WO2005075644A2 - Leader sequence and method for synthesizing polypepides in cell-free systems - Google Patents

Leader sequence and method for synthesizing polypepides in cell-free systems Download PDF

Info

Publication number
WO2005075644A2
WO2005075644A2 PCT/EP2005/001146 EP2005001146W WO2005075644A2 WO 2005075644 A2 WO2005075644 A2 WO 2005075644A2 EP 2005001146 W EP2005001146 W EP 2005001146W WO 2005075644 A2 WO2005075644 A2 WO 2005075644A2
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
poly
utr
translation
cell
Prior art date
Application number
PCT/EP2005/001146
Other languages
French (fr)
Other versions
WO2005075644A3 (en
Inventor
Anatoly Timofeevich Gudkov
Marija Vladimirovna Ozerova
Vyacheslav Mihailovich Shiryaev
Alexander-Sergeyevich Spirin
Original Assignee
Roche Diagnostics Gmbh
F. Hoffmann-La Roche Ag
Institute Of Protein Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Roche Diagnostics Gmbh, F. Hoffmann-La Roche Ag, Institute Of Protein Research filed Critical Roche Diagnostics Gmbh
Publication of WO2005075644A2 publication Critical patent/WO2005075644A2/en
Publication of WO2005075644A3 publication Critical patent/WO2005075644A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/60—Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]

Definitions

  • the invention relates to molecular biology and biotechnology, in particular, to creating genetic constructs to be used in protein synthesis in cell-free systems.
  • Enhancer elements are introduced either simultaneously in both the 5'- and 3 '-untranslated regions (Palmenberg, 1990) or only in the 5'- or 3 '-untranslated region. Genetic constructs for subsequent expression of genes are obtained either by their cloning in different vectors (Jendrisak, 1988; Palmenberg, 1990) or by PCR (Lanar, 1992; Kawarasaki et al., 2000), which excludes some stages in the DNA preparation and reproduction and simplifies the process.
  • a method for obtaining novel genetic constructs in which the mRNA leader 5'-UTR sequence of a virus coat protein is linked to any sequence coding for the target proteins (Gehrke, 1989).
  • Wilson (WO 87/07644, 1987, US 5.489.527) describes the use of the 5' untranslated region of tobacco mosaic virus (TMN) named OMEGA as an enhancer element of the mR ⁇ A translation in cells and cell-free systems.
  • Wilson further (WO 87/07644, 1987, US 5.891.665) gives examples of the use of 5 '-untranslated regions of tobacco mosaic virus (TMN), turnip yellow mosaic virus (TYMN), brome mosaic virus (BMN), alfalfa mosaic virus (A1MV) and rous sarcoma virus (RSN) for obtaining mRNAs with improved translation ability.
  • TNN tobacco mosaic virus
  • TMMN turnip yellow mosaic virus
  • BNN brome mosaic virus
  • A1MV alfalfa mosaic virus
  • RSN rous sarcoma virus
  • Endo proposes to choose the enhancer leader sequence from the following sequences: the main sequence of alfalfa mosaic virus (AMN), the main OMEGA sequence of tobacco mosaic virus (TMN), the sequence with 70% or more homology of the leader of alfalfa mosaic virus (AMN) and tobacco mosaic virus (TMN). It is further proposed that the above sequences will have no less than 70% initiation of translation activity as compared to that of mR ⁇ As in which CAP structures are used.
  • the purpose of this invention is to provide a new type of leader sequences that would provide for an efficient translation of mR ⁇ As in cell-free systems.
  • the present invention relates to appropriate leader sequences, containing poly(A) of 5 A to 35A nucleotides (adenine nucleotides) long or, alternatively, to appropriate leader sequences containing at least one nucleotide substitution in the poly(A) sequence that provides for enhanced mR ⁇ A translation in cell-free systems.
  • Another object of the invention is a method for synthesizing polypeptides in cell-free systems which is used first to obtain a genetic construct that contains a leader sequence in 5'-UTR including po- ly(A).
  • the length and content of the leader sequence that is the most efficient enhancer element is selected by the results of mR ⁇ A translation in eukaryotic cell-free systems at mR ⁇ A concentrations from 50 to 2000 pmol/ml.
  • FIG. 1 Translation of two types of GFP mR ⁇ As with poly(A) and omega 5'-UTR leaders in a dialysis translation system (CECF), continous Exchange Continous Flow, mR ⁇ A concentration is 500 pmol/ml.
  • CECF dialysis translation system
  • mR ⁇ A concentration 500 pmol/ml.
  • the search and analysis of primary sequences of novel mRNA leaders capable of enhancing mRNA translation in cell-free systems have revealed a non-evident fact that leader sequences containing poly(A) regions of 5 A to 35A long can be used as enhancer elements of CAP-dependent or CAP- independent translation in mRNA constructs.
  • the data received by the above procedure include, but is not limited to the types of cell-free systems, regimes of polypeptide synthesis and types of mRNA and DNA that can be obtained using a leader on the basis of poly(A).
  • the 5' -UTR leader sequence contains a poly(A) region joined to the initiator mRNA codon of up to 25 A long or a deletion of the poly(A) region in the range from 25 A to 5 A, or a combination of the poly(A) region with at least one nucleotide, or substitution of at least one nucleotide in a complete or deleted form of poly(A).
  • leader sequence contains oligo(A)-sequences of various length (5, 12 or 25 bases):
  • A Leader sequence of 5' -UTR consisting of 26 nucleotides.
  • SEQ ID No. 1 GAAAAAAAAAAAAAAAAAAAAAAAAAAA that includes 25A nucleotides (A 25 ).
  • B Leader sequence of 5' -UTR consisting of 13 nucleotides.
  • SEQ ID No. 2 GAAAAAAAAAAAA that includes 12A nucleotides (A 12 ).
  • C Leader sequence of 5'-UTR consisting of 6 nucleotides.
  • SEQ ID No. 3 GAAAAA that includes 5A nucleotides (A 5 ).
  • 3'-UTR sequences were chosen: viral, poly(A) and non-specific random sequence.
  • the 3'-UTR sequence of TMN consisting of 266 nucleotides was chosen as a viral sequence.
  • the poly(A) sequences used in the study were 10 (A 10 ) and 100 (A 10 o) nucleotides long.
  • Non-specific sequences were from plasmid pUC19 with the length of 13 nucleotides (SEQ ID No. 4), 190 nucleotides (SEQ ID No. 5), 250 nucleotides (SEQ ID No. 6) and 310 nucleotides (SEQ ID No. 7).
  • control mRNAs was a construct in which 5' -UTR contained the known omega-leader from TMV combined with 3 '-UTR TMN. Sequences of 5'- and 3 '-UTR are given in the Sequence listing.
  • the version of 5'-poly(A)-leaders given in SEQ ID No. 1 - SEQ No. 3 include, but do not limit possible versions of leader sequences that are chosen in the range from 6 to 36 nucleotides, preferably from 20 to 26 nucleotides.
  • plasmids (example 1) everyone of which includes: (a) the chosen promoter sequence, (b) the chosen DNA fragment whose sequence corresponds to the leader 5' -UTR region, (c) the gene coding for the chosen polypeptide sequence and (d) the DNA fragment corresponding to the chosen 3'-UTR sequence.
  • the obtained plasmids are reproduced using known methods.
  • To verify the efficiency of leader poly(A) sequences several plasmids are constructed which contain various reporter genes: the gene of a green fluorescent protein (GFP), the gene of luciferase (luc) and the gene of dehydropholate reductase (DHFR).
  • GFP green fluorescent protein
  • luc gene of luciferase
  • DHFR dehydropholate reductase
  • 5' -UTR obtained using poly(A) of different lengths
  • the 5'-UTR (OMEGA) leader from TMN
  • the leader contained in plasmid pGEMluc Promega Corp.
  • Plasmid constructs of GFP (Chambers et al, 1988) and luciferase luc (Zeyenko et al., 1994) are used as templates for synthesis during amplification of GFP, DHFR and luc genes.
  • the DHFR gene is recloned from plasmid pDF46 (Murzina et al., 1990).
  • the plasmid (Zeyenko et al., 1994) was used as a template during amplification of omega 5'- and 3'-UTR TMN.
  • the following plasmids were obtained: (1) pTZ ⁇ luc, (2) pAGU, (3) pTZ ⁇ GFP and (4) pTZ ⁇ DHFR.
  • plasmids can be purified and directly used for synthesizing target polypeptides in a cell-free system "upon coupled transcription-translation (Biryu- kov et al., 2000).
  • a comparison of the efficiency of translation of chosen mR ⁇ As is done in different modes of synthesis (batch, fed-batch, CECF, CFCF) using cell-free systems prepared in different ways (Roberts and Paterson, 1973; Erickson and Blobel, 1983; Madin et al., 2000).
  • the comparison is done at different concentrations of the plasmid or mR ⁇ A introduced in the cell-free system for the synthesis. This allows, for example, determining the influence of mR ⁇ A concentration on the yield of synthesis in a wide range of mR ⁇ A concentrations from 10 to 2000 pmol/ml.
  • the same procedure can be used to construct and test other recombinant palsmids that can contain different coding sites of polypeptide structures: (i) the sequence for coding single polypeptides, (ii) the sequence for coding different types of polypeptides in a tandem construct or a multimer sequence coding multiple recurrence of the same sequence or (iii) the target polypeptide sequence fused in the C- and N-termini with the TAG region having affinity properties.
  • the proteins can be purified after the synthesis with column chrornatography or gel electrophoresis or can be immobilized on a porous carrier with affinity properties in the reaction mixture during synthesis.
  • the synthesis of target GFP, DHFR and luc polypeptides have been exemplarily performed in a batch or a dialysis (CECF) mode.
  • the synthesized eukaryotic protein or polypeptide can be analogous to an appropriate animal or plant protein or polypeptide, represent a fragment of the latter or a homologous analogue or a functionally equivalent derivative. It can also represent a newly synthesized protein or polypeptide.
  • the range of application of such synthesized proteins includes but does not limit the preparation of enzymes, toxic and pharmacological peptides and synthesis of biopolymers for diagnostics.
  • another subject of a invention is a method for synthesizing polypeptides in a cell-free system in which at the first stage a genetic construct is obtained which contains a leader sequence in 5'-UTR including poly(A).
  • the length and composition of the leader sequence that is the most efficient enhancer is chosen by the results of mRNA translation or coupled transcription-translation of DNA in eukaryotic cell-free systems at mRNA concentrations from 50 to 2000 pmol/ml.
  • the mode of polypeptide synthesis is chosen from the following: static batch mode, dialysis CECF mode (Alakhov et al, 1995), dynamic mode with changeable parameters of the reaction mixture during synthesis (Biryukov et al, 2000), and flow-through CFCF mode (Spirin et al, 1988).
  • the composition of the reaction mixture and feeding solution with different types of cell-free extracts is determined.
  • the type of reactors (Biryukov et al, 2003) and the type of semi-permeable barriers are chosen.
  • the temperature is chosen and the synthesis is performed.
  • the invention additionally concerns a reaction kit for carrying out in vitro protein syntheses, for the translation or for the coupled in vitro transcription and translation of proteins in a cell-free system.
  • the kit is essentially composed of a solution essentially comprising a substance buffering between pH 7 and 8, ca. 150 to 400 mM potassium ions, ca. 10 to 50 mM magnesium ions, nucleotide tri- phosphates (ATP, CTP, GTP and UTP), ca. 20 different amino acids and a substance reducing sul- fide groups.
  • additional auxiliary substances such as stabilizers or inhibitors, e.g., RNase inliibitors, for preventing undesired reactions can be added to the solution.
  • the final solution for the reaction mixtures contains a leader sequence containing a nucleotide poly(A) sequence from 5 A to 35 A or a leader sequence containing an additional sequence linked to the complete or deleted construct of poly(A) sequence or containing at least one nucleotide substitution either in the complete or deleted poly(A) sequence that provides for enhanced mRNA translation in cell-free systems, a cell- free lysate i.e. a prokaryotic or eukaryotic ribosomal fraction, tRNA and an RNA polymerase.
  • a cell- free lysate i.e. a prokaryotic or eukaryotic ribosomal fraction
  • tRNA and an RNA polymerase it is preferable to not admix the components of the reaction mixture solutions that are different from the components of the basic solution until shortly before carrying out the reaction i.e. they are each present in separate vessels.
  • Insertion into the mRNA structure of a new poly(A) 5' -UTR leader in combination with TMN 3 '- UTR or with 3' -UTR of no less than 300 nucleotides makes it possible to carry out an efficient translation of various types of mR ⁇ As with coding sequences of different lengths.
  • Soft inhibition of translation by using a high concentration of mR ⁇ A with a poly(A) 5' -UTR leader allows for equal polypeptide and protein synthesis both at low (from 50 pmol/ml) and high (from 400 to 2000 pmol/ml) mR ⁇ A concentrations.
  • plasmids are constructed which contain the DNA fragment, whose 5' -UTR sequence includes the poly(A) sequence.
  • DNA fragment whose 5' -UTR sequence includes the poly(A) sequence.
  • reproduction and transcription mRNAs are obtained whose efficiency is tested in a cell-free translation system.
  • Plasmid pAGU was constructed using the pMTL22 plasmid (Chambers et al, 19S 8) in which a PCR fragment of GFP obtained from plasmid pB ADGFPcycle3 (Maxygen) was cloned in sites
  • Plasmid pTZ ⁇ GFP was obtained using the pTZ ⁇ luc plasmid (Zeyenko, 1994) in which a PCR fragment of GFP-TMV was cloned in sites Sall/EcoRI. Plasmid pTZ ⁇ DHFR was obtained using the pTZ ⁇ GFP plasmid in which the DHFR gene was recloned from plasmid pDF46 in sites Sall/Sacl (Murzina et al, 1990).
  • PCR fragments of all the above plasmids were obtained for transcription with the use of corresponding primers complementary to the 5 '-terminus of 5' -UTR and 3 '-terminus of 3' -UTR.
  • the 5 '-primer contains both the sequences of no less than any 5 nucleotides (to ensure efficient insertion of RNA polymerase) before the T7 promotor and a part of the sequence complementary to 5' -UTR.
  • E. coli cells can, for example, be used as host cells.
  • a valid LB solution contains the following: yeast extract (5 g/1), bactotrypton (10 g/1) and NaCl (5 g/1), pH 7.
  • yeast extract 5 g/1
  • bactotrypton 10 g/1
  • NaCl 5 g/1
  • pH 7. To prepare agarose solutions, agar is added to a concentration of 1.5%. The concentration of ampicillin in the E. coli mixture is 100 ⁇ g/ml.
  • To prepare indicator plates 200 ⁇ l of 2% X-gal solution and 40 ⁇ l of 100 mM IPTG solution are added to the molten agarose solution (per 100 ml). The temperature of cultivation is 37°C. Aeration, stirring and shaking are used to raise the efficiency of cell growth in a solution.
  • the expressed DNAs are isolated after cell disruption caused by pressure and ultrasound using known purification procedures.
  • DNA fragments suitable for transcription with T7 RNA polymerase are synthesized using PCR.
  • PCR As an example that includes but does not limit the subject of invention, below are given sequences of primers for preparation of a PCR fragment for transcription of mA (GFP)310 mRNA.
  • the primer is complementary to the plasmid region at a distance of 310 nucleotides from the stop- codon of the GFP gene.
  • Sequence SEQ ID No. 7 of mA 25 (G-FP)310 3'-UTR is given in the Sequence listing.
  • Composition of PCR mixture 100 ⁇ l of the reaction mixture contain 10 mM Tris-HCl, pH 8.5, 50 mM KC1, 2.5 mM MgCl 2 , 0.2 mM dNTPs (each), 20-50 ng plasmid DNA, 0.5 ⁇ M each primer, 2-3 units of Taq-DNA polymerase and 0.05-0.1 units of PwoDNA polymerase.
  • the yield of amplified DNA is 1-3 ⁇ g. If the yield is low, it is possible to amplify the system once again by using the universal and 3 '-terminal primers and the standard PCR procedure.
  • PCR products are extracted in a mixture of phenol and chloroform and dissolved in sterile TE buffer containing 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. Amplified DNA fragments are identified with electrophoresis in 4% polyacrylamide gel or in 1% agarose.
  • In-vitro transcription with T7 RNA is performed as described (Pokrovskaya and Gurevich, 1994). In-vitro transcription proceeds for 2-3 h at 37°C in 100 ⁇ l of the reaction mixture containing 120 mM HEPES-KOH, pH 7.6, 20 mM MgCl 2 , 20 mM DTT, 4 mM of each ribonucleoside triphosphate (ATP, GTP, CTP and UTP), 2 mM spermidine, 2-3 ⁇ g of PCR fragment, 50 units of a RNase inhibitor, e.g., RNAasine, 500 units of T7 RNA-polymerase.
  • a RNase inhibitor e.g., RNAasine
  • RNA is precipitated with 125 ⁇ l of 8 M LiCl (in the cold), the precipitate is dissolved in 140 ⁇ l of bidistilled water, and the RNA is precipitated with ethanol in the presence of 1 M ammonium acetate. The precipitate is washed twice with 80% and once with 95% ethyl alcohol, dissolved in water.
  • RNA preparations are analyzed in 4% PAGE. TAE is used as an electrophoretic buffer. Prior to layering the preparations are denatured during 5 min at 85°C in the buffer containing 95% forma- mide, 20 mM EDTA, 0.05% bromphenol Blue, 0.05% xylain cyanol. The electrophoresis is performed at a current of 30-40 mA. The gel is stained with etidium bromide and visualized in transmitted ultraviolet light.
  • mRNA translation is performed in a cell-free system using a wheat germ extract.
  • the reaction is run from 1 to 2 h at a temperature from 22°C to 30°C, most preferably at 25°C.
  • a wheat germ extract is prepared as described (Erickson and Blobel, 1983) or by the modified procedure described by Madin et al.,(2000).
  • the amount of the [ 14 C]-marker included in the syntliesized polypeptide is determined by analyzing 5 ⁇ l aliquots from the total reaction mixture volume and further precipitation of the sample with 5% solution of trichloroacetic acid.
  • a reaction mix ixe and a feeding solution are prepared.
  • the reaction mixture is prepared as described in ExampLe 5.
  • 25 ⁇ l of the feeding solution contain: 40 mM HEPES, pH 7.6, 1.7-3.5 mM Mg(OAc) 2 , 60-100 mM KOAc, 5 mM DTT, 2 mM ATP, 0.3 mM GTP, 0.25 mM spermidine, 16 mM creatine phosphate, 100 mM each of 20 amino acids.
  • the reaction is run from 15 to 40 h at a temperature from. 22°C to 30°C, most preferably at 25°C.
  • the ratio of the reaction mixture and the feeding solution is chosen from 5 to 15, if possible 1:10.
  • Pore dimensions in the dialysis membrane should be from. 10 to 30 kD. Membranes with pore dimensions from 12 to 15 kD are most suitable.
  • the reaction mixture is placed in a single-channel or multi-channel reactor which contains at least one semi-permeable barrier separating the reac-tion mixture and feeding solution (Alakhov et al, 1995).
  • the synthesis proceeds in a dynamic mode of exchange between low-molecular components of the feeding solution and the reaction mixture.
  • the components are exchanged either using dialysis (CECF mode) or in a dynamic flow-throug h of the feeding solution via the reaction mixture (CFCF mode).
  • CECF mode dialysis
  • CFCF mode dynamic flow-throug h of the feeding solution via the reaction mixture
  • the application of the RNA cons. tract described in this invention includes but does not limit its usage for synthesizing proteins in mRNA translation (Examples 5 and 6) or in coupled transcription-translation (Biryukov et al, 200(T).
  • mRNA capping is done co-translationally using a cap-scribe kit (Roche Diagnostics GmbH) as recommended in the manufacturer's manual. 50 ⁇ l the reaction mixture contain lx cap-scribe buffer, 0.5-1 ⁇ g DNA, 50-100 units of T7 RNA polymerase (Roche Diagnostics GmbH), 20-40 units RNAsine (Roche Diagnostics GmbH). The reaction is run for 2 h at 37°C, then the transcript is treated as described above and analyzed in 4% PAGE with stained ethidium bromide.
  • a cap-scribe kit Roche Diagnostics GmbH
  • the composition of the reaction mixture was as follows: lx buffer for poly(A) polymerase (the composition as given in the Amersham catalogue), 3 mM ATP, 2.5 mM MnCl 2 , 0.06 u/ ⁇ l poly(A) polymerase, 0.2-0.8 ⁇ g/ ⁇ l DNA.
  • the reaction is performed for 1 h at 37°C, then (1) deproteinized buffer (1% SDS, 100 mM NaCl, 20 mM Tris-HCl, pH 9.0) is added to the reaction mixture; (2) the mixture is treated with phenol saturated with Tris-HCl, pH 9.0; (3) the phenol/chloroform mixture (1:1) is used for treatment; (4) RNA is precipitated with 8 M LiCl; (5) RNA is tlirice washed with 70% ethanol and (6) the mixture is dissolved in bidistilled water (as usual for these kind of applications).
  • deproteinized buffer 1% SDS, 100 mM NaCl, 20 mM Tris-HCl, pH 9.0
  • the mixture is treated with phenol saturated with Tris-HCl, pH 9.0
  • the phenol/chloroform mixture (1:1) is used for treatment
  • RNA is precipitated with 8 M LiCl
  • RNA is tlirice washed with 70% ethanol and (6) the mixture is dissolved in bi
  • UTR contains poly(A) of different lengths (A5, A12, A25)
  • plasmids are constructed that contain a DNA fragment whose sequence conesponds to the length of the poly(A) leader region for the GFP gene, DHFR gene and luciferase gene.
  • DNA cloning reproduction and transcription such mRNAs are obtained whose efficiency is verified in a cell-free translation system in a batch mode at mRNA concentration of 200 pmol/ml.
  • Table 1 It has been found that the longer the 5'-poly(A) sequence is, the stronger is the effect enhancing translation. The best result was obtained with the 5'-GA 25 leader combined with TMV 5' -UTR. The enhancing effect of the 5'- poly(A) leader does not depend on the nature of the coding fragment. This has been demonstrated for three reporter-proteins used in the study: GFP, firefly luciferase and DHFR.
  • mRNA constructs containing the DHFR gene with different types of 5'-UTR are compared: (1) poly(A) 5' -UTR or omega 5' -UTR, (2) mRNA constructs containing the luciferase gene with different types of 5' -UTR, namely mRNA translation with poly(A) 5' -UTR compared to mRNA translation obtained with plasmid pGEMluc (Promega).
  • the synthesis is performed in a batch mode at the mRNA concentration of 200 pmol/ml.
  • the comparison shows approximately the same efficiency of translation between 5' -UTR: omega 5' -UTR and plasmid pGEMluc (Promega) constructs (see Table 2).
  • 5' -UTR mRNA contains poly(A) of different lengths (A5, A12, A25).
  • the synthesis is performed in a batch mode at the mRNA concentration of 200 pmol/ml: 1 r translation of mRNA containing the GFP gene; 2 - translation of mRNA containing the DHFR gene; 3 - translation of mRNA containing the luciferase gene.
  • the obtained GFP mRNA constructs are translated in a batch mode at the mRNA concentration of 200 pmol/ml and in a dialysis CECF mode at the mRNA concentration of 500 pmol/ml.
  • the results of comparison are given in the table.
  • the efficiency of mRNA containing the poly(A) 5' -UTR leader depends little on non-specific sequences used as 3' -UTR.
  • the amount of protein synthesized in a dialysis mode is proportional to the length of 3' -UTR which supports the protective function of the non-specific 3' -UTR preventing or retarding the 3 '-terminal degradation of mRNA.
  • Plasmids which contain theJDNA fragment with the sequence corresponding to the length (25 oli- gonucleotides) of the leader poly(A) region are constructed as described in Examples 1-4.
  • the GFP gene is used as a target product.
  • capped mRNA is obtained and then polyadenylated.
  • the efficiency of mRNA is verified in a cell- free translation system in a batch mode at different mRNA concentrations from 20 pmol/mol to 1000 pmol/ml.
  • Figure 1 shows the results of translation in a dialysis CECF mode of two GFP mRNAs containing TMV 3'-UTR and different leader sequences with poly(A) 5'-UTR and omega 5'-UTR.
  • the results of mRNA translation show that the efficiency of the leader sequence on the base of poly(A) 5' -UTR included in mRNAs is similar to that of mRNA which contains the known omega 5' -UTR leader.
  • a polyadenylated 3'UTR of 100 nucleotides long and (b) leader sequences of 5'UTR based on a 25-nt poly(A) or an omega 5'UTR leader.
  • different versions of plasmids are constructed in such a way that they would contain various DNA fragments whose sequences correspond to the chosen leader region 5'UTR.
  • an uncapped or capped mRNA is obtained (see Example 7) which is polyadenylated with E. coli poly(A) polymerase (see Example 8).
  • the mRNA efficiency is checked in a cell-free system with reticulocyte lysate in a batch mode.
  • the reticulocyte lysate is either prepared as described by Pelham and Jackson (1976) or a lysate produced commercially available, e.g., by Roche Diagnostics GmbH is used.
  • the reaction is performed in 20 ⁇ l reaction mixture containing 20 mM HEPES-KOH, pH 7.6; 2 mM magnesium acetate; 100 mM potassium acetate; 1 mM DTT; 1 mM ATP; 0.2 mM GTP; 0.5 mM spermidine; 8 mM creatine phostate; 60 ⁇ g/ml creatine ldnase (350 u/mg); 100 ⁇ M of each of 19 amino acids (excluding leucine); 100 ⁇ M [ 14 C]leucine (320 mCu/mmol); 100 pmol/ml mRNA; 8 ⁇ l reticulocyte lysate. The reaction is done for 1 h at 30°C. The amount of incorporated [ 14 C]leucine is determined in 3 ⁇ l aliquots precipitated with hot 5% trichloroacetic acid.
  • Murzina NV Gudkov AT, Invariant amino acid replacement affects the dihydrofolate reductase function and its gene expression, Protein Eng. Aug; 3(8): 709-712 (1990).
  • RNAs of a strongly-expressed late gene of cowpox virus contain 5 '-terminal ⁇ oly(A) sequences, EMBO, vol. 6, no.12, pp.3787-3794 (1987)
  • Wilson T. M. A. Translation of m-RNA. WO87/07644 (17.12.1987), US 5.489.527 (06.03. 1996) Wilson T. M., Untranslated leader sequences from RNA viruses as enhancers of translation, US 5.891.665 (April 6, 1999)

Abstract

The invention pertains to the leader sequence that provides for enhancement of mRNA translation in cell-free systems. The 5’-UTR leader sequence contains poly(A) region joined to the initiator mRNA codon of up to 25A long or a deletion of the poly(A) region in the range from 25A to 5A, or a combination of the poly(A) region with at least one nucleotide, or a substitution of at least one nucleotide in a complete or deleted form of poly(A). The invention pertains also to the method for synthesis of polypeptides in cell-free systems, wherein at the first stage a genetic construct is obtained that contains a leader sequence in the 5’-UTR which includes poly(A); the length and composition of the leader sequence are chosen by the results of mRNA translation or coupled transcription-translation of DNA in eukaryotic cell-free systems at mRNA concentrations from 50 to 2000 pmol/ml.

Description

LEADER SEQUENCE AND METHOD FOR SYNTHESIZING POLYPEPIDES IN CELL-FREE SYSTEMS
The invention relates to molecular biology and biotechnology, in particular, to creating genetic constructs to be used in protein synthesis in cell-free systems.
There are methods for protein synthesis in cell-free systems based on prokaryotic and eukaryotic extracts and lysates (Spirin et al., 1988; Alakhov et al., 1995).
The efficiency of synthesis in cell-free systems can be increased by constructing new types of mRNAs that would include leader sequences with enhancer functions. Enhancer elements are introduced either simultaneously in both the 5'- and 3 '-untranslated regions (Palmenberg, 1990) or only in the 5'- or 3 '-untranslated region. Genetic constructs for subsequent expression of genes are obtained either by their cloning in different vectors (Jendrisak, 1988; Palmenberg, 1990) or by PCR (Lanar, 1992; Kawarasaki et al., 2000), which excludes some stages in the DNA preparation and reproduction and simplifies the process.
In most cases the lαiown enhancer elements existing in 5'-UTR of mRNA use sequences from plant or other viruses.
A method is known for obtaining novel genetic constructs in which the mRNA leader 5'-UTR sequence of a virus coat protein is linked to any sequence coding for the target proteins (Gehrke, 1989).
Wilson (WO 87/07644, 1987, US 5.489.527) describes the use of the 5' untranslated region of tobacco mosaic virus (TMN) named OMEGA as an enhancer element of the mRΝA translation in cells and cell-free systems. Wilson further (WO 87/07644, 1987, US 5.891.665) gives examples of the use of 5 '-untranslated regions of tobacco mosaic virus (TMN), turnip yellow mosaic virus (TYMN), brome mosaic virus (BMN), alfalfa mosaic virus (A1MV) and rous sarcoma virus (RSN) for obtaining mRNAs with improved translation ability. Kawasaki et al. (2000) used a 29-nucleotide enhancer from the conservative region of tobacco virus 5'-UTR to express genes in a cell-free system. Endo (WO/017260, 2001) proposes to choose the enhancer leader sequence from the following sequences: the main sequence of alfalfa mosaic virus (AMN), the main OMEGA sequence of tobacco mosaic virus (TMN), the sequence with 70% or more homology of the leader of alfalfa mosaic virus (AMN) and tobacco mosaic virus (TMN). It is further proposed that the above sequences will have no less than 70% initiation of translation activity as compared to that of mRΝAs in which CAP structures are used.
Consequently, the purpose of this invention is to provide a new type of leader sequences that would provide for an efficient translation of mRΝAs in cell-free systems.
The above problem is resolved by using both the poly(A) leader sequence in the 5'UTR and the construct prepared from mRΝA and DΝA, in which poly(A) fragment is inserted in 5'UTR adjacent to the site of initiation of translation.
The present invention relates to appropriate leader sequences, containing poly(A) of 5 A to 35A nucleotides (adenine nucleotides) long or, alternatively, to appropriate leader sequences containing at least one nucleotide substitution in the poly(A) sequence that provides for enhanced mRΝA translation in cell-free systems.
Another object of the invention is a method for synthesizing polypeptides in cell-free systems which is used first to obtain a genetic construct that contains a leader sequence in 5'-UTR including po- ly(A). The length and content of the leader sequence that is the most efficient enhancer element is selected by the results of mRΝA translation in eukaryotic cell-free systems at mRΝA concentrations from 50 to 2000 pmol/ml.
Brief Description of the Figure
Figure 1. Translation of two types of GFP mRΝAs with poly(A) and omega 5'-UTR leaders in a dialysis translation system (CECF), continous Exchange Continous Flow, mRΝA concentration is 500 pmol/ml. The search and analysis of primary sequences of novel mRNA leaders capable of enhancing mRNA translation in cell-free systems have revealed a non-evident fact that leader sequences containing poly(A) regions of 5 A to 35A long can be used as enhancer elements of CAP-dependent or CAP- independent translation in mRNA constructs.
It is known that late mRNAs of smallpox viruses are intensively translated templates_within host cells. Their high translatability depends on polyadenylic poly(A) sequences of 5' -UTR. The length of a poly(A) leader is determined to be from 5 to 21 nucleotides (Patel and Pickup 1987) or 35 nucleotides (Schwer et al., 1987). However it is not known whether poly(A) leaders are used for creating new types of mRNAs or plasmids for cell-free synthesis of biopolymers.
To confirm the efficiency of translation of mRNAs containing the leader sequence of 5' -UTR poly(A), the following steps were carried out: (a) different mRNAs containing both the above 5'- UTR sequence and different 3' -UTR sequences "were studied, (b) different coding regions were used, (c) the dependence of the efficiency of translation on mRNA concentration was analyzed, (d) novel leaders contained in 5' -UTR were compared with known viral leaders and (e) the efficiency of translation in different modes of synthesis was tested.
The data received by the above procedure include, but is not limited to the types of cell-free systems, regimes of polypeptide synthesis and types of mRNA and DNA that can be obtained using a leader on the basis of poly(A).
The 5' -UTR leader sequence contains a poly(A) region joined to the initiator mRNA codon of up to 25 A long or a deletion of the poly(A) region in the range from 25 A to 5 A, or a combination of the poly(A) region with at least one nucleotide, or substitution of at least one nucleotide in a complete or deleted form of poly(A).
1.Choice of the Leader Sequence Composition
To study the translation activity of mRNAs with 5'-poly(A) leaders, some constructs have been created in which the leader sequence contains oligo(A)-sequences of various length (5, 12 or 25 bases): (A) Leader sequence of 5' -UTR consisting of 26 nucleotides. (SEQ ID No. 1) GAAAAAAAAAAAAAAAAAAAAAAAAA that includes 25A nucleotides (A25). (B) Leader sequence of 5' -UTR consisting of 13 nucleotides. (SEQ ID No. 2) GAAAAAAAAAAAA that includes 12A nucleotides (A12). (C) Leader sequence of 5'-UTR consisting of 6 nucleotides. (SEQ ID No. 3) GAAAAA that includes 5A nucleotides (A5).
To study the dependence of mRNA translation activity on the composition of 3' -UTR, three types of 3'-UTR sequences were chosen: viral, poly(A) and non-specific random sequence. The 3'-UTR sequence of TMN consisting of 266 nucleotides was chosen as a viral sequence. The poly(A) sequences used in the study were 10 (A10) and 100 (A10o) nucleotides long. Non-specific sequences were from plasmid pUC19 with the length of 13 nucleotides (SEQ ID No. 4), 190 nucleotides (SEQ ID No. 5), 250 nucleotides (SEQ ID No. 6) and 310 nucleotides (SEQ ID No. 7).
One of the control mRNAs was a construct in which 5' -UTR contained the known omega-leader from TMV combined with 3 '-UTR TMN. Sequences of 5'- and 3 '-UTR are given in the Sequence listing.
The version of 5'-poly(A)-leaders given in SEQ ID No. 1 - SEQ No. 3 include, but do not limit possible versions of leader sequences that are chosen in the range from 6 to 36 nucleotides, preferably from 20 to 26 nucleotides.
2. Construction of Recombinant DNAs
An insertion of sequences coding for 5' -UTR into the DNA molecule and DNA reproduction are made using the following known methods of genetic engineering: cloning, PCR, mutagenesis, chemical synthesis.
Genetic engineering is used to construct recombinant plasmids (example 1) everyone of which includes: (a) the chosen promoter sequence, (b) the chosen DNA fragment whose sequence corresponds to the leader 5' -UTR region, (c) the gene coding for the chosen polypeptide sequence and (d) the DNA fragment corresponding to the chosen 3'-UTR sequence. The obtained plasmids are reproduced using known methods. To verify the efficiency of leader poly(A) sequences, several plasmids are constructed which contain various reporter genes: the gene of a green fluorescent protein (GFP), the gene of luciferase (luc) and the gene of dehydropholate reductase (DHFR). The choice of this type of proteins is explained by a fast and simple determination of their physical and chemical parameters (e.g. biological activity or molecular weight) after synthesis.
To compare the efficiency of different types of 5' -UTR, the following are used: 5' -UTR obtained using poly(A) of different lengths, the 5'-UTR (OMEGA) leader from TMN and the leader contained in plasmid pGEMluc (Promega Corp.). Plasmid constructs of GFP (Chambers et al, 1988) and luciferase luc (Zeyenko et al., 1994) are used as templates for synthesis during amplification of GFP, DHFR and luc genes. The DHFR gene is recloned from plasmid pDF46 (Murzina et al., 1990). The plasmid (Zeyenko et al., 1994) was used as a template during amplification of omega 5'- and 3'-UTR TMN. The following plasmids were obtained: (1) pTZΩluc, (2) pAGU, (3) pTZΩGFP and (4) pTZΩDHFR.
3. Efficiency of Genetic Constructs Containing 5'-poly(A Leader
In the principle two methods are available to improve the efficiency of genetic constructs containing 5'-poly(A) leader sequences. According to the first method, DΝA transcription is done (Example 4) and then the obtained mRΝAs are used for synthesizing the target polypeptide in a cell-free system (Examples 5-6). According to the second method, plasmids can be purified and directly used for synthesizing target polypeptides in a cell-free system "upon coupled transcription-translation (Biryu- kov et al., 2000). A comparison of the efficiency of translation of chosen mRΝAs is done in different modes of synthesis (batch, fed-batch, CECF, CFCF) using cell-free systems prepared in different ways (Roberts and Paterson, 1973; Erickson and Blobel, 1983; Madin et al., 2000). The comparison is done at different concentrations of the plasmid or mRΝA introduced in the cell-free system for the synthesis. This allows, for example, determining the influence of mRΝA concentration on the yield of synthesis in a wide range of mRΝA concentrations from 10 to 2000 pmol/ml. While analyzing translation efficiency of different types of mRΝAs containing a poly(A)- leader it was surprisingly observed that such mRNAs do not inhibit translation at high mRNA concentrations, e.g. at 1000 pmol/ml (see Example 12).
The same procedure can be used to construct and test other recombinant palsmids that can contain different coding sites of polypeptide structures: (i) the sequence for coding single polypeptides, (ii) the sequence for coding different types of polypeptides in a tandem construct or a multimer sequence coding multiple recurrence of the same sequence or (iii) the target polypeptide sequence fused in the C- and N-termini with the TAG region having affinity properties. By using these properties the proteins can be purified after the synthesis with column chrornatography or gel electrophoresis or can be immobilized on a porous carrier with affinity properties in the reaction mixture during synthesis. For the instant invention the synthesis of target GFP, DHFR and luc polypeptides have been exemplarily performed in a batch or a dialysis (CECF) mode.
The synthesized eukaryotic protein or polypeptide can be analogous to an appropriate animal or plant protein or polypeptide, represent a fragment of the latter or a homologous analogue or a functionally equivalent derivative. It can also represent a newly synthesized protein or polypeptide. The range of application of such synthesized proteins includes but does not limit the preparation of enzymes, toxic and pharmacological peptides and synthesis of biopolymers for diagnostics.
Therefore, another subject of a invention is a method for synthesizing polypeptides in a cell-free system in which at the first stage a genetic construct is obtained which contains a leader sequence in 5'-UTR including poly(A). The length and composition of the leader sequence that is the most efficient enhancer is chosen by the results of mRNA translation or coupled transcription-translation of DNA in eukaryotic cell-free systems at mRNA concentrations from 50 to 2000 pmol/ml. The mode of polypeptide synthesis is chosen from the following: static batch mode, dialysis CECF mode (Alakhov et al, 1995), dynamic mode with changeable parameters of the reaction mixture during synthesis (Biryukov et al, 2000), and flow-through CFCF mode (Spirin et al, 1988). The composition of the reaction mixture and feeding solution with different types of cell-free extracts is determined. The type of reactors (Biryukov et al, 2003) and the type of semi-permeable barriers are chosen. The temperature is chosen and the synthesis is performed. The invention additionally concerns a reaction kit for carrying out in vitro protein syntheses, for the translation or for the coupled in vitro transcription and translation of proteins in a cell-free system. The kit is essentially composed of a solution essentially comprising a substance buffering between pH 7 and 8, ca. 150 to 400 mM potassium ions, ca. 10 to 50 mM magnesium ions, nucleotide tri- phosphates (ATP, CTP, GTP and UTP), ca. 20 different amino acids and a substance reducing sul- fide groups. Moreover, additional auxiliary substances such as stabilizers or inhibitors, e.g., RNase inliibitors, for preventing undesired reactions can be added to the solution. The final solution for the reaction mixtures contains a leader sequence containing a nucleotide poly(A) sequence from 5 A to 35 A or a leader sequence containing an additional sequence linked to the complete or deleted construct of poly(A) sequence or containing at least one nucleotide substitution either in the complete or deleted poly(A) sequence that provides for enhanced mRNA translation in cell-free systems, a cell- free lysate i.e. a prokaryotic or eukaryotic ribosomal fraction, tRNA and an RNA polymerase. According to the invention it is preferable to not admix the components of the reaction mixture solutions that are different from the components of the basic solution until shortly before carrying out the reaction i.e. they are each present in separate vessels.
Insertion into the mRNA structure of a new poly(A) 5' -UTR leader in combination with TMN 3 '- UTR or with 3' -UTR of no less than 300 nucleotides makes it possible to carry out an efficient translation of various types of mRΝAs with coding sequences of different lengths. Soft inhibition of translation by using a high concentration of mRΝA with a poly(A) 5' -UTR leader allows for equal polypeptide and protein synthesis both at low (from 50 pmol/ml) and high (from 400 to 2000 pmol/ml) mRΝA concentrations. This facilitates the use of such mRΝAs for synthesis and testing of different target polypeptides in batch systems when the amount of the reaction mixture is 5 μl and more and the efficient use of mRΝAs in reaction systems with modified extracts having higher concentrations due to their preliminary treatment.
In batch systems high concentrations of mRΝA or DΝA result in a higher yield of the product because part of the RΝA is preserved to the end of the synthesis and the synthesis does not terminate due to complete RΝA degradation, which is a limiting factor for standard systems. In dynamic (fed- batch, CECF, CFCF) systems the use of new leader sequences with poly(A) 5'-UTR provides for a wider choice of modes and conditions of synthesis, including elimination of a multiple input of mRΝA portions of low concentration during the synthesis. The invention can find use in research and applied studies for synthesis of novel types of proteins and polypeptides.
The invention is illustrated by the examples given below which include but do not limit the range of its application. As shown in the examples, plasmids are constructed which contain the DNA fragment, whose 5' -UTR sequence includes the poly(A) sequence. As a result of DNA cloning, reproduction and transcription mRNAs are obtained whose efficiency is tested in a cell-free translation system.
EXAMPLE 1
Construction of Plasmid pAGU
Plasmid pAGU was constructed using the pMTL22 plasmid (Chambers et al, 19S 8) in which a PCR fragment of GFP obtained from plasmid pB ADGFPcycle3 (Maxygen) was cloned in sites
Kpnl/Hindlll. Plasmid pTZΩGFP was obtained using the pTZΩluc plasmid (Zeyenko, 1994) in which a PCR fragment of GFP-TMV was cloned in sites Sall/EcoRI. Plasmid pTZΩDHFR was obtained using the pTZΩGFP plasmid in which the DHFR gene was recloned from plasmid pDF46 in sites Sall/Sacl (Murzina et al, 1990).
According to the present invention PCR fragments of all the above plasmids were obtained for transcription with the use of corresponding primers complementary to the 5 '-terminus of 5' -UTR and 3 '-terminus of 3' -UTR. hi all cases the 5 '-primer contains both the sequences of no less than any 5 nucleotides (to ensure efficient insertion of RNA polymerase) before the T7 promotor and a part of the sequence complementary to 5' -UTR.
The sequencing listing enclosed provides exemplified data on primers and sequences of 3' -UTR for obtaining a PCR-fragment for the transcription and accumulation of mA 5(GFP)310 mRNA as shown in the following. EXAMPLE 2 Cloning
The method of cloning is widely used (Sambrook et al, 1989). It is based on the choice of the type of host cells, insertion of prepared recombinant vectors in said host cells, reproduction of the cells in appropriate media, DNA isolation and purification. E. coli cells can, for example, be used as host cells.
To grow transformed E. coli bacteria, a valid LB solution is used that contains the following: yeast extract (5 g/1), bactotrypton (10 g/1) and NaCl (5 g/1), pH 7. To prepare agarose solutions, agar is added to a concentration of 1.5%. The concentration of ampicillin in the E. coli mixture is 100 μg/ml. To prepare indicator plates, 200 μl of 2% X-gal solution and 40 μl of 100 mM IPTG solution are added to the molten agarose solution (per 100 ml). The temperature of cultivation is 37°C. Aeration, stirring and shaking are used to raise the efficiency of cell growth in a solution. The expressed DNAs are isolated after cell disruption caused by pressure and ultrasound using known purification procedures.
EXAMPLE 3 Obtaining PCR products
DNA fragments suitable for transcription with T7 RNA polymerase are synthesized using PCR. As an example that includes but does not limit the subject of invention, below are given sequences of primers for preparation of a PCR fragment for transcription of mA (GFP)310 mRNA.
PCR was performed on plasmid pAGU using primers:
SEQ ID No.8
5'- ACCATGGGGTACCATTAATACGACTCACTATA Ncol Kpnl T7-promoter GAAAAAAAAAAAAAAAAAAAAAAAAA 5'poly(A) ATG ACT AGC AAA GGA GAA GAA C -3 ' Met Thr Ser Lys Gly Glu Glu SEQ ID No.9 5'-AGCTGATACCGCTCGCC-3'
The primer is complementary to the plasmid region at a distance of 310 nucleotides from the stop- codon of the GFP gene. Sequence SEQ ID No. 7 of mA25(G-FP)310 3'-UTR is given in the Sequence listing.Composition of PCR mixture 100 μl of the reaction mixture contain 10 mM Tris-HCl, pH 8.5, 50 mM KC1, 2.5 mM MgCl2, 0.2 mM dNTPs (each), 20-50 ng plasmid DNA, 0.5 μM each primer, 2-3 units of Taq-DNA polymerase and 0.05-0.1 units of PwoDNA polymerase.
Conditions for PCR
(1) Denaturation: 95°C, 30 min (2) Annealing: the temperature is chosen to comply with. Tm of primers, 30 min (3) Elongation: 72°C, the duration depends on the lengfJh of the fragment synthesized (providing lOOO bp/min).
As a rule, the yield of amplified DNA is 1-3 μg. If the yield is low, it is possible to amplify the system once again by using the universal and 3 '-terminal primers and the standard PCR procedure.
PCR products are extracted in a mixture of phenol and chloroform and dissolved in sterile TE buffer containing 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. Amplified DNA fragments are identified with electrophoresis in 4% polyacrylamide gel or in 1% agarose.
The obtained PCR fragments are purified and used either di rectly in the coupled transcription- translation or for preparing mRNAs by means of transcription. EXAMPLE 4 In-vitro transcription
In-vitro transcription with T7 RNA is performed as described (Pokrovskaya and Gurevich, 1994). In-vitro transcription proceeds for 2-3 h at 37°C in 100 μl of the reaction mixture containing 120 mM HEPES-KOH, pH 7.6, 20 mM MgCl2, 20 mM DTT, 4 mM of each ribonucleoside triphosphate (ATP, GTP, CTP and UTP), 2 mM spermidine, 2-3 μg of PCR fragment, 50 units of a RNase inhibitor, e.g., RNAasine, 500 units of T7 RNA-polymerase.
After termination of the reaction the volume of the reaction mixture is adjusted to 200 μl by adding water, extracted first in 100 μl of acid phenol and then in 100 μl of phenol/chloroform mixture (1:1). RNA is precipitated with 125 μl of 8 M LiCl (in the cold), the precipitate is dissolved in 140 μl of bidistilled water, and the RNA is precipitated with ethanol in the presence of 1 M ammonium acetate. The precipitate is washed twice with 80% and once with 95% ethyl alcohol, dissolved in water.
RNA preparations are analyzed in 4% PAGE. TAE is used as an electrophoretic buffer. Prior to layering the preparations are denatured during 5 min at 85°C in the buffer containing 95% forma- mide, 20 mM EDTA, 0.05% bromphenol Blue, 0.05% xylain cyanol. The electrophoresis is performed at a current of 30-40 mA. The gel is stained with etidium bromide and visualized in transmitted ultraviolet light.
EXAMPLE 5 mRNA translation in a batch mode
mRNA translation is performed in a cell-free system using a wheat germ extract. In a batch mode 25 μl of the reaction mixture is used (40 mM HEPES, pH 7.6, 1.7-3.5 mM Mg(OAc)2, 60-100 mM KOAc, 5 mM DTT, 2 mM ATP, 0.3 mM GTP, 0.25 mM spermidine, 0.03% NaN3, 16 mM creatine phosphate, 60 μg/ml creatine kinase (350 u/mg), 500 u/ml RNAsin; 100 μM each of 20 amino acids, 40-1500 pmol/ml mRNA, 8 μl of wheat extract (OD26o=120-200 ou/ml). The reaction is run from 1 to 2 h at a temperature from 22°C to 30°C, most preferably at 25°C. A wheat germ extract is prepared as described (Erickson and Blobel, 1983) or by the modified procedure described by Madin et al.,(2000). The amount of the [14C]-marker included in the syntliesized polypeptide is determined by analyzing 5 μl aliquots from the total reaction mixture volume and further precipitation of the sample with 5% solution of trichloroacetic acid.
EXAMPLE 6 mRNA translation in a dialysis CECF mode
To synthesize polypeptides in a dialysis mode, a reaction mix ixe and a feeding solution are prepared. The reaction mixture is prepared as described in ExampLe 5. 25 μl of the feeding solution contain: 40 mM HEPES, pH 7.6, 1.7-3.5 mM Mg(OAc)2, 60-100 mM KOAc, 5 mM DTT, 2 mM ATP, 0.3 mM GTP, 0.25 mM spermidine, 16 mM creatine phosphate, 100 mM each of 20 amino acids. The reaction is run from 15 to 40 h at a temperature from. 22°C to 30°C, most preferably at 25°C. The ratio of the reaction mixture and the feeding solution, is chosen from 5 to 15, if possible 1:10. Pore dimensions in the dialysis membrane should be from. 10 to 30 kD. Membranes with pore dimensions from 12 to 15 kD are most suitable.
To test the efficiency of genetic constructs obtained for synthesizing target protein with a yield over 0.5-1.0 mg/ml, the reaction mixture is placed in a single-channel or multi-channel reactor which contains at least one semi-permeable barrier separating the reac-tion mixture and feeding solution (Alakhov et al, 1995). The synthesis proceeds in a dynamic mode of exchange between low-molecular components of the feeding solution and the reaction mixture. The components are exchanged either using dialysis (CECF mode) or in a dynamic flow-throug h of the feeding solution via the reaction mixture (CFCF mode). The application of the RNA cons. tract described in this invention includes but does not limit its usage for synthesizing proteins in mRNA translation (Examples 5 and 6) or in coupled transcription-translation (Biryukov et al, 200(T).
EXAMPLE 7 mRNA Capping
mRNA capping is done co-translationally using a cap-scribe kit (Roche Diagnostics GmbH) as recommended in the manufacturer's manual. 50 μl the reaction mixture contain lx cap-scribe buffer, 0.5-1 μg DNA, 50-100 units of T7 RNA polymerase (Roche Diagnostics GmbH), 20-40 units RNAsine (Roche Diagnostics GmbH). The reaction is run for 2 h at 37°C, then the transcript is treated as described above and analyzed in 4% PAGE with stained ethidium bromide.
EXAMPLE 8 mRNA polyadenylation
The composition of the reaction mixture was as follows: lx buffer for poly(A) polymerase (the composition as given in the Amersham catalogue), 3 mM ATP, 2.5 mM MnCl2, 0.06 u/μl poly(A) polymerase, 0.2-0.8 μg/μl DNA.
The reaction is performed for 1 h at 37°C, then (1) deproteinized buffer (1% SDS, 100 mM NaCl, 20 mM Tris-HCl, pH 9.0) is added to the reaction mixture; (2) the mixture is treated with phenol saturated with Tris-HCl, pH 9.0; (3) the phenol/chloroform mixture (1:1) is used for treatment; (4) RNA is precipitated with 8 M LiCl; (5) RNA is tlirice washed with 70% ethanol and (6) the mixture is dissolved in bidistilled water (as usual for these kind of applications).
EXAMPLE 9
Comparison of translation efficiency of mRNAs with different coding regions whose mRNA 5'-
UTR contains poly(A) of different lengths (A5, A12, A25)
As described in Examples 1-4, plasmids are constructed that contain a DNA fragment whose sequence conesponds to the length of the poly(A) leader region for the GFP gene, DHFR gene and luciferase gene. As a result of DNA cloning, reproduction and transcription such mRNAs are obtained whose efficiency is verified in a cell-free translation system in a batch mode at mRNA concentration of 200 pmol/ml. The results of comparison are shown in Table 1. It has been found that the longer the 5'-poly(A) sequence is, the stronger is the effect enhancing translation. The best result was obtained with the 5'-GA25 leader combined with TMV 5' -UTR. The enhancing effect of the 5'- poly(A) leader does not depend on the nature of the coding fragment. This has been demonstrated for three reporter-proteins used in the study: GFP, firefly luciferase and DHFR. EXAMPLE 10
Comparison of translation efficiency of mRNAs containing DHFR gene or luciferase gene with different types of 5' -UTR sequence
mRNA constructs containing the DHFR gene with different types of 5'-UTR are compared: (1) poly(A) 5' -UTR or omega 5' -UTR, (2) mRNA constructs containing the luciferase gene with different types of 5' -UTR, namely mRNA translation with poly(A) 5' -UTR compared to mRNA translation obtained with plasmid pGEMluc (Promega). The synthesis is performed in a batch mode at the mRNA concentration of 200 pmol/ml. The comparison shows approximately the same efficiency of translation between 5' -UTR: omega 5' -UTR and plasmid pGEMluc (Promega) constructs (see Table 2).
Table 1. Comparison of translation efficiency of mRNAs with different coding regions. 5' -UTR mRNA contains poly(A) of different lengths (A5, A12, A25). The synthesis is performed in a batch mode at the mRNA concentration of 200 pmol/ml: 1 r translation of mRNA containing the GFP gene; 2 - translation of mRNA containing the DHFR gene; 3 - translation of mRNA containing the luciferase gene.
Figure imgf000015_0001
Table 2. Comparison of translation efficiency of mRNAs containing the DHFR gene or the luciferase gene with different types of 5' -UTR sequences. The synthesis is performed in a batch mode at the mRNA concentration of 200 pmol/ml: 1 - translation of DHFR mRNA that contains poly(A) 5'- UTR or omega 5' -UTR; 2 - translation of luc mRNA that contains poly (A) 5' -UTR as compared to the translation of mRNA isolated from plasmid pGEMluc (Promega).
Figure imgf000016_0001
EXAMPLE 11
Comparison of translation efficiency of different types of GFP mRNAs in which poly(A) is used as 5' -UTR and different lengths of random sequences isolated from plasmid pUC19 or TMV 3 '-UTR sequence are used as 3 '-UTR
The obtained GFP mRNA constructs are translated in a batch mode at the mRNA concentration of 200 pmol/ml and in a dialysis CECF mode at the mRNA concentration of 500 pmol/ml. The results of comparison are given in the table. The efficiency of mRNA containing the poly(A) 5' -UTR leader depends little on non-specific sequences used as 3' -UTR. The amount of protein synthesized in a dialysis mode is proportional to the length of 3' -UTR which supports the protective function of the non-specific 3' -UTR preventing or retarding the 3 '-terminal degradation of mRNA.
Table 3. Comparison of translation efficiency of different GFP mRNAs in which poly(A) is used as 5 ' -UTR and both random sequences of a different length isolated from plasmid pUC 19 and the TMV 3 '-UTR sequence are used as 3 '-UTR. (A) The synthesis is performed in a batch mode at the mRNA concentration of 200 pmol/ml. (B) The synthesis is performed in the CECF mode at the mRNA concentration of 500 pmol/ml.
Figure imgf000017_0001
EXAMPLE 12
Comparison of translation efficiency of GFP mRNA depending on the presence of Cap structure in
5' -UTR and poly(A) in 3' -UTR for different .concentrations of the template
Plasmids which contain theJDNA fragment with the sequence corresponding to the length (25 oli- gonucleotides) of the leader poly(A) region are constructed as described in Examples 1-4. The GFP gene is used as a target product. As a result of cloning, reproduction and transcription of DNA, capped mRNA is obtained and then polyadenylated. The efficiency of mRNA is verified in a cell- free translation system in a batch mode at different mRNA concentrations from 20 pmol/mol to 1000 pmol/ml.
Polyadenylation of the 3 '-terminus of GFP mRNA with a 5'-GA25-leader does not lead to enhancement of translation if the 5 '-terminus is not capped (see Table 4). Similarly the insertion of the CAP structure on mRNA without the polyadenylated 3 '-terminus does not enhance the translation. Only the presence of both the CAP structure and the 3 '-polyadenylated region on a template molecule enhances the translation activity two times. The increase in the mRNA concentration from 100 to 1000 pmol/ml does not lead to a noticeable decrease in the translation efficiency.
Table 4. Comparison of efficiency of GFP mRNA translation depending on the presence of CAP structure in 5' -UTR and ρoly(A) in 3' -UTR for different template concentrations
Figure imgf000018_0001
Figure 1 shows the results of translation in a dialysis CECF mode of two GFP mRNAs containing TMV 3'-UTR and different leader sequences with poly(A) 5'-UTR and omega 5'-UTR. The results of mRNA translation show that the efficiency of the leader sequence on the base of poly(A) 5' -UTR included in mRNAs is similar to that of mRNA which contains the known omega 5' -UTR leader. EXAMPLE 13
Translation of GFP mRNA in cell-free reticulocyte lysate
A comparison is made of the results of translation of several versions of GFP mRNA which include: (a) a polyadenylated 3'UTR of 100 nucleotides long and (b) leader sequences of 5'UTR based on a 25-nt poly(A) or an omega 5'UTR leader. As described in Examples 1-4, different versions of plasmids are constructed in such a way that they would contain various DNA fragments whose sequences correspond to the chosen leader region 5'UTR. As a result of DNA cloning, repro- duction and transcription, an uncapped or capped mRNA is obtained (see Example 7) which is polyadenylated with E. coli poly(A) polymerase (see Example 8). The mRNA efficiency is checked in a cell-free system with reticulocyte lysate in a batch mode. The reticulocyte lysate is either prepared as described by Pelham and Jackson (1976) or a lysate produced commercially available, e.g., by Roche Diagnostics GmbH is used.
The reaction is performed in 20 μl reaction mixture containing 20 mM HEPES-KOH, pH 7.6; 2 mM magnesium acetate; 100 mM potassium acetate; 1 mM DTT; 1 mM ATP; 0.2 mM GTP; 0.5 mM spermidine; 8 mM creatine phostate; 60 μg/ml creatine ldnase (350 u/mg); 100 μM of each of 19 amino acids (excluding leucine); 100 μM [14C]leucine (320 mCu/mmol); 100 pmol/ml mRNA; 8 μl reticulocyte lysate. The reaction is done for 1 h at 30°C. The amount of incorporated [14C]leucine is determined in 3 μl aliquots precipitated with hot 5% trichloroacetic acid.
A comparison of the results shows approximately the same translation efficiency in the cell-free reticulocyte system of mRNA whose 5'UTR include either poly(A) (SEQ ID No. 1) or the known omega 5'UTR leader. Capped versions of mRNA raise significantly the efficiency of the synthesis (see Table 5).
Table 5. Comparison of efficiency of GFP mRNA translation depending on the presence of Cap structure in 5'UTR of different types of 5'UTR (poly(A) 5'UTR or omega 5'UTR) in the presence ofpoly(A) in the 3'UTR
Figure imgf000019_0001
References
Alakliov J. B. et al., Method of preparing polypeptides in a cell-free translation system. US 5.478.730 (26.12.1995)
Biryukov SN. et al., Method for preparing polypeptides in cell-free system and device for its realization. US 6.518.058 (11.03.2003)
Biryukov SN. et al., Method for synthesis of polypeptides in cell-free systems, WO 00/58493 (05.10.2000)
Chambers S.P. et al., The pMTL nic-cloning vectors. I. Improved pUC polylinker regions to facilitate the use of sonicated DΝA for nucleotide sequencing, Gene. Aug 15; 68(1): 139-149 (1988).
Endo Y., Template molecule having broad applicability and highly efficient function means of cell- free synthesis of proteins by using the same, WO/0127260 (19.04.2001).
Erickson AH and Blobel G., Cell-free translation of messenger RΝA in a wheat germ system, Methods Enzymol.; 96:38-50 (1983)
Gehrke L., Process for enchanting translational efficiency of eukaryotic mRΝA., US 4.820.639 (11.04.1989).
Jendrisak J. J. et al., Vectors for in vitro production of RΝA copies of either strand of a cloned DΝA sequence, 4.766.072. (23.08.1988)
Kawarasaki Y. et al., A trimmed viral-capindependent translation enhancing sequence for rapid in vitro gene expression, Biotechnol. Prog. May - Jun; 16 (3): 517 - 21 (2000)
Lanar D.E., Method for the in vitro production of protein from a DΝA sequence without cloning WO 92/07949 (14.05.1992 ) Madin K. et al., A highly efficient and robust cell-free protein synthesis system prepared from wheat embryos: plants apparently contain a suicide system directed at ribosomes, Proc. Natl. Acad. Sci. U.S.A. 97:559-564 (2000)
Murzina NV, Gudkov AT, Invariant amino acid replacement affects the dihydrofolate reductase function and its gene expression, Protein Eng. Aug; 3(8): 709-712 (1990).
Palmenberg A.C. et al, Translation enhancer. US 4.937.190 (26.06.1990)
Patel D.D. and Pickup D., Messenger RNAs of a strongly-expressed late gene of cowpox virus contain 5 '-terminal ρoly(A) sequences, EMBO, vol. 6, no.12, pp.3787-3794 (1987)
Pelham H.R.B. and Jackson R.J., An efficient mRNA-Dependent translation system from reticulocyte lysates, Eur. J. Biochem. 67: 247-256 (1976)
Pokrovskaya I.D. and Gurevich V.V., In vitro transcription: preparative RNA yields in analytical reactions, Anal. Biochem. 220:420-423 (1994)
Roberts B.E. and Paterson B.M., Efficient translation of tobacco mosaic virus RNA and rabbit globin 8S RNA in a cell-free system from commercial wheat germ, Proc. Natl. Acad. Sci. U.S.A. 70: 2330-2334 (1973)
Sambrook J. et al., Molecular cloning: a laboratory manual, 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. (1989)
Schwer B. et al., Discontinuous transcription or RNA processing of vaccinia virus late messengers results in a 5' Poly(A) leader, Cell, vol. 50, pp.163-169 (1987)
Spirin A.S. et al., A continuous cell-free translation system capable of producing polypeptides in high yield, Science, 242: 1162-1164 (1988).
Wilson T. M., A. Translation of m-RNA. WO87/07644 (17.12.1987), US 5.489.527 (06.03. 1996) Wilson T. M., Untranslated leader sequences from RNA viruses as enhancers of translation, US 5.891.665 (April 6, 1999)
Zeyenko V.V., Enhancing effect of the 3 '-untranslated region of tobacco mosaic virus RNA on protein syntliesis in vitro, FEBS Lett. Nov 14; 354(3): 271-273 (1994)

Claims

1. A leader sequence containing a nucleotide poly(A) sequence from 5 A to 35A or a leader sequence containing an additional sequence linked to the complete or deleted construct of poly(A) sequence or containing at least one nucleotide substitution either in the complete or deleted po- ly(A) sequence that provides for enhanced mRNA translation in cell-free systems.
2. The leader sequence according to claim 1 containing sequence SEQ ID No. 1.
3. The leader sequence according to claim 1 or 2 is inserted in a 5 '-untranslated region (5' -UTR) adjacent to the site of initiation of translation.
4. A method for synthesizing polypepides in a cell-free system, wherein at the initial stage a genetic construct containing a leader sequence in poly(A) 5'-UTR is obtained, the length and composition of the leader sequence are chosen by the results of mRNA translation or coupled transcription-translation of DNA in eukaryotic cell-free systems at mRNA concentrations from 50 to 2000 pmol/ml.
5. The method according claim 4, wherein a leader sequence according any of claims 1 to 3 is used.
6. Kit for synthesizing polypeptides in a cell-free system comprising a leader sequence containing a nucleotide poly(A) sequence from 5 A to 35A or a leader sequence containing an additional sequence linked to the complete or deleted construct of poly(A) sequence or containing at least one nucleotide substitution either in the complete or deleted poly(A) sequence that provides for enhanced mRNA translation in cell-free systems and a substance buffering between pH 7 and 8, 10 to 50 mM magnesium ions, 150 to 400 mM potassium ions, ribonucleotide triphosphates, amino acids, a sulfide groups reducing substance, an energy-rich compound, an tRNA fraction, an RNA polymerase and a cell-free lysate.
PCT/EP2005/001146 2004-02-06 2005-02-04 Leader sequence and method for synthesizing polypepides in cell-free systems WO2005075644A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
RU2004103495/13A RU2004103495A (en) 2004-02-06 2004-02-06 LEADER SEQUENCE AND METHOD FOR SYNTHESIS OF POLYEPEPTIDES IN A CELLLESS SYSTEM
RU2004103495 2004-02-06

Publications (2)

Publication Number Publication Date
WO2005075644A2 true WO2005075644A2 (en) 2005-08-18
WO2005075644A3 WO2005075644A3 (en) 2008-12-11

Family

ID=34836927

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2005/001146 WO2005075644A2 (en) 2004-02-06 2005-02-04 Leader sequence and method for synthesizing polypepides in cell-free systems

Country Status (2)

Country Link
RU (1) RU2004103495A (en)
WO (1) WO2005075644A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3230458B1 (en) * 2014-12-12 2020-02-19 CureVac AG Artificial nucleic acid molecules for improved protein expression

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2385134A1 (en) * 1999-10-15 2001-04-19 Wakenyaku Co., Ltd. Template molecule having broad applicability and highly efficient function means of cell-free synthesis of proteins by using the same

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2385134A1 (en) * 1999-10-15 2001-04-19 Wakenyaku Co., Ltd. Template molecule having broad applicability and highly efficient function means of cell-free synthesis of proteins by using the same

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
AHN B-Y ET AL: "IDENTIFICATION OF THE VACCINIA VIRUS GENE ENCODING AN 18-KILODALTON SUBUNIT OF RNA POLYMERASE AND DEMONSTRATION OF A 5' POLY-A LEADER ON ITS EARLY TRANSCRIPT" JOURNAL OF VIROLOGY, vol. 64, no. 6, 1990, pages 3019-3024, XP002341120 ISSN: 0022-538X *
DE MELO NETO OSVALDO P ET AL: "Autoregulation of poly(A)-binding protein synthesis in vitro" NUCLEIC ACIDS RESEARCH, vol. 23, no. 12, 1995, pages 2198-2205, XP002341118 ISSN: 0305-1048 *
GUDKOV ANATOLY T ET AL: "5'-poly(A) sequence as an effective leader for translation in eukaryotic cell-free systems." BIOTECHNOLOGY AND BIOENGINEERING. 20 AUG 2005, vol. 91, no. 4, 20 August 2005 (2005-08-20), pages 468-473, XP002341121 ISSN: 0006-3592 *
PATEL D D ET AL: "A POXVIRUS-DERIVED VECTOR THAT DIRECTS HIGH LEVELS OF EXPRESSION OF CLONED GENES IN MAMMALIAN CELLS" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE. WASHINGTON, US, vol. 85, no. 24, 1 December 1988 (1988-12-01), pages 9431-9435, XP000008759 ISSN: 0027-8424 *
PATEL D D ET AL: "Messenger RNAs of a strongly-expressed late gene of cowpox virus contain 5'-terminal poly(A) sequences" EMBO (EUROPEAN MOLECULAR BIOLOGY ORGANIZATION) JOURNAL, vol. 6, no. 12, 1987, pages 3787-3794, XP002341119 ISSN: 0261-4189 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3230458B1 (en) * 2014-12-12 2020-02-19 CureVac AG Artificial nucleic acid molecules for improved protein expression
EP3708668A1 (en) * 2014-12-12 2020-09-16 CureVac AG Artificial nucleic acid molecules for improved protein expression
US11149278B2 (en) 2014-12-12 2021-10-19 Curevac Ag Artificial nucleic acid molecules for improved protein expression
US11286492B2 (en) 2014-12-12 2022-03-29 Curevac Ag Artificial nucleic acid molecules for improved protein expression
US11345920B2 (en) 2014-12-12 2022-05-31 Curevac Ag Artificial nucleic acid molecules for improved protein expression
EP4023755A1 (en) * 2014-12-12 2022-07-06 CureVac AG Artificial nucleic acid molecules for improved protein expression
EP3708668B1 (en) 2014-12-12 2022-07-27 CureVac AG Artificial nucleic acid molecules for improved protein expression
US11761009B2 (en) 2014-12-12 2023-09-19 CureVac SE Artificial nucleic acid molecules for improved protein expression
EP4241784A3 (en) * 2014-12-12 2023-11-15 CureVac SE Artificial nucleic acid molecules for improved protein expression

Also Published As

Publication number Publication date
RU2004103495A (en) 2005-07-27
WO2005075644A3 (en) 2008-12-11

Similar Documents

Publication Publication Date Title
US5324637A (en) Coupled transcription and translation in eukaryotic cell-free extract
US5492817A (en) Coupled transcription and translation in eukaryotic cell-free extract
WO2018171747A1 (en) In vitro dna-to-protein (d2p) synthesis system, preparation, reagent kit, and preparation method
US5665563A (en) Coupled transcription and translation in eukaryotic cell-free extract
US11421259B2 (en) Cell-free protein expression using rolling circle amplification product
US20200332280A1 (en) Use of lambda-gam protein in ribosomal display technology
EP1279736A1 (en) Methods of RNA and protein synthesis
JP4762481B2 (en) Design and construction of transcription template for cell-free protein synthesis and dilution batch method wheat germ cell-free protein synthesis method using the same
EP3665286B1 (en) Cell-free protein expression using double-stranded concatameric dna
US11371047B2 (en) Promoter construct for cell-free protein synthesis
CN110551745A (en) Multiple histidine sequence tag and application thereof in protein expression and purification
JP7028986B2 (en) Tandem DNA element that can increase protein synthesis efficiency
WO2005075644A2 (en) Leader sequence and method for synthesizing polypepides in cell-free systems
US20190330672A1 (en) Highly efficient and tunable system for the incorporation of unnatural amino acids into proteins in escherichia coli
CN111378706B (en) Method for changing in vitro protein synthesis capacity through Edc3 gene knockout and application thereof
US20060029999A1 (en) Nucleic acid sequences having an activity of regulating translation efficiency and utilization thereof
JP2022535651A (en) Systems, methods and compositions for recombinant in vitro transcription and translation using thermophilic proteins
WO2024051855A1 (en) Nucleic acid construct and use thereof in ivtt system
US20230117150A1 (en) Fully orthogonal system for protein synthisis in bacterial cells
EP1466972A1 (en) Nucleotide sequences having activity of controlling translation efficiency and utilization thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase