WO2005090595A2 - Nitrile hydratases from metagenome libraries - Google Patents
Nitrile hydratases from metagenome libraries Download PDFInfo
- Publication number
- WO2005090595A2 WO2005090595A2 PCT/EP2005/002556 EP2005002556W WO2005090595A2 WO 2005090595 A2 WO2005090595 A2 WO 2005090595A2 EP 2005002556 W EP2005002556 W EP 2005002556W WO 2005090595 A2 WO2005090595 A2 WO 2005090595A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- sequences
- nucleic acid
- olr
- acid sequences
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y402/00—Carbon-oxygen lyases (4.2)
- C12Y402/01—Hydro-lyases (4.2.1)
- C12Y402/01084—Nitrile hydratase (4.2.1.84)
Definitions
- Nitrile hydratases from metageno e libraries Nitrile hydratases from metageno e libraries
- the present invention is directed toward specific degenerate primers . These latter are preferably employed in a process for preparing nitrile hydratases.
- the present invention therefore also relates to the nitrile hydratases which are prepared by the process which is performed using the primers and to other proteins which are required for the nitrile hydratases to be active.
- the nucleic acids encoding these protein sequences, and expression systems comprising these nucleic acids likewise form an additional part of the subject matter of the application.
- the use of the nitrile hydratases, and of the underlying nucleic acid sequences, constitutes an additional aspect of the present invention.
- amide and carboxylic acid structural classes are becoming ever more important as precursors of fine chemicals.
- Specific aminoamides and (proteinogenic and nonproteinogenic) amino acids are key intermediates for synthesizing pharmaceutical and agrochemical products as well as in .the foodstuffs field.
- Enantiomerically pure amides and amino acids in particular, play an ever greater role in the abovementioned areas of application.
- a inonitrile precursors as are required for preparing the abovementioned compound classes, can be readily obtained in racemic form by way of what is termed Strecker synthesis.
- the nitriles which have been obtained in this way can then be converted into the corresponding amides and carboxylic acids by means of chemical or enzymic hydrolysis.
- Nitrilases convert a nitrile function directly into the acid whereas nitrile hydratases (E.C. 4.2.1.84) in this case form the corresponding amide. This latter can then finally be converted into the corresponding carboxylic acid by means of an amidase (E.C. 3.5.1.4) (scheme 1).
- Using isolated enzymes or whole-cell catalysts to hydrolyze nitriles to give the corresponding amides and acids helps to save large quantities of salt which would otherwise accrue in the neutralization step following the chemical hydrolysis of nitriles. For this reason, the enzymic hydrolysis of nitriles to give, for example, aminoamides and/or amino acids represents a more sustainable production process.
- Nitrile hydratases In their active form, nitrile hydratases consist of 2 nonhomologous , and ⁇ subunits. These latter form heterodimers and tetramers, while even decamers have been demonstrated to be present in the case of Rhodococcus rhodochrous Jl. While the ⁇ and ⁇ subunits are of approximately the same size, they do not otherwise share any similarities . Nitrile hydratases are metalloproteins which contain Fe3 + or Co3 + ions (Bunch A. W. (1998), Nitriles, in: Biotechnology, Volume 8a, Biotransformations I, Chapter 6, Eds.: Rehm HJ, Reed G, Wiley-VCH, p.
- An additional advantage is the yield of biomass in high cell density fermentations using E. coli .
- DBM dry biomass
- nitrile hydratase ⁇ and ⁇ subunit sequences are known from the genus Rhodococcus. However, it is precisely the nitrile hydratases from this genus which it has thus far only been possible to express in E. coli with particular difficulty (Ikehata 0, Nishiyama M, Horinouchi S, Beppu T (1989) Primary structure of nitrile hydratase deduced from the nucleotide sequence of a Rhodococcus species and its expression in Escherichia coli. Eur J Biochem 181: 563- 570) .
- the literature describes systems for expressing nitrile hydratases whose specific activities are between 4.2 and 12.2 U/mg of total protein in the case of Co-dependent nitrile hydratases from R. rhodochrous Jl ( obayasj i M, Nishiyama M, Nagasawa T, Horinouchi S, Beppu T, Yamada H (1991) Cloning, nucleotide sequence and expression in Escherichia coli of two cobalt-containing nitrole hydratase genes from Rhodococcus rhodochrous .
- the genetic screening for enzyme-encoding genes can either be effected on the basis of sequence homology, based on conserved sequence motifs, or, when suitable enzyme tests/indicator media are available, on the basis of activity homology (Lorenz P, K ⁇ hler B, Wolf M, Eck J, Zinke H (2000) Expression Cloning of Metagenome DNA from Soil. Biotechnol. 2000, Book of Abstr. Vol 2: 306).
- nitrile hydratases have already been amplified from metagenomic DNA by means of a PCR-based screening method using degenerate primers, the nature of the sequences is such that they exhibit very high degrees of similarity (90 - 99%) with those for known nitrile hydratases (Precigou S, Goulas P, Duran R, (2001) Rapid and specific identification of nitrile hydratase encoding genes in soil samples by polymerase chain reaction, FEMS Microbiol. Letters 204: 155-161). It is not possible to make any proper assessment of the primers which are used in this reference since the authors do not reveal the sequences of the degenerate primers or their degree of degeneracy. The high degree of similarity of the sequences to those for the Rhodococcus rhodochrous Jl nitrile hydratases suggests that the substrate specificity is not markedly different from that of this latter enzyme, either.
- the object of the present invention was therefore to specify an additional process for preparing nitrile hydratases.
- the process should be able to identify nitrile hydratases which are present in what are termed nonculturable organisms.
- An additional object of the present invention was to prepare nitrile hydratases which are superior to those in the prior art.
- a prerequisite for finding novel nitrile hydratases is to specify nucleic acid sequences which are able to serve as probes for nitrile hydratase genes which are present in metagenome DNA libraries.
- degenerate primer constituents from the group consisting of A-Olf : gcs rsgcstgg (Seq. ID NO. 1)
- B-Olf ggsctsccsccc (Seq. ID NO. 2)
- B-Olr ggsggsagscc (Seq. ID NO. 3)
- C-Olr : ggncgcwbsgg (Seq. ID NO.
- A-Olf gcnmrrgcntgg (Seq. ID NO. 5) B-Olf : ggnytnccncc (Seq. ID NO. 6) B-Olr : ggnggnarncc (Seq. ID NO. 7) C-Olr : gwngwrtccca (Seq. ID NO. 8) A-Olf : gcntggrynga (Seq. ID NO. 9) B-Olf : ggnytsccnccc (Seq. ID NO. 10) B-Olr : ggnggsarncc (Seq. ID NO. 11) C-Olr : swnswrtccca (Seq. ID NO. 12)
- nucleic acid sequences which help to construct specific probes for screening for nitrile hydratase genes in metagenome DNA libraries .
- These nucleic acid sequences are degenerate sequences which, on the one hand, are specific enough for finding only nitrile hydratase genes but which, on the other hand, are so nonspecific that, if at all possible, all the nitrile hydratase genes which are present are detected.
- the present invention accordingly also related to a process for preparing protein sequences which are required for constructing the activity of a nitrile hydratase, such that a) a metagenome DNA library of a habitat is prepared, b) this library is contacted with in each case at least one forward(f) primer and one reverse (r) primer exhibiting a degenerate nucleic acid sequence in accordance with sequences 1 to 12 , c) a PCR is carried out using these primers, d) the full-length sequences of the nucleic acids encoding protein sequences which are required for constructing the activity of a nitrile hydratase are generated from the part sequences which are obtained, and e) these full-length sequences are cloned into a host organism and expressed.
- nitrile hydratases consist of at least two different subunits ( ⁇ and ⁇ subunits) .
- further protein sequences in addition to these two subunits, may also be required to enable the nitrile hydratases to be active.
- the presence of particular putative "activators” e.g. folding proteins, etc.
- the nucleic acid sequences which encode these activators are frequently located- in the immediate vicinity of the nucleic acid sequences which encode the corresponding nitrile hydratase subunits.
- the first step is that of preparing a metagenome DNA library of a particular habitat.
- the skilled person is familar with the way in which this library is prepared (Knietsch, AW, Tanja; BS; Henne, ADR (2003) Metagenomes of Complex Microbial Consortia Derived from Different Soils as Sources for Novel Genes Conferring Formation of Carbonyls from Short-Chain Polyols on Escherichia coli .
- the degenerate nucleic acid sequences according to the invention are employed in the present process such that in each case primer pairs composed of primers exhibiting the nucleic acid sequences A-Olf (Seq. ID Nos. 1, 5 and 9) and B-Olr (Seq. ID Nos. 3, 7 and 11) or C-Olr (Seq. ID Nos. 4, 8 and 12) and also B-Olf (Seq. ID Nos. 2, 6 and 10) and C-Olr (Seq. ID Nos. 4, 8 and 12) are used in the PCR.
- primer pairs composed of primers exhibiting the nucleic acid sequences A-Olf (Seq. ID Nos. 1, 5 and 9) and B-Olr (Seq. ID Nos. 3, 7 and 11) or C-Olr (Seq. ID Nos. 4, 8 and 12) and also B-Olf (Seq. ID Nos. 2, 6 and 10) and C-Olr (Se
- the primers employed in the PC reaction consist of degenerate nucleic acid sequences of the above-described type (sequences ID Nos. 1 to 12) and the nucleic acid sequences mentioned in the sequences having the ID Nos . 13 to 23.
- sequences ID Nos. 1 to 12 sequences ID Nos. 1 to 12
- nucleic acid sequences mentioned in the sequences having the ID Nos . 13 to 23 are very particular preference, therefore, to a process in which nucleic acid sequences selected from the group consisting of: GCCAAGGTCGTC (Seq. ID NO. 13) GGCCGGTCCTG (Seq. ID NO. 14) TCCTTGTACCAGGTC (Seq. ID NO.
- GCCCGCC (Seq. ID NO. 16) GGCGCTAATGTTGTT (Seq. ID NO. 17) TGGCCGGTTCTG (Seq. ID NO. 18) CAAATTCTTTATACCAAGTC (Seq. ID NO. 19) CCATATATCGCATTTCAGCT (Seq. ID NO. 20) GGTCGTGGCCAAG (Seq. ID NO. 21) GGCCGGTCCTG (Seq. ID NO. 22) TCCTTGTACCAGGTC (Seq. ID NO. 23) GCGCATTTCGGCG (Seq. ID NO. are placed upstream of the degenerate nucleic acid sequences (Seq. ID Nos. 1-12) .
- upstream sequences are likewise derived from conserved nitrile hydratase regions and adapted to the codon usage of organisms having a different GC content.
- primers which are selected from the group consisting of GCCAAGGTCGTCgcsmrsgcstgg (Seq. ID NO. 25) GGCCGGTCCTGggsctsccscc (Seq. ID NO. 26) TCCTTGTACCAGGTCggsggsagscc (Seq. ID NO. 27) GCCCGCCggncgcwbsgg (Seq. ID NO.
- GGCGCTAAAGTTGTTgcnmrrgcntgg (Seq. ID NO. 29) TGGCCGGTTCTGggnytnccncc (Seq. ID NO. 30) CAAATTCTTTATACCAAGTCggnggnarncc (Seq. ID NO. 31) CCATATATCGCATTTCAGCTgngwrtccca (Seq. ID NO. 32) GGTCGTGGCCAAGgcntggrynga (Seq. ID NO. 33) GGCCGGTCCTGggnytsccnccc (Seq. ID NO. 34) TCCTTGTACCAGGTCggnggsarncc (Seq. ID NO. 35) GCGCATTTCGGCGswnswrtccca (Seq. ID NO. 36) is therefore very particularly advantageous .
- a next part of the subject matter of the present invention is constituted by the protein sequences which are required for. constructing the activity of a nitrile hydratase, with these sequences possessing less than 100% homology, preferably less than 97%, more preferably less than 96%, even more preferably less than 95%, yet more preferably less than 90%, very preferably less than 85%, and extremely preferably less than 80%, homology, at the amino acid level, with such known protein sequences, and with the nucleic acid sequences encoding them being generated from part sequences which give a - positive hybridization signal, under stringent conditions, with the primers according to the invention exhibiting the nucleic acid sequences having the sequences ID Nos. 1 to 12.
- the positive hybridization is a prerequisite for it to be possible to find corresponding nucleic acid sequences using the PC reaction-based screening. Methods with which the skilled person is familar can then be used to obtain the corresponding recombinant protein sequences from these nucleic acid sequences.
- rec-protein sequences according to the invention are prepared using recombinant DNA methods which are known to the skilled person (Sambrook, J.; Fritsch, E. F. and Maniatis, T. (1989), Molecular cloning: a laboratory manual, 2 nd ed. , Cold Spring Harbor Laboratory Press, New York; Balbas, P. and Bolivar, F. (1990), Design and construction of expression plasmid vectors in E.coli, Methods Enzymol. 185, 14-37; Rodriguez, R.L. and Denhardt, D.
- nucleic acid sequences which encode the protein sequences which have just been described, also constitute a next part of the present invention. These nucleic acid sequences are therefore all those which, within the bounds of the degeneracy of the genetic code, encode the same protein sequence.
- nucleic acid sequences which possess, at the nucleic acid level, a homology with the nucleic acid sequences found in accordance with the invention of at least 70 percent, or corresponding fragments of these nucleic acid sequences, which in turn encode protein sequences which are involved in constructing the activity of a nitrile hydratase. Preference is given to these nucleic acid sequences encoding protein sequences which are improved as compared with the protein sequences found in accordance with the invention.
- nucleic acid sequences according to the invention are those of the odd-numbered Seq. ID Nos. 37 to 85. It is possible, as described above, to use the nucleic acid sequences which have been found to obtain the protein sequences according to the invention in high yields from rapidly growing host organisms, e.g. E. coli .
- a next aspect of the present invention is therefore constituted by a (articially prepared) expression system which exhibits one or more of the nucleic acid sequences according to the invention.
- a (articially prepared) expression system which exhibits one or more of the nucleic acid sequences according to the invention.
- all the systems which are familiar to the skilled person for this purpose are suitable for use as the expression system. These systems are preferably plasmids or vectors and microorganisms .
- plasmids or vectors all the embodiments which are available to the skilled person for this purpose are suitable for use as plasmids or vectors.
- These plasmids and vectors can be found, for example, in Studier and coworkers (Studier, W. F.; Rosenberg A. H. ; Dunn J. J. ; Dubendroff J. W. ; (1990), Use of the T7 RNA polymerase to direct expression of cloned genes, Methods Enzymol. 185, 61-89) or in the brochures supplied by the companies Novagen, Promega, New England Biolabs, Clontech or Gibco BRL.
- Other preferred plasmids and vectors can be found in: Glover, D. M.
- Plasmids which can very preferably be used to clone the construct containing the nucleic acid sequences according to the invention into the host organism are: pUCl ⁇ (Roche Biochemicals) , pKK-177-3H (Roche Biochemicals) , pBTac2 (Roche Biochemicals), pKK223-3 (Amersham Pharmacia Biotech), pKK-233-3 (Stratagene) or pET (Novagen). Extreme preference is given to plasmids of the pET series.
- the recombinant microorganism into which the plasmids or vectors which contain the nucleic acid sequences according to the invention are cloned is used for replicating and isolating an adequate quantity of the recombinant protein sequence.
- the methods for doing this are well known to the skilled person (Sambrook, J.; Fritsch, E. F. and Maniatis, T. (1989), Molecular cloning: a laboratory manual, 2 nd ed., Cold Spring Harbor Laboratory Press, New York) .
- the microorganisms which are used can be any organisms which the skilled person takes into consideration for this purpose, for example yeasts, such as Hansenula polymorpha, Pichia sp .
- E. coli strains Preference is given to using E. coli strains for this purpose. The following are very particularly preferred: E. coli XLl Blue, NM 522, JM101, JM109, JM105, RRl, DH5 , TOP 10 " or HB101, BL21, BL21 (DE3), or BL21 (DE3) codon plus RIL.
- nucleic acid sequences which are in accordance with the invention are preferably suitable for preparing what are termed whole- cell catalysts.
- whole-cell catalysts of this type are recombinant microorganisms such as those which have just been mentioned.
- these whole-cell catalysts also comprise additional enzymes which are required for decomposing nitriles into acids. As explained at the outset, these enzymes are enzymes which exhibit amidase activity.
- whole-cell catalysts which comprise at least one cloned gene for a protein sequence possessing (D- or L-) amidase activity and cloned genes encoding an active nitrile hydratase are also regarded as being recombinant microorganisms of the abovementioned type.
- the whole-cell catalyst can comprise additional nucleic acid sequences which encode enzymes which are advantageous for decomposing a nitrile function into an acid function.
- enzymes are, in particular, enzymes which are selected from the group of protein sequences possessing ⁇ -aminonitrile racemase activity, possessing cyanohydrin racemase acti- vity, possessing ⁇ -hydroxycarboxylic acid racemase activity • or possessing ( ⁇ - or ⁇ -) -amino acid amide racemase activity.
- the whole-cell catalyst according to the invention preferably produces a protein sequence possessing L-amidase activity from rhizobium, preferably R. huautlense DSM 14983 (WO2004/005517) or possessing D-amidase activity, e.g. that from Variovorax (EP 1318193) .
- Corresponding racemases are known, for example, from Pseudomonas putida and Rhodococcus sp . (Godtfredsen, S. E.; Clausen, K.; Ingvorsen, K.; Hermes, H. F.; Van Balken, J. A.; Meijer, E. M. (1989, EP 0 307 023; WO 8 901 525).
- Other amino acid amide racemases have been described in Klebsiella oxytoca by Hermes and coworkers (Hermes, H. F. M. ; Peeters, W. P.; Peters, P. J.
- nucleic acid sequences in question with regard to the turnover rates of the protein sequences (enzymes) which they encode, the corresponding nucleic acid sequences can be installed on different plasmids possessing different copy numbers and/or promoters of differing strength can be used so as to ensure that the nucleic acid sequences are expressed at different strengths.
- nitrile hydratases which exhibit the protein sequences according to the invention for nitrile hydratase ⁇ subunits and ⁇ subunits and which can be prepared from the nucleic acid sequences which are made available by this process and which encode the ⁇ and ⁇ subunits according to the invention.
- active nitrile hydratases are also formed, in this connection, when any arbitrary ⁇ subunits are combined with any arbitrary ⁇ subunits. This thereby makes it possible to increase still further the diversity of possible nitrile hydratases .
- nucleic acid sequences which are prepared by the process according to the invention for producing improved protein sequences which are required for constructing the activity of a nitrile hydratase.
- the way in which the skilled person proceeds when improving protein sequences on the basis of altering nucleic acid sequences is well known. In general, this is effected by using methods of mutagenesis . Any methods which are available to the skilled person for this purpose are suitable for being used as mutagenesis methods. In particular, these methods are saturation mutagenesis, random mutagenesis, in-vitro recombination methods and site-directed mutagenesis (Eigen,
- novel nucleic acid sequences which are obtained in this way are cloned into a host organism, and expressed, using the above-described methods, and the protein sequences which have been prepared in this way are detected by means of suitable screening methods and then isolated.
- any detection reactions which are possible for the molecules which are formed are suitable for the detection.
- Nitrile hydratase activities can be detected in a coupled enzymic test using amidases, with ammonium being formed as a by product.
- any possible reactions for detecting ammonia or ammonium ions such as Nessler reagent (Vogel, A., I., (1989) Vogel's textbook of quantitative chemical analysis, John Wiley & Sons, Inc., 5 th ed.
- HPLC methods are used for detecting amino acids, for example a derivative method based on o-phthaldialdehyde and N-isobutyryl-cysteine for enantiomerically separating amino acids (Bruckner, H., Wittner R., and Godel H., (1991) Fully automated high- performance liquid chromatographic separation of DL-amino acids derivatized with o-Phthaldialdehyde together with N- isopropyl-cysteine. Application to food samples, Anal. Biochem. 144, 204-206) .
- the amide which is directly formed by the nitrile hydratase reaction can likewise be detected using HPLC methods (e.g. reverse phase) .
- the latter relates to the use of the nitrile hydratases according to the invention for preparing organic acid amides and acids, in particular enantiomerically enriched ⁇ -hydroxy acids or ⁇ -amino acids .
- the nitrile hydratase in question can be used in free form, as a homogeneously purified compound or as a recombinantly prepared enzyme.
- the enzyme can also be employed as a constituent of an intact host organism or in combination with the disrupted, and, if desired, highly purified, cell mass of the host organism. It is likewise possible to use the enzyme in immobilized form (Shar a B. P.; Bailey L. F. and Messing R. A.
- the immobilization is advantageously effected by means of lyophilization (Paradkar, V. M. ; Dordick, J. S. (1994), Aqueous-Like
- Eupergit ® in particular Eupergit C ® and Eupergit 250L ® (Rohm)
- Eupergit C a carrier for immobilization of enzymes of industrial potential.
- the present invention describes the isolation of nitrile hydratases and their corresponding genes by using molecular genetic methods to tap the uncultured microbial diversity of different habitats.
- Using degenerate primers in connection with the PCR-based screening of metagenome DNA libraries identifies nitrile hydratase genes and elucidates the part sequences of the PCR products which are obtained in this way.
- the complete DNA sequences of the genes are determined in order, after cloning and heterologous expression, to provide enzyme samples for activity profiling and investigating applications .
- metagenome libraries metagenome DNA libraries
- the genetic screening in metagenome libraries provides a pool of corresponding nitrile hydratase genes for subsequent expression, which pool can, however, also serve as the basis for enzyme optimization by means of directional evolution.
- Metagenome libraries which were prepared from four different habitats and sites (grassland, forest, sandy ecosystem and biofilm) , and which contained more than 83 000 clones, were screened for identifying novel nitrile hydratases.
- the skilled person is familiar with the construction of such metagenome libraries (Schloss, PD; bottlesman, J (2003) Biotechnological prospects from metagenomics . Current Opinion in Biotechnology, 14(3): 303- 310; Knietsch, AW, Tanja; BS; Henne, ADR (2003) Metagenomes of Complex Microbial Consortia Derived from Different Soils as Sources for Novel Genes Conferring Formation of Carbonyls from Short-Chain Polyols on Escherichia coli .
- the metagenome DNA libraries were screened for novel nitrile hydratases by means of a PCR screening which used degenerate oligonucleotides which were derived from conserved primary structural motifs of known nitrile hydratases .
- the degenerate primers employed were those depicted in sequence ID Nos. 25 to 36.
- the primers having the primer constituent A-Olf can, in particular, in each case be combined with those having the primer constituents B-Olr (size of the PCR product to be expected, approx. 210 bp) or C-Olr (size of the PCR product to be expected, approx. 350 bp) , while the primers having the primer constituent B-Olf can be combined with those having the primer constituent C-Olr (size of the PCR product to be expected, approx. 180 bp) .
- the degenerate "core" part of the primers (underlined in sequence ID Nos. 25 to 36) is important for identifying novel nitrile hydratases while the nondegenerate segment can be varied.
- PC reaction can be carried out using known methods .
- special polymerases are used, the PCR must be amended in accordance with the manufacturer's instructions .
- the genes encoding the ⁇ and ⁇ subunits were in each case placed separately under the control of the phage T7 gene 10 promoter.
- the vectors pET22b and, respectively, pET 6b (Novagen, CN Bioscience, Inc.) were used for this purpose (figs. 5 and 6).
- pET22b and, respectively, pET 6b (Novagen, CN Bioscience, Inc.) were used for this purpose (figs. 5 and 6).
- pET22b and, respectively, pET 6b Novagen, CN Bioscience, Inc.
- Corresponding constructs were expressed in E. coli strain BL21 (DE3) CodonPlus RIL (Novagen, CN Bioscience, Inc.). The cells were incubated at
- nitrile hydratases In the case of a variety of nitrile hydratases, an additional small open reading frame, which encodes a protein sequence which appears to be involved in activating the nitrile hydratase, was identified in the immediate vicinity of the genes for the subunits of the enzyme. These proteins were designated P12K (Seq. ID No. 81/83) or P14K (Seq. ID No. 85) since their molecular weight was about 12 or 14 kDa. While it was possible to prepare some nitrile hydratases in active form even without these P12K homologs, the presence of these proteins was essential for other nitrile hydratases to be expressed in active form.
- nitrile hydratase genes M49bD9 (Seq. ID No. 49/71) and M3aGlO (Seq. ID No. 57/79) were expressed in the presence of the corresponding P12K homologs (Seq. ID No. 83 M49bD9; Seq. ID No. 85 - M3aGlO) at 26°C in E. coli strain BL21 CodonPlus RIL. In both cases, it was possible to markedly overexpress the subunits of the nitrile hydratases . The presence of the P12K homolog (Seq. ID No. 83) increased the activity of the clone M49bD9 nitrile hydratases (Seq. ID No.
- Combining subunits from different metagenome clones opens up the possibility of generating nitrile hydratases which possess potentially novel substrate specificities. By combining ⁇ subunits with different ⁇ subunits, it would be possible to generate a great diversity of combinations of novel nitrile hydratases. Such a combination of subunits from unrelated nitrile hydratases has not thus far been disclosed in the literature.
- a stringent hybridization in accordance with the present invention preferably exists when a positive hybridization signal is still observed after washing for 1 hour with 1 x SSC (150 mM sodium chloride, 15 mM sodium citrate, pH 7.0) and 0.1% SDS (sodium dodecyl sulfate) at 50°C, preferably at 55°C, more preferably at 62°C and most preferably at 68°C, and more preferably for 1 hour with 0.2 X SSC and 0.1% SDS at 50°C, more preferably at 55°C, yet more preferably at 62°C and most preferably at 68°C.
- 1 x SSC 150 mM sodium chloride, 15 mM sodium citrate, pH 7.0
- SDS sodium dodecyl sulfate
- optically enriched (enantiomerically enriched, enantiomer enriched) compounds are understood as meaning the presence of one optical antipode at > 50 mol% in a mixture with the other antipode.
- All types of single-stranded DNA, and DNA which is complementary thereto or double-stranded DNA e.g. genomic DNA or cDNA
- RNA e.g. RNA
- nucleic acid sequences are subsumed under the term nucleic acid sequences .
- Improved nucleic acid sequences encode improved protein sequences.
- Improved protein sequences are those which exhibit an improvement, as compared with the original sequences, in regard to activity and/or selectivity and/or stability. According to the invention, this means that the proteins are more active and/or more selective or less selective, or are more stable under the reaction conditions employed. While the activity and the stability of the proteins should naturally be as high as possible for the industrial application, an improvement with regard to selectivity is said to have taken place when the substrate selectivity decreases but the enantioselectivity of the proteins is increased. This also applies to proteins as constituents of nitrile hydratases insofar as they help to confer the corresponding improved properties on the enzyme.
- the claimed protein sequences and nucleic acid sequences also encompass those sequences which exhibit a homology (excluding the natural degeneracy) which is greater than 70% (with regard to the nucleic acid sequence) or 80% (with regard to the protein sequences) , preferably greater than 90%, 91%, 92%, 93% or 94%, more preferably greater than 95% or 96% and particularly preferably greater than 97%, 98% or 99%, with one of these sequences, provided the mode of action or purpose of such a sequence is preserved.
- a homology excluding the natural degeneracy
- nucleic acid sequences which encode polypeptides encompasses all the sequences which appear possible in accordance with the degeneracy of the genetic code.
- Figure 1 Homology among the nitrile hydratase ⁇ and ⁇ subunits which were found by means of a genetic screening.
- Figure 2 Activity of different metagenome nitrile hydratases toward benzonitrile following expression in E. coli BL21 (DE3) codon plus RIL, with ⁇ and ⁇ without coexpression of the trigger factor (n.d. : not determined) .
- Figure 3 Activity of nitrile hydratases when subunits rom different metagenome clones are combined.
- Figure 4 The vector map shows the general arrangement of the ⁇ subunits in plasmid pET22, taking clone M49bD9 as an example.
- Figure 5 The vector map shows the general arrangement of the ⁇ subunits in plasmid pET26 taking clone M49bD9 as an example.
- Figure 6 The vector map shows the arrangement of the P12K protein from clone M49bD9 in plasmid pBBR5.
- Figure 7 The vector map shows the arrangement of the P12K protein from clone M3aGlO in plasmid pBBR5.
- E. coli cells were cultured and stored as described in Sambrock et al . (Sambrook, J.; Fritsch, E. F. and Maniatis, T. (1989), Molecular cloning: a laboratory manual, 2 nd ed. , Cold Spring Harbor Laboratory Press, New York) .
- the DNA to be cut is provided with 5 U of restriction enzyme and the appurtenant buffer and, unless otherwise required, incubated at 37°C. Chromosomal DNA is digested with 10 U of enzyme. The incubation period is 1.5 2.5 hours .
- Circular DNA can only be formed once again by inserting a DNA fragment.
- the vector which has been cut with a restriction endonuclease is incubated at 65°C for 15 minutes in order to stop the restriction endonuclease.
- the dephosphorylation buffer is then added and the vector is incubated with 1 u of shrimp alkaline phosphatase at 37°C for 10 min.
- the enzyme is then separated off from the vector DNA by means of a subsequent gel electrophoresis .
- Vector and insert are used for the ligation in a ratio of 1:3.
- the volume is chosen to be as small as possible (7 - 20 ⁇ l) .
- the mixture is incubated overnight at 16°C in ligation buffer and in the presence of 1 U of ligase.
- 100 ⁇ l of competent cells are added by pipette to the ligation mixture, the constituents of which are mixed by being repeatedly drawn up into the pipette. After 30 min of incubation on ice, a heat shock step at 42°C is carried out for 45 sec and the mixture is incubated once again on ice for 2 min. 120-900 ⁇ l of SOC medium are added and the mixture is incubated at 37°C for 45 min while being agitated. The mixture is subsequently plated out and incubated overnight at 37°C.
- T7 promoters were expressed in accordance with the following protocol: 50 ml' of LB am pioo medium containing 2 mM Fe citrate and in each case 50 ⁇ g of kanamycin and ampicillin/ml were inoculated in a ratio of 99:1 with an overnight culture.
- the activity was calculated by calculating a ⁇ mol turnover after one minute, with one ⁇ mol corresponding to one U (unit) . Specific activities are given in U per g of DBM or mg of protein.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP05715932.9A EP1730300B1 (en) | 2004-03-20 | 2005-03-10 | Nitrile hydratases from metagenome libraries |
US10/593,357 US7872100B2 (en) | 2004-03-20 | 2005-03-10 | Nitrile hydratases from metagenome libraries |
CA2557476A CA2557476C (en) | 2004-03-20 | 2005-03-10 | Nitrile hydratases from metagenome libraries |
DK05715932.9T DK1730300T3 (en) | 2004-03-20 | 2005-03-10 | Nitrile hydrates from metagenome libraries |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE102004013842A DE102004013842A1 (en) | 2004-03-20 | 2004-03-20 | Nitrile hydratases from metagenome libraries |
DE102004013842.7 | 2004-03-20 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2005090595A2 true WO2005090595A2 (en) | 2005-09-29 |
WO2005090595A3 WO2005090595A3 (en) | 2006-03-02 |
Family
ID=34961911
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2005/002556 WO2005090595A2 (en) | 2004-03-20 | 2005-03-10 | Nitrile hydratases from metagenome libraries |
Country Status (8)
Country | Link |
---|---|
US (1) | US7872100B2 (en) |
EP (3) | EP2369010B1 (en) |
CA (1) | CA2557476C (en) |
DE (1) | DE102004013842A1 (en) |
DK (3) | DK2369009T3 (en) |
SG (1) | SG157384A1 (en) |
WO (1) | WO2005090595A2 (en) |
ZA (1) | ZA200607776B (en) |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1842907A1 (en) | 2006-04-07 | 2007-10-10 | B.R.A.I.N. Ag | A group of novel enantioselective microbial nitrile hydratases with broad substrate specificity |
WO2009009117A2 (en) * | 2007-07-11 | 2009-01-15 | Bioverdant, Inc. | Chemoenzymatic processes for preparation of levetiracetam |
JP2010178671A (en) * | 2009-02-05 | 2010-08-19 | Mitsubishi Rayon Co Ltd | New nitrile-hydratase from environmental dna and gene thereof |
WO2015186298A1 (en) * | 2014-06-06 | 2015-12-10 | 三菱レイヨン株式会社 | Improved nitrile hydratase |
US9738885B2 (en) | 2011-06-07 | 2017-08-22 | Mitsubishi Chemical Corporation | Nitrile hydratase |
AU2015203199B2 (en) * | 2011-06-07 | 2017-10-26 | Mitsubishi Chemical Corporation | Improved nitrile hydratase |
US10429162B2 (en) | 2013-12-02 | 2019-10-01 | Austin Star Detonator Company | Method and apparatus for wireless blasting with first and second firing messages |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US11345959B2 (en) * | 2015-06-24 | 2022-05-31 | Done Woo Lee | Method for exploring useful genetic resources through bulk metagenome analysis and use thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997012964A2 (en) * | 1995-10-06 | 1997-04-10 | E.I. Du Pont De Nemours And Company | Nucleic acid fragments encoding stereospecific nitrile hydratase and amidase enzymes and recombinant microorganisms expressing those enzymes useful for the production of chiral amides and acides |
Family Cites Families (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE3875953T2 (en) | 1987-08-17 | 1993-06-03 | Novo Industri As | METHOD FOR PRODUCING ORGANIC CHEMICAL COMPOUNDS. |
EP0383403A1 (en) | 1989-02-16 | 1990-08-22 | Stamicarbon B.V. | Process for preparation of organic chemicals |
DE19920712A1 (en) | 1999-05-05 | 2000-11-09 | Rhein Biotech Proz & Prod Gmbh | Process for producing a recombinant protein |
DE10100127A1 (en) | 2001-01-03 | 2002-10-02 | Henkel Kgaa | Procedure for determining the homeostasis of the skin |
US6656732B1 (en) | 2001-05-18 | 2003-12-02 | Isis Pharmaceuticals, Inc. | Antisense inhibition of src-c expression |
DE10155928A1 (en) | 2001-11-15 | 2003-06-12 | Degussa | recA negative and RhaB negative microorganism |
DE10160066A1 (en) | 2001-12-06 | 2003-06-18 | Degussa | Variovorax amidase |
ATE362544T1 (en) | 2002-06-14 | 2007-06-15 | Dsm Ip Assets Bv | POLYPEPTIDES WITH ALPHA-H ALPHA AMINO ACID AMIDE RACEMASE ACTIVITY AND NUCLEIC ACIDS CODING THERETO |
AU2003257434A1 (en) | 2002-07-09 | 2004-01-23 | Degussa Ag | L-amidase from rhizobium huautlense |
-
2004
- 2004-03-20 DE DE102004013842A patent/DE102004013842A1/en not_active Withdrawn
-
2005
- 2005-03-10 DK DK11002156.5T patent/DK2369009T3/en active
- 2005-03-10 EP EP11002157.3A patent/EP2369010B1/en not_active Not-in-force
- 2005-03-10 DK DK05715932.9T patent/DK1730300T3/en active
- 2005-03-10 SG SG200907507-8A patent/SG157384A1/en unknown
- 2005-03-10 EP EP11002156.5A patent/EP2369009B1/en not_active Not-in-force
- 2005-03-10 US US10/593,357 patent/US7872100B2/en not_active Expired - Fee Related
- 2005-03-10 CA CA2557476A patent/CA2557476C/en not_active Expired - Fee Related
- 2005-03-10 EP EP05715932.9A patent/EP1730300B1/en not_active Not-in-force
- 2005-03-10 DK DK11002157.3T patent/DK2369010T3/en active
- 2005-03-10 WO PCT/EP2005/002556 patent/WO2005090595A2/en not_active Application Discontinuation
-
2006
- 2006-09-18 ZA ZA200607776A patent/ZA200607776B/en unknown
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997012964A2 (en) * | 1995-10-06 | 1997-04-10 | E.I. Du Pont De Nemours And Company | Nucleic acid fragments encoding stereospecific nitrile hydratase and amidase enzymes and recombinant microorganisms expressing those enzymes useful for the production of chiral amides and acides |
Non-Patent Citations (7)
Title |
---|
DATABASE EMBL [Online] 12 February 1992 (1992-02-12), "R.rhodochrous gene for L-NHase" XP002331764 retrieved from EBI accession no. EM_PRO:RRLNHASE Database accession no. RRLNHASE * |
DATABASE EMBL [Online] 19 March 1997 (1997-03-19), "Pseudomonas putida P38K, amidase, nitrile hydratase alpha subunit, nitrile hydratase beta subunit, and P14K genes, complete cds." XP002331765 retrieved from EBI accession no. EM_PRO:PPU89363 Database accession no. PPU89363 * |
LIEBETON K ET AL: "Identification and expression in E. coli of novel nitrile hydratases from the metagenome" ENGINEERING IN LIFE SCIENCES 2004 GERMANY, vol. 4, no. 6, 2004, pages 557-562, XP009048590 ISSN: 1618-0240 * |
LOPES LOURENCO PEDRO MIGUEL ET AL: "Searching for nitrile hydratase using the consensus-degenerate hybrid oligonucleotide primers strategy" JOURNAL OF BASIC MICROBIOLOGY, vol. 44, no. 3, 2004, pages 203-214, XP009048598 ISSN: 0233-111X * |
LORENZ P ET AL: "Metagenome: A challenging source of enzyme discovery" JOURNAL OF MOLECULAR CATALYSIS. B, ENZYMATIC, ELSEVIER, AMSTERDAM,, NL, no. 19-20, 2 December 2002 (2002-12-02), pages 13-19, XP002319921 ISSN: 1381-1177 * |
LORENZ PATRICK ET AL: "Screening for novel enzymes for biocatalytic processes: Accessing the metagenome as a resource of novel functional sequence space." CURRENT OPINION IN BIOTECHNOLOGY, vol. 13, no. 6, December 2002 (2002-12), pages 572-577, XP002330804 ISSN: 0958-1669 * |
PRECIGOU S ET AL: "Rapid and specific identification of nitrile hydratase (NHase)-encoding genes in soil samples by polymerase chain reaction" FEMS MICROBIOLOGY LETTERS, AMSTERDAM, NL, vol. 204, no. 1, 2001, pages 155-161, XP002248648 ISSN: 0378-1097 cited in the application * |
Cited By (19)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2261327A2 (en) | 2006-04-07 | 2010-12-15 | B.R.A.I.N. Ag | A group of novel enantioselective microbial nitrile hydratases with broad substrate specificity |
WO2007115797A2 (en) * | 2006-04-07 | 2007-10-18 | B.R.A.I.N. Ag | A group of novel enantioselective microbial nitrile hydratases with broad substrate specificity |
WO2007115797A3 (en) * | 2006-04-07 | 2008-03-06 | B R A I N Ag | A group of novel enantioselective microbial nitrile hydratases with broad substrate specificity |
US8470576B2 (en) | 2006-04-07 | 2013-06-25 | B.R.A.I.N. Ag | Group of novel enantioselective microbial nitrile hydratases with broad substrate specificity |
EP1842907A1 (en) | 2006-04-07 | 2007-10-10 | B.R.A.I.N. Ag | A group of novel enantioselective microbial nitrile hydratases with broad substrate specificity |
EP2261327A3 (en) * | 2006-04-07 | 2011-03-16 | B.R.A.I.N. Ag | A group of novel enantioselective microbial nitrile hydratases with broad substrate specificity |
WO2009009117A3 (en) * | 2007-07-11 | 2009-04-02 | Bioverdant Inc | Chemoenzymatic processes for preparation of levetiracetam |
WO2009009117A2 (en) * | 2007-07-11 | 2009-01-15 | Bioverdant, Inc. | Chemoenzymatic processes for preparation of levetiracetam |
JP2010178671A (en) * | 2009-02-05 | 2010-08-19 | Mitsubishi Rayon Co Ltd | New nitrile-hydratase from environmental dna and gene thereof |
US9738885B2 (en) | 2011-06-07 | 2017-08-22 | Mitsubishi Chemical Corporation | Nitrile hydratase |
AU2015203199B2 (en) * | 2011-06-07 | 2017-10-26 | Mitsubishi Chemical Corporation | Improved nitrile hydratase |
US10066225B2 (en) | 2011-06-07 | 2018-09-04 | Mitsubishi Chemical Corporation | Nitrile hydratase |
US10221410B2 (en) | 2011-06-07 | 2019-03-05 | Mitsubishi Chemical Corporation | Nitrile hydratase |
US10487320B2 (en) | 2011-06-07 | 2019-11-26 | Mitsubishi Chemical Corporation | Nitrile hydratase |
US10429162B2 (en) | 2013-12-02 | 2019-10-01 | Austin Star Detonator Company | Method and apparatus for wireless blasting with first and second firing messages |
US11009331B2 (en) | 2013-12-02 | 2021-05-18 | Austin Star Detonator Company | Method and apparatus for wireless blasting |
WO2015186298A1 (en) * | 2014-06-06 | 2015-12-10 | 三菱レイヨン株式会社 | Improved nitrile hydratase |
US10093912B2 (en) | 2014-06-06 | 2018-10-09 | Mitsubishi Chemical Corporation | Nitrile hydratase |
RU2689606C2 (en) * | 2014-06-06 | 2019-05-28 | Мицубиси Кемикал Корпорейшн | Improved nitrile hydratase |
Also Published As
Publication number | Publication date |
---|---|
DK1730300T3 (en) | 2013-09-30 |
EP2369009B1 (en) | 2013-12-11 |
EP2369010B1 (en) | 2014-05-07 |
CA2557476A1 (en) | 2005-09-29 |
US7872100B2 (en) | 2011-01-18 |
ZA200607776B (en) | 2008-06-25 |
EP2369010A2 (en) | 2011-09-28 |
EP2369010A3 (en) | 2012-07-18 |
EP2369009A3 (en) | 2012-03-14 |
SG157384A1 (en) | 2009-12-29 |
EP2369009A2 (en) | 2011-09-28 |
DK2369009T3 (en) | 2014-01-13 |
WO2005090595A3 (en) | 2006-03-02 |
CA2557476C (en) | 2016-02-23 |
EP1730300B1 (en) | 2013-07-17 |
DK2369010T3 (en) | 2014-05-26 |
DE102004013842A1 (en) | 2005-10-13 |
EP1730300A2 (en) | 2006-12-13 |
US20080171389A1 (en) | 2008-07-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP2369010B1 (en) | Nitrile hydratases from metagenome libraries | |
MXPA05001537A (en) | Enzymatic processes for the production of 4-substituted 3-hydroxybutyric acid derivatives. | |
Kang et al. | High-level expression in Corynebacterium glutamicum of nitrile hydratase from Rhodococcus rhodochrous for acrylamide production | |
Sosedov et al. | Improvement of the amides forming capacity of the arylacetonitrilase from Pseudomonas fluorescens EBC191 by site-directed mutagenesis | |
Liebeton et al. | Identification and expression in E. coli of novel nitrile hydratases from the metagenome | |
EP2004814B1 (en) | A group of novel enantioselective microbial nitrile hydratases with broad substrate specificity | |
JP3408737B2 (en) | Protein involved in nitrile hydratase activation and gene encoding the same | |
JP2003504049A (en) | Methods for stabilizing nitrilase activity and preserving microbial cells | |
US7070963B2 (en) | Amidase from variovorax | |
EP2215225B1 (en) | Improvement in immobilized microbial nitrilase for production of glycolic acid | |
JP4216700B2 (en) | Method for modifying an enzyme having nitrile hydratase activity | |
EP1727902B1 (en) | Expression of nitrile hydratases in a two-vector expression system | |
US7247465B2 (en) | Screening process for hydantoin racemases | |
JP5190207B2 (en) | Preservative, activation activator and deactivation preventive for amidase containing zinc or salt thereof | |
KR101570356B1 (en) | Nitrile Hydratase Mutant and Method of Producing Amide Using the Same | |
JP2011041550A (en) | Preservation agent, activity activation agent and deactivation preventing agent for amidase |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2557476 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2005715932 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 10593357 Country of ref document: US Ref document number: 2006/07776 Country of ref document: ZA Ref document number: 200607776 Country of ref document: ZA |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWW | Wipo information: withdrawn in national office |
Country of ref document: DE |
|
WWP | Wipo information: published in national office |
Ref document number: 2005715932 Country of ref document: EP |