WO2005079842A1

WO2005079842A1 - Immunological adjuvant

Info

Publication number: WO2005079842A1
Application number: PCT/CN2005/000084
Authority: WO
Inventors: Bin Wang; Qingling Yu; Huali Jin; Youmin Kang
Original assignee: China Agricultural University
Priority date: 2004-02-20
Filing date: 2005-01-19
Publication date: 2005-09-01
Also published as: CN1909925B; CN1909925A

Abstract

This invention relates to an immunological adjuvant. The immunological adjuvant is levomisole, or derivative thereof, or a composition consisting of levomisole or derivative thereof and at least one of while oil, glycerol, oleic acid, DDA or saponin. The immunological adjuvant of the present invention can effectively stimulate the immunological adjuvant of the present invention can effectively stimulate the immunological reaction capacity of protein vaccine, nucleic acid vaccine, polypeptide vaccine and inactivated vaccine. The immunological adjuvant also can enhance the immunological effect of T cell and extend protective period. The method for preparing the immunological adjuvant of the present invention is easy. The immunological adjuvant can be used widely and can bring enormous benefit.

Description

An immune adjuvant

Technical field

The invention relates to an immune adjuvant.

Background technique

Improving the body's immunity is the most important means of preventing infections of various pathogens, which can usually be achieved by vaccination. Therefore, vaccination is one of the effective measures to prevent infections of various pathogens. Common pathogens include viruses, microorganisms, eukaryotic cells, parasites, and environmental factors. Various methods have been reported to produce vaccines against infectious pathogens, such as inactivated vaccines, live attenuated vaccines, recombinant vaccines, subunit vaccines, and nucleic acid vaccines. The basic principles of these vaccines are the same, that is, with the help of The target protein bound to the pathogen stimulates the immune response, so that the immune individual is not infected by the infectious pathogen. When an individual comes into contact with an infectious pathogen, their immune system can recognize the protein of the pathogen and produce an effective protective response against infection. Many vaccines currently in use consist of non-infectious and low-infectious proteins or nucleic acid substances isolated from pathogens. The advantage of nucleic acid vaccine is that it can activate humoral immune response and cellular immune response, and more effectively stimulate protective and clearance immune response, to achieve resistance to pathogen infection, anti-tumor, treatment of autoimmune diseases and elimination of poisoning symptoms caused by toxins. Infections and internal lesions from foreign pathogens, and nucleic acid vaccines are highly respected for their ease of preparation, low cost, and good safety. However, the disadvantage of nucleic acid vaccines is that it is inefficient to activate the body to produce a complete immune response in the body, and it cannot achieve protective effects or protective instability when used alone. Adjuvants that supplement, activate, and regulate the immune response of nucleic acid vaccines are the key to solving this problem.

There are many types of adjuvants, which can be divided into soluble aluminum salt adjuvants (Glemiy, J. Path.

Bacteriol, 34, 267, 1926), oil-water emulsion adjuvants (such as Freund's adjuvant), microorganisms and their metabolites Zoqi ¹ J (R. Germanier, ed., Bacterial Vaccines, Academic Press Inc. New York, 1984) , Synthetic adjuvant (Coughl in et al., P. The Journal of Infectious Diseases, 171: 1049-1052, 1995), Immune Stimulation Composition (ISC0M) adjuvant (Coughl in et al., P. The Journal of Infectious Diseases, 171: 1049-1052, 1995), cytokine-based adjuvants (Trinchieri G. Immunology 13: 251-276, 1995), nucleic acid and its analogues (US Patent 6,372, 227; Manmohan Singh & Derek 0 'Hagan. Nature Biotechnology 17, 1075-1081, 1999; Virgi l EJC Schi jns. Current Opinion in I, awakening logy, 12: 456-463, 2000); According to the mode of action, it can be divided into three types: 1) in An antigen reservoir is formed at the inoculation site, so that the antigen is slowly released, so as to contact the immune cells for a long time and stimulate the adjuvant to the antigen response; 2) assist the antigen exposure and present the antigen epitope that can stimulate the specific immune response to the immunity Cell adjuvant; 3 ) Adjuvants that induce the release of cytokines that mediate the immune response.

However, each of the above adjuvants has some problems. For example, most of them have been developed and designed to increase antibody levels, but they have not promoted the T cell immune level of the body; instead, some adjuvants have immune effects on T cells. It also has a large inhibitory effect, which makes it appear weak in immunogenicity, low cell level, short protection period and other shortcomings in the application of proteins, peptides and inactivated vaccines, which makes the application of such adjuvants limited. Invention Disclosure

The object of the present invention is to provide an immune adjuvant which can increase the immune level of τ cells.

The immune adjuvant provided by the present invention is a combination of levamisole, or a derivative of levamisole, or a combination of levamisole or a levamisole derivative with at least one of the following substances: white oil, glycerol, oleic acid, double ten Octamethyl dimethyl ammonium bromide or saponin.

The specific composition of the immune adjuvant of the present invention is as follows:

The immune adjuvant is levamisole or a levamisole derivative.

The immune adjuvant is a combination of levamisole or a levamisole derivative and white oil. The mass ratio of the white oil to the levamisole or levamisole derivative is 20: 1-1: 20, and the preferred mass ratio is 10: 1-1: 1.

The immune adjuvant is a combination of levamisole or a levamisole derivative and glycerol. The mass ratio of glycerol to levamisole or levamisole derivative is 5: 1-1: 5, and the preferred mass ratio is 2: 1-1: 2.

The immune adjuvant is a combination of levamisole or a levamisole derivative and oleic acid. The mass ratio of the oleic acid to the levamisole or levamisole derivative is 5: 1-1: 5, and the preferred mass ratio is 2: 1-1: 2.

The immune adjuvant is a combination of levamisole or a levamisole derivative and bisoctadecyldimethylammonium bromide. The mass ratio of the bisoctadecyldimethylammonium bromide to the levamisole or levamisole derivative is 20: 1 to 1:20, and the preferred mass ratio is 10: 1 to 1: 5.

The immune adjuvant is a combination of levamisole or a levamisole derivative and saponin. The mass ratio of the saponin to the levamisole or levamisole derivative is 20: 1-1: 20, and the preferred ratio is 10: 1-1: 5.

The levamisole derivative may be levamisole hydrochloride or levamisole phosphate. The white oil is white oil for food or white oil for injection.

The adjuvant of the present invention can be combined with a vaccine to form an immune composition. The vaccine may be a protein vaccine, a polypeptide vaccine, a nucleic acid vaccine or an inactivated vaccine.

The protein vaccine and the peptide vaccine are artificial antigens or vaccine-specific antigen substances produced by an organism. The organism is Escherichia coli, Bacillus, yeast or eukaryotic cells, which can be scaled up under artificial culture conditions.

The inactivated vaccine is an antigenic substance used as a vaccine after the pathogen is inactivated by a known method.

The immune composition can be introduced into the body such as muscle, intradermal, subcutaneous, vein, mucosal tissue by injection, spray, oral, nasal, eye drop, penetration, absorption, physical or chemically mediated methods; or by other substances Into the body after mixing or wrapping.

The immune composition can be obtained by the following method: a protein vaccine, a nucleic acid vaccine, a polypeptide vaccine or an inactivated vaccine is dissolved in a physiological saline containing levamisole (or a levamisole derivative) at a concentration of 0.1% to 10% by mass Medium; or soluble in levamisole (or 0.1% to 10%) Levamisole derivative) and white oil in normal saline with a mass percentage of 1% to 20%; or soluble in levamisole (or levamisole derivative) containing a mass concentration of 0.1% to 10% And glycerol in normal saline with a concentration of 1% to 10%; or dissolved in levamisole (or a derivative of imidate) with a concentration of 0.1% to 10% by mass and a content of 0.1% to 5% of oleic acid in normal saline; or soluble in levamisole (or levamisole derivative) containing 0.1% to 10% by mass and 0.1% by mass % To 10% of dioctadecyl dimethyl ammonium bromide in physiological saline; or soluble in levamisole (or levamisole derivative) containing 0.1% to 10% by mass In normal saline with a concentration of 0.1% to 5% of saponin, the final concentration of the protein vaccine, nucleic acid vaccine, peptide vaccine or inactivated vaccine is 1 to 200 micrograms per milliliter.

The immune adjuvant of the present invention is used together with a corresponding vaccine to enhance the body's immune response ability to the following pathogenic pathogens: viruses, prokaryotic cells, and eukaryotic cells. Among them, eukaryotic pathogens include single cell pathogens and multicellular parasites. Viral pathogens include, but are not limited to, respiratory viruses (influenza and rotavirus), sores (German measles, chicken pox, vaccinia, smallpox, shingles, etc.), central nervous system virus (prion), immune system virus (HIV), reproductive system virus (condyloma acuminatum), animal virus (foot-and-mouth disease virus, classical swine fever virus, avian influenza virus, Newcastle disease virus). BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the 1% agarose gel electrophoresis map of the FMDV VP1 gene amplified by PCR.

Figure 2 is an electrophoresis map of the recombinant expression vector SuperY / VPl for digestion and identification.

Figure 3 is an SDS-PAGE map of the VP1 gene expression product

Figure 4 shows the expression profile of VP1 protein detected by Western-blot experiments.

Figure 5 shows the curve of antibody titer produced by mice immunized with the immune composition formed by VP1 protein and different adjuvants.

Figure 6 shows the effect of T cell-specific expansion on mice immunized with an immune composition composed of 146S antigen and different adjuvants.

Figure 7 Comparison of titers of antibodies produced by pigs with reproductive and respiratory syndrome inactivated virus antigens and immune compositions immunized with different adjuvants

Figure 8: Comparison of T cell-specific expansion activity of immunorecombinant mice with pig reproductive and respiratory syndrome inactivated virus antigens and different adjuvants

Figure 9 shows the comparison of the delayed immune response of pigs reproductive and respiratory syndrome inactivated virus antigen and immune composition composed of different adjuvants.

Figure 10 shows the results of T cell proliferation in BABL / C mice immunized with 146S antigen

Figure 11 shows the results of T cell proliferation in C57BL / 6 mice immunized with 146S antigen

Figure 12 shows the results of T cell proliferation in BABL / C mice immunized with PRRSV antigen Figure 13 shows the results of T cell proliferation of C57BL / 6 mice immunized with PRRSV antigen

Figure 14 is an electrophoresis diagram of cDNA concentration after quantitative regulation of HPRT housekeeping genes

Figure 15 is an electrophoresis image of IL-4, IL-10, IL-2 and IFN-γ expressed in BABL / c mice immunized with 146S antigen

Figure 16 shows the results of analyzing the expression of IL-4, IL-10, IL-2 and IFN-γ in C57BL / 6 mice immunized with 146S antigen by Bio-Rad Image software.

Figure 17 shows the results of analyzing the expression of IL-4, IL-10, IL-2 and IFN-γ in BABL / c mice immunized with porcine reproductive and respiratory syndrome virus antigen by Bio-Rad Image software.

Figure 18 shows the analysis of immune system of porcine reproductive and respiratory syndrome virus antigen by Bio-Rad Image software.

Results of IL-4, IL_10, IL-2 and IFN-γ expression in C57BL / 6 mice

Fig. 19 is an electrophoresis diagram of MHC and costimulatory molecules expressed by BABL / c mice immunized with 146S antigen Fig. 20 is a result of analysis of MHC and costimulatory molecules expression of C57BL / 6 mice immunized with 146S antigen by Bio-Rad Image software

Figure 21 shows the analysis of the immune response of porcine reproductive and respiratory syndrome virus antigen by Bio-Rad Image software.

Results of expression of costimulatory molecules in BABL / c mice

Figure 22 shows the results of analysis of MH (:) and co-stimulatory molecules in C57BL / 6 mice immunized with PRSV antigen by Bio-Rad Image software.

Figure 23 shows the analysis results of SOCS1 and SOCS3 expressions of BABL / c mice immunized with 146S antigen by Bio-Rad Image software.

Figure 24 shows the results of analyzing the expression of SOCS1 and SOCS3 of C57BL / 6 mice immunized with 146S antigen by Bio-Rad Image software.

Figure 25 shows the analysis results of SOCS1 and SOCS3 expressions of BABL / c mice immunized with porcine reproductive and respiratory syndrome virus antigen by Bio-Rad Image software.

Figure 26 shows the analysis of the immune system of porcine reproductive and respiratory syndrome virus antigen by Bio-Rad Image software.

Results of SOCS1 and SOCS3 expression in C57BL / 6 mice

Figure 27 shows the results of T cell proliferation of BABL / C mice immunized with chicken Newcastle disease virus antigen.

The best way to implement the invention

Unless otherwise specified, the experimental methods mentioned in the following examples are conventional methods; the percentages mentioned are mass percentages unless otherwise specified.

Example 1. Preparation of Foot-and-Mouth Disease (FMDV) VP1 protein vaccine

I. Cloning of Foot and Mouth Disease VP1 cDNA

Oral diseased tissue infected with foot-and-mouth disease virus, using RNA extraction kit (purchased from Shanghai Biological Engineering Co., Ltd.) to extract total RNA of the virus using guanidine isothiocyanate one-step method according to the instructions of the kit, specific steps As follows: Take the diseased tissue to disrupt and separate the cells, add 0.5mL guanidine isothiocyanate solution, 0.5mL phenol / chloroform / isoamyl alcohol (25: 24: 1) solution, and centrifuge at 4V 12000rpm for 5 minutes, and transfer the supernatant to In a new 1.5 ml plastic centrifuge tube, add the same amount of isopropanol, leave it at -20 ° C for 30 minutes, centrifuge at 12000rpm for 10 minutes, discard the supernatant, wash the precipitate with 70% ethanol, and dissolve the precipitate in 30u after drying. LDEPC-treated water showed that viral RNA was obtained by denaturing agarose gel electrophoresis.

The first-strand cDNA was synthesized under the following reaction conditions: 2 μg RNA of Foot and Mouth Disease Virus, 50 mmol / L Tris-HCl (pH8.3), 75 μl / LKCl, 10 mmol / L DTT, 3 mmol / L MgCl ₂ , 500 μ mol / L dNTPs, 100 μg random hexamer primer, 500 units of LV reverse transcriptase, total volume 20 L, incubated at 37 ° C for 1 h. Using the first-strand cDNA product as a template, primer 1: 5 '-AAG_

AATTCGGAGGTACCACCTCTGCGGGTGAG-3 '; and primer 2:

5. -AATCTAGACCTCCGGAACCCAGAAGCTGTTTTGCGGG-3 ', (introduced EcoRl recognition site and ¾ l recognition site, respectively, under primer 1 and primer 2, PCR amplification of bovine foot-and-mouth disease virus VP1 cDNAo reaction system: 5 μL first-strand cDNA The product, the primer 1 and primer 2 are each lOpmol, 500mM KCl, lOOmM Tris- HCl (pH8.4), 1.5mM MgCl 2, 100 μ g / mL BSA, ImM dNTPs, 2.5U Taq DNA polymerase in a total volume of 50 L . The reaction conditions were: 94Ό denaturation for 30 seconds, 54 ° C renaturation. 30 seconds, 72 ° C extension for 1 minute, a total of 30 cycles. The results of the 1% agarose gel electrophoresis of the FMDV VP1 gene amplified by PCR are shown in Figure 1 (lane M is the DNA Marker; lane 1 is the PCR product). The position of the target band indicated by the arrow in the figure indicates the purpose The size of the fragment was 639bp, which was consistent with the size of the VP1 gene fragment. The amplified fragment was recovered using a low melting point gel.

Construction and identification of the expression vector SuperY / VPl

Foot-and-mouth disease VP1 cDNA fragment obtained by restriction enzyme οΛΊ and ¾al digestion step 1 was electrophoresed and recovered. The VP1 gene fragment was cloned into the shuttle plasmid SuperY (in the Sphl and HPal sites of plasmid pGAPZa purchased from Invitrogen, USA). Kanamycin resistance gene (Kan ^r ) was added to get the EcoRl and al restriction sites of SuperY, and then the recombinant vector was digested with EcoRl and ¾al restriction enzymes to identify the recombinant vector. % Agarose gel electrophoresis, the detection results are shown in Figure 2 (lane M is the DNA Marker; lane 1 is the digested product), where the small fragment size is 639bp, which is consistent with the VP1 gene fragment size, indicating that VP1 has been cloned to SuperY, and named the recombinant vector SuperY / VPl, then transformed SuperY / VPl into E. coli ToplO F 'competent cells, screened and identified positive clones, and sequenced the positive clones. The results showed that the nucleotides of the amplified products The sequence is consistent with the VP1 gene and has been successfully cloned into the SuperY plasmid.

3. Expression of VP1 gene in yeast and detection of its expression products

The recombinant expression vector SuperY / VPl constructed in step 2 was transformed into yeast SMD1168 by electric shock method, and positive clones were selected and identified. Single colonies were picked and cultured at 30 ° C for 48-96 hours (also set yeast SMD1168 and yeast SMD1168 transformed with SuperY). As a control), the supernatant was denatured and then subjected to SDS-PAGE After electrophoresis, staining with Coomassie Brilliant Blue G250 and photographing with a gel imaging system, the results are shown in Figure 3 (Lane 1: Yeast SMD1168 supernatant; Lane 2: SuperY transformed yeast SMD1168 expression supernatant; Lane 3: Transformation SuperY / VPl yeast SMD1168 expression supernatant; lane M: low molecular weight protein standard), lane 3 shows that there are two VP1 expression products with molecular weights of 66kD and 43kD, indicating that the VP1 gene in SuperY / VPl is in yeast cells Get expression. Western blotting analysis was performed on the expression product of the recombinant expression vector SuperY / VP1. The specific method is as follows: After the expressed protein is denatured, the protein is separated by SDS-PAGE, and then it is electrically transferred to the NC membrane. Blocking agent, followed by incubation with bovine anti-foot-and-mouth disease virus high immunity serum (purchased from Xinjiang Construction Corps Veterinary Station), sheep anti-bovine IgG-HRP enzyme-labeled antibody (purchased by Sigma, USA), and finally under DAB / H ₂ 0 ₂ The results are shown in Figure 4. (Lane M: low molecular weight protein standard; Lane 1: SuperY / VPl transformed yeast SMD1168 expression supernatant; Lane 3: yeast SMD1168 supernatant; Lane 4: SuperY transformed yeast SMD1168 Expression supernatant), lane 1 showed specific color bands near 66kD and 43kD, but no bands appeared in lanes 2 and 3, indicating that the expressed protein can react with anti-FMDV serum to generate specific reaction bands. The protein product has the immunogenicity of FMDV. The expressed supernatant was desalted and stored at 20 ° C, which can be used as a vaccine for foot-and-mouth disease VP1 protein.

Example 2.An animal immunity experiment

Antigen and adjuvant preparation:

1. Preparation of 146S antigen: Removal of mineral oil from inactivated cattle foot-and-mouth disease type 0 vaccine (purchased from Lanzhou Veterinary Research Institute), stored at 4 ° C.

2. Preparation of Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) Antigen: Remove the mineral oil from the inactivated reproductive and respiratory syndrome virus vaccine purchased from Harbin Veterinary Research Institute and store at 4 ° C.

3. Inactivated Lasota Newcastle disease virus antigen was purchased from Beijing Biological Products Factory and stored at 4 ° C.

4. VP1 protein: The purified VP1 protein is dissolved in 0.9% physiological saline and stored at 4 ° C.

5. Inactivated avian influenza virus H5N1 vaccine (purchased from Harbin Veterinary Research Institute) Remove the emulsion and store at 4 ° C.

6. White oil for injection was purchased from Hangzhou Refinery of Sinopec Group.

7. Saponin was purchased from Sigma, USA.

8. L-imidazole derivative, levamisole hydrochloride, or levamisole phosphate (Nanjing Baijingyi Pharmaceutical Factory). The above antigens were quantified by Bradford method.

9 ° /。 When used, the above antigen and the adjuvant of the present invention are soluble in 0.9 ° /. NaCl in water (saline).

I. Immune experiments in mice

1.Determination of anti-foot-and-mouth disease antibodies in mice

5% 盐 The levamisole hydrochloride was dissolved in a 0.9% NaCl solution, configured as an adjuvant with the following concentration: 0.5% salt Levamisole acid, 1% levamisole hydrochloride, 1% white oil for injection + 1% levamisole hydrochloride, 5% white oil for injection + 1% levamisole hydrochloride, 1% glycerol + 1% levamisole hydrochloride, 5% glycerol + 1% levamisole hydrochloride, 0.5% oleic acid + 1% levamisole hydrochloride, 0.5% bisoctadecyldimethylammonium bromide + 1% levamisole hydrochloride, 1% bisoctadecyldimethylammonium bromide + 1% levamisole hydrochloride, 0.5% saponin + 1% levamisole hydrochloride, 1% saponin + 1% levamisole hydrochloride. 6-8 week-old female BALB / c (H- 2 ^d ) female mice (14 groups, 6 in each group, including blank control group and negative control group), the negative control group was intramuscularly injected with 1% white oil for injection and 100 microliters of a composition containing 20 micrograms of 146S antigen, blank control group was injected with 100 microliters of 0.9% NaCl solution, and the remaining 12 groups were intramuscularly injected with 100 microliters of a composition containing 20 micrograms of 146S antigen and the different adjuvants, for the first time On the 14th day after immunization, boost the immunization once again with the same dose, and on the 14, 28, 56 and 80 days after the second immunization, take the serum and measure its antibody titer by ELISA. The detection method is: 96-well microtiter plate Coat with 8ug / ml antigen, overnight at 4 ° C, block with 3% calf serum at 37 ° C for 1 h; wash with PBST (0.05% Tween20 in PBS) 3 times for 5 minutes each time; add not less than 1: 100 Diluted serum from immunized animals (mouse), use unimmunized mouse serum as a control, and incubate at 37 ° C for 2 hours. After washing the plate three times with PBST, horseradish peroxidase-labeled goat anti-mouse IgG ( Secondary antibody, Sigma, St. Louis) 100 μl, 37 ° C, discarded after 1 hour incubation, washed 3 times with PBST, 5 minutes each time; washed 3 times with PBST Then, 100 μ1 of TMB substrate was added, and the reaction was developed at room temperature for 30 minutes. The reaction was stopped by 2M sulfuric acid, and 0D _{45 was} measured with a microplate reader. _{/ 62} . The optical density value is considered positive when the 0D value of the experimental well reaches twice the 0D value of the control well. The results are shown in Table 1:

Aging changes in anti-foot and mouth disease antibody titers

Immune adjuvant group 14 days 28 days 56 days 80 days Not immunized 0 0 0 0

1% white oil for injection 2000 4000 8000 4000

0.5% levamisole hydrochloride 4000 4000 8000 4000

1% levamisole hydrochloride 4000 4000 8000 8000

1% white oil for injection + 1% levamisole hydrochloride 4000 4000 8000 8000

5% white oil for injection + 1% levamisole hydrochloride 4000 4000 8000 16000

1% glycerol + 1% levamisole hydrochloride 4000 4000 8000 8000

5% glycerol + 1% levamisole hydrochloride 4000 4000 16000 16000

0.5% oleic acid + 1% levamisole hydrochloride 4000 4000 8000 8000

0.5% dioctadecyldimethylammonium bromide + 1% levamisole hydrochloride 4000 8000 32000 16000

1% bisoctadecyl dimethyl bromide + 1% levamisole hydrochloride 4000 8000 32000 32000

0.5% saponin + 1% levamisole hydrochloride 4000 8000 16000 16000 1% saponin + 1% levamisole hydrochloride 4000 8000 32000 16000 Table 1 shows that the use of levamisole hydrochloride, levamisole hydrochloride + white oil for injection, levamisole hydrochloride + glycerol, levamisole hydrochloride + dioctadecyl dimethyl Ammonium bromide, levamisole hydrochloride + saponin are adjuvants. Compared with the traditional mineral oil adjuvant (white oil for injection), the antibody titer is significantly improved in time, and the antibody titer appears earlier.

2.Comparison the changes of antibody titers in mice immunized with SuperY / VPl recombinant plasmid expression product VP1 antigen and immune composition composed of different adjuvants

Twenty-four 6-8 week-old BALB / c (H-2 ^d ) female mice were divided into two groups. One group was intramuscularly injected with 1% levamisole hydrochloride and the VP1 protein (20 micrograms) of foot-and-mouth disease obtained in Example 1. The composition was 100 microliters, and another group was intramuscularly injected with 100 microliters of a composition containing 1% white oil for injection and 20 micrograms of foot-and-mouth disease VP1 protein for immunization, and the immunization was boosted again at the same dose on the 14th day after the first immunization. Serum was taken at 14, 28, 42 and 56 days after the second immunization to determine the antibody titer by ELISA. The detection method is the same as that in step 1. The results are shown in Figure 5 (◊: Foot-and-mouth disease VP1 protein + 1% White oil for injection, 〇: VP1 protein + 1% levamisole hydrochloride), indicating that levamisole hydrochloride or a combination vaccine of oil adjuvant and VP1 protein can stimulate the production of specific antibodies, but vaccine antibodies using levamisole hydrochloride as an adjuvant The titer is high.

3.Compare the effects of 146S antigen of foot-and-mouth disease with different adjuvants on the specific expansion of T cells in mice immunized

60 6-8 week-old BALB / c (H-2d) female mice were divided into two groups. The first group was intramuscularly injected with 100 microliters of a vaccine composition containing 50% white oil for injection and 20 micrograms of 146S antigen. Two groups were intramuscularly injected with 100 microliters of a composition containing 20 micrograms of antigen 146S and 1% levamisole hydrochloride. On the 14th day after the first immunization, boost the immunization again at the same dose, and take the spleen T cells on the 14th day after the second immunization to determine its T cell expansion activity. The specific method is: under sterile conditions, take the spleen Make a single cell suspension, remove the red blood cells with red blood cell lysate, then wash three times with PBS solution, centrifuge and count the cells, adjust the cell concentration to 1 X 10 ⁶ cells / ml, and add 96 cells of each group in three portions. Well plate. One of them added 100 μl concanavalin (Con-A) to a final concentration of 5 g / ml, one added the corresponding specific antigen (146S antigen) as a stimulant to a final concentration of 2 g / ml, and the other did not Add the stimulus. After 24 hours, add 100μΙ MTTT to each well to a final concentration of 5mg / ml. After 48h, add 100μΙ SDS-DMSO (20% SDS dissolved in 50% DMS0, pH2.0) to each well to completely dissolve. After 4h incubation, read the 0D value at 570nm on a microplate reader and calculate the stimulus index (SI = number of experimental stimuli _÷ number of non-stimulus). The results are shown in Figure 6, which shows that the use of levamisole hydrochloride as an adjuvant for inactivated foot-and-mouth disease virus vaccines has significantly improved T cell expansion activity compared to its oil-adjuvant inactivated vaccines compared to its corresponding oil-adjuvant vaccines. In FIG. 6, ConA represents a positive control.

4.Comparison of the effects of antibodies produced by immunized mice after the immune composition of porcine reproductive and respiratory syndrome virus antigens and different adjuvants Sixty 6-8 week old BALB / c (H-2 ^ female mice were divided into five groups. Each group was injected with 20 micrograms of porcine reproductive and respiratory syndrome virus (PRRSV) antigen and the following adjuvant. 100 microliters of a composition for immunization, the adjuvant is: 50% white oil for injection, 0.5% levamisole hydrochloride, 1% levamisole hydrochloride, 2% levamisole hydrochloride or 1% levamisole hydrochloride + 0.5% glycerol On the 14th day after the first immunization, boost the immunization with the same dose again, and on the 28th, 42nd, 56th, 63rd, 77th, and 84th days after the second immunization, take the serum and measure its antibody titer by ELISA. The result is the same as that in step 1. As shown in FIG. 7, it is shown that using different concentrations of levamisole hydrochloride and levamisole hydrochloride + glycerol as adjuvants, the antibody titer is significantly improved in time compared with the traditional white oil adjuvant for injection.

5.Comparison of the effects of specific expansion of T cells in immunized mice after the immune composition of porcine reproductive and respiratory syndrome virus antigens and different adjuvants was formed

72 6-8 week-old BALB / c (H-2d) female mice were divided into seven groups, and intramuscularly injected with 20 micrograms of reproductive and respiratory syndrome virus (PRRSV) antigen and one of the following adjuvants. 100 microliters of the composition, the adjuvant is: no adjuvant, 50% white oil for injection, 0.25% levamisole hydrochloride, 0.5% levamisole hydrochloride, 1% levamisole hydrochloride, 2% levamisole hydrochloride, 1% hydrochloric acid Levamisole + 0.5% glycerol. On the 14th day after the first immunization, boost the immunization with the same dose again, and take the spleen τ cells on the 14th day after the second immunization to determine its T cell expansion activity. The specific method is to exclude the stimulant for porcine reproductive and respiratory syndrome Except for the viral antigen, the other steps are the same as in step 3. The results are shown in Figure 8. It shows that T-cell expansion is compared with the traditional white oil adjuvant for injection with different concentrations of levamisole hydrochloride and levamisole hydrochloride + glycerol. The activity is significantly improved. In Figure 8, BSA indicates a negative stimulus control, none indicates no adjuvant, oil indicates 50% white oil for injection, and LMS indicates levamisole hydrochloride.

6. Compare the effect of delayed immune response in immunized mice after the immune composition of pig reproductive respiratory syndrome virus antigen and different adjuvants is formed

Sixty 6-8 week-old female BALB / c (H-2d) mice were divided into five groups. Each group was injected with 20 micrograms of porcine reproductive and respiratory syndrome virus (PRRSV) antigen and one of the following groups. 100 microliters of adjuvant composition was used for immunization, the adjuvant was: 50% white oil for injection, 0.5% levamisole hydrochloride, 1% levamisole hydrochloride, 2% levamisole hydrochloride, 1% levamisole hydrochloride + 0.5% glycerin. On the 14th day after the first immunization, booster immunization was performed at the same dose once again, and on the 7th day after the second immunization, 20 micrograms of porcine reproductive respiratory syndrome virus antigen was injected into the left foot of the mouse, and saline was injected into the right foot. The thickness of the sole was measured at 0, 24, 36 and 72 hours after the sole injection. The results are shown in Figure 9, which shows that different concentrations of levamisole hydrochloride, levamisole hydrochloride + glycerol are used as adjuvants, which are in phase with traditional mineral oil adjuvant The delayed immune response was comparable, but significantly higher than that of the saline injection control.

7.Detection of antibody titer, the effect of immune compositions with different adjuvants on the specific expansion of mouse T cells, and the expression of cytokines in immune mice

The experiments were divided into two groups: BALB / c mice (126) and C57BL / 6 mice (126). The mouse immune antigens were inactivated foot-and-mouth disease (FMD) virus antigen 146S and porcine reproductive and respiratory syndrome virus (PRRSV) antigens. Each large group was further divided into 1, 2, 3, 4, 5, 6, and 7 groups with seven treatment groups, with 18 mice in each group, of which 9 were immunized with 146S antigen and 9 were immunized with porcine reproductive and respiratory syndrome ( PRRS) virus antigen, 1 group was the control group, and only injected 100 microliters of 0.9% NaCl solution containing 20 micrograms of mouse immune antigen; 2 groups were injected with 20 micrograms of mouse immune antigen and 50% white oil composition for injection 100 microliters; three groups of intramuscular injections containing 20 micrograms of mouse immune antigen and 0.25% levamisole hydrochloride composition 100 microliters; four groups of intramuscular injections containing 20 micrograms of mouse immune antigen and 0.5% levamisole hydrochloride composition 100 microliters; 5 groups of intramuscular injections containing 20 micrograms of mouse immune antigen and 1% levamisole hydrochloride composition 100 microliters; 6 groups of intramuscular injections containing 20 micrograms of mouse immune antigen and 2% levamisole hydrochloride composition 100 microliters; The 7 groups were intramuscularly injected with 20 micrograms of mouse immune antigen and 100 microliters of a 1% levamisole hydrochloride + 1% glycerol composition. On the 14th day after the first immunization, boost the immunization with the same dose again, and take 3 mice from each group for the anti-foot-and-mouth disease antibody and porcine reproductive and respiratory syndrome inactivated virus antibody titer; The effects of the above composition on the specific expansion of T cells were measured in mice; the remaining 3 mice in each group were tested for the expression of cytokines, MHC, costimulatory molecules and SOCS by RT-PCR, as follows:

On the 28th, 42nd, 56th, 70th, and 84th days after the first immunization, the serum of 3 mice were taken from each group and the serum IgG levels were determined by ELISA. The detection method is the same as that in step 1, and the results are shown in Table 2. Shown-antibody titer results

Antibody titer

Vaccine mice group 28 days 42 days 56 days 70 days 84 days

146S BALB / C 1 8000 8000 4000 2000 400

2 16000 32000 16000 4000 800

3 4000 8000 4000 2000 400

4 8000 16000 8000 2000 400

5 16000 32000 16000 2000 800

6 32000 64000 * 4000 4000 1600

7 8000 2000 16000 8000 * 1600

146S C57BL / 6 1 4000 8000 2000 800 200

2 8000 16000 16000 1600 800

3 4000 8000 4000 800 200

4 4000 8000 4000 800 200

5 16000 16000 8000 1600 400

6 16000 32000 * 8000 1600 800

7 8000 16000 8000 3200 * 800

PRRS BALB / C 1 4000 8000 4000 1000 400

2 8000 16000 8000 4000 800 3 4000 8000 4000 2000 400

4 8000 16000 8000 2000 400

5 8000 16000 16000 4000 400

6 16000 32000 * 16000 4000 800

7 8000 16000 16000 8000 * 16000

PRRS C57BL / 6 1 2000 4000 2000 400 100

2 4000 8000 8000 1600 800

3 2000 4000 2000 400 100

4 4000 8000 2000 400 200

5 4000 8000 4000 800 400

6 8000 16000 * 4000 1600 800

7 4000 8000 8000 3200 * 1600

* In the table means p <0.05.

Table 2 shows that the antibody titers of the 2% levamisole hydrochloride group and the 1% levamisole hydrochloride + 1% glycerol composition group were significantly higher than those of the white oil adjuvant group for injection, while the 1% levamisole hydrochloride + 1% glycerol composition Group antibodies extended the longest. The antibody titers of the other concentrations of the levamisole hydrochloride group were comparable to those of the white oil injection group adjuvant group.

On the 7th day after the booster immunization, 3 mice immunized with 146S antigen and 3 immunized with PRRS virus antigen were taken from each group, and the spleen T cells were measured for T cell expansion activity. The stimulus was the same as that in step 3 except Porcine Reproductive and Respiratory Syndrome Virus or 6S antigen. The results are shown in Figures 10-13, indicating that different concentrations of levamisole hydrochloride as an adjuvant group and traditional white oil for injection Compared with the adjuvant group, the T cell expansion activity was significantly improved. * In Figs. 10-13 indicates that p <0.05.

On the seventh day after the second immunization, the spleen was collected, and total RNA (TRIZ0L, Dingguo Biological Co., Ltd.) was extracted and reverse-transcribed into cDNA. Reverse transcription was performed according to the Dalian RT-PCR RNA RT-PCR operating guide. Purified 1μ _§ Total RNA was placed in a 250μί centrifuge tube, and related reagents were added in this order: 4μ1 MgCl ₂ , 2μ1 10X buffer, 8.5μ1 DEPC water, 2μ1 dNTP mixture, 0.5μ1 RNase inhibitor, 0.5μ1 M-MLV reverse transcriptase (Promage), 0.5 μΐ Oligo (dT) _ι2 primer; reaction conditions were 42 ° C 30 min, 99 ° C 5 min, 5 ° C 5 min. Using the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT) as the endogenous expression standard, adjust the cDNA concentration in each group to be consistent, as shown in Figure 14 (lanes 1-7 are 1-7 treatment groups), and then Take 2μ1 of cDNA for PCR amplification of the following four cytokine genes: IL-2 gene, IFN-γ gene, IL-4 gene and IL-10 gene. The primers required for the reaction and the PCR reaction conditions are shown in Table 3. (Because the housekeeping gene HPRT is constantly expressed in vivo, it is used as a template control for endogenous expression standards) Table 3. Primer sequences and PCR reaction parameters of HPRT, IL-2, IFN-γ, IL-4 and IL-10

Target gene primer reaction conditions HPRT 5 'GTTGGATACAGGCCAGACTTTGTTG 94 ° C 30 sec, 60 ° C 30 sec and

3 'GAGGGTAGGCTGGCCTATGGCT 72 ° C 40 sec

IL-2 5 'TCCACTTCAAGCTCTACAG 94 ° C 30 sec, 55 ° C 30 sec and

3 'GAGTCAAATCCAGAACATGCC 72 ° C 40 sec

IFN-γ 5 'CATTGAAAGCCTAGAAAGTCTG 94 ° C 30 sec, 58. C 30 sec and

3 'CTCATGGAATGCATCCTTTTTCG 72 ° C 40 sec

IL-4 5 'GAAAGAGACCTTGACACAGCTG 94 ° C 30 sec, 54. C 30 sec and

3 'GAACTCTTGCAGGTAATCCAGG 72 ° C 40 sec

IL-10 5 'CCAGTTTTACCTGGTAGAAGTGATG 94 ° C 30 sec, 56 ° C 30 sec and

₃ , TGTCTAGGTCCTGGAGTCCAGCAGACTCAA 72 ° C 40 sec

The results of electrophoresis detection of the PCR products are shown in Figure 15 (lanes 1-7 are 1-7 treatment groups). The electrophoresis images were analyzed and mapped with Bio-Rad Image software (Quantity One 4.2.0), and the results are shown in Figure 16. -Figure 18 shows that 0.5% or 0.25% levamisole hydrochloride adjuvant group can produce high levels of IL-2 and IFN-γ (Th1 type immune response) after immunization, while low levels of IL-4 (Th2 type immune response) and IL-10 (immunosuppressive factor). In contrast, the 2% levamisole hydrochloride adjuvant group produced high levels of IL-4 and IL-10 after immunization, but low levels of IL-2 and IFN- _Y . The adjuvant group in the white oil injection group produced low levels of Thl and Th2 cytokines. However, high levels of IL-10 were produced. This shows that the injection of the white oil group adjuvant group not only failed to activate T cells, but also produced IL-10 that inhibited T cell levels.

The 2 μ 1 cDNA synthesized in the previous paragraph was used as a template for PCR amplification of the MHCI, MHCII, CD40, CD80, CD86, SOCS1 and SOCS3 genes. The primer sequences and PCR reaction conditions are shown in Table 4. The electrophoretic detection results are shown in Figure 19 (lanes 1-7 are 1-7 treatment groups, respectively). The electrophoresis images were analyzed with Bio-Rad Image software (Quantity One 4. 2. 0) Analysis and mapping. The results are shown in Figs. 19-26, which show that the immunization with levamisole hydrochloride adjuvant group can produce high levels of MHC-I and MHC-II. In contrast, MHC-1 and MHC-II expression were lowest in the adjuvant group of the white oil group for injection. Because MHC molecules play an important role in the activation of immune T cells, the white oil group adjuvant also fails to play a role in this process. Another class of co-stimulatory molecules, CD40, CD80, and CD86, produced high levels of expression after immunization with the 0.5% levamisole hydrochloride composition group, indicating that 0.5% levamisole hydrochloride has a better effect in enhancing T cell immunity. . The white oil group had the worst adjuvant group. Since both SOCS1 and SOCS3 are T-cell immunosuppressive molecules, it was proved in experiments that the white oil group adjuvant group produced high levels of SOCS1 and SOCS3 expression after immunization, further illustrating that the white oil group adjuvant inhibited T cell activation.

Table 4 Primer sequences and PCR reaction parameters of MHC, costimulatory molecules and SOCS Gene Length Purpose * Primer PCR Reaction Parameters

(bp)

5 'TGGAACGGCAGACCTAGACT 3' 94 ° C 40 sec, 60 ° C 30 sec

MHCI GCTGAAGACTGACCTCAGGG and 72 ° C 40 sec 402

5 'AACAAGGAGAAGACGGCTCA

94 ° C 40 sec, 60 ° C 30 sec

MHCI I

and 72 ° C 40 sec 319 3 'CGGGTTCTGCTCTAATGC

5 'ACTCAGGCGAATTCTCAGC

94 ° C 40 sec, 60 ° C 30 sec

CD40

and 72 ° C 40 sec 252 3 'CCAGGGATGACAGACGGTA

5 'AGTGGCTTTTGCTCTTTGGA 3' 94 ° C 40 sec, 60. C 30 sec

CD80

GATTCTGGTCCCGTTGAGAA and 72 ° C 40 sec 362

CD86 5 'GTCTGGAGAATGCTGTGCAA 3' 94 ° C 40 sec, 60 ° C 30 sec

GCTCAGACCTGCCAAAGTTC and 72 ° C 40 sec 467

5 'GAGCCCTCCTCGTCCTCGTCT

94 ° C 40 sec, 64 ° C 30

S0CS 1

3 'GATGCGCTGGCGACACAG sec and 72 ° C 40 sec 480

5 'GCGCCACTTCTTCACGTTG

94 ° C 40 sec, 59 ° C 30

S0CS3

3 'TGATCCAGGAACTCCCCAATG sec and 72 ° C 40 sec 432 2. Detection of anti-foot and mouth disease antibodies in cattle

The 6-month-old bulls were divided into five groups, two in each group. The first group was a control group without any injection. The second group was injected with a composition containing 50 micrograms of 146S antigen and 50% white oil for injection. 100 microliters; the third group was intramuscularly injected with 100 microliters of a composition containing 50 micrograms of 146S antigen and 5% levamisole; the fourth group was intramuscularly injected with 100 microliters of a composition containing 50 micrograms of VP1 protein and 50% white oil for injection; The fifth group was intramuscularly injected with 100 microliters of a composition containing 50 micrograms of VP1 protein and 5% levamisole. On the 14th day, the immunization was boosted again at the same dose. On the 14th day after the second immunization, the serum was taken to determine the antibody titer. The results are shown in Table 5:

Bovine anti-foot-and-mouth disease antibody titer

Table 5 shows that the use of levamisole as an adjuvant for cattle anti-foot-and-mouth disease vaccine has significantly improved antibody titer compared to traditional mineral oil as an adjuvant.

Third, chicken immune experiments

In the following steps, the Lasota Newcastle disease virus antigen purchased from Beijing Biological Products Factory was inactivated by formaldehyde as the Lasota Newcastle disease virus antigen for immunization. 1. Aging test of chicken anti-Newcastle disease antibody:

The SPF chickens were divided into six groups, six in each group. The first group was a blank control group, which was injected with 100 microliters of a 0.9% NaCl aqueous solution. The second group was intramuscularly injected with 20 micrograms of Lasota Newcastle disease virus antigen. 100 microliters of a composition of levamisole hydrochloride and 0.1% bisoctadecyldimethylammonium bromide; the third group was intramuscularly injected with 20 micrograms of Lasota Newcastle disease virus antigen, 2% levamisole hydrochloride and 0.5 100 microliters of a composition of bisoctadecyldimethylammonium bromide; the fourth group was injected intramuscularly with 20 micrograms of Lasota Newcastle disease virus antigen, 2% levamisole hydrochloride and 1% bisoctadecyldimethyl bromide 100 microliters of ammonium chloride composition; 100 microliters of a composition containing 20 micrograms of Lasota Newcastle disease virus antigen, 2% levamisole hydrochloride, and 2% saponin in the fifth group; intramuscular injection of chickens against Newcastle disease in the sixth group Commercial seedlings of white oil adjuvant for injection (containing 50% white oil for injection, purchased by Beijing Biological Products Factory) 100 μl. On the 14th day, boost the immunization with the same dose again, and take the serum on the 14th day after the second immunization to determine the antibody hemagglutination value. The results are shown in Table 6: Chicken anti-Newcastle disease antibody titer

Table 6 shows that compared with traditional mineral oil adjuvants, levamisole hydrochloride, levamisole hydrochloride + dioctadecyldimethylammonium bromide, levamisole hydrochloride + saponin were used as adjuvants for chicken against Newcastle disease vaccine Antibody titers were similar.

Among them, the chicken antibody hemagglutination inhibition titer (HI) detection method is as follows: In the two rows of wells on the microaggregation plate, from the 1st to 12th or according to the number of antiserum titers, each well is added to 0. 025ml physiological saline; unknown sera 0.025ml were added to the first row and the first well, respectively, and diluted to the last well in order, each well was filled with a known virus solution containing 4 agglutination units. Add 0. 025ml of PBS to the first well in the second row, and then dilute to the last well in multiples, and add a known virus solution containing 4 agglutination units to each well. After shaking and mixing, 30 minutes at room temperature, it can be suppressed by unknown serum, and it is judged as the HI titer in serum.

2.Aging of chicken anti-Newcastle disease antibodies

The SPF chickens were divided into six groups, six in each group. The first group was a negative control group and was injected only with 100 microliters of a 0.9% NaCl aqueous solution. The second group was intramuscularly injected with an aqueous solution containing 20 micrograms of Lasota Newcastle disease virus antigen. 100 μl; the third group was injected intramuscularly with 20 μg Lasota Newcastle disease virus antigen and 2% levami microphone 100 μl of the immune composition of azole; fourth group of 100 μl of the immune composition containing 20 micrograms of Lasota Newcastle disease virus antigen and 4% levamisole; intramuscular injection of chicken against Newcastle white oil Commercial vaccine (containing 50% white oil for injection, purchased by Beijing Biological Products Factory) 100 microliters, intramuscular injection 4 ° / in the sixth group. 100 microliters of levamisole. On the 14th day, the immunization was boosted again with the same dose, and the serum was taken to determine the antibody hemagglutination value on the 28th and 60th days after the second immunization. The results are shown in Table 7:

Aging test results of chicken anti-Newcastle disease antibodies

Table 7 shows that the use of levamisole as an adjuvant for chicken anti-Newcastle disease vaccine, compared with the traditional mineral oil adjuvant, the antibody titer does not decrease significantly in time.

3. Detection of T cells after chicken Newcastle disease immunization

The SPF chickens were divided into six groups of six animals. The first group was injected intramuscularly with 20 micrograms of Lasota Newcastle disease virus antigen, 2% levamisole hydrochloride, and 0.5% bisoctadecyldimethylammonium bromide. 100 microliters of the composition; the second group was intramuscularly injected with 20 micrograms of Lasota Newcastle disease virus antigen, 100 microliters of the composition with 2% levamisole hydrochloride and 2% saponin; the third group was intramuscularly injected with 20 micrograms of Lasota Newcastle disease virus antigen The fourth group was intramuscularly injected with 100% of a composition containing 2% levamisole hydrochloride and 0.5% bisoctadecyldimethylammonium bromide; the fifth group was intramuscularly injected with 2% levamisole hydrochloride and 2% soap 100 microliters of the composition; the sixth group was intramuscularly injected chicken with Newcastle disease-resistant white oil adjuvant commercial vaccine (containing 50% white oil for injection, purchased from Beijing Biological Products Factory) 100 microliters. On the 14th day after the first immunization, boost the immunization again at the same dose, and take the spleen T cells on the 14th day after the second immunization to determine its T cell expansion activity. The specific method is: under sterile conditions, take the spleen Make a single cell suspension, remove the red blood cells with red blood cell lysate, then wash three times with PBS solution, centrifuge and count the cells, adjust the cell concentration to IX 10 ⁶ cells / ml, and add the cell suspension of each group into 4 wells into 96 wells In a culture plate. Wherein a ΙΟΟμΙ Con A was added to a final concentration of 5μ β _/ ιτι1, corresponding to a specific antigen was added (inactivated virus antigen of Lasota) as a stimulus to a final concentration of 2 g / ml, lOO l BSA was added to a The final concentration was 2 g / ml as the irrelevant antigen, and another portion was added without stimulus. After 24 hours, 100 μl of MTT was added to a final concentration of 5 mg / ml. After 48 h, 100 μl of SDS-DMS0 (20% SDS) was added to each well. Dissolved in 50% DMSO, pH 2.0) to completely dissolve. After 4h incubation, read the 0D value at 570nm on a microplate reader to calculate the stimulus index SI. The results are shown in Figure 27. It was shown that a combination of 2% levamisole hydrochloride and 0.5% bisoctadecyldimethylammonium bromide or 2% levamisole hydrochloride and 2% saponin was used as an adjuvant to the Lasota inactivated virus vaccine, corresponding to Compared with the oil adjuvant vaccine, the T cell expansion activity was significantly improved compared to its oil adjuvant inactivated vaccine. In Figure 27, the ordinate is the SI stimulation index. On the horizontal axis, 1 indicates that the ConA stimulation group is a positive control; 2 indicates the T cell expansion activity of the first group after immunization; 3 indicates the T cell expansion activity of the second group after immunization. 4 indicates the T cell expansion activity after the third group of immunization; 5 indicates the T cell expansion activity after the fourth group of immunization; 6 indicates the T cell expansion activity after the fifth group of immunization; 7 indicates the sixth group after immunization T cell expansion activity.

4. Chicken Newcastle disease attack protection experiment

The SPF chickens were divided into six groups of four, the first group was a negative control group, and only 100 microliters of 0.9% NaCl aqueous solution was injected; the second group was intramuscularly injected with 20 micrograms of Lasota Newcastle disease virus antigen and 1 100 microliters of immune composition of levamisole levamisole; 100 microliters of immune composition of 20 micrograms of Lasota Newcastle disease virus antigen and 2% levamisole phosphate intramuscularly in the third group; 20 micrograms of Lasota Newtown intramuscular injection 100 microliters of immune composition of epidemic virus antigen and 4% levamisole phosphate; fifth group of intramuscularly injected chicken vaccines against Newcastle disease white oil adjuvant (containing 50% white oil for injection, purchased by Beijing Biological Products Factory) 100 In the sixth group, 100 microliters of 4% levamisole phosphate was injected intramuscularly. On the 14th day, the immunization was boosted once again with the same dose. On the 14th day after the second immunization, the serum was taken to determine the antibody hemagglutination value and 1000 semi-lethal doses of Newcastle disease Lasota strain 0.2 ml (that is, diluted 2 X 10- ⁹ virus) The chickens were challenged. The statistical results after 7 days of challenge are shown in Table 8:

Table 8 Experimental results of chicken Newcastle disease attack and protection

Table 8 shows that the use of levamisole phosphate as an adjuvant against chickens against Newcastle disease vaccine has a higher protection rate than traditional mineral oil adjuvants, both of which are 100%, while white oil adjuvant commercial seedlings are only 50%. Among them, the protection rate = (number of survivals / total) x 100%.

5.Aging of chicken anti-avian influenza H5N1 antibody

The SPF chickens were divided into three groups of 6 each. The first group was a negative control group and was injected with only 100 microliters of normal saline. The second group was intramuscularly injected with an inactivated avian influenza virus H5N1 vaccine (containing 50% white for injection). oil, (Purchased from Harbin Veterinary Research Institute) 100 microliters; the third group was intramuscularly injected with 100 microliters of a composition containing 5 micrograms of the emulsion-inactivated avian influenza virus H5N1 vaccine and 5% levamisole hydrochloride. On the 21st day, the immunization was boosted again at the same dose. Serum was taken on day 7 after the first and second immunizations to determine the antibody titer. The results are shown in Table 9:

Table 9 Aging changes of anti-avian influenza H5N1 antibody titers

Serum IgG antibody (2 ⁿ )

Immune group

7 days after the first immunization 7 days after the second immunization Normal saline <1. 0 <1. 0 Avian influenza virus H5N1 mineral oil

13. 7 ± 1. 2 16. 0 ± 1. 0 commercial vaccine

Vaccine + 5% levamisole hydrochloride 16. 7 ± 0. 6 20. 3 ± 1. 2 Table 9 shows that the adjuvant titer of levamisole hydrochloride as avian influenza virus H5N1 vaccine is similar to that of the traditional mineral oil adjuvant. .

6.Avian influenza H5N1 attack protection experiment

After the bird flu virus H5N1 is inactivated by formaldehyde, it is divided into two parts. One is emulsified with 5% white oil for injection to make a traditional mineral oil vaccine. The other is mixed with 5% levamisole hydrochloride as an adjuvant. Into a vaccine. SPF chickens were divided into three groups (10 chickens per group). The first group was intramuscularly injected with 100 μl of the above-mentioned avian influenza virus H5N1 mineral oil vaccine; the second group was intramuscularly injected with 5 μg of inactivated avian influenza virus H5N1 antigen and 5 100 microliters of the composition of levamisole hydrochloride%; the third group was a control group, and 100 microliters of 5% levamisole hydrochloride was injected. After 70 days, virus 100-fold lethal dose of the avian influenza virus i.e. 0.1 ml 2 X 10- ⁹ chickens were diluted virus challenge, the results as shown in Table 10:

Table 10 Avian influenza H5N1 attack protection experiment results

Table 10 shows that the use of levamisole hydrochloride as an adjuvant for chicken anti-avian influenza H5N1 vaccine has a higher protection rate than the traditional mineral oil adjuvant.

Industrial applications

The immune adjuvant of the present invention can effectively improve the ability of protein vaccines, nucleic acid vaccines, peptide vaccines and inactivated vaccines to stimulate the body's complete immune response, enhance the immune effect of T cells of the body, and prolong the protection period; Simple does not require complicated equipment and operating steps, is easy to implement, has excellent application prospects in the medical field, and will produce huge social and economic benefits.

Claims

Rights request

1. An immune adjuvant, which is levamisole, or a derivative of levamisole, or a combination of levamisole or a levamisole derivative, and at least one of the following: white oil, glycerol, oleic acid, bis (18) Amido dimethyl ammonium bromide or saponin.

2. The immune adjuvant according to claim 1, wherein the immune adjuvant is levamisole or a levamisole derivative.

3. The immune adjuvant according to claim 1, wherein the immune adjuvant is a combination of levamisole or a levamisole derivative and white oil.

4. The immune adjuvant according to claim 1, wherein the immune adjuvant is a combination of levamisole or a levamisole derivative and glycerol.

5. The immune adjuvant according to claim 1, wherein the immune adjuvant is a combination of levamisole or a levamisole derivative and oleic acid.

6. The immune adjuvant according to claim 1, wherein the immune adjuvant is a combination of levamisole or a levamisole derivative and bisoctadecyldimethylammonium bromide.

7. The immune adjuvant according to claim 1, wherein the immune adjuvant is a combination of levamisole or a levamisole derivative and saponin.

8. The immune adjuvant according to any one of claims 1-7, wherein the levamisole derivative is levamisole hydrochloride or levamisole phosphate.

9. The immune adjuvant according to any one of claims 1 to 7, characterized in that the white oil is white oil for food or white oil for injection.

10. The immune adjuvant according to claim 3, wherein the mass ratio of the white oil to the levamisole or levamisole derivative is 20: 1 to 1:20.

11. The immune adjuvant according to claim 10, wherein the mass ratio of the white oil to levamisole or levamisole derivative is 10: 1 to 1: 1.

12. The immune adjuvant according to claim 4, characterized in that: the mass ratio of the glycerol to the levamisole or levamisole derivative is 5: 1 to 1: 5. '

13. The immune adjuvant according to claim 12, characterized in that: the mass ratio of the glycerol to the levamisole or levamisole derivative is 2: 1 to 1: 2.

14. The immune adjuvant according to claim 5, characterized in that: the mass ratio of the oleic acid to the levamisole or levamisole derivative is 5: 1 to 1: 5.

15. The immune adjuvant according to claim 14, characterized in that: the mass ratio of the oleic acid to the levamisole or levamisole derivative is 2: 1 to 1: 2.

16. The immune adjuvant according to claim 6, characterized in that: the mass ratio of the dioctadecyldimethylammonium bromide to the levamisole or levamisole derivative is 20: 1 to 1:20.

17. The immune adjuvant according to claim 16, characterized in that: the mass ratio of the bisoctadecyldimethylammonium bromide to the levamisole or levamisole derivative is 10: 1 to 1: 5.

18. The immune adjuvant according to claim 7, characterized in that: the mass ratio of the saponin to the levamisole or levamisole derivative is 20: 1 to 1:20.

19. The immune adjuvant according to claim 18, characterized in that the mass ratio of the saponin to the levamisole or levamisole derivative is 10: 1 to 1: 5.