WO2005078076A2

WO2005078076A2 - Tpl2 and its expression

Info

Publication number: WO2005078076A2
Application number: PCT/GB2005/000385
Authority: WO
Inventors: Steven Sedgwick; Marco Geymonat
Original assignee: Medical Research Council
Priority date: 2004-02-06
Filing date: 2005-02-04
Publication date: 2005-08-25
Also published as: WO2005078076A3; GB0402661D0

Abstract

The invention relates to the expression of the Tp12 (tumor progression locus 2) protein, homologues and derivatives thereof. The invention also relates to the expression of Tp12 as a dimer with p105.

Description

TPL2 AND ITS EXPRESSION

All documents cited herein are incorporated by reference in their entirety.

TECHNICAL FIELD

This invention is in the field of the recombinant expression of Tpl2 protein. BACKGROUND ART

Tpl2 (tumor progression locus 2) protein is a serine/threonine kinase that is a member of the MAP kinase kinase kinase (MAP3K) family. It is also known as 'Cot' (cancer Osaka thyroid), 'MAP3 8' (mitogen-activated protein kinase kinase kinase 8) or ΕST' (Ewing sarcoma transformant), and it regulates oncogenic and inflammatory pathways. Tpl2 forms complexes with NF-κBl pi 05 and promotes cellular proliferation when over-expressed in a variety of tumour cell lines [refs. 1-10].

Recombinant expression of Tpl2 protein has proved to be difficult using known systems, and there is thus a need for an expression system which can provide useful Tpl2 protein. It is an object of the invention to provide an improved expression system to address this need, and to provide Tpl2 protein in a form that is useful for protein investigation.

DISCLOSURE OF THE INVENTION

The inventors have expressed Tpl2 in a yeast system that uses the MOBl gene as a selection marker. Mobl is a yeast protein whose expression is absolutely required for completion of mitosis and maintenance of ploidy in yeast [11]. Expression plasmids include a Tpl2 gene and MOBl, and these plasmids are expressed in cells that do not have a functional chromosomal copy of MOBl. As MOBl is expressed from the plasmid rather than from a chromosomal gene, and as loss of MOBl is unconditionally lethal, selection pressure for cells which contain the plasmid is absolute i.e. the cells which survive must contain the plasmid, with both the essential gene and the heterologous gene.

The use of an essential gene in yeast makes the system inherently stable and so is preferable to the use of a resistance gene for several reasons. By avoiding auxotrophic hosts and their metabolic selection markers, cells can be grown in rich media rather than in minimal media, thereby giving much better growth rates. There is also no risk of the final product being contaminated by the resistance molecule e.g. anti-fungal contamination, and there is no need for expensive anti-fungals.

Tpl2 expression methods

The invention provides a method of purifying Tpl2 protein, comprising the steps of: (a) culturing Saccharomyces cerevisiae cells, wherein: the cells express chromosomal genes and extra-chromosomal genes; the expressed extra-chromosomal genes include (i) a gene encoding a Tρl2 protein and (ii) a MOBl gene; and the expressed chromosomal genes do not include MOBl, and (b) purifying Tpl2 protein expressed by the cells. It is preferred that the Tpl2-encoding gene is under the control of an inducible promoter. The method may then include an initial step of culturing the cells such that the Tpl2-encoding gene is not expressed, followed by a step of activating the inducible promoter such that the Tpl2-encoding gene is expressed by the cell. The Tpl2 protein will generally have been expressed intracellularly. Purification in step (b) will thus involve an initial step of cell lysis, followed by purification of Tpl2 protein from the cellular lysate. The Tpl2 protein will usually be in the soluble part of the lysate.

The invention also provides a yeast plasmid, comprising: (a) a MOBl gene; (b) a TRP1 gene to allow selection of Trp-auxotrophic yeasts that include the plasmid; and (c) a gene encoding a Tpl2 protein. The yeast plasmid can direct expression of the Tpl2 protein by the method of the invention.

The invention also provides a yeast containing a plasmid of the invention. It also provides a yeast that expresses a plasmid-encoded Tpl2 protein in a soluble form.

Coexpresslon ofTpl2

According to this method, Tpl2 may be coexpressed with a further heterologous protein. In such a case, the cells comprise a first set of extra-chromosomal genes including (i) a gene encoding a Tpl2 protein and (ii) a MOBl gene; a second set of extra-chromosomal genes including (i) a gene encoding a further heterologous protein and (ii) an essential gene other than MOBl wherein the expressed chromosomal genes do not include MOBl or the other essential gene. One example of a further essential gene is CDC28. Loss of either MOBl of the other essential gene will be lethal to the cell. The further heterologous protein can preferably bind specifically to Tpl2. The further heterologous gene is also preferably under the control of an inducible promoter. Preferably the further heterologous protein is human pl05, a precursor of the NFKB transcription factor and regulator of Tpl2. Purification of the further heterologous protein will be carried out as described above. It is possible to purify heterooligomers (e.g. heterodimers) that include Tpl2 and the further heterologous protein.

Tpl2 proteins of the invention

Although Tpl2 protein has successfully been expressed in yeast, the invention is not limited to Tpl2 expressed in this host.

The invention provides a composition comprising one or more proteins, including a Tpl2 protein, wherein the proportion of the Tpl2 protein in the composition relative to total protein in the composition, measured by mass, is at least x%. The value of x can be selected from: 50, 60, 70, 75, 80, 85, 90, 93, 95, 96, 97, 98, 99, 99.5, 99.9 or 100.

The invention also provides a composition comprising one or more proteins, including a complex of Tpl2 protein and pi 05 protein, wherein the proportion of the complex in the composition relative to total protein in the composition, measured by mass, is at least y%. The value of y can be selected from: 50, 60, 70, 75, 80, 85, 90, 93, 95, 96, 97, 98, 99, 99.5, 99.9 or 100.

Preferably, these compositions of the invention are substantially free from one or more of: (a) nucleic acids; (b) lipids; (c) dyes; (d) stains; (e) antibiotics; and (f) antifungals. The invention also provides a composition (i) comprising a Tpl2 protein from an organism of choice, (ii) optionally comprising a pl05 protein from the organism of choice, but not (iii) including any other proteins from the organism of choice. Although the composition includes only (i) one or (ii) two proteins from the organism of choice, it may include proteins from a recombinant expression host e.g. yeast proteins. As well as including Tpl2 protein (and, optionally, i 05 protein), compositions of the invention may include water, buffering substances, salts, etc.

Tpl2 proteins of the invention are preferably mammalian Tpl2 proteins e.g. a human Tpl2 protein or a murine Tpl2 protein. Prototypic full-length Tpl2 sequences from mouse, rat and human are given in Figure 8. Tpl2 sequences in proteins of the invention preferably have >n% identity to one of these Tpl2 sequences, wherein n is selected from 65, 70, 75, 80, 85, 90, 93, 95, 96, 97, 98, 99, 99.5, 99.9 and 100. Sequence identity is preferably assessed using the KERR algorithm, as described in reference 12. As an alternative to the KERR algorithm, percentage sequence identity can be by the Smith- aterman homology search algorithm using an affine gap search with a gap open penalty of 12 and a gap extension penalty of 2, BLOSUM matrix of 62. The Smith- Waterman homology search algorithm is disclosed in reference 13.

Tpl2 proteins of the invention can take various forms. For example, the Tpl2 protein may be glycosylated or non-glycosylated; it may or may not include a fusion partner; and it may be a full-length Tpl2 protein or a fragment of a full-length Tpl2 protein.

TpI2 proteins of the invention may include a fusion partner. One type of fusion partner is a sequence that is useful during protein purification. Polypeptides commonly used as fusion partners to assist in purification include, but are not limited to: glutathione-S-transferase (GST), purified using immobilised glutathione [14]; poly-histidine tags, purified by IMAC [15]; calmodulin-binding peptide (CBP), purified using immobilised calmodulin; maltose-binding protein (MBP), purified using immobilised amylose; a chitin-binding domain (CBD), purified by binding to chitin; secretory signals; and the Flag epitope (DYKDDDDK) (SEQ ID NO: 1) [16], haemagglutinin epitope

(YPYDVPDYA, HA-tag) (SEQ ID NO: 2), VSV-G epitope, thioredoxin or c-myc epitope

(EQKLISEEDL) (SEQ ID NO: 3), purified by specific immunoaffinity chromatography. The Tpl2 sequence and purification sequence may be arranged in either order, N-terminus to C-terminus, but it is typical referred to have the further sequence downstream of (i.e. fused to the C-terminus of) the purification sequence. Where purification sequences are used, the protein will usually include a protease recognition sequence at the junction between the Tpl2 and purification sequences. A protease can then be used to generate non-fusion Tpl2 that lacks the purification tag. Protease recognition sites include, but are not limited to: VPR/GS (Thrombin) (SEQ ID NO: 4); IEGR (SEQ ID NO: 5) (Factor Xa Protease); DDDDK (SEQ ID NO: 6) (Enterokinase); ENLYFQ/G (SEQ ID NO: 7) (endopeptidase rTEV from tobacco etch virus); and LEVLFQ/GP (SEQ ID NO: 8) (human rhinovirus protease 3C). As an alternative to using a protease recognition sequence, a self-cleaving protein can be constructed based on inteins [17,18].

The proteolytic cleavage can take place after purification of the fusion protein or, to simplify purification, can take place while the fusion protein is immobilised on an affinity column, allowing cleaved Tpl2 to elute while the purification tag remains immobilised. The method of the invention may thus include a step of protein cleavage. This step may take place before or during purification in step (b), or may take place after purification of a fusion protein.

Tpl2 protein with a sequence free from any fusion partner may thus have been expressed as a fusion protein, with the fusion partner then having been removed, or it may have been expressed directly with its native sequence.

The Tpl2 protein may be phosphorylated, particularly on a serine residue e.g. at Ser-400 (numbered with reference to the human sequence in Figure 8). This may arise through autophosphorylation.

Any Tpl2 isof rm can be used with the invention. Human Tpl2 is known to exist in 52kDa and 58kDa isoforms, arising from alternative initiation.

Tpl2 proteins of the invention may be full-length Tpl2 proteins (e.g. as shown in Figure 8, starting with the original N-terminus methionine residue), or they may be fragments of full-length Tpl2 proteins. Preferred fragments lack (a) up to n amino acids from the N-terminus of a full-length Tpl2 protein, and/or (b) up to c amino acids from the C-terminus of a full-length Tpl2 protein. The value of 7i can be selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86 ,87, 88, 89, 90, 91, 92, 93, 94, 95, 96 ,97, 98, 99, 100 or more. The value of c can be selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96 ,97, 98, 99, 100 or more. Forms of Tpl2 lacking 70 C-terminal residues are known to be oncogenic, and the use of alternative start codons can remove 30 N-terminal residues. The C-terminus of Tpl2 seems necessary for interaction with pl05. When N-terminal residues are removed without leaving a new N-terminus methionine residue, the Tpl2 may include an additional N-terminus residue. A preferred fragment of Tρl2 is a deletion mutant lacking the 78 C-terminal amino acids. A further preferred deletion mutant of Tpl2 lacks both the 78 C-terminal amino acids and the 30 N-terminal amino acids.

Other Tpl2 proteins for use with the invention are those lacking at least one (e.g. lacking 1, 2, 3, 4, 5 or 6) exon from a native Tpl2 gene. The Tpl2 protein may contain point mutations e.g. to remove kinase activity. For example, kinase dead mutants disclosed in reference 10 have A270 and/or R167 mutations.

Screening methods

TPL2 is believed to be responsible for degradation of pi 05 and the resultant release of Rel subunits [10]. TPL2 can mediate direct or indirect phosphorylation of pl05, which leads directly to its degradation and translocation to the nucleus of the associated Rel subunit, as a homodimer or as a heterodimer with a further Rel monomer. Accordingly, compounds which are capable of modulating the direct or indirect interaction between TPL2 and pi 05, either by binding to TPL2, modulating the activity of TPL2 or influencing the interaction of TPL2 with pi 05 or with other polypeptides involved in the phosphorylation of pl05, are capable of modulating the activation of NFkB via pl05. The invention provides a method for identifying a compound or compounds capable, directly or indirectly, of modulating the proteolysis of pl05 and thereby its inhibitory activity, comprising the steps of: (a) incubating a Tpl2 protein with the compound or compounds to be assessed; and (b) identifying those compounds which influence the activity of the TPL2 molecule.

The invention provides a method for identifying a compound or compounds capable, directly or indirectly, of modulating the activity of pi 05, comprising the steps of: (a) incubating a Tpl2 protein of the invention with the compound or compounds to be assessed; and (b) identifying those compounds which influence the activity of the Tpl2 protein. The compounds may bind to the Tpl2 protein. The compounds may further be tested in a step of (c) assessing the compounds for their ability to modulate NFKB activation in a cell-based assay. The invention also provides a method for identifying a compound, comprising: incubating a compound or compounds to be tested with a Tpl2 protein and pl05, under conditions in which, but for the presence of the compound or compounds to be tested, Tpl2 associates with pi 05 with a reference affinity; determining the binding affinity of Tpl2 for pi 05 in the presence of the compound or compounds to be tested; and selecting those compounds which modulate the binding affinity of TPL2 for pi 05 with respect to the reference binding affinity.

The invention also provides a method for identifying a compound, comprising: incubating a compound or compounds to be tested with a Tpl2 protein and NFKB, under conditions in which, but for the presence of the compound or compounds to be tested, Tpl2 associates with pi 05 with a reference affinity; determining the binding affinity of Tpl2 for pi 05 in the presence of the compound or compounds to be tested; and selecting those compounds which modulate the binding affinity of TPL2 for NFKB with respect to the reference binding affinity.

TNF-ct is known to be capable of stimulating pi 05 degradation and NFκB-induced activation of gene transcription. Thus the invention provides a method for identifying a compound, comprising: incubating a compound or compounds to be tested with a Tpl2 protein and a tumour necrosis factor (TNF), under conditions in which, but for the presence of the compound or compounds to be tested, the interaction of TNF and Tpl2 induces a measurable chemical or biological effect; determining the ability of TNF to interact, directly or indirectly, with Tpl2 to induce the measurable chemical or biological effect in the presence of the compound or compounds to be tested; and selecting those compounds which modulate the interaction of TNF and TPL2.

The invention also provides a method for identifying a compound, comprising the steps of: providing a purified Tpl2 protein; incubating the Tpl2 protein with a substrate known to be phosphorylated by Tpl2 and a test compound or compounds; and identifying the test compound or compounds capable of modulating the phosphorylation of the substrate. One such substrate is MEK. The invention also provides a method for identifying a compound which regulates an inflammatory response mediated by TPL2, comprising the steps of: contacting a reaction mixture that includes a TPL2 protein with a test compound and determining the effect of the test compound on an indicator of NFKB activity to thereby identify a compound that regulates NFKB activity mediated by TPL2. The invention also provides a method for identifying a compound which regulates TPL2 -mediated NFKB activity.

The invention also provides a method for identifying a compound which regulates signal transduction by TPL2, comprising the steps of: contacting a reaction mixture containing a TPL2 protein with a test compound, and determining the effect of the test compound on an indicator of signal transduction by the TPL2 polypeptide in the reaction mixture in order to identify a compound which regulates signal transduction by TPL2.

The invention also provides a method for identifying a compound which modulates the interaction of a TPL2 polypeptide with a target component of TPL2 modulation, comprising the steps of: contacting a reaction mixture containing a TPL2 protein with a target component of the TPL2 modulation, and a test compound, under conditions where, but for the presence of the test compound, the TPL2 polypeptide specifically interacts with the target component at a reference level. Accordingly, the method allows for measuring a change in the level of interaction in the presence of the test compound, where a difference indicates that the test compound modulates the interaction of a TPL2 protein with a target component of TPL2 modulation. In a preferred embodiment, the target component is pl05, IκB-α, IicB-β, MEK-1, SEK-1, or NFKB and preferably, a purified polypeptide. Methods of the invention may include a step of determining TPL2 activity e.g. kinase activity, binding activity, and/or signaling activity. Similarly, the methods may include a step of measuring apoptosis of a cell, cell proliferation, or an immune response.

Methods of the invention identify test compounds. These may then be subjected to in vivo testing e.g. to determine their effects on a TNF/pl05 originating signalling pathway.

These methods for identifying compounds may be performed in vitro or in vivo in a cell. As an alternative, the method may involve the use of a cell-free mixture or a cell-based mixture and such a mixture may be derived from a recombinant cell, preferably a recombinant cell having a heterologous nucleic acid encoding a TPL2 protein. In a preferred embodiment, the cell-free mixture may employ a purified TPL2 protein. In another embodiment, the method includes a determination of signaling that includes TNF expression. In a related embodiment, the recombinant cell includes a reporter gene construct that is operably linked with a transcriptional regulatory sequence sensitive to intracellular signals transduced by TPL2 or NFKB. In a preferred embodiment, the transcriptional regulatory sequence is a TNF transcriptional regulatory sequence. The invention also provides a method for identifying a modulator of NFKB activity, comprising the steps of: (a) incubating a Tpl2 protein with the compound or compounds to be assessed; and (b) identifying those compounds which bind to the Tpl2 protein. Preferably, the method further comprises the step of: (c) assessing the compounds which bind to TPL2 for the ability to modulate NFKB activation in a cell-based assay. Binding to TPL2 may be assessed by any technique known to those skilled in the art. Examples of suitable assays include the two hybrid assay system, which measures interactions in vivo, affinity chromatography assays, for example involving binding to polypeptides immobilized on a column, fluorescence assays in which binding of the compound(s) and TPL2 is associated with a change in fluorescence of one or both partners in a binding pair, and the like. Preferred are assays performed in vivo in cells, such as the two-hybrid assay.

The invention also provides a method for identifying a lead compound for a pharmaceutical useful in the treatment of disease involving or using an inflammatory response, comprising incubating a compound or compounds to be tested with a Tpl2 protein and pl05, under conditions in which, but for the presence of the compound or compounds to be tested, TPL2 associates with pl05 with a reference affinity; determining the binding affinity of TPL2 for pi 05 in the presence of the compound or compounds to be tested; and selecting those compounds which modulate the binding affinity of TPL2 for pi 05 with respect to the reference binding affinity.

Preferably, the assay is calibrated in absence of the compound or compounds to be tested, or in the presence of a reference compound whose activity in binding to TPL2 is known or is otherwise desirable as a reference value. For example, in a two-hybrid system, a reference value may be obtained in the absence of any compound. Addition of a compound or compounds which increase the binding affinity of TPL2 for pi 05 increases the readout from the assay above the reference level, whilst addition of a compound or compounds which decrease this affinity results in a decrease of the assay readout below the reference level.

The invention may be configured to detect functional interactions between a compound or compounds and TPL2. Such interactions will occur either at the level of the regulation of TPL2, such that this kinase is itself activated or inactivated in response to the compound or compounds to be tested, or at the level of the modulation of the biological effect of TPL2 on pl05. As used herein, "activation", and "inactivation" include modulation of the activity, enzymatic or otherwise, of a compound, as well as the modulation of the rate of production thereof, for example by the activation or repression of expression of a polypeptide in a cell. The terms include direct action on gene transcription in order to modulate the expression of a gene product.

Assays which detect modulation of the functional interaction between TPL2 and pi 05 are preferably cell-based assays. For example, they may be based on an assessment of the degree of phosphorylation of pi 05, which is indicative of the degree of NFKB activation, resulting from the TPL2-pl05 interaction.

In some embodiments, a yeast of the invention expressing Tpl2 may be employed for the identification of compounds, particularly low molecular weight compounds, which modulate the function of TPL2. Thus yeast cells expressing TPL2 are useful for drug screening and the invention provides a method for identifying compounds that modulate the activity of TPL2, said method comprising exposing yeast cells of the invention to at least one compound or mixture of compounds or signal whose ability to modulate the activity of said TPL2 is sought to be determined, and then monitoring said cells for changes caused by said modulation. Such an assay enables the identification of modulators, such as agonists, antagonists and allosteric modulators of TPL2. A compound or signal that modulates the activity of TPL2 refers to a compound that alters the activity of TPL2 in such a way that the activity of TPL2 in pl05 activation is different in the presence of the compound or signal (as compared to the absence of said compound or signal).

Cell-based screening assays can be designed by constructing cell lines in which the expression of a reporter protein, i.e. an easily assayable protein, such as β-galactosidase, chloramphenicol acetyltransferase (CAT) or luciferase, is dependent on activation of pi 05 by TPL2. For example, a reporter gene encoding one of the above polypeptides may be placed under the control of an NFKB- response element which is specifically activated p50. Where the element is activated by p50 heterodimers, provision must be made for expression of alternative Rel monomers at a predictable level. Such an assay enables the detection of compounds that directly modulate TPL2 function, such as compounds that antagonize phosphorylation of pi 05 by TPL2, or compounds that inhibit or potentiate other cellular functions required for the activity of TPL2. Alternative assay formats include assays which directly assess inflammatory responses in a biological system. It is known that constitutive expression of unregulated p50 results in an inflammatory phenotype in animals. Cell-based systems, such as those dependent on cytokine release or cell proliferation, may be used to assess the activity of p50. The invention provides a method for identifying a lead compound for a pharmaceutical useful in the treatment of disease involving or using an inflammatory response, comprising: incubating a compound or compounds to be tested with a Tpl2 protein and pl05, under conditions in which, but for the presence of the compound or compounds to be tested, TPL2 directly or indirectly causes the phosphorylation of pi 05 with a reference phosphorylation efficiency; determining the ability of TPL2 to cause the phosphorylation, directly or indirectly, of pi 05 in the presence of the compound or compounds to be tested; and selecting those compounds which modulate the ability of TPL2 to phosphorylate pl05 with respect to the reference phosphorylation efficiency.

In the case where TPL2 indirectly phosphorylates a target polypeptide (e.g. pi 05) a further kinase or kinases may be involved and thus, the assays according to the present embodiment of the invention may be advantageously configured to detect indirect target polypeptide or pi 05 phosphorylation by TPL2.

The invention also provides a method for identifying a lead compound for a pharmaceutical, comprising the steps of: providing a purified Tpl2 protein; incubating the Tpl2 protein with a substrate known to be phosphorylated by TPL2 and a test compound or compounds; and identifying the test compound or compounds capable of modulating the phosphorylation of the substrate.

A substrate for TPL2 phosphorylation is MEK (EMBO J.15:817-826,1996). Preferably, therefore, MEK is used as a substrate to monitor compounds capable of modulating TPL2 kinase activity. In another embodiment, the test substrate may be any suitable TPL2 target polypeptide, such as, e.g., MEK-1, SEK-1, IκB-α, IκB-α, NF-κBl pl05, NFKB and TPL2 itself. Other peptide substrates for TPL2/COT may be derived from these protein substrates, and include for example the IκB-α-derived peptide NH₂-DDRHDSGLDSMKDKKK-COOH (SEQ ID NO: 9) and the MEK-derived peptide NH₂-QLIDSMANSFVGTKKK-COOH (SEQ ID NO: 10). These and other TPL2 target polypeptides described herein allows for a person skilled in the art to screen directly for kinase modulators. Preferably, kinase modulators are kinase (TPL2) inhibitors. Optionally, a test compound(s) identified may then be subjected to in vivo testing to determine their effects on a TNF/pl05 originating signaling pathway.

Detailed guidance for performing these methods can be found in reference 10.

Pharmaceuticals

The invention also provides a compound identified or identifiable by the screening methods of the invention. The compound should be capable of modulating the direct or indirect interaction of Tpl2 with i 05. The compound may be an antibody. Such compounds can be used to prepare pharmaceutical compounds for treating inflammatory diseases or diseases involving an inflammatory response.

The compounds may themselves be useful as pharmaceuticals, or may be useful as lead compound for pharmaceutical development. For example, small organic compounds can be modified to improve pharmacokinetic properties, toxicity, bioavailability, etc., and antibodies can be modified to improve binding affinity or to reduce immunogenicity (e.g. by humanisation).

Diseases of interest include, but are not limited to: rheumatoid arthritis, multiple sclerosis (MS), inflammatory bowel disease (IBD), insulin-dependent diabetes mellitus (IDDM), sepsis, psoriasis, misregulated TNF expression and graft rejection. The invention is also useful in general for modulating the immune system response of a patient, for treating a TPL2-mediated condition in a patient, for modulating TPL2-mediated NFKB regulation in a patient, for modulating TPL2-mediated NFkB regulation within a cell, for treating TNF misregulation, etc.

TPL2 activities that can be affected by the invention can include its binding activity and its phosphorylating activity.

Test compounds

Typical test compounds for use in screening methods of the invention include, but are not restricted to, peptides, peptoids, proteins, lipids, metals, small organic molecules, RNA aptamers, antibiotics and other known pharmaceuticals, polyamines, antibodies or antibody derivatives (e.g. antigen- binding fragments, single chain antibodies including scFvs, etc.), protein-based, carbohydrate-based, lipid-based, nucleic acid-based, natural organic-based, synthetically derived organic-based, antibody- based, and combinations or derivatives thereof. Small organic molecules have a molecular weight of about more than 50 and less than about 2,500 daltons, and most preferably between about 300 and about 800 daltons. Candidate compounds may be derived from large libraries of synthetic or natural compounds. For instance, synthetic compound libraries are commercially available from MayBridge Chemical Co. (Revillet, Cornwall, UK) or Aldrich (Milwaukee, WI). Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts may be used. Additionally, candidate compounds may be synthetically produced using combinatorial chemistry either as individual compounds or as mixtures.

Preparing the cell

Yeasts of the invention have lost MOBl function from their chromosomes, but that loss is complemented by an extra-chromosomal copy of the gene. As loss of an essential gene like MOBl cannot be tolerated, it is not feasible to make cells of the invention simply by deleting the chromosomal copy and then transforming the mutant cells with a vector encoding the gene, because death means that there is no way of selecting for cells which lack the essential gene. Instead, cells of the invention can be prepared by means of "plasmid shuffling" [19], involving a transitional stage where cells possess MOBl in both chromosomal and extra-chromosomal fonn (e.g. see Figure 6).

The overall shuffling process begins with a mutant cell that lacks a chromosomal copy of MOBl, but which possesses a replacement copy on a first plasmid, which plasmid also contains a conditionally- lethal marker. A second plasmid is then used, carrying (a) a further replacement MOBl, (b) a conditionally-essential marker, and (c) a Tpl2 gene, and transfonnants are selected on the basis of the plasmid' s conditionally-selective marker. At this stage the cell contains two plasmid copies of MOBl, one on a first plasmid that contains a negative selection marker and one on a second plasmid that contains a positive selection marker and a heterologous gene. Loss of either plasmid leads to retention of MOBl, but only the second plasmid is useful for Tpl2 expression. Thus the process then proceeds to eliminate cells which retain the first plasmid, thereby selecting cells which possess only the second plasmid. This final selection uses the first plasmid' s conditionally-lethal marker, to yield cells in which the essential gene and the Tpl2 gene are encoded by the same plasmid. The overall effect of this process, therefore, is to replace the first plasmid with the second plasmid. Cells which lose both plasmid lose MOBl and thus die. The first vector is referred to as a 'covering' plasmid.

In S.cerevisiae a covering plasmid will generally include the URA3 counterselection marker, the expression plasmid will include a selection marker (e.g. auxotrophic marker), and the expression of Tpl2 protein will be controlled by galactose repression of GAL1-10. The URA3 marker advantageously allows selection of starting cells which contain the covering plasmid and also, using FOA, allows counterselection of intermediate cells.

Plasmids and expression control

Cells of the invention include extra-chromosomal genes, which are located on a plasmid. Plasmids include: - MOBl, such that (a) the plasmid can complement the lack of MOBl function in a host's chromosome, and (b) loss of the plasmid is lethal to the cell. - TRP1, such that Trp-auxotrophic yeasts containing the plasmid can be selected on the basis of growth in a Trp-free medium. - A Tpl2 gene.

The second set of extra-chromosomal genes described above for use in the coexpression of Tpl2 and a further heterologous gene are also provided on a plasmid. Such a plasmid includes: • CDC28, such that (a) the plasmid can complement the lack of CDC28 function in a host's chromosome, and (b) loss of the plasmid is lethal to the cell. HIS3, such that His-auxotrophic yeasts containing the plasmid can be selected on the basis of growth in a His-free medium. • A further heterologous gene, such as a i 05 gene.

Plasmids will typically also include one or more of the following elements: (i) an origin of replication functional in yeast, such as an ar l element or, more preferably, a 2μ ori element; (ii) a polylinker or multi-cloning site, containing a plurality (e.g. 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) of restriction sites in the same or, preferably, in different reading frames; (iii) a transcription termination sequence (e.g. Υ-ADH1, T-CYC1, etc.) and/or additional stop codons (TGA, TAA and/or TAG) downstream of one or more (preferably all) of the promoters and their coding sequences in the plasmid; and (iv) a stabilising sequence, such as stb.

To function as a shuttle vector between eukaryotes and bacteria, thereby simplifying preparative work, the plasmid may also include one or more of: (v) an origin of replication functional in bacteria, such as the ColEl origin of replication; and (vi) an antibiotic resistance marker suitable for selection of bacterial transformants.

Expression of genes in the plasmid is controlled by upstream promoters. Various promoters may be used, but the invention offers better expression if particular promoters are used. MOBl is preferably under the control of a repressible promoter. To increase expression levels, the invention exploits the background level of "leaky" expression driven by such promoters even when they are turned "off e.g. by catabolite repression. As MOBl is required for the host cell to survive, but the host cell does not have a copy of MOBl on its own chromosome, there is a selective pressure to increase the plasmid' s copy number. As the copy number increases, the overall expression of MOBl increases such that the combined background expression is adequate for survival.

By repressing expression of MOBl, therefore, the invention can achieve a high copy number of the plasmid. An increase in copy number also gives increased levels of the Tpl2 gene, thereby improving its expression levels. The process of the invention may thus include a step of increasing the copy number of the plasmid to at least 5 (e.g. to at least 10, 20, 30, 40, 50 or more). The use of "leaky" low level expression to increase copy number is known [20].

The Tpl2 gene is preferably under the control of a promoter that is both repressible and inducible. Rather than being used to increase copy number, however, this promoter is used to allow controlled expression of Tpl2 protein. When there is an increase in copy number of the plasmid, high levels of Tpl2 expression are achieved. It is thus useful to avoid expression of Tpl2 until a desired time to avoid possible toxic effects of over-expression, although no such toxic effects have been seen.

A typical repressible promoter system for use with the invention is based on the GAL1-10 promoters of Gall galactokinase I and Gal 10 UDP-glucose 4 epimerase. These are tightly repressed by glucose but highly activated when galactose is the sole carbon source. In S.cerevisiase, the dual GAL1 and GAL10 promoters are juxtaposed in nature (within the PGALI element) and are transcribed in opposite directions, and this arrangement of promoters conveniently allows divergent repression of MOBl (controlled by one of the pair, in one direction) and Tpl2 (controlled by the other member of the pair, in the other direction) [21].

Host yeast cells

Tpl2 protein is conveniently expressed in yeasts. Yeast is an inexpensive organism to work with, can be stored easily by freezing, and has an extensive historical background in expression and genetic manipulation, and with the sequencing of the S. cerevisiae genome, genomics and proteomics of this organism have been heavily exploited. Many suitable clones and vectors for expression and selection are readily available, and these have been extensively studied and characterised. Furthermore, studies of the yeast proteome have shown that yeasts are extremely tolerant to the expression of genes in the form of fusion proteins, without loss of solubility or function [22,23] .

Preferred yeasts are those which, for assisting in the preparation of cells of the invention, which exist in haploid and diploid forms. Budding yeasts are particularly preferred. A particularly preferred species for use with the invention is Saccharomyces cerevisiae (budding or bakers yeast), which is readily available to the skilled person. The invention does not utilise wild-type yeast cells as hosts, as the invention relies on the absence of a functional MOBl gene from the host's chromosome, with that absence being complemented by a plasmid copy of the gene. Typically, therefore, the invention will use a host that has a MOBl knockout genotype. The knockout may remove or disrupt the whole or part of the chromosomal gene, in the regulatory region(s) and/or the coding region(s). Thus remnants of MOBl may remain in the chromosome, but the overall effect will be that the host's chromosome cannot be transcribed and/or translated to produce Mobl protein functional form.

Knockout by homologous recombination is a preferred method for obtaining suitable host cells, and in particular knockout by isogenic deletion. Replacement of a chromosomal gene with a marker gene is typical e.g. as a result of homologous recombination to insert an antibiotic resistance gene. Gene inactivation methods such as those disclosed in references 24 and 25 can easily be adapted by the inclusion of covering plasmids encoding MOBl prior to the inactivation step.

In addition to knockout of the essential gene, the host may include further mutations to remove undesirable phenotypes. These mutations may already be present in a starting yeast strain, or they may be introduced. For example, many host cells express endogenous proteases which degrade heterologous proteins, but which are not essential to viability under laboratory conditions. Deletion of such proteases from the host improves recombinant protein expression. Thus a cell of the invention may include knockout mutations of one or more endogenous proteases. In yeast, deletion ofPEP4 function (the saccharopepsin aspartyl protease [26]) is a preferred mutation. Other proteases which can be knocked out include Prbl, Prcl and Cpsl. The host cell may have mutations to prevent slow growth e.g. deletion of cln3 or cln2 in yeast. A preferred strain is one which is able to produce a higher biomass than wild-type yeast under the same conditions. A mutant strain has been described which contains only a single hexose transporter, a hybrid of Hxtl and Hxt7 [27]. This mutation restricts glucose influx and avoids overflow into lactate. This results in slow steady respiration of the glucose and a higher resultant biomass.

General The tenn "comprising" means "including" as well as "consisting" e.g. a composition "comprising" X may consist exclusively of X or may include something additional e.g. X + Y.

The term "about" in relation to a numerical value x means, for example, x+10%.

The word "substantially" does not exclude "completely" e.g. a composition which is "substantially free" from Y may be completely free from Y. Where necessary, the word "substantially" may be omitted from the definition of the invention.

BRIEF DESCRIPTION OF DRAWINGS

Figure 1 illustrates the construction of starting strains for use with the invention, and figure 2 shows a further development of this process, starting with the strain produced at the end of figure 1.

Figure 3 shows two maps of the pMGl plasmid, with figure 4 showing its polylinker site (SEQ ID NO: 11 and SEQ ID NO: 12).

Figure 5 shows expression from the pMGl plasmid using glucose (5A) or galactose (5B).

Figure 6 shows the plasmid shuffling used in selecting cells of the invention. The yeast cell is shown progressing from starting cell to intermediate cell to a cell useful for heterologous expression of proteins according to the invention. Figure 7 shows the results of Tpl2 expression according to the invention. The lanes were loaded with protein from ~30ml of culture.

Figure 8 shows Tpl2 sequences from mice (SEQ ID NO: 15), rats (SEQ ID NO: 16) and humans (SEQ ID NO: 17), with GenBank accession numbers.

Figure 9 shows the expression of rat GST-Tpl2 andN- and C-terminal deletion derivatives. Figure 10 shows the interaction of GST-Tpl2 and 6His-pl05.

Figure 11 shows the MOB/TRP1 -based vectors (A) pMH919 and (B) pGSTMob/Dbf2.

Figure 12 shows vector maps of (A) pMH925 and (B) pMH927.

Figure 13 shows the coexpression and copurification of GST-Tpl2 and 6His-ρl05.

MODES FOR CARRYING OUT THE INVENTION Construction of starting yeast strains

Diploid S. cerevisiae strains that are heterozygous for MOBl (MOBl/mobl::kan^R) are available. Such a strain was obtained and was transformed with a τpURA3 plasmid ("pRS316" [28]) carrying a

BamΗl-EcoKL PCR fragment encompassing the entire MOBl coding sequence plus flanking regulatory elements [11]. This strain is gal2 (has sub-optimal growth on galactose as a sole carbon source) and is Ura^" (requires uracil in growth medium). Ura⁺ transformants were selected and allowed to sporulate. After germination, haploid mobl::kan^R strains were selected using G418. These cells have lost their chromosomal MOBl, but its activity is complemented by the MOBl⁺ plasmid. These cells were mated with a second haploid strain ("CG379" [29]) which was MOBl trpl GAL2 and the mated diploid cells were then sporulated. Spores which were trpl GAL2 mobl::kan^R (cannot grow without tryptophan, can grow on galactose, G418 resistant) were selected for G418 resistance and growth on galactose medium. One which was mating type a was designated MGY66 and had the following relevant genotype MATΆ mobl::kan^R trpl GAL ura3 pURA3-MOBl. MGY66 is a suitable starting cell for use with the invention, and its overall construction is shown in Figure 1.

As a further development, shown in Figure 2, the PEP4 gene of this strain was knocked out and replaced with a LEU2 cassette [30]. The resulting strain is referred to as "MGY70" and is MATa mobl::kαn^R trpl GAL pep4::LEU2 urα3 pURA3-MOBl. The PEP4 gene encodes an aspartyl protease ("saccharopepsin") which can degrade recombinantly-expressed proteins, but which is not essential for cell survival, and so its deletion can improve yields of stable recombinant proteins.

Preparation of expression plasmids

Starting with plasmid pESC-URA (Invitrogen™), a Pvul fragment was excised, which contains the divergent, conditional and galactose-inducible yeast Gall -10 promoters and yeast ADH and CYC1 terminators. This fragment was used to replace a Pvul fragment of pRS424 [31] to give "pESC-424". An EcoVJ-Spel fragment encompassing the MOBl coding sequence was made by PCR of yeast genomic DNA using the following primers: Fwd, with £cøRI site: CCCGAATTCATGTCTTTTCTACAAAAT (SEQ ID NO: 13) Rev, with Spel site: CCCACTAGTCTACCTATCCCTCAACTCC (SEQ ID NO: 14)

The PCR fragment was cloned into the GAL10 promoter of pESC-424 to give pESC-424- 0J3i. The same EcoRl site was then removed by infilling with Klenow DNA polymerase, to give "pESC-424- MOBl-AEcoRl". Removal of this EcoRI site allowed a unique EcoBΛ site to be later included in a polylinker.

A BgR-Xhol fragment containing a GST coding sequence, a thrombin cleavage site and a polylinker was made by PCR of pGEX-KG [32] and cloned between BamΑ and Xhol sites of pESC-424- MOBl-AEco l, to give the plasmid "pMGl" (Figures 3A & 3B). The polylinker site (Figure 4) can receive genes encoding proteins of interest for expression as GST-fusions.

Transformation to express recombinant proteins (Figure 6)

Plasmid pMGl is grown in E.coli and a plasmid DNA miniprep is prepared. Separately, a gene encoding a heterologous protein of interest is prepared which, after restriction enzyme treatment, will have sticky ends that are compatible and in-frame with the polylinker site in pMGl. The two molecules are digested and ligated to give a plasmid encoding the protein of interest in the form of a GST-fusion protein. This plasmid ("pMGl-X") is transferred into MGY70 yeast by the lithium acetate protocol, and is then selected on a minimal medium lacking tryptophan. As MGY70 is trpl, only transfonnants survive. Next, the cells are grown on agar with uracil and lmg/ml 5-fluororotic acid, which selects against URA3⁺ cells. Surviving cells are those which have lost the pURA3-MOBl plasmid, but which have retained pMGl-X as the sole source of MOBl.

The final transformants can be grown in rich media (e.g. in YEP medium) without further selection. The cells require uracil to grow, but this is supplied by rich media. The cells can be frozen at this stage to provide long-term stocks e.g. freezing at-80°C in YEP medium with 20% glycerol. Expression of the heterologous fusion protein can be induced by switching on the pGAL promoters.

TPL2 expression and purification

Yeast cells of the invention contains a Tpl2 gene under the control of a pGAL promoter. The MOBl is also under the control of a pGAL promoter. This arrangement allows a very high copy number of the pMG plasmid to be achieved prior to Tpl2 induction, thereby giving high expression levels. Furthermore, by keeping the Tpl2 gene in an "off state at this stage then any possible toxic effects of Tpl2 are avoided.

Cells need MOBl expression to survive. As the MOBl gene is under the control of a pGAL promoter, which is repressed when cells are grown on glucose, it would seem on paper that the cells would die when grown on glucose. As repression is not 100% efficient, however, there is a low-level basal expression from the pGAL promoters (Figure 5A). This basal expression provides low levels of MOBl to the growing cells, allowing survival. Moreover, the absolute need for MOBl operates as a selection pressure to increase the copy number of pMGl. In the presence of glucose, therefore, the copy number of pMGl increases to high levels.

When Tpl2 expression is desired, the cells are transferred to a galactose medium. The absence of glucose and presence of galactose removes repression of the pGAL promoters and Tpl2 expression is thus induced (Figure 5B). Furthermore, the recombinant gene is expressed at even higher levels because of the high copy number resulting from the pGAL-controlled MOBl selection. After induction, cells are grown and then harvested. The cell lysate is applied to a glutathione column, which retains the GST-fusion protein. After washing, thrombin is added to the column, leading to elution of cleaved Tpl2 in pure form.

A pCDNA3 vector carrying the cDNA of the complete mouse TPL2 coding sequence was used as a

PCR template to generate a DNA fragment suitable for cloning into pMGYl. The PCR forwards primer included the first 18 coding bases of TPL2 preceded by a synthetic BarnHL site. The BamRl site was designed to so that the TPL2 sequence was in frame with the 3' end of the GST sequence of pMGl. The reverse primer had the last 18 bases of the negative strand in reverse 5'-3' orientation preceded by a synthetic Xliol site. The PCR product was prepared for digestion using the Wizard PCR Preps DNA Purification System. The PCR fragment and pMGl were digested with Ba VΑ and Xhol restriction enzymes. The PCR fragment was again purified using the Wizard PCR Preps DNA Purification System. The digested vector was electrophoresed through a 10% agarose TAE buffered gel. Linear plasmid was excised from the gel and purified from the agarose using a Geneclean Kit. Vector and PCR fragments were ligated together by incubation together for 2h. Control ligations were done with no insert DNA.

Ligation mixtures were transformed into E.coli DHlOb.Transformed E.coli were selected on L agar containing 20μg/ml ampicillin + 20μg/ml nafcillin. Individual clones were colony purified by restreaking on amp+naf selective medium. Miniprep DNA of individual clones was prepared using the Wizard Plus Minipreps DNA Purification System. Miniprep DNA was digested with BamHI + Xl ol restriction enzymes to identify clones carrying the ~1.6kb TPL2 coding sequence.

The DNA of three potentially positive pMGl-TPL2 clones were transformed into S. cerevisiae MGY70 using the lithium acetate procedure. MGY70 transformants with this TRP1 plasmid were selected by growth at 30°C on minimal agar medium lacking tryptophan. Two individual transformant clones obtained from each miniprep DNA sample were colony purified by re-streaking on agar medium lacking tryptophan. A single colony from each of these plates was streaked onto minimal medium supplemented with 20μg/ml uracil and lmg/ml FOA. FOA plates were incubated for 2-3 days at 30°C. Single colonies were picked onto fresh FOA plates and grown for a further 2-3 days. In these cells the covering plasmid in MGY70 that provided the essential MOBl gene had been replaced by the expression plasmid and its copy of MOBl. From this point onwards these cells could be grown on rich medium with no further conditional selection.

Examples of the resulting single colonies were next tested for protein expression. However, at this stage it was useful to test whether expression of the cloned gene in toxic as this influences the induction regime for inducible gene expression. Induction of toxic gene products is indicated by failure of the cells to grow on rich agar medium with 2% galactose as carbon source. Induction of the potential TPL2 clones was not toxic as judged by this simple test.

Three potential isolates originating from three independent ligation events were tested for expression of TPL2. 50ml overnight cultures were grown at 30°C in rich, YEP, medium with 2% raffϊnose as carbon source. The cultures were inoculated so that cell density after overnight growth was approximately 5x10⁷ /ml. The overnight cultures were used to inoculate 500ml of YEP medium supplemented with 2% galactose as carbon source and grown for 6-8h at 30°C. Cells from 50ml and 450ml of culture were harvested by centrifugation, frozen rapidly on dry ice and stored at -80°C. The small pellets were used to check for induced expression of TPL2 while the larger pellets were held in reserve for preparation of Tpl2 for experimental use. Small pellets were resuspended in 400μl of lysis buffer (50mM Tris-HCl pH 7.5, 250mM NaCl, 1% Nonidet P40, 10% glycerol, 4mM dithiothreitol, 200μg/ml sodium orthovanadate, lOmM NaF, 50mM glycerol-2-phosphate, ImM PMSF, 'Complete' protease inhibitor (Roche™)). For cell lysis, glass beads, 0.5mm diameter, were added to the meniscus in 2ml screw cap tubes which were then shaken three times lOsec in a RiboLyser apparatus (Hybaid™). Cell lysate was recovered by piecing the base of the tube and followed by centrifugation inside a larger tube. Cell debris and insoluble material was removed by 2x15 min centrifugation at 13000 rpm in a refrigerated micro centrifuge. The cleared lysate was added to 50μl of glutathione sepharose beads which had been pre-equilibrated in 250mM NaCl, 50mM Tris-HCl pH 7.5, 0.2% Nonidet P40. The beads were gently mixed with the lysate on a rotor at 4°C for l-2h. The beads were washed 5x with 250mM NaCl, 50mM Tris-HCl pH 7.5, 0.2% Nonidet P40, 4mM dithiothreitol. Proteins bound to the glutathione sepharose beads were analysed by SDS-polyacylamide gel electrophoresis. Protein bands were visualised by staining with coomassie blue (Figure 7).

Large cell pellets were resuspended in lysis buffer (approximately lOml/lg cells). Cells were lysed with a French pressure cell operating at 20000psi. Cleared lysates were made by centrifugation at 18000g for 2x20 min at 4°C. Large scale affinity purification of GST-TPL2 was essentially as described above except that appropriately increased amounts of reagents were used.

In contrast to the successful expression of TPL2 using the system of the invention, attempts to express the protein in E.coli using the pGEX-4t and pET28 plasmids failed. The attempts used the full length protein as well as deletion derivatives lacking the N-terminal 30 residues and/or the C-terminal 70 residues (an oncogenic form). The kinase domain on its own was also tested. In all cases, however, any product which was seen (very little) was heavily degraded, inactive, insoluble or aggregated and was thus of limited use.

Expression was also attempted without success using the Invitrogen™ DES system using the pMT/V5-His vector and S2 Drosophila cells.

In addition to full length Tpl2, three deletion derivatives have also been expressed using the invention. An N-terminal deletion lacking 30 residues, a C-terminal deletion lacking 78 residues (which mimics a naturally occurring oncogenic form of the protein), and an N- and C- terminal derivative combining both of these deletions (Figure 9).

Following expression of Tpl2, as it was known that Tpl2 and pi 05 interact in vivo, one test of the functionality of the proteins produced in yeast was to test for their interaction in vitro (Figure 10). Glutathione sepharose beads loaded with GST-Tpl2, GST, or GST-PLKΔ were mixed with 6His- pl05 that had been eluted from a nickel sepharose column, (see Figure 9). Lane 3 of Figure 10 shows that 6His-pl05 was retained by the GST-TPL2 beads but not by beads carrying GST (lane 5) or GST-PLKΔ (lane 1). Thus pl05 and Tpl2 produced in this yeast system are able to interact in vitro as they do in vivo. Coexpression ofTpl2 with another protein

Although MOBl has been used as the essential selection gene for all the work described above, by employing a second essential gene for selection, a yeast expression system has been constructed to express two recombinant proteins simultaneously from two expression plasmids. One class of expression plasmid includes all the MOB/TRP1 -based vectors described above and in Figure 11. The second class of expression plasmids utilise the essential gene, CDC28 for selection rather than MOBl and have HIS3 as an auxotrophic marker instead of TRP pMH927 is designed to produce proteins with a GST tag and pMH927 is designed to make 6His-tagged products (Figure 12A&B). The two classes of plasmids both use the divergent GAL1-10 promoter and can express either GST- or 6His- fusion proteins. The expression cells have chromosomal deletions of essential MOBl and CDC28 genes. They are kept alive by a third, covering plasmid which has a URA3 selective marker and which expresses MOBl and CDC28 genes from their endogenous promoters.

Use of this system is essentially the same as the single expression system. Coding sequences are cloned into the two types of expression vectors. The vectors are transformed into the expression strain selecting for trytophan and histidine prototrophy. The transformants are grown on medium containing 5-fluoro-orotic acid to select for loss of the 'covering' URA3 MOBl CDC28 plasmid. The loss of the covering plasmid produces a strain carrying two different expression plasmids whose presence is maintained by selection for their essential MOBl and CDC28 genes.

An example of the use of this system is shown where two proteins are co-expressed and, because of their known affinity for each other, they also co-purify (Figure 13). A pMH925, CDC28- based plasmid encoding GST-TPL2 was co-expressed with either a pMH919 derivative expressing 6His-pl05 or the 'empty' pMH919 vector expressing only the 6His affinity tag. Additional control cells expressed the GST affinity tag from pMH925 with a pMH919 derivative expressing 6His-pl05. Lysates were prepared from these cells and GST- and 6His-tagged proteins were recovered by affinity purification with both glutathione sepharose and nickel sepharose. This experiment shows that GST-Tpl2 can be expressed from plasmids relying on a second essential gene, CDC28, for selection (Lane 1). GST is also expressed from the CX>C2S-based vector which was co-expressed with 6His-pl05 (lane 3). As expected, the 6His-pl05 that was co-expressed with GST was not recovered using glutathione sepharose in lane 3, but it was seen using nickel sepharose purification (lane 6). Thus two different proteins can be co-expressed. Co-expression was also seen in extracts from cells encoding GST-Tpl2 and 6His-pl05. GST-Tpl2 was recovered after purification with glutathione sepharose (lane 2) while 6His-pl05 was purified from the same cells with nickel sepharose. Importantly, 6His-pl05 also co-purified with the GST-Tpl2 on glutathione sepharose (lane 2) but not with GST alone (lane 3). This indicates specific co-purification of 6His-pl05 with GST-Tpl2. Similarly, GST-Tpl2 co-purified with 6His-pl05 on nickel sepharose (lane 5) but not with the 6His tag alone (lane 4). Thus the GST-Tpl2 and 6His-pl05 are co-expressed in forms that are able to interact and so co-purify. It will be understood that the invention has been described by way of example only and modifications may be made whilst remaining within the scope and spirit of the invention.

REFERENCES (the contents of which are hereby incorporated in full) 1] Waterfield et al. (2003) Mol Cell 11:685-694. 2] Kikuchi et al. (2003) J Dent Res 82:546-550. 3] Channavajhala etal. (2003) JBiol Chem 278:47089-47097. 4] Beinke et al. (2003) Mol Cell Biol 23:4739-4752. 5] Patriotis et al. (2001) J Cell Physiol 187:176-187. 6] Sourvinos et al. (1999) Oncogene 18:4968-4973. 7] Eliopoulos et al. (2002) J Virol 76:4567-4579. 8] Belich et al. (1999) Nature 397:363-368. 9] US patent 6660906. WO00/11191 (see also US application 20020099169). Luca & Winey (1998) Mol Biol Cell 9:29-46. Dufresnel et al. (2002) Nature Biotechnol 12:1269-1271. Smith & Waterman (1981) AdvAppl Math 2:482-489. Frangioni & Neel (1993) Anal Biochem 210:179-187. Gaberc-Porekar & Menart (2001) J Biochem Biophys Methods 49:335-360. Brizzard et al. (1994) Biotechniques 16:730-735. C ong t al. (1997) Gene 192:271-281. Southworth et al. (1999) Biotechniques 27:110-120. Sikorski & Boeke (1991) Methods Enzymol 194:302-318. Erhart & Hollenberg (1983) JBacteriol 156:625-635. Johnston & Davis (1984) Mol Cell Biol 4:1440-1448. Huh et al. (2003) Nature 425:686-691. Ghaemmaghami et al. (2003) Nature 425:737-741. Datsenko & Wanner (2000) PNAS USA 97:6640-6645. Link et al. (1997) JBacteriol 179:6228-6237. Ammerer et al. (1986) Mol Cell Biol 6:2490-2499. Otterstedt et al. (2004) EMBO Rep. 5(5):532-537. Sikorski & Hieter (1989) Genetics 122:19-27. Johnston et al. (1990) Mol Cell Biol 10:1358-1366. Berben et al. (1991) Yeast 7:475-477. Christianson etβ/. (1992) Gene 110:119-122. Guan & Dixon (1991) Anal Biochem 192:262-267.

Claims

1. A composition comprising one or more proteins, including a Tpl2 protein, wherein the proportion of the Tpl2 protein in the composition relative to total protein in the composition, measured by mass, is at least 50%.

2. A composition comprising one or more proteins, including a complex of Tpl2 protein and pi 05 protein, wherein the proportion of the complex in the composition relative to total protein in the composition, measured by mass, is at least 50%.

3. A composition according to claim 1 or claim 2 that is substantially free from one or more of: (a) nucleic acids; (b) lipids; (c) dyes; (d) stains; (e) antibiotics; and (f) antifungals.

4. A composition (i) comprising a Tpl2 protein from an organism of choice, (ii) optionally comprising a pi 05 protein from the organism of choice, but not (iii) including any other proteins from the organism of choice.

5. A purified Tpl2 protein having more than 65% identity to SEQ ID NO: 15, SEQ ID NO: 16 and/or SEQ ID NO: 17.

6. A purified Tpl2 protein according to claim 5, further comprising a fusion partner selected from glutathione-S-transferase, a poly-histidine tag, calmodulin-binding peptide, maltose-binding protein, a chitin-binding domain, the Flag epitope, a haemagglutinin epitope or a VSV-G epitope.

7. A purified Tpl2 protein according to claim 6, further comprising a protease recognition sequence between the Tpl2 and fusion partner sequences.

8. A method for identifying a compound or compounds capable, directly or indirectly, of modulating the proteo lysis of pi 05 and thereby its inhibitory activity, comprising the steps of: (a) incubating a Tpl2 protein with the compound or compounds to be assessed; and (b) identifying those compounds which influence the activity of the TPL2 molecule.

9. A method for identifying a compound or compounds capable, directly or indirectly, of modulating the activity of pl05, comprising the steps of: (a) incubating a Tpl2 protein of the invention with the compound or compounds to be assessed; and (b) identifying those compounds which influence the activity of the Tpl2 protein.

10. A method for identifying a compound, comprising: incubating a compound or compounds to be tested with a Tpl2 protein and pl05, under conditions in which, but for the presence of the compound or compounds to be tested, Tpl2 associates with pl05 with a reference affinity; determining the binding affinity of Tpl2 for pi 05 in the presence of the compound or compounds to be tested; and selecting those compounds which modulate the binding affinity of TPL2 for pl05 with respect to the reference binding affinity.

11. A method for identifying a compound, comprising: incubating a compound or compounds to be tested with a TpI2 protein and NFKB, under conditions in which, but for the presence of the compound or compounds to be tested, Tpl2 associates with pi 05 with a reference affinity; determining the binding affinity of Tpl2 for pi 05 in the presence of the compound or compounds to be tested; and selecting those compounds which modulate the binding affinity of TPL2 for NFKB with respect to the reference binding affinity.

12. A method for identifying a compound, comprising the steps of: providing a purified Tpl2 protein; incubating the Tpl2 protein with a substrate known to be phosphorylated by Tpl2 and a test compound or compounds; and identifying the test compound or compounds capable of modulating the phosphorylation of the substrate.

13. A method for identifying a compound which regulates an inflammatory response mediated by TPL2, comprising the steps of: contacting a reaction mixture that includes a TPL2 protein with a test compound and determining the effect of the test compound on an indicator of NFKB activity to thereby identify a compound that regulates NFKB activity mediated by TPL2.

14. A method for identifying a compound which regulates signal transduction by TPL2, comprising the steps of: contacting a reaction mixture containing a TPL2 protein with a test compound, and determining the effect of the test compound on an indicator of signal transduction by the TPL2 polypeptide in the reaction mixture in order to identify a compound which regulates signal transduction by TPL2.

15. A method for identifying a compound which modulates the interaction of a TPL2 polypeptide with a target component of TPL2 modulation, comprising the steps of: contacting a reaction mixture containing a TPL2 protein with a target component of the TPL2 modulation, and a test compound, under conditions where, but for the presence of the test compound, the TPL2 polypeptide specifically interacts with the target component at a reference level.

16. A method according to any one of claims 8 to 15 wherein said method further comprises a step of determining TPL2 activity, especially kinase activity, binding activity and/or signalling activity.

17. A method for identifying a modulator of NFKB activity, comprising the steps of: (a) incubating a Tpl2 protein with the compound or compounds to be assessed; and (b) identifying those compounds which bind to the Tpl2 protein.

18. A pharmaceutical composition comprising a compound identified by a method according to any one of claims 8 to 17, capable of modulating the interaction of Tpl2 with pi 05.

19. A method of purifying Tpl2 protein, comprising the steps of: (a) culturing Saccharomyces cerevisiae cells, wherein: the cells express chromosomal genes and extra-chromosomal genes; the expressed extra-chromosomal genes include (i) a gene encoding a Tpl2 protein and (ii) a MOBl gene; and the expressed chromosomal genes do not include MOBl, and (b) purifying Tpl2 protein expressed by the cells.