WO2005090399A1

WO2005090399A1 - Antibody recognizing the proliferation/differentiation of various types of cells and method of evaluating proliferation/differentiation by using the antibody

Info

Publication number: WO2005090399A1
Application number: PCT/JP2005/004932
Authority: WO
Inventors: Yukihiro Akao; Kenji Matsumoto
Original assignee: Gifu International Institute Of Biotechnology
Priority date: 2004-03-24
Filing date: 2005-03-18
Publication date: 2005-09-29
Also published as: JPWO2005090399A1

Abstract

Based on a finding obtained in the course of the clarification of an rck/p54 protein, it is intended to detect the step of the proliferation and differentiation of various types of cells and provide a means of evaluating the proliferation/differentiation of various types of cells. An antibody is constructing by using a peptide, which is a partial sequence of the rck/p54 protein, as an antigen and the roles of the rck/p54 protein on various types of cells are examined by using the antibody having a specific reactivity with the rck/p54 protein. Thus, a means of evaluating the proliferation and differentiation of various types of cells is established.

Description

Specification

An antibody that recognizes proliferation / differentiation of various cells, an antibody for the antibody, a method for evaluating proliferation / differentiation

Technical field

The present invention relates to a method for measuring proliferation and differentiation of various types of cells using an antibody prepared using rck / p54-derived low molecular weight peptide as an antigen.

Background art

[0002] rck / p54 is a protein which has been confirmed to have RNA helicase activity and which is essential for efficient translation of mRNA in Xenopus oogenesis. Human rck / p54 is a gene product cloned from the chromosome 11 band q23 of the chromosomal translocation t (11; 14) (q23; q32) in the human B lymphoma cell line RC-K8. The rck / p54 protein is a cytoplasmic localized protein with a molecular weight of 54 kDa, which is also 472 amino acids, and is found in all tissues in normal cells, but its expression is reduced in brain, skeletal muscle and lung tissues. However, in these tumors, the expression of rck / p54 is enhanced in tumors that have developed, and rck / p54 cooperates with other translation initiation factors in tumor cells and is a gene involved in cell proliferation and virulence. It is speculated that it promotes the translation of mRNA (s) (general literature 1).

[0003] Patent Document 1 discloses the rck / p54, and a homologue protein substantially identical thereto or a protein having substantially the same action. Such a protein is used to provide an RNA modifying protein configured to be able to change the structure of mRNA molecule in a direction to increase the protein synthesis efficiency, and is configured to easily increase the protein synthesis efficiency. It is intended to provide a protein synthesis promoter, a gene therapeutic agent configured to enhance translation efficiency of a transgene, and a cancer therapeutic agent configured to be able to effectively treat cancer. as a goal! Scold.

[0004] In the present invention, an antibody obtained using a peptide that is a partial sequence of rck / p54 protein as an antigen is prepared, and an antibody that specifically reacts with the obtained rck / p54 protein is used. In addition to detecting the stages of proliferation and differentiation of various cell types, we will try to elucidate the role of rck / p54. It is

Patent Document 1: Japanese Patent Application Laid-Open No. 2003-289860

Non-patent literature 1: Cancer Research, 55, 3444-4449, 1995

Disclosure of the invention

Problem that invention tries to solve

[0005] The present invention is a means for detecting proliferation and differentiation stages of various cells and examining proliferation and differentiation of various cells based on the knowledge obtained in the process of elucidating the role of rck / p54 protein. To provide

Means to solve the problem

[0006] An antibody is prepared using a peptide which is a partial sequence of rck / p54 protein as an antigen, and an antibody having specific reactivity with rck / p54 protein is used to determine the role of rck / p54 protein in various cells. As a result of intensive research, we established a means to examine the proliferation and differentiation of various cells.

[0007] A feature of the present invention is a small molecule peptide having the following amino acid sequence:

(a) STARTENPVI (1-10), where

(b) Amino acid sequence This is an amino acid sequence comprising an amino acid in which one or several amino acids are deleted, substituted or added in (a), or modified with monoacetic acid or the like. The following experiment was performed using the above-mentioned (a) sequence which is a partial sequence of rck / p54 protein.

Another feature of the present invention is an antibody characterized in that the peptide according to claim 1 is obtained as an antigen. From the amino acid sequence of rckZp54 protein, the amino acid sequence of STARTENPVI (1-10) was used for various experiments.

Another feature of the present invention is an antibody characterized in that an antibody obtained using the peptide of claim 1 as an antigen is a monoclonal antibody. By using a peptide having the amino acid sequence (a) of claim 1 as an antigen, an antibody having reactivity specifically with rckZp54 protein was obtained.

Another feature of the present invention is a method of examining proliferation and differentiation of each type of cells characterized by using the antibody obtained in claim 2 or 3. By using a peptide having the amino acid sequence (a) of claim 1 as an antigen, it is specifically reactive to the rckZp54 protein. Monoclonal antibody was obtained.

[0011] Another feature of the present invention is a kit for examining proliferation and differentiation of various cells, which comprises the antibody obtained in claim 2 or 3.

[0012] Another feature of the present invention is a method of examining proliferation and differentiation of sperm characterized by using the antibody obtained in claim 2 or 3.

[0013] Another feature of the present invention is a kit for examining proliferation and differentiation of sperm, characterized in that it contains the antibody obtained in claim 2 or 3.

Another feature of the present invention is a method of diagnosing infertility, characterized by using the antibody obtained in claim 2 or 3.

[0015] Another feature of the present invention is a kit for diagnosing infertility, characterized in that it contains the antibody obtained in claim 2 or 3.

Effect of the invention

[0016] From the amino acid sequence of rckZp54 protein, as a result of immunizing a peptide having the amino acid sequence of STARTENPVI (1-10) as an antigen, an antibody specifically reactive to rckZp54 protein was obtained. This antibody can be used to detect the stages of proliferation and differentiation of various cells.

Brief description of the drawings

FIG. 1 shows the reaction of rckZp54 protein with anti-rckZp54 antibody by Western blotting.

[FIG. 2] FIG. 2 shows the detection of rckZp54 protein in the ovary by the fluorescent antibody method and the localization thereof.

[FIG. 3] FIG. 3 shows detection of rckZp54 protein in testis by fluorescent antibody method and its localization.

[FIG. 4] FIG. 4 shows the detection of rckZp54 protein in the epididymis by fluorescent antibody method and its localization.

[FIG. 5] FIG. 5 shows the results of examining the effect of progesterone administration on the expression level of rckZp54 protein.

[FIG. 6] FIG. 6 shows the results of examining the relationship between fertilization and the expression level of rckZp54 gene. [FIG. 7A] FIG. 7A shows the results of examining cell proliferation in Con-A-treated cells.

[FIG. 7B] FIG. 7B shows the results of examining the expression of rckZp54 protein in Con-A-treated cells.

[FIG. 8A] FIG. 8A shows the results of examining the proliferation of U937 cells in TPA-treated cells.

[Fig. 8B] Fig. 8B is a Ding? 8 shows expression of 038 of 11937 cells in treated cells.

[Figure 8C] Figure 8C, right? The results of examining the expression of 1 ^ 1 ^ 754 protein of 11937 cells in 8 treated cells are shown.

BEST MODE FOR CARRYING OUT THE INVENTION

Peptide synthesis

The synthesis of the peptide of the present invention is carried out by well-known methods, for example, the ability to condense two successive aminoacyl groups sequentially in a predetermined order, or a fragment previously formed with an aminoacyl group and already having several aminoacyl groups. These can be obtained by synthesis by condensation of several fragments which have been pre-formed in this way, or by condensation in an appropriate order. In this case, all reactive functional groups possessed by these aminoacyl groups or fragments, in particular the activity of the carboxyl functional group, except for one of the amine functional groups and the other of the carboxyl groups (or the opposite) which usually form a peptide bond. Care is taken to pre-protect them according to methods known in peptide synthesis! It is also possible to use coupling reactions using conventional coupling reagents such as carbodiimide type, for example 1-ethyl 3- (3-dimethylaminopropyl) carpimide. If the aminoacyl radical used has a further amine functional group (for example in the case of lysine) or another acid functional group (for example in the case of glutamic acid), these functional groups may be, for example, amine groups, such as carbohydrates. Benzoxy is protected by a t-butyl carboxyl group, and the carboxy functional group is protected by a t-butyl ester group. These operations are similar to the protection of any other reactive functional group. For example, the aminoacyl group to be used (for example, in the case of cysteine, an acetoamidomethyl group or a paramethyoxybenzyl group can be used. In the case of progressive synthesis for each amino acid, the synthesis is C-terminal amino acid and Initiated by condensation with the amino acid corresponding to the adjacent aminoacyl group in the desired sequence, and so on, step by step, up to the N-terminal amino acid. Is preferred.

[0019] Another preferable synthesis method of the peptide of the present invention is a solid phase peptide synthesis method by R. D. Merrifield. Merrifield's method uses a highly porous polymer resin to which the first C-terminal amino acid of the peptide chain is fixed. This amino acid is fixed to the resin via its carboxyl group, and its amine functional group is protected by, for example, t-butyl oxycarboyl group. Initial C-terminal amino acid power Once fixed in the resin this way, the protecting group of the amine functional group is removed by washing the resin with acid. If the protecting group of the phenylalanine functional group is t-butyloxycarbonyl group, the resin can be removed by treatment with trifluoroacetic acid. The second amino acid is then coupled, which results in the second aminoacyl group of the desired sequence leading to the deprotected amine function of the first C-terminal amino acid fixed to the C-terminal aminoacyl group. give. Preferably, the carboxyl group of this second amino acid is activated, for example by means of dicyclohexylcarbodiimide, and the amine function is protected, for example by means of t-butyloxycarbol. In this way, the first part of the desired peptide chain is obtained, which consists of two amino acids, the terminal amine function of which is protected. In the same manner as described above, it becomes possible to deprotect the amine functional group, and then to fix the third aminoacyl group under the same conditions as the conditions for addition of the second C-terminal amino acid. In this way, one after the other, the amino acids constituting the peptide chain are fixed to the previously deprotected amino groups of the part of the peptide chain attached to the already formed resin. When the desired peptide chain is completely formed, the protecting groups of different amino acids forming the peptide chain can be removed, and the peptide can be desorbed from the resin using, for example, hydrofluoric acid to obtain the desired peptide. .

Preparation of antibody

The polyclonal antibody was prepared by mixing 100 μg / body of the partial sequence of rck / p54 obtained as described above with an equal amount of complete adjuvant, and using 5 mice every 4 weeks for 5 weeks. I was immunized. One week after the final immunization, according to a conventional method, whole blood of rabbits which produced sufficient titer of antisera was collected, followed by leaving it at 37 ° C for 1 hour and then at 4 ° C overnight. Serum is obtained by centrifuging at 3000 rpm and this is After purification by adsorption and desorption by chromatography, an anti-rckZp54 polyclonal antibody was obtained.

A method for obtaining a monoclonal antibody using the peptide of partial sequence of rck / p54 obtained in the present invention can be obtained according to a known method. That is, examples of mammals for immunization include mice, rats, guinea pigs, sheep, goats and the like. Of these, mice and rats are preferred because they are easy to handle. The route of administration of the antigen upon immunization is not particularly limited. For example, administration can be by any route such as subcutaneous, intraperitoneal, intravenous or intramuscular. Specifically, for example, a peptide antigen is administered several times every several days for several days to BALB / c mice. The dose is 0.1 / ^-100 / ^ at one time per animal. Spleens are isolated from the mice thus immunized, and spleen cells are obtained by centrifugation. Since these cells are not proliferative, they are fused with cells having self-proliferating ability. Lymphoid cells such as myeloma cells are desirable as cells having an autoproliferative capacity. As Mie mouth cells, it is preferable to use Mie mouth cells that do not secrete antibody in the same species as the animal from which the antibody-producing cells were obtained. Examples of useful myeloma cells include Sp2Z0-aql4, P3 / NSl / l-Aq4-1, P3X63Aq8U.1 etc. in the case of mouse myeloma cells. The fusion between antibody-producing cells and myeloma cells can be carried out according to a conventional method, for example, by treating these cells with a solution (or suspension) containing a cell fusion agent such as polyethylene glycol. The ratio of antibody-producing cells to myeloma cells is preferably about 3: 1 to 10: 1 in terms of the cell number ratio.

The resulting fused cells are separated by limiting dilution, and the separated fused cells are grown, and antibodies produced in each well on a microplate are immobilized with the peptide of the present invention. Select cells with high antibody production by ELISA. Furthermore, the reactivity with the rck / p54 protein can be examined by immunohistological staining to obtain a hybridoma producing a highly reactive desired antibody. The monoclonal antibody obtained in this manner is obtained from a culture supernatant obtained by culturing using an appropriate medium, or from ascites fluid, serum or the like inoculated in the peritoneal cavity of a mouse etc. Purified antibodies can be easily obtained by ammonium sulfate fractionation, anion exchange chromatography, affinity chromatography using protein A or the like. [0023] Measurement of rck / p54 Protein Using Antibody

The results of examining the reactivity with the rckZp54 protein by the Western blot method using the antibody obtained as described above are shown in FIG. That is, according to a standard method, a denaturant such as sodium dodecyl sulfate (SDS) was added to 1 _μg of a tissue extraction sample such as an ovary and testis or epididymis and then subjected to 10% polyacrylamide gel electrophoresis. After electrophoresis, after transfer to a nylon membrane, only rck / p54 protein could be detected by visualization using a 3000-fold dilution of antibody.

Furthermore, FIG. 2 shows the results of examining the localization of rckZp54 protein in the ovary or the expression at the differentiation stage. Immunohistological staining of the ovaries blocks plates containing tissue sections to block endogenous peroxidase, so 30% H 2 O and methyl alcohol 1 to 100

twenty two

Process for 20 minutes with the proportions mixed. Then, the antibody was washed three times with PBS (saline) and incubated with normal horse serum diluted 10-fold with PBS containing 1% BSA (bovine serum albumin), and then the antibody was stained. The antibody used was diluted 3000-fold with PBS containing 1% BSA. After standing at room temperature for 1 hour or overnight at 4 ° C., the cells were washed 3 times with PBS. Then, a peroxidase-conjugated avidin- 1-biotin conjugate was added. The concentration is prepared at least 30 minutes before addition at 1000-fold dilution in PBS. After reacting for 30 minutes at room temperature, washing was performed 3 times with PBS. Color development was carried out by dissolving 20 mg of diaminobenzidine hydrochloride in 1000 ml by adding distilled water to 25 ml of 0.2 M trisaminomethane, 19.2 ml of 0.2 N hydrochloric acid, and further adding HO 0. 03 ml was added. Plate the above solution

twenty two

The reaction was allowed to proceed for 7 minutes, after which the color development was stopped. Nuclear staining was performed with hematoxylin. Here, rckZp54 protein is abundantly stained in egg cells. In particular, it is recognized that the cytoplasm is stained a lot. The oocyte on the outermost surface forms follicles and separates, but before ovulation, immature cells are present in the middle, and when ovulation occurs, they become white bodies. As a result, it is clear that the rckZp54 protein is highly expressed in egg cells.

FIG. 3 shows the results of examining the localization of rckZp54 protein in the testis or the expression at the differentiation stage in the same manner as in FIG. As a result, the rck / p 54 protein reacted with the antibody shows localization in testicular cells.

[0026] FIG. 4 shows the localization of rckZp54 protein in the epididymis in the same manner as FIG. 2, or The results of examining the expression at the differentiation stage are shown in FIG. As a result, the rck / p54 protein reacted with the antibody shows localization in epididymal cells. As a result, it is shown that it is highly expressed in spermatogonia and appears in the nucleus from the front of sperm, and the juvenile force is also transferred from cytoplasm to nucleus as it matures. Furthermore, the epididymis is highly expressed in the nucleus as sperm matures further.

[0027] FIG. 5 shows changes in rckZp54 protein when a hormone (PMSG; progesterone), which is also separated from equine serum, is administered to mice. The rck / p54 protein is shown to be significantly increased by progesterone administration. The results show that the rck / p54 protein is hormone dependent.

When fertilized, as shown in FIG. 6A, when a transcript is converted to cDNA and PCR is performed using RCK primers, the product increases at an accelerated rate from 27 cycles. rck / p54 controls erong geography factor 1. In addition, as shown in FIG. 6B, highly expressed fertilized eggs are combined, divided, and in the order of morula, the expression of rck / p54 protein decreases.

[0029] In Table 1, when the rck / p54 gene was microinjected into the fertilized egg and returned to the uterus, an increase in the number of fetal deaths and a decrease in the number of births were observed. Thus, the expression of the rckZp54 protein upon introduction of the rck / p54 gene indicates that conception is abnormal.

[0030] [Table 1]

Growth of the number of offspring of TG mice

Gene name Injection number Pseudopregnant female mouse Number of pregnancy Number of offspring Number of death Number of positive

A & B 7 0 1 3 4 3 1 2 1 2 2 0 i 0

% 9 1. 2 3 0. 2 9 + 4 5. 5

R C K 6 2 4 2 8 2 2 1 0 7 2 7 5

% 7 8 ₊ 5 1 7 1 2 5 2 6 3

D 3 6 0 1 8 1 8 1 0 0 1 1

% 10 0 2 7. 8 1

»The two genes A and B are the ones just before R C K and the one 0 is the one immediately after,

All mice used C 5 7 BL / 6. From the above results, the anti-ck / p54 antibody prepared using the partial sequence of rckZ _P 54 protein detects infertility as a reagent for detecting the stage of cell proliferation and differentiation. It can be used as a reagent for The composition of the detection reagent may contain at least one of the above-described anti-rck / p54 antibodies, ie, the above-described polyclonal antibodies or monoclonal antibodies, and more preferably, various types of additives as additives. Antiseptics (except those that suppress the reaction of sodium azide and peroxidase), reagents for suppressing nonspecific reactions, such as bovine serum albumin at high concentration, block ace (Snow Brand Milk Products), gelatin, skimmed milk, etc. It is desirable to use. By using such an additive, it is possible to improve the convenience, storage stability and the like of the detection reagent by simply increasing the accuracy of the rck / p54 protein detection method using the anti-rck / p54 antibody of the present invention. I can do it.

[0033] rckZp 54 expression levels in cell proliferation and differentiation

Total RNA was isolated using RNAqueous-4 PCR (Ambion, Austin, TX, USA). The RNA was reverse transcribed using Super Script II RAase H-reverse transcriptase (Invitorogen and oligo (dT) primer (Invitrogen). The prepared cDNA was purified using a PCR purification kit (Qiagen, Hilden, Germany). The β-actin was used as an internal standard control The primers for RCK used the following: T-RCK forward: 5,-GGCTGGGAAAGCCATCT-3, reverse of T- RCK, c-myc forward, 5, ACATCATCATCCAGGACTG-3, c-myc revers, 5 'TTTAGCTCCGTTCCTCCTCTG 3' The amount of PCR production is developed by agar electrophoresis, and the intensity of the band is measured by densitometer did.

[0034] Cell culture, differentiation treatment, FACS, morphological examination, cell viability

Human peripheral blood lymphocytes were collected from healthy volunteers using Fico 卜 paque (Amersham Biosciences AB, Uppsala, Sweden). After culturing for 8 hours using RPMI 1640 medium, the cells were stimulated with 15 g Z ml of Con-A (Sigma, St. Louis, MO, USA) for 48 hours. U937 (T-lymphoma) cells contain 95% air and 5% carbon dioxide in RPMI-1640 medium containing 10% (v / v) heated fetal bovine serum (SIgma, Tokyo) and 2 mM L-glutamine. Below, 3

, ^ ^;

[0035] Results

The expression level of rckZp54 in cell proliferation and differentiation was measured. When peripheral blood lymphocytes are stimulated with Con-A, the number of cells does not increase in the untreated group, as shown in Fig. 7A. It increased linearly at 48 hours after the on-A treatment. The expression level of rckZp54 was significantly increased as shown in the upper row of FIG. 7B. Levels of TRCK, representing total mRNA levels of RCK, also correlated with protein expression. The levels of c myc mRNA and protein were increased with high expression of rckZp54. This result indicates that high expression of rckZp54 positively acts on cell proliferation in response to growth factor-mediated mitogen stimulation.

[0037] U937 cells were examined for the expression level of rckZp54 in differentiation of cells treated with TPA, which is a stimulator of protein kinase C (PKC). As shown in FIG. 8A, the number of viable cells decreased after 6 hours of treatment with TPA, and as shown in FIG. 8B, expression of CD38, a delivery marker, appeared 24 hours after treatment. Furthermore, as shown in FIG. 8C, expression of c myc was reduced after 6 hours of TPA treatment. The levels of rckZ45 and TRCK decreased significantly after 48 hours of treatment.

Industrial applicability

From the above results, it is understood that the anti-rck / p54 antibody prepared using the partial sequence of rckZp54 protein as a reagent for detecting cell proliferation and differentiation stages, and infertility. It can be used as a reagent for detecting

Claims

The scope of the claims

[1] Low molecular weight peptide having the following amino acid sequence

(a) STARTENPVI (1-10)

(b) Amino acid sequence An amino acid sequence comprising an amino acid in which one or several amino acids are deleted, substituted or added in (a), or modified with monoacetic acid or the like.

[2] An antibody obtained by using the peptide according to claim 1 as an antigen.

[3] An antibody characterized in that an antibody obtained using the peptide according to claim 1 as an antigen is a monoclonal antibody.

[4] A method of examining proliferation and differentiation of various cells, characterized by using the antibody obtained in claim 2 or 3.

[5] A kit for examining proliferation and differentiation of various cells, which comprises the antibody obtained in claim 2 or 3.

[6] A method of detecting proliferation and differentiation of sperm characterized by using the antibody obtained in claim 2 or 3.

[7] A kit for examining proliferation and differentiation of sperm, characterized in that it contains the antibody obtained in claim 2 or 3.

[8] A method of diagnosing infertility comprising using the antibody obtained in claim 2 or 3.

[9] A kit for infertility diagnosis comprising the antibody obtained in claim 2 or 3.