAGTTACAGCAGCAGCACCTCCTGTCTTTGCAGCGCCGAGGCCTTCTGACA

PJB y3 - PJB021 358 TCAGCCCGGGCAGCCTGCCCTTCCCCTTCAACCTCTTGCTCAAGGCATGATTCCAACAC

PJBHLY1 - PJB021 358 rTCAGCCCGGGCAGCCTGCCCTTCCCCTTCAACCTCTTGCTCAAGGCATGATTCCAACAG PJBLylO - PJB021 360 'TCAGCCCGGGCAGCCTGCCCTTCCCCTTCAACCTCTTGCTCAAGGCATGATTCCAACAG

PJBLylO - PJB020 316 ^TCAGCCCGGGCAGCCTGCCCTTCCCCTTCAACCTCTTGCTCAAGGCATGATTCCAACAC

PJBHLY1 - PJB020 315 TCAGCCCGGGCAGCCTGCCCTTCCCCTTCAACCTCTTGCTCAAGGCATGATTCCAACAC

PJB]_y3 - PJB020 315 TCAGCCCGGGCAGCCTGCCCTTCCCCTTCAACCTCTTGCTCAAGGCATGATTCCAACAC

PJBLy3-PJB021 418 CTGCAGCAGCTCTGGAAAGAAGTGACAAGTGCTi

PJBHLY1-PJB021 418 CTGCAGCAGCTCTGGAAAGAAGTGACAAGT gThilJeJifel-

PJBLylO-PJB021 420 CTGCAGCAGCTCTGGAAAGAAGTGACAAGTGC^r

PJBLyl0-PJB020 376 CTGCAGCAGCTCTGGAAAGAAGTGACAAGTGCTCATABCTGCAGAAGAAACCACAGGC

PJBHLY1-PJB020 375 .CTGCAGCAGCTCTGGAAAGAAGTGACAAGTGCTCATABCTGCAGAAGAAACCACAGG PJB y3-PJB020 375 iCTGCAGCAGCTCTGGAAAGAAGTGACAAGTGCTCATAflCTGCAGAAGAAACCACAGG

PJB20=coding and PJB21 was non-coding

Sequence analysis of this PCR product confirmed that it was indeed a FOXPl isoform.

The exons in the FOXPl reference sequence AF250920 were numbered 1-20. Additional exons, that we know of from our own splice variants and analysis of FOXPl EST sequences in Genbank, were then added in as (5' UTR) -2 and -1 and then alternative coding exons 3b, 5b, 5c, and 6b. Our pAB199 alternatively spliced FOXPl cDNA (described in original FOXPl patent, PCT/GBOO/04590) is comprised of exons 6b, 7, 10-20. PCR with the PJB020/PKB021 primers, in exons 6b and 10, was predicted to generate a 271bp product from the pAB199 variant (which was not observed in the cell lines) . The 550bp product corresponded to the same 5' exon (6b)_. as in the pAB199 cDNA isoform but without the removal of exons 8 and 9.

Thus this variant that distinguishes the ABC-like DLBCL cell lines is encoded by exons 6b, 7-10 (likely to be all exons 7- 20 based on predicted molecular weight) . While we have used PCR primers to exons 6b and 10, smaller PCR products amplified using a 3' primer in exon 8 or 9 may actually be more useful diagnostically. The products would be smaller and thus the assay would be applicable to paraffin embedded tissue and there would be no possibility of detecting the pAB199 FOXPl variant lacking these exons.

Translation of this cDNA resulted in the following protein sequence .

RTA-RTVPVS VA MTPQVIT PQQMQQILQQ QWSPQQLQV LLQQQQALML QQQQLQEFYK KQQEQLQLQL LQQQHAGKQP KEQQQVATQQ LAFQQQLLQM

QQLQQQHLLS LQRQGLLTIQ PGQPALPLQP LAQGMIPTEL QQLWKEVTSA

This alternate 5' exon leads to the introduction of an upstream stop codon and the translation of FOXPl protein is predicted to start from internal in frame methionine codons that are part of the normal FOXPl protein. Thus this product represents an N-terminally truncated FOXPl protein starting from approximately aalOl/102 MMTPQVIT. The presence of two additional downstream methionines (indicated in bold) may also explain the expression of two lower molecular weight

FOXPl isoforms if one or other is used to initiate translation. The smallest isoform may start from the 4th methionine codon resulting in the N-terminal protein sequence MLQQQLQEFYK. This FOXPl variant may have lost the - N-terminal LXXLL motif (shown in italics above) . This nuclear receptor box motif enables co-regulatory proteins to bind nuclear receptors such as NF-kB and thus its absence in this FOXPl isoform may be biologically important in ABC-like DLBCL whose survivial is driven by constitutive NF-kB activation. Interestingly, other forkhead proteins such as Foxo3a and Foxj 1 have recently been reported to act as NF-kB repressors.

Reagents specific for N-terminal 100 amino acids of FOXPl

An affinity purified rabbit polyclonal antibody (AB/FOX330) to a peptide epitope within the N-terminal lOOaa of FOXPl (QVSGLKSPKRNDKQP) has recently been made commercially available by CeMines International.

The reactivity of this antibody for the FOXPl protein was confirmed by immunohistochemical labelling of COS-1 cells transfected with the pAB195 FOXPl cDNA with a 1/200 dilution of the polyclonal antibody (Figure 12) . This staining was compared to labelling using the JC12 monoclonal antibody and comparable results were seen in terms of the frequency of either strong nuclear or cytoplasmic positivity. There was some weak cytoplasmic staining with the polyclonal antibody in most cells that may be non-specific staining. Antibody labelling was detected in exactly the same way for both FOXPl antibodies as the DAKO EnVisionTM system recognises both mouse and rabbit primary antibodies. The reactivity of both the JC12 antibody (dil 1/10) and the FOXPl polyclonal antibody (dil 1/200) was then tested in parallel on frozen cytospin preparations of the OCI-Ly3 activated B-cell-like DLBCL cell line. Stronger staining was observed using the JC12 antibody, that recognises both the full-length FOXPl protein and the smaller isoforms. The polyclonal antibody should not recognise smaller isoforms that lack the epitope within the N-terminal 100 aa. These preliminary experimental data suggest that comparative staining using JC12 and an antibody to the N-terminal lOOaa of FOXPl may provide a method with which to identify DLCBL cases where high level expression of FOXPl is predominantly in the form of lower molecular weight isoforms .

Claims

CLAIMS :

1. A nucleic acid molecule comprising: (i) the sequence of SEQ ID NO: 11; (ii) the mRNA equivalent of (i) ; (iii) the complement of (i) or (ii) ; or (iv) sequences which hybridize to (i) , (ii) or (iii) .

2. A polypeptide consisting essentially of or consisting of the amino acid sequence of SEQ ID NO : 8, SEQ ID NO : 9 or

SEQ ID NO: 10.

3. A method of detecting a nucleic acid molecule consisting essentially of or consisting of: (i) the sequence of SEQ ID NO: 2 (ii) the mRNA equivalent of (i) (iii) the complement of (i) or (ii) ; or (iv) sequences which hybridize to (i) , (ii) or (iii) comprising utilising at least a forward and reverse primer to amplify the nucleic acid molecule and detecting the product of amplification.

4. A method of diagnosing a disease associated with activation of NF-κB in a subject, the method comprising; in a sample obtained from a subject, detecting a nucleic acid molecule comprising (i) the sequence of SEQ ID NO: 2 (ii) the mRNA equivalent of (i)

(iii) the complement of (i) or (ii) ; or (iv) .sequences which hybridize to (i) , (ii) or (iii) wherein detection of the nucleic acid molecule indicates the presence of the disease.

5. The method according to claim 4 wherein activated B- cell-like (ABC) diffuse large B-cell lymphoma (DLBCL) is diagnosed.

6. The method according to claim 5 wherein activated B- cell-like diffuse large B-cell lymphoma (ABC-DLBCL) is distinguished from germinal centre-like diffuse large B-cell lymphoma (GC-DLBCL) .

7. The method according to claim 5 wherein activated B- cell-like diffuse large B-cell lymphoma (ABC-DLBCL) is distinguished from type 3 diffuse large B-cell lymphoma (type 3 -DLBCL) .

8. The method according to claim 5,6 or 7 wherein the subject is human.

9. The method according to any one of claims 4 to 8 wherein the sample is a tissue sample.

10. The method according to claim 9 wherein the tissue sample is paraffin embedded.

11. The method according to any one of claims 3 to 10 wherein detection occurs by RT-PCR.

12. The method according to claim 11 wherein the RT-PCR is real-time quantitative RT-PCR.

13. The method according to any one of claims 10 to 12 wherein amplification occurs using a forward primer which binds to a nucleic acid molecule having the sequence of SEQ ID NO: 2 and a reverse primer which binds -to a nucleic acid molecule having the sequence of SEQ ID NO: 3, 4 or 5.

14. The method according to any one of claims 3 to 13 wherein detection is carried out using a cDNA microarray.

15. The method according to claim 14 wherein expression of one or more additional genes is also detected.

16. A primer pair for use in the method of any one of claims 2 to 15 which when used in an amplification reaction leads to amplification of a (cDNA) product comprising at least part of the sequence of SEQ ID NO:2.

17. The primer pair according to claim 16 wherein one of the primers binds to the complement of the sequence of SEQ ID NO: 3, 4, 5 or 6.

18. The primer according to claim 17 which binds to the complement of sequence of SEQ ID NO: 3, 4 or 5 and is used with a primer binding to SEQ ID NO: 2.

19. A cDNA microarray comprising a cDNA molecule comprising the sequence of SEQ ID NO: 2 immobilised thereon.

20. The cDNA microarray of claim 19 comprising the nucleic acid molecule consisting essentially of the sequence of SEQ ID NO: 7 immobilised thereon.

21. A method of diagnosing a disease characterised by expression of low molecular weight isoforms of FOXPl containing an N-terminal deletion in a subject comprising: contacting a sample obtained from the subject with a first reagent specific for the N-terminal region of FOXPl which is not found in the low molecular weight isoform of FOXPl and also with a second reagent specific for the amino acids found in both low molecular weight and full length FOXPl and comparing the binding patterns of the two reagents to thus detect relative expression of the low molecular weight isoforms of FOXPl containing an N-terminal deletion.

22. The method according to claim 21 wherein the method is used to diagnose the activated B-cell-like (ABC) subtype of diffuse large B-cell lymphoma (DLBCL) .

23. The method according to claim 21 or 22 wherein the first reagent is an antibody.

24. The method of any one of claims 21 to 23 wherein the second reagent is an antibody.

25. The method of any one of claims 21 to 24 wherein the first reagent is AB/FOX330 polyclonal antibody.

26. The method according to any one of claims 21 to 25 wherein the second reagent is JC12.

27. The method according to any one of claims 21 to 26 which comprises immunohistochemistry.

28. A siRNA molecule which inhibits or prevents translation of the mRNA sequence corresponding to SEQ ID NO : 7.

29. An siRNA according to claim 28 which targets a nucleic acid molecule comprising the sequence of any one of SEQ ID

NO: 13, 16, 19, 22, 25 or 28.

30. An siRNA molecule according to claim 26 or 27 comprising the sequence of any one of SEQ ID NO: 14 and 15, SEQ ID NO: 17 and 18, SEQ ID NO: 20 and 21, SEQ ID NO: 23 and 24, SEQ ID NO : 26 and 27 or SEQ ID NO : 29 and 30.

31. An siRNA molecule according to claim 31 consisting essentially of or consisting of the sequence of any one of SEQ ID NO: 14 and 15, SEQ ID NO: 17 and 18, SEQ ID NO: 20 and 21, SEQ ID NO: 23 and 24, SEQ ID NO: 26 and 27 or SEQ ID NO: 29 and 30.

32. A method of diagnosing a disease associated with expression of low molecular weight forms of FOXPl in a subject comprising: contacting a sample obtained from the subject with a reagent which allows identification of the presence of the low molecular weight forms of FOXPl in the sample and detecting the presence of the low molecular weight forms of FOXPl.

33. A method according to claim 32 wherein the disease is cancer.

34. A method according to claim 33 wherein the cancer is selected from diffuse large B-cell lymphoma (DLBCL) , Non- Hodgkin's lymphoma, leukaemia, cervical, prostate, stomach, colon, head and neck, renal, breast or lung cancer.

35. A method according to claim 34 wherein the diffuse large B-cell lymphoma (DLBCL) is the activated B-cell-like subtype (ABC) of diffuse large B-cell lymphoma (DLBCL) .

36. A method according to any one of claims 32 to 35 wherein the reagent is an antibody.

37. A method according to claim 36 wherein the antibody is a monoclonal antibody.

38. A method according to any one of claims 32 to 37 further comprising measuring gene expression profiles of suitable markers .

39. A method of treating a disease associated with expression of low molecular weight forms of FOXPl comprising administering to a subject in need thereof a siRNA molecule as defined in any one of claims 28 to 31.

40. A method according to claim 39 wherein the disease is cancer.

41. A method according to claim 40 wherein the cancer is selected from diffuse large B-cell lymphoma (DLBCL) , Non- Hodgkin's lymphoma, leukaemia, cervical, prostate, stomach, colon, head and neck, renal, breast or lung cancer.

42. A method according to claim 41 wherein the diffuse large B-cell lymphoma (DLBCL) is the activated B-cell-like subtype (ABC) of diffuse large B-cell lymphoma (DLBCL) .

43. An siRNA molecule as defined in any one of claims 28 to 31 for use in the treatment of disease.

44. The use according to claim 43 wherein the disease is cancer.

45. The use according to claim 44 wherein the cancer is selected from diffuse large B-cell lymphoma (DLBCL) , Non Hodgkin's lymphoma, leukaemia, cervical, prostate, stomach, colon, head and neck, renal, breast or lung cancer.

46. The use according to claim 45 wherein the diffuse large B-cell lymphoma (DLBCL) is the activated B-cell-like subtype (ABC) of diffuse large B-cell lymphoma (DLBCL) .

47. A pharmaceutical composition comprising a siRNA molecule as defined in any one of claims 28 to 31 together with a pharmaceutically acceptable carrier.

48. The composition of claim 47 wherein the carrier is a lipid based carrier.

49. The composition of claim 48 wherein the lipid based carrier is a liposome.