WO2005068635A2 - Test system for the identification of antifungal agents - Google Patents

Test system for the identification of antifungal agents Download PDF

Info

Publication number
WO2005068635A2
WO2005068635A2 PCT/EP2004/014826 EP2004014826W WO2005068635A2 WO 2005068635 A2 WO2005068635 A2 WO 2005068635A2 EP 2004014826 W EP2004014826 W EP 2004014826W WO 2005068635 A2 WO2005068635 A2 WO 2005068635A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
acid sequence
nucleic acid
amino acid
translation
Prior art date
Application number
PCT/EP2004/014826
Other languages
French (fr)
Other versions
WO2005068635A3 (en
Inventor
Thierry Lacour
Wilhelm Schäfer
Frank Maier
Original Assignee
Basf Aktiengesellschaft
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Basf Aktiengesellschaft filed Critical Basf Aktiengesellschaft
Publication of WO2005068635A2 publication Critical patent/WO2005068635A2/en
Publication of WO2005068635A3 publication Critical patent/WO2005068635A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae

Definitions

  • the present invention relates to the provision of expression cassettes and nucleic acid sequences and to the use of these aforementioned nucleic acid sequences in a method for identifying antifungal compounds, which inhibit the mitochondrial transport process in eucaryotes. Furthermore, the invention relates to the use of these compounds identified via the abovementioned method as fungicides.
  • Detecting novel targets entails substantial difficulties in practice since the inhibition of an enzyme which is part of a metabolic pathway frequently has no further effect on the growth or the infectivity of the pathogenic fungus. The reasons may be firstly that the pathogenic fungus reverts to alternative metabolic pathways whose existence is unknown, or, secondly, that the inhibited enzyme is not limiting for the metabolic pathway. The suitability of a gene product as target can therefore not be predicted, even when its gene function is known.
  • the import mechanism of nuclear encoded proteins into mitochondria is a complex cellular process starting from the synthesis of messenger RNA (gene transcription) in the nucleus to the transportation of the precursor proteins into the mitochondria where they exert their physiological function. It is estimated that most of the 1000 mitochondrial proteins from eucaryotic cells are concerned with this mechanisms. Thus, it requires a dynamic process that must first recognize the respective RNA-precursor molecules to be targeted to mitochondria from the other RNA-molecules present in the cyto- sol of cell. Afterwards, in a second step the translation into the protein sequence together with the translocation across the mitochondrial membranes and the correct folding of the resulting protein functionally active has to be accomplished. This dynamic process is still under investigation. In this task, the yeast S. cerevisiae constitutes a very good model system.
  • the TOM complex comprising the subunits Tom 70, Tom 20, Tom 22, Tom 40, Tom 5, Tom 6, Tom 7, responsible for the translocation across the mitochondrial outer membrane
  • TIM 23 complex comprising the subunits Tim 17, Tim 23, Tim 44, Tim 50, which is responsible for the translocation of nuclear encoded proteins across the inner membrane of mitochondria
  • TIM 22 complex made with Tim 54, Tim 18, Tim22 responsible for the targeting of nuclear gene encoded protein in the inner membrane of mitochondria.
  • the protein precursor is synthesized in an inactive form in the cytosol prior import into the mitochondria.
  • the transportation of the precursor is assumed by several chaperone proteins
  • the protein precursor is synthesized during the import in the mitochondria due to cytosolic ribosomes that encounter the mitochondrial transport TOM complex.
  • the signal permitting the recognition of mitochondrial protein precursors from other precursors present in the cytosol resides in the protein precursor itself.
  • This signal may take the form of a an amino acid extension called hereinafter signal sequence, which is either cleaved off after the import in the mitochondria or still present within the mature proteins (Schatz et al., Science. 1996 Mar 15;271(5255):1519-26; Neupert W. , Protein import into mitochondria. Annu Rev Biochem. 1997;66:863-917; Pfanner et al. Nat Rev Mol Cell Biol. 2001 May;2(5): 339-49) .
  • the mitochondrial protein import system is also essential for the phythopathogenic fungi or not.
  • a frequently used strategy consists of the analysis of the import of a chimeric protein in vitro in a reconstituted system made with pure mitochondria from yeast (for example Leuenberger D, Bally NA, Schatz G, Koehler CM., Different import pathways through the mitochondrial intermembrane space for inner membrane proteins, EMBO J. 1999 Sep 1,18(1 ):4816-22).
  • This strategy permits to identify precisely the involvement of the various subunit of the TOM and the TIM 22 complex.
  • Specific inhibitors for example valinomycin
  • the strategy is very powerful for the understanding of the mitochondrial import mechanism .
  • the efficiency of the import of the chimeric protein is very low in such a reconstituted system. Thus the technology often requires the use of radiolabelled compounds such as (S35) methionine to reach enough sensitivity for the signal detection.
  • Another difficulty is the choice of an appropriate signal sequence to be fused to a marker protein.
  • the signal sequence must be long enough to ensure the targeting of the marker protein into the mitochondria without disturbing the intrinsic properties of the marker protein used for the detection. Comparative analysis of known signal se- quences showed that they are very different from one another, (von Heijne G, Step- puhn J, Herrmann RG, Domain structure of mitochondrial and chloroplast targeting peptides, Eur J Biochem. 1989 Apr 1;180(3):535-45).
  • MPC Protein complexes, which are responsible for the translocation of nuclear encoded proteins into mitochondria, are herein referred to as MPC.
  • MPC designates fungal and yeast protein complexes, which are responsible for the translocation of nuclear encoded proteins into mitochondria.
  • MPC designates the mitochondrial transport protein complexes TOM, TIM23 and/or TIM 22, most preferably the mitochondrial transport protein complexes TOM and TIM23.
  • fungi fungus as used herein below comprises yeast and fungi, such as phathogenic fungi and yeast and non-pathogenic fungi and yeast.
  • Preferred filamen- tous fungi are non-pathogenic fungi, such as those selected from the genera Neuro- spora (e.g. Neurospora crassa).
  • Preferred pathogenic fungi are pathogenic fungi such as human pathogens Candida species (e.g. Candida albicans) and Aspergillus species (e.g. Aspergillus fumigatus) and phytopathogenic fungi, wherein the phytopathogenic fungi are preferred.
  • Preferred phytopathogenic fungi are such as those selected from the genera Alternaria, Podosphaera, Sclerotinia, Physalospora, Blumeria, Botrytis, Corynespora; Colletotrichum; Diplocarpon; Elsinoe; Diaporthe; Sphaerotheca; Cerco- spora; Sphaerotheca; Leveillula; Mycosphaerella; Phyllactinia; Gloeosporium; Gymno- sporangium, Leptothryium, Podosphaera; Gloeodes; Cladosporium; Phomop- sis;Phytophthora; Erysiphe; Fusarium; Verticillium; Glomerella; Drechslera; Bipolaris; Peronospora; Phaeoisariopsis; Sphaceloma; Pseudocercosporella; Pseudoperono- spora; Pu
  • Cladosporium for example Cladosporium carpophilum; Phomopsis; Phytophthora, for example Phytophthora infestans; Verticillium; Glomerella, for example Glomerella cin- gulata; Drechslera; Bipolaris; Peronospora; Phaeoisariopsis, for example Phaeoisariopsis vitis; Sphaceloma, for example Sphaceloma ampelina; Pseudocerco- sporella, for example Pseudocercosporella herpotrichoides; Pseudoperonospora; Puc- cinia; Typhula; Pyricularia, for example Pyricularia oryzae (Magnaporthe grisea); Rhizoctonia; Stagonospora, for example Stagonospora nodorum; Uncinula, for example Uncinula necator; Ustilago; Gaeumannomyces species
  • avenaceum Fusarium avenaceum ssp. ayhong, Fusarium avenaceum ssp. nurragi, Fusarium hetrosporum, Fusarium acuminatum ssp. acuminatum, Fusarium acuminatum ssp. armeniacum, Fusarium longipes, Fusarium compactum, Fusarium equiseti, Fusarium scripi, Fusarium polyphialidicum, Fusarium semitectum and Fusarium beomiforme and Fusarium graminearum.
  • yeasts such as those selected from the group con- sisting of the genera and species Saccharomyces such as Saccharomyces cerevisiae, Schizosaccheromyces such as Schizosaccharomyces pombe or Pichia such as Pichia pastoris or Pichia methanolica.
  • the expression cassette also comprises a terminator d).
  • Said expression cassettes are used in a method for the identification of antifungal agents.
  • a functional linkage is understood to mean the sequential arrangement of promoter, the signal sequence and the sequence encoding the protein to be transported in the mitochondria, and (optionally) terminator in such a manner that each of the regulatory elements can, upon expression of the coding sequence, fulfill its function for the recombi- nant expression of the nucleic acid sequence. Direct linkage in the chemical sense is not necessarily required for this purpose.
  • Preferred arrangements are those in which the signal sequence functionally linked to the nucleic acid sequence encoding a protein to be transported in the mitochondrial matrix is positioned downstream of the sequence which acts as promoter, so that the two sequences are linked covalently to each other.
  • the distance between the promoter sequence and the nucleic acid sequence to be expressed recombinantly is preferably less than 100 base pairs, especially preferably less than 50 base pairs, and very especially preferably less than 10 base pairs.
  • the distance between the terminator sequence and the nucleic acid sequence to be expressed recombinantly is preferably less than 100 base pairs, especially preferably less than 50 base pairs, and very especially preferably less than 10 base pairs.
  • the distance between the signal sequence and the nucleic acid sequence encoding the protein to be transported in the mitochondria is preferably less than 100 base pairs, especially preferably less than 50 base pairs, and very especially preferably less than 10 base pairs.
  • further sequences which, for example, exert the function of a linker with certain restriction enzyme cleavage sites, or of a signal peptide, may also be positioned between the sequences, which are functionally linked to each other, such as the signal sequence and the reporter protein.
  • What is also optionally possible is to insert a DNA fragment encoding parts or the complete of the full length sequence of the protein originally linked to the signal sequence between the nucleic acid sequence cod- ing for the singal sequence and the nucleic acid sequence encoding the reporter protein.
  • the signal sequence b) has a length between 20 and 120 amino acid residues, preferably between 35 and 100 amino acid residues, more pref- erably 50 and 80 amino acid residues, most preferably between 55 and 74 amino acid residues
  • the signal sequence is encoded by
  • l-b a nucleic acid sequence which, on the basis of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO:2; SEQ ID NO:8, SEQ ID NO:14 or SEQ ID NO:20 by back translation; or
  • nucleic acid sequence SEQ ID NO:1 which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:2; or
  • nucleic acid sequence SEQ ID NO:7 which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:8; or
  • nucleic acid sequence SEQ ID NO:19 which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:20.
  • the N-terminal part is encoded by a nucleic acid sequence as set forth in l-a), l-b), l-c), l-d), l-e) or l-f) and as an amino acid composition as set forth in i), ii), iii) or iv).
  • SEQ ID NO:1 SEQ ID NO:7, SEQ ID NO: 13, SEQ ID NO: 15 or SEQ ID NO: 19 describes nucleic acid sequences encod- ing a polypeptide having the function of N-terminal part of a signal sequence, which directs the transport of a protein in the mitochondrial matrix.
  • identity or “homology” between two nucleic acid sequences or polypeptide sequences is defined by the identity of the nucleic acid sequence/polypeptide sequence by in each case the entire sequence length, which is calculated by alignment with the aid of the program algorithm GAP (Wisconsin Package Version 10.0, Univer- sity of Wisconsin, Genetics Computer Group (GCG), Madison, USA), setting the following parameters:
  • Gap Weight 8 Length Weight: 4
  • the functional equivalents of the nucleic acid sequence SEQ ID NO:1 set forth in l-c) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:2.
  • the functional equivalents of the nucleic acid sequence SEQ ID NO:7 set forth in l-d) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:8.
  • the functional equivalents of the nucleic acid sequence SEQ ID NO:13 set forth in l-e) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:14.
  • the functional equivalents of the nucleic acid sequence SEQ ID NO:19 set forth in l-f) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:20.
  • “Functional equivalents” in relation to the SEQ ID NO:1; SEQ ID NO:7, SEQ ID NO: 13, SEQ ID NO:15 or SEQ ID NO: 19 furthermore describe nucleic acid sequences which hybridize under standard conditions with the nucleic acid sequence or portions of the nucleic acid sequence set forth in SEQ ID NO:1; SEQ ID NO:7, SEQ ID NO: 13, SEQ ID NO:15 or SEQ ID NO:19 encoding a polypeptide having the function of a signal sequence, which directs the transport of a protein functionally linked to said signal se- quence in the mitochondrial matrix.
  • oligonucleotides of a length of 10-50 bp, preferably 15- 40 bp, for example of the conserved or other regions, which can be determined via comparisons with other related genes in a manner known to the skilled worker for the hybridization.
  • longer fragments of the nucleic acids according to the invention or the complete sequences for the hybridization are also possible. These standard conditions vary depending on the nucleic acid used, viz. oligonucleotide, longer fragment or complete sequence, or depending on which type of nucleic acid, viz. DNA or RNA, is being used for the hybridization.
  • the melting tem- peratures for DNA:DNA hybrids are approx. 10°C lower than those of DNA:RNA hybrids of equal length.
  • the hybridization conditions for DNA:DNA hybrids are advantageously 0.1 x SSC and temperatures of between approximately 20 °C and 45 °C, preferably between approximately 30 °C and 45 °C.
  • RNA hybrids are advantageously 0.1 x SSC and temperatures of between approximately 30°C and 55 °C, preferably between approximately 45°C and 55°C. These temperatures stated for the hybridization are melting temperature values which have been calculated by way of example for a nucleic acid with a length of approx. 100 nucleotides and a G + C content of 50% in the absence of formamide.
  • the experimental conditions for DNA hybridization are described in specialist textbooks of genetics such as, for example, Sambrook et al., "Molecular Cloning", Cold Spring Harbor Laboratory, 1989 and can be calculated using formulae known to the skilled worker, for example as a function of the length of the nucleic acids, the type of the hybrids or the G + C content.
  • a functional equivalent is furthermore also understood to mean, in particular, natural or artificial mutations of the relevant nucleic acid sequences of the signal sequences as set forth in SEQ ID NO:1; SEQ ID NO:7, SEQ ID NO:13, SEQ ID NO:15 or SEQ ID NO: 19 and its homologs from other organisms , wherein mutations comprise substitutions, additions, deletions, inversions or insertions of one or more nucleotide residues. This may also lead to a modification of the corresponding amino acid sequence of the signal sequences by substitution, insertion or deletion of one or more amino acids.
  • the scope of the present invention also extends to, for example, those nucleotide sequences which are obtained by modification of the nucleic acid sequence of the selection marker described by SEQ ID NO:1; SEQ ID NO:7, SEQ ID NO:13 or SEQ ID NO: 19 respectively.
  • the purpose of such a modification can be, for example, the insertion of further cleavage sites for restriction enzymes, the removal of excess DNA, or the addition of further sequences.
  • Said nucleic acid sequences should still maintain the desired function as of a signal sequence, which directs the transport of a protein in the mitochondria.
  • the signal sequence b) can be derived from any protein, which has to be imported into the mitochondria. Thus, it is possible, to determine experimentally the signal sequences of inner mitochondrial proteins to find a suitable signal sequence.
  • the signal sequence is the signal sequence of a protein with the biological activity of ferredoxin, which is preferably encoded by
  • ll-a a nucleic acid sequence with the nucleic acid sequence shown in SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:21 ; or
  • I l-b a nucleic acid sequence which, on the basis of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:16, SEQ ID NO:22 by back translation; or
  • nucleic acid sequence SEQ ID NO:3 which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:4;
  • nucleic acid sequence SEQ ID NO:9 a functional equivalent of the nucleic acid sequence SEQ ID NO:9, which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO: 10; or ll-e) a functional equivalent of the nucleic acid sequence SEQ ID NO:15, which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO: 16; or
  • ll-f a functional equivalent of the nucleic acid sequence SEQ ID NO:21 , which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:22.
  • the functional equivalents of the nucleic acid sequence SEQ ID NO:3 set forth in ll-c) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:4.
  • the functional equivalents of the nucleic acid sequence SEQ ID NO:9 set forth in ll-d) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO: 10.
  • the functional equivalents of the nucleic acid sequence SEQ ID NO:15 set forth in ll-e) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO: 16.
  • the functional equivalents of the nucleic acid sequence SEQ ID NO:21 set forth in ll-f) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:22.
  • “Functional equivalents” in the present context furthermore describe nucleic acid se- quences which hybridize under standard conditions with the nucleic acid sequence SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:21 or portions of the nucleic acid sequence SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO: 15 or SEQ ID NO:21 encoding a polypeptide having the function of ferredoxin.
  • Suitable hybridization conditions are those set forth above.
  • a functional equivalent is furthermore also understood to mean, in particular, natural or artificial mutations of the relevant nucleic acid sequences of the signal sequences as set forth in SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO: 15 or SEQ ID NO:21 and its ho- mologs from other organisms , wherein mutations comprise substitutions, additions, deletions, inversions or insertions of one or more nucleotide residues. This may also lead to a modification of the corresponding amino acid sequence of the signal sequences by substitution, insertion or deletion of one or more amino acids.
  • the scope of the present invention also extends to, for example, those nucleotide sequences which are obtained by modification of the nucleic acid sequence of the selection marker described by SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:21 respectively.
  • the purpose of such a modification can be, for example, the insertion of further cleavage sites for restriction enzymes, the removal of excess DNA, or the addition of further sequences.
  • Said nucleic acid sequences should still maintain the desired function as of the C-terminal part of a signal sequence, which directs the transport of a protein in the mitochondrial matrix.
  • the signal sequences which directs the trans- port of a protein in the mitochondrial matrix, is derived from a nucleic acid sequence comprising ll-a) a nucleic acid sequence with the nucleic acid sequence shown in SEQ ID NO:5, SEQ ID NO:11, SEQ ID NO:17 or SEQ ID NO:23; or
  • lll-b a nucleic acid sequence which, on the basis of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:16, SEQ ID NO:22 by back translation; or
  • nucleic acid sequence SEQ ID NO:3 which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:6; or lll-d) a functional equivalent of the nucleic acid sequence SEQ ID NO:9, which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:12; or
  • nucleic acid sequence SEQ ID NO:15 which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO: 18; or
  • lll-f a functional equivalent of the nucleic acid sequence SEQ ID NO:21 , which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:24.
  • the functional equivalents of the nucleic acid sequence SEQ ID NO:5 set forth in lll-c) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:6
  • the functional equivalents of the nucleic acid sequence SEQ ID NO:11 set forth in lll-d) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:12.
  • the functional equivalents of the nucleic acid sequence SEQ ID NO:17 set forth in lll-e) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:18.
  • the functional equivalents of the nucleic acid sequence SEQ ID NO:23 set forth in lll-f) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:24.
  • “Functional equivalents” in the present context furthermore describe nucleic acid se- quences which hybridize under standard conditions with the nucleic acid sequence SEQ ID NO:5, SEQ ID NO:11, SEQ ID NO: 17 or SEQ ID NO:23 or portions of the nucleic acid sequence SEQ ID NO:5, SEQ ID NO:11, SEQ ID NO:17 or SEQ ID NO:23 encoding a signal sequence, which directs the transport of a protein in the inner- mitochondrial matrix.
  • Suitable hybridization conditions are those set forth above.
  • a functional equivalent is furthermore also understood to mean, in particular, natural or artificial mutations of the relevant nucleic acid sequences of the signal sequences as set forth in SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:21 and its ho- mologs from other organisms , wherein mutations comprise substitutions, additions, deletions, inversions or insertions of one or more nucleotide residues. This may also lead to a modification of the corresponding amino acid sequence of the signal sequences by substitution, insertion or deletion of one or more amino acids.
  • the scope of the present invention also extends to, for example, those nucleotide sequences which are obtained by modification of the nucleic acid sequence of the selection marker described by SEQ ID NO:5, SEQ ID NO:11, SEQ ID NO:17 or SEQ ID NO:23 respectively.
  • the purpose of such a modification can be, for example, the inser- tion of further cleavage sites for restriction enzymes, the removal of excess DNA, or the addition of further sequences.
  • suitable promoters are fungal promoters such as AUG1 , GPD-1 , PX6, TEF, CUP1, PGK, GAP1, TPI, PHO5, AOX1, GAL10/CYC1, CYC1, OliC, ADH, TDH, Kex2, MFa, GAL or NMT or combinations of the abovementioned promoters (Degryse et al., Yeast 1995 Jun 15; 11 (7):629-40; Romanos et al. Yeast 1992 Jun;8(6):423-88; Benito et al. Eur. J. Plant Pathol. 104, 207-220 (1998); Cregg et al.
  • fungal promoters such as AUG1 , GPD-1 , PX6, TEF, CUP1, PGK, GAP1, TPI, PHO5, AOX1, GAL10/CYC1, CYC1, OliC, ADH, TDH, Kex2, MFa, GAL or NMT or combinations
  • a preferred fungal promoter is the GAL -promotor.
  • reporter proteins are readily quantifiable proteins. The transformation efficacy or the expression site or timing can be assessed by means of these genes via growth assay, fluorescence assay, chemoluminescence assay, bioluminescence assay or resistance assay or via a photometric measurement (intrinsic color) or enzyme activity.
  • reporter proteins such as "green fluorescent protein” (GFP) (Gerdes HH and Kaether C, FEBS Lett. 1996; 389(1 ):44-47; Chui WL et al., Curr Biol 1996, 6:325-330; Leffel SM et al., Biotechniques.
  • GFP green fluorescent protein
  • green fluo- rescent marker protein such as eGFP, GFP or cGFP
  • lacZ lacZ
  • LUC low-density polyethylene glycol
  • GUS ribonucleic acid
  • CAT Oriti- din 5'Monophosphatdecarboxylase
  • Nitrat Reduktase more preferred green fluorescent marker protein and variants or derivates of green fluorescent marker protein.
  • Suitable terminator are fungal fungal terminators such as the transcription terminator NMT, Gcy1, TrpC, AOX1, nos, PGK or CYC1 (Degryse et al., Yeast 1995 Jun 15; 11(7):629-40; Brunelli et al. Yeast 1993 Dec9(12): 1309-18; Frisch et al., Plant Mol. Biol. 27 (2), 405-409 (1995); Scorer et al., Biotechnology (N.Y.) 12 (2), 181-184 (1994), GenBank Ace. Number Z46232; Zhao et al.
  • the expression cassettes may also contain functional elements.
  • “Functional elements” are herein understood as meaning by way of example but not by limitation origins of replication and selection markers, functionally linked to the nucleic acid sequence in accordance with the invention direct or by means of a linker optionally comprising a protease cleavage site.
  • Selection markers confer resistance to antibiotics or other toxic compounds: examples which may be mentioned in this context are the neomycin phosphotransferase gene, which confers resistance to the aminoglycoside antibiotics neomycin (G 418), kanamycin, paromycin (Deshayes A et al., EMBO J.
  • selection marker genes are genes which confer resistance to 2- deoxyglucose-6-phosphate (WO 98/45456) or phosphinothricin and the like, or those which confer a resistance to antimetabolites, for example the dhfr gene (Reiss, Plant Physiol. (Life Sci. Adv.) 13 (1994) 142-149).
  • examples of other genes which are suit- able are trpB or hisD (Hartman SC and Mulligan RC, Proc Natl Acad Sci U S A. 85 (1988) 8047-8051).
  • Mannose phosphate isomerase gene WO 94/20627
  • ODC ornithine decarboxylase
  • Ori or "origin of replication” ensure the multiplication of the expression cassettes or vectors according to the invention in yeast, for example the ARS1 ori in yeast (Nucleic Acids Research, 2000, 28(10): 2060-2068).
  • the expression cassettes according to the invention are also understood as meaning analogs which can be brought about, for example by a combination of the individual nucleic acid sequences on a polynucleotide (multiple constructs), on a plurality of poly- nucleotides in a cell (cotransformation) or by sequential transformation.
  • vectors comprising at least one copy of the signal sequences b), if the expression vector comprises suitable promotor sequences and optionally suitable terminator sequences as defined above and/or the expression cassettes according to the invention.
  • Suitable vectors for use in fungi are pYepSed (Baldari, et al., (1987) Embo J. 6:229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30:933-943), pJRY88 (Schultz et al., (1987) Gene 54:113-123), and pYES derivatives, pGAPZ derivatives, pPICZ derivatives and the vectors of the "Pichia Expression Kit” (Invitrogen Corporation, San Diego, CA).
  • Vectors for use in filamentous fungi are described in: van den Hondel, C.A.M.J. J. & Punt, P. J.
  • Another embodiment of the invention is a transgenic fungi comprising at least signal sequence b) and/or one expression cassette according to the invention and/or at least one vector according to the invention.
  • transformation describes in the present context a process for introducing heterologous DNA into a eukaryotic cell.
  • transformed cell describes not only the product of the transformation process per se, but also all of the transgenic progeny of the transgenic organism generated by the transformation.
  • fungi the skilled worker will find suitable methods in the textbooks by Sambrook, J. et al. (1989) "Molecular cloning: A laboratory manual", Cold Spring Harbor Laboratory Press, by F.M. Ausubel et al. (1994) "Current protocols in molecular biology", John Wiley and Sons, by D.M.
  • transgenic fungi generated by transformation with one of the above-described em- bodiments of an expression cassette according to the invention or with a vector according to the invention are subject matter of the present invention.
  • the use of transgenic organisms in the assay systems described below is likewise subject matter of the present invention.
  • a further embodiment of the invention is the use of a transgenic organism according to the invention in a method of identifying fungicides.
  • this method comprises the following steps:
  • Significant decrease means in the present context that a reduction of the reporter protein in the transformed organism in relation to the corresponding transgenic organism of the same species, which is not incubated with the test substance of at least 20%, advantageously at least 30%, preferably at least 50%, especially preferably at least 70% and very especially preferably at least 90%, or 100% reduction (blocking) is achieved using an inhibitor concentration of not more than lO ⁇ M, preferably not more than lO ⁇ M, more preferably not more than 10 " °M and most preferably not more than 10 "7 M.
  • the monitoring of test substances which bring about significant decrease in the amount of reporter protein in the mitochondria of the transgenic organism of a) can done by comparing the amount of reporter protein present in the transgenic organism incubated with a test substance with the amount of reporter protein present in the transgenic organism, which is not incubated with the test substance
  • transgenic organism according to the present invention which is incubated with a known inhibitor can serve as "positive" control for selection of a suitable inhibitor.
  • the reporter protein is green fluorescent marker protein, variants or derivates of green fluorescent marker protein, luciferase (see above, claim 3, what would be also preferred) and the monitoring of step b) is done by fluorometry or flow-cytometry (for reference see Curr Opin Biotechnol. 2003 Feb;14(1):5-12.
  • (2004) SF, van den Engh G for reference see Curr Opin Biotechnol. 2003 Feb;14(1):5-12.
  • test compounds in the method according to the invention, it is also possible, in the method according to the invention, to employ a plurality of test compounds in a method according to the invention. If a group of test compounds affects the target, then it is either possible directly to isolate the individual test compounds or to divide the group of test compounds into a variety of subgroups, for exam- pie when it consists of a multiplicity of different components, in order to reduce the number of the different test compounds in the method according to the invention. The method according to the invention is then repeated with the individual test compound or the relevant subgroup of test compounds. Depending on the complexity of the sample, the above-described steps can be carried out repeatedly, preferably until the subgroup identified in accordance with the method according to the invention only comprises a small number of test compounds, or indeed just one test compound.
  • the method according to the invention can advantageously be carried out as an HTS procedure, which makes possible the simultaneous testing of a multiplicity of different compounds.
  • supports which contain one or more transgenic organisms according to the invention lends itself to carrying out an HTS in practice.
  • the support used is solid or liquid, it is preferably solid and especially preferably a microtiter plate.
  • the abovemen- tioned supports are also the subject matter of the present invention.
  • 96-well microtiter plates which, as a rule, can comprise volumes of from 50 to 500 ⁇ l, are used.
  • the further components of an HTS system which match the 96-well microtiter plates, such as a large number of instruments, materials, automatic pipetting devices, robots, automated plate readers and plate washers, are commercially available.
  • All of the substances which have been identified via a method according to the invention can subsequently be checked for their fungicidal action in a further in-vivo activity assay.
  • One possibility consists in assaying the substance in question in agar diffusion tests as described, for example, by Zahner, H. 1965 Biologie der Antibiotika, Berlin, Springer Verlag.
  • the assay is carried out with a culture of a filamentous phytopathogenic fungus, preferably a culture of a phytopathogenic fungus. It is possible to identify the fungicidal action for example via reduced growth.
  • phytopathogenic fungus is understood as meaning, in this context, the following genera and species: Alternaria species, Podosphaera species, Sclerotinia species, Physalospora canker on vegeta- bles and fruit, Botrytis cinerea (gray mold) on strawberries, vegetables, ornamentals and grapevines, Corynespora melonis on cucumbers, strawberries; Colletotrichum species on cucumbers; Diplocarpon rosae on roses; Elsinoe fawcetti and Diaporthe citri on citrus fruit; Sphaerotheca species on cucumbers, cucurbits, strawberries and roses; Uncinula necator on cucumbers, Cercospora species on peanuts, sugar beet, auber- gines and date plums; Erysiphe cichoracearum and Sphaerotheca fuliginea on cucurbits, Leveillula taurica on pimento; Mycosphaerella species on apples and Japanese
  • the invention furthermore relates to nucleic acid sequences as target for fungicides encoding a polypeptide homologue to Tim 17 of the mitochondrial membrane complex comprising:
  • nucleic acid sequence which, on the basis of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO:26 by back translation;
  • nucleic acid sequence SEQ ID NO:25 which can be derived from an amino acid sequence by back-translation that has at least an identity of 74% with the SEQ ID NO:26.
  • nucleic acid sequence as target for fungicides encoding a polypeptide homologue to Tom 20 of the mitochondrial membrane complex comprising:
  • nucleic acid sequence which, on the basis of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO:28 by back translation;
  • a polypeptide homologue toTim 17 of the mitochondrial membrane describes a poly- peptid, which is an essential subunit of the TIM 23 complex responsible for the translocation of nuclear encoded proteins across the inner membrane of mitochondria.
  • a polypeptide with the activity of Tom 20 of the mitochondrial membrane complex de-scribes a polypeptide, which an essential subunit of the TOM complex, which is responsible for the translocation across the mitochondrial outer membrane.
  • the functional equivalents of the nucleic acid sequence SEQ ID NO:25 set forth in c) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:26 by back translation having at least an identity of 74%, 75%, 76%, 77%, 78% or 79% preferably of 80%, 81%, 82%, 83%, 84%, 85% or 86 more preferably of 87%, 88%, 89% or 90% and most preferably of 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:26.
  • the functional equivalents of the nucleic acid sequence SEQ ID NO:27 set forth in e) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:28 by back translation having at least an identity of 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:28.
  • the invention furthermore relates to the use of nucleic acid sequences as target for fungicides encoding a polypeptide homologue to Tim 17 of the mitochondrial membrane complex in a method according to the invention said nucleic acid sequence comprising:
  • nucleic acid sequence which, on the basis of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO:26 by back translation;
  • nucleic acid sequence SEQ ID NO:25 which can be derived from an amino acid sequence by back-translation that has at least an identity of 50% with the SEQ ID NO:26.
  • nucleic acid sequences as target for fungicides encoding a polypeptide homologue to Tom 20 of the mitochondrial membrane complex in a method according to the invention
  • said nucleic acid sequence comprising:
  • nucleic acid sequence which, on the basis of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO:28 by back translation; or f) a functional equivalent of the nucleic acid sequence SEQ ID NO:27, which can be derived from an amino acid sequence by back-translation that has at least an identity of 50% with the SEQ ID NO:28.
  • the functional equivalents of the nucleic acid sequence SEQ ID NO:25 set forth in c) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:26 by back translation having at least an identity of 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:26
  • SEQ ID NO: 25 An examples of a functional equivalents of SEQ ID NO: 25 is the nucleic acid se- quences of
  • Saccharomyces.cerevisiae http://db.yeastgenome.org, Ace. No.:YJL143W Chr 10.
  • SEQ ID NO: 26 is the amino acid sequence of Saccharomyces.cerevisiae (http://www.ncbi.nlm.nih.gov, Ace. No.: CAA89438)
  • the functional equivalents of the nucleic acid sequence SEQ ID NO:27 set forth in e) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:28 by back translation having at least an identity of 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:28
  • SEQ ID NO: 27 examples of a functional equivalents of SEQ ID NO: 27 are the nucleic acid sequences of
  • Saccharomyces.cerevisiae http://db.yeastgenome.org; Ace. No: YGR082W
  • Neurospora crassa http://www.ncbi.nlm.nih.gov/entrez; Ace. No: XM_326486
  • SEQ ID NO: 28 Examples of a functional equivalent of SEQ ID NO: 28 are the amino acid sequences of Saccharomyces.cerevisiae (http://www.ncbi.nlm.nih.gov; Ace. No.:CAA97084) and Neurspora crassa (http://www.ncbi.nlm.nih.gov/entrez; Ace. No.:XP_326487)
  • the invention furthermore relates to compounds identified by the methods according to the invention. These compounds are hereinbelow referred to as "selected compounds". They have a molecular weight of less than 1 000 g/mol, advantageously less than 500 g/mol, preferably less than 400 g/mol, especially preferably less than 300 g/mol. Fungicidally active compounds have a Ki value of less than 1 mM, preferably less than 1 ⁇ M, especially preferably less than 0.1 ⁇ M, very especially preferably less than 0.01 ⁇ M.
  • the selected compounds are suitable for controlling phytopathogenic fungi.
  • phytopathogenic fungi are those mentioned above.
  • the selected compounds can also be present in the form of their agriculturally useful salts.
  • Agriculturally useful salts which are suitable are mainly the salts of those cations, or the acid addition salts of those acids, whose cations, or anions, do not adversely affect the fungicidal action of the fungicidally active compounds identified via the methods according to the invention.
  • the selected compounds can be chemically synthesized substances or substances produced by microorganisms and can be found, for example, in cell extracts of, for example, plants, animals or microorganisms.
  • the reaction mixture can be a cell-free extract or comprise a cell or cell culture. Suitable methods are known to the skilled worker and are described generally for example in Alberts, Molecular Biology the cell, 3rd Edi- tion (1994), for example chapter 17.
  • test compounds can be expression libraries such as, for example, cDNA expression libraries, peptides, proteins, nucleic acids, antibodies, small organic substances, hormones, PNAs or the like (Milner, Nature Medicin 1 (1995), 879-880; Hupp, Cell. 83 (1995), 237-245; Gibbs, Cell. 79 (1994), 193-198 and references cited therein).
  • Fungicidal compositions which comprise the selected compounds demonstrate very good control of phytopathogenic fungi, especially at high application rates.
  • crops such as wheat, rice, maize, soybean and cotton
  • they act against phytopathogenic fungi without inflicting any significant damage on the crop plants. This effect is observed in particular at low application rates.
  • the fungicidal active ingredients found with the aid of the methods according to the invention act as nonselective or as selective fungicides depends, inter alia, on the application rate, the selectivity and other factors.
  • the substances can be used for controlling the pathogenic fungi which have already been mentioned above.
  • the selected compounds, or compositions comprising them can advantageously be used for eliminating the phytopathogenic fungi which have already been mentioned at the outset.
  • the invention furthermore relates to a method of preparing the fungicidal composition which has already been mentioned above, which comprises formulating selected compounds with adjuvants which are suitable for the formulation of fungicides.
  • the selected compounds can be formulated for example in the form of directly spray- able aqueous solutions, powders, suspensions, also highly concentrated aqueous, oily or other suspensions or suspoemulsions or dispersions, emulsifiable concentrates, emulsions, oil dispersions, pastes, dusts, materials for spreading or granules and applied by means of spraying, atomizing, dusting, spreading or pouring.
  • the use forms depend on the intended use and the nature of the selected compounds; in each case, they should guarantee the finest possible distribution of the selected compounds.
  • the fungicidal compositions comprise a fungicidally active amount of at least one selected compound and auxiliaries conventionally used in the formulation of fungicidal compositions.
  • the selected compounds can be dissolved or dispersed in an oil or solvent, it being possible to add further formulation auxiliaries for homogenization purposes.
  • further formulation auxiliaries for homogenization purposes.
  • liquid or solid concentrates of selected compound if appropriate solvents or oil and, optionally, further auxiliaries, and these concentrates are suitable for dilution with water.
  • emulsifiable concentrates EC, EW
  • suspensions SC
  • soluble concentrates SL
  • dispersible concentrates DC
  • pastes pills
  • wettable powders or granules it being possible for the solid formulations either to be soluble or dispersible (wettable) in water.
  • suitable powders or granules or tablets can additionally be provided with a coating which prevents abrasion or premature release of the active ingredient.
  • auxiliaries is understood as meaning the following classes of compounds: antifoam agents, thickeners, wetters, stickers, dispersants, emulsifiers, bactericides and/or thixotropic agents.
  • antifoam agents thickeners, wetters, stickers, dispersants, emulsifiers, bactericides and/or thixotropic agents.
  • the skilled worker is familiar with the meaning of the abovementioned agents.
  • SLs, EWs and ECs can be prepared by simply mixing the constituents in question; powders can be prepared by mixing or grinding in specific types of mills (for example hammer mills).
  • DCs, SCs and SEs are usually prepared by wet milling, it being possi- ble to prepare an SE from an SC by addition of an organic phase which may comprise further auxiliaries or selected compounds.
  • the preparation is known.
  • Powders, materials for spreading and dusts can advantageously be prepared by mixing or concomi- tantly grinding the active substances together with a solid carrier.
  • Granules for example coated granules, impregnated granules and homogeneous granules, can be prepared by binding the selected compounds to solid carriers.
  • inert liquid and/or solid carriers which are suitable for the formulations according to the invention, such as, for example, liquid additives such as mineral oil fractions of medium to high boiling point such as kerosene or diesel oil, furthermore coal tar oils and oils of vegetable or animal origin, aliphatic, cyclic and aromatic hydrocarbons, for example paraffin, tetrahydronaphthalene, alky- lated naphthalenes or their derivatives, alkylated benzenes or their derivatives, alcohols such as methanol, ethanol, propanol, butanol and cyclohexanol, ketones such as cyclohexanone, or strongly polar solvents, for example amines such as N- methylpyrrolidone or water.
  • liquid additives such as mineral oil fractions of medium to high boiling point such as kerosene or diesel oil, furthermore coal tar oils and oils of vegetable or animal origin, aliphatic, cyclic and aromatic hydrocarbons, for example
  • solid carriers examples include mineral earths such as silicas, silica gels, silicates, talc, kaolin, limestone, lime, chalk, bole, loess, clay, dolomite, diatomaceous earth, calcium sulfate, magnesium sulfate, magnesium oxide, ground synthetic materials, fertilizers such as ammonium sulfate, ammonium phosphate, ammonium nitrate, ureas and products of vegetable origin such as cereal meal, tree bark meal, wood meal and nut- shell meal, cellulose powders or other solid carriers.
  • mineral earths such as silicas, silica gels, silicates, talc, kaolin, limestone, lime, chalk, bole, loess, clay, dolomite, diatomaceous earth, calcium sulfate, magnesium sulfate, magnesium oxide, ground synthetic materials, fertilizers such as ammonium sulfate, ammonium phosphate, ammonium nitrate, ureas
  • surfactants which are suitable for the formulations according to the invention such as, for example, alkali metal salts, alkaline earth metal salts or ammonium salts of aromatic sulfonic acids, for example lignosulfonic acid, phenolsulfonic acid, naphthalenesulfonic acid and dibutylnaphthalenesulfonic acid, and of fatty acids, of alkyl- and alkylarylsul- fonates, of alkyl sulfates, lauryl ether sulfates and fatty alcohol sulfates, and salts of sulfated hexa-, hepta- and octadecanols and of fatty alcohol glycol ethers, condensates of sulfonated naphthalene and its derivatives with formaldehyde, condensates of naph- thalene or of the naphthalen
  • aromatic sulfonic acids for example lignosulf
  • the fungicidal compositions, or the active ingredients can be applied curatively, eradi- catively or protectively.
  • the application rates of fungicidal active ingredient amount to 0.001 to 3.0, preferably 0.01 to 1.0, kg/ha.
  • Cloning methods such as, for example, restriction cleavages, the isolation of DNA, aga- rose gel electrophoreses, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linking DNA fragments, transformation of E. coli cells, bacterial cultures, sequence analysis of recombinant DNA and Southern and Western blots were carried out as described by Sambrook et al. Cold Spring Harbor Laboratory Press, (1989) and Ausubel, F.M. et al., Current Protocols in Molecular Biol- ogy, Greene Publishing Assoc. and Wiley-lnterscience (1994); ISBN 0-87969-309-6.
  • DNA- modifying enzymes and molecular biology kits were obtained from AGS (Heidelberg), Amersham (Braunschweig), Biometra (G ⁇ ttingen), Roche (Mannheim), Genomed (Bad Oeynnhausen), New England Biolabs (Schwalbach Taunus), Novagen (Madison, Wis- consin, USA), Perkin-Elmer (Weiterstadt), Promega (Madison, Wisconsin, USA),
  • Example 1- construction of expression plasmid pLAC ⁇ comprising a reporter protein fused with a signal sequence
  • GFP Green Fluorescent Protein
  • Lac 78 (5'cccgaattcatgctgaaaattgttactcg 3') (SEQ ID NO: 29) and
  • Lac 79 (5'ttattctagatttccatggggcctggtttcggttttttcaaatggccgt 3') (SEQ ID NO:30)
  • GFP Green Fluorescent Protein
  • Lac 84 (5'cgccaccatggtgagcaagggcgaggagctgtt 3') (SEQ ID NO:31)and
  • Lac 85 (5'tatgatctagagtcgcggccgctttacttgtacagctcg 3')(SEQ ID NO:32)
  • the PCR products were assembled in frame with the Nco I restriction sites present in the oligonucleotides Lac 79 and Lac 84 and cloned in the expression plasmid pYes2 (Invitrogen) using the restriction sites EcoR / and Xba I present in the oligonucleotides Lac 78 and Lac 85, respectively.
  • the recombinant gene encoding the chimeric protein preYAH1-GFP corresponding to the leader sequence of YAH1 fused to GFP in the N-terminus is under the control of the galactose (Gal 1) promoter and cytochrome C1 terminator.
  • Plasmid pLAC10 containing the cDNA of the protein marker (GFP) without mitochondrial leader sequence was created in analogy to the procedure set forth in example 1. To do so the GFP DNA fragment was amplified by PCR using the plasmid pEGFP-N2 (Genbank; U57608) and the oligonucleotide primers Lac 89 (5'aaaagaattcatggtgagcaagggcgagga 3') (SEQ ID NO:33)and
  • the PCR fragment was cloned in the expression plasmid pYes2 using the restriction enzymes EcoR I and Xba I.
  • the Saccharomyces cerevisiae strain INVSd (genotype MATa, his3delta1, Ieu2, trp1- 289,ura3-52) was obtained from Invitrogen GmbH.
  • the strain was transformed with the plasmid pLAC ⁇ or pLACIO using the protoplast transformation method according to Ausubel et al. (Current Protocols in Molecular Biology, Ausubel et al. (eds), 1985, Current Protocols in Molecular Biology, John Wiley & Sons, New York).
  • the recombinant strains INVSd -pLac ⁇ and INVSd -pLadO were isolated on selective medium due to their capability to grow in the absence of uracile by the plasmid complementation (pYES 2) as indicated by the supplier (Invitrogen GmbH).
  • Example 4- Cell culture and production of the recombinant GFP in mitochondria / Evaluation of the test system
  • the strain INVSd -pLac ⁇ was cultured in liquid medium M-SD-1 (made with Minimal SD Base containing 2% glucose as carbon source (Ref 630411.Clontech) supple- mented with -Ura Do Supplement (630416, Clontech) and 2% Galactose).
  • M-SD-1 made with Minimal SD Base containing 2% glucose as carbon source (Ref 630411.Clontech) supple- mented with -Ura Do Supplement (630416, Clontech) and 2% Galactose).
  • the culture was incubated at 28°C with 200 rpm. In this conditions, the production of GFP does not occur during the early phases of the culture since the Gall promoter is repressed by the presence of glucose in the medium.
  • GFP fused with the signal sequence is produced when the recombinant yeast is using galactose as the major carbon source. This event occurred generally during the late log-phase of culture since the yeast use preferentially the glucose as the first carbon source. After 36h, the green fluorescence corresponding to the production of GFP was observed in the strain INVSd -pLac ⁇ using an an AxlOSSCkop microscope (Zeiss) with a filter 450-490 nm.
  • the yeast INVSd -pLac ⁇ was cultured as described above and sub- cellular fractions of the recombinant strain were obtained by differential centrifigution as described previously (Zinser and Daum (Yeast. 1995 May;11(6):493-536; Dumas B, Cauet G, Lacour T, Degryse E, Laruelle L, Ledoux C, Spagnoli R, AchstetterT, Eur J Biochem. 1996 Jun 1 ;23 ⁇ (2):495-504).
  • the recombinant cells were collected at the end of the culture and broken according to classical techniques (as set forth in Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Assoc.
  • the cell extract was cleared by several centrifugation steps (3x (2000xg, 10 min). Then, the supernatant was centrifuged at 10 OOOxg for 20 min. to pellet the mitochondria. The soluble fraction was finally centrifuged at 150 OOOxg for 1h to pellet the microsomes; the remaining supernatant corresponded to the cytosolic fraction of the cells.
  • This technology permits the separation of 3 sub- cellular fractions, namely the mitochondrial , the microsomal and the cytosolic fractions with a good yield of purity to perform further investigations.
  • microsomal and mitochondrial sub-cellular fractions were suspended with a solution containing 50 mM Tris buffer pH7.4 and sorbitol 0,6M to reach a protein concentration of about 10 mg/ml. Then, 50 Dg of each subcellular fractions were used for microscopic observations to visualize the fluorescence of the chimeric GFP using an AxlOSSCkop microscope (Zeiss) with a filter 450-490nm as described above
  • the mitochondrial fraction was the only one to show the typical fluorescence of GFP indicating that the GFP is localized in the mitochondria of the recombinant cells.
  • a test system using the yeast strain INVSd -pLac ⁇ to identify or optimise modulators of the mitochondrial protein import has been developed in a micro plate format.
  • the culture of INVSd -pLac ⁇ was performed in classical micro plates (96 wells) using 200 i M-SD1 as described above. After 24h of culture test compounds are added to the micro-culture in a concentration range (mM to ⁇ M) to avoid toxicity. The incubation is fur- ther conducted for 24h.
  • the fluorescence of the micro-cultures is analysed by flow-cytometry, a technology permitting the precise measurement of the fluorescence of single cells for a given number of cells.
  • the cells of INVSd -pLac ⁇ cultured without test compounds and inhibitor presenting significant fluorescence intensity were counted and compared with wild type strain INVSd.
  • the fluorescence intensity is not equal for each individual cells of the micro-culture. This can be explained simply by the fact that the galactose induction at the molecular level may not start exactly at the same time depending on the physiological state of individual cells (cells in mitosis, or younger cells generated in the late log phase of the culture may not have enough galactose available to produce the recombinant GFP).
  • antimycin (1 mM) was used to validate the test system.
  • the com- pound is known to inhibit the ATP synthesis and consequently prevents the formation of the membrane potential of inner mitochondrial membrane, which is essential to import protein precursor in mitochondria.
  • the fluorescence pattern of cells of INVSd -pLac ⁇ cultured with antimycin was different from the fluorescence pattern of cells of INVSd -pLac ⁇ cultured without the inhibitor antimycin (region 50 AU to 1000 AU), Actually, the fluorescence was significantly reduced, to the basic level observed for the wild-type strain INVSd.
  • DSM:4527 can be used as F. Graminearum wild-type strain.
  • the oligonucleotide primers To generate the Tim 17- knock-out plasmid, the oligonucleotide primers
  • the oligonucleotide primers To generate the Tom 20- knock-out plasmid, the oligonucleotide primers
  • Lac 205 5' ATAAGAATGCGGCCGCatggctagtatcgtaccaga 3' (SEQ ID NO:3 ⁇ )
  • Lac 206 5' AAATGGCGCGCCcgtcaaaggtgttgcagttg 3' (SEQ ID NO:39)
  • the fragment was cloned into the vector the pUCmini-Hyg (as described in PCT/EP/03/0702 ⁇ ) using the restriction sites Notl and Asd, present in Lac 205 and Lac 206, respectively.
  • Tim 17- knock-out plasmid, the Tom 20- knock-out plasmid and the PKS-knock-out plasmid were linearized with the restriction enzymes SgrA1, Xhol and Eco47lll located in the middle of the DNA inserts, respectively.
  • CM-medium (Leach et al., 1982, J. Gen. Microbiol. 128: 1719-1729) were inoculated with approximately 10 5 conidia, and incubated for 2 days at 28°C, 140 rpm. Resulting hyphae were homogenized in a Warring-Blender; 200 ml CM were inoculated with 10 ml hyphal suspension, and incubated overnight at 24°C. Mycel were trapped on a sterile filter, and washed two times with sterile water.
  • the protoplasts were pelleted by centrifugation (1300 x g) in a swing-out Rotor and washed two times with ice-cold NaCl 700 mM and centrifuge (630 x g). Then the protoplasts were resus- pended in STC (O. ⁇ M sorbitol, 50 mM Tris-HCI pH ⁇ .0, 50 mM CaCI 2 ) and store on ice until transformation .
  • STC O. ⁇ M sorbitol, 50 mM Tris-HCI pH ⁇ .0, 50 mM CaCI 2
  • protoplasts were resuspended in 4 parts STC and 1 part SPTC (O. ⁇ M sorbitol, 40% polyethylene glycol 4000, 50 mM Tris-HCI pH 6.0, 50 mM CaCI 2 ) at a concentration of 0.5-2 x 10 ⁇ /ml; 30 ⁇ g of the linearized UGP- and gpmkl knock-out plasmids were added to 100 ⁇ l of the protoplast suspension in 10 ml tubes. After mix- ing, samples were incubated on ice for 30 min. 1 ml SPTC was mixed to the suspension and incubated at room temperature for 20 min.
  • SPTC O. ⁇ M sorbitol, 40% polyethylene glycol 4000, 50 mM Tris-HCI pH 6.0, 50 mM CaCI 2
  • Protoplasts were mixed gently into 200 ml regeneration medium ( 0.1% (w/v) yeast extract, 0.1% (w/v) caseinhydrolysate, 34.2% (w/v) sucrose, 1.6% (w/v) granulated Agar) at 43°C and spread on a 94 mm plates (20 ml per plate). The plates were incubated at 2 ⁇ °C.
  • CM-Hyg-plates consisting of CM-media, 100 ⁇ g/ml hygromycin and 2% (w/v) Agar.
  • the transformants were isolated by single spore isolation.
  • the transformants were cultivated on SNA plates (Nirenberg, 1981 , Canadian J. Botany 59: 1599-1609) under UV-light 7-14 days at 1 ⁇ °C. Dilutions of conidia were plated on CM-Hyg plates, and single colonies were transferred from these plates to fresh CM-Hyg plates..
  • Ef-Tim17 5'tttctgcatgggtgccatcggt3' Er-Tim17 5" atgtcagccagtcgttgttcgt 3' (SEQ ID NO:41 )
  • Ef-Tom20 5' gcaggatagaccttgagaccct 3' Er-Tom20 5' gacgtaatattctccgtcactc 3' (SEQ ID NO:43)
  • Ef-Pks 5' ATAAGAATGCGGCCGCgccctcgaaacagcttacga 3" (SEQ ID NO:44)
  • Ef-Pks 5' AAATGGCGCGCCacagtatccgtctgctccat 3' (SEQ ID NO:45)
  • N leader sequence
  • C ferredoxin (mature protein)
  • N+C ferredoxin precursor (leader sequence and ferredoxin)
  • SC Saccharomyces cerevisiae
  • FG Fusarium graminearum
  • CA Candida albicans
  • MG Magnaporthe grisea

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Mycology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Botany (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention relates to the provision of expression cassettes and nucleic acid sequences and to the use of these aforementioned nucleic acid sequences in a method for identifying antifungal compounds, which inhibit the mitochondrial transport process in eucaryotes. Furthermore, the invention relates to the use of these compounds identified via the abovementioned method as fungicides.

Description

Test system for the identification of antifungal agents
The present invention relates to the provision of expression cassettes and nucleic acid sequences and to the use of these aforementioned nucleic acid sequences in a method for identifying antifungal compounds, which inhibit the mitochondrial transport process in eucaryotes. Furthermore, the invention relates to the use of these compounds identified via the abovementioned method as fungicides.
The basic principle of identifying fungicides via the inhibition of a defined target is known (for example US 5,187071, WO 98/33925, WO 00/77185). In general, there is a high demand for the detection of enzymes which might constitute novel targets for fungicides. The reasons herefor are not only the resistance problems which may occur, but also the continuous striving for the identification of novel fungicidal active ingredients which are distinguished by an as broad as possible range of action, by ecological and toxicological acceptability and by low application rates.
Detecting novel targets entails substantial difficulties in practice since the inhibition of an enzyme which is part of a metabolic pathway frequently has no further effect on the growth or the infectivity of the pathogenic fungus. The reasons may be firstly that the pathogenic fungus reverts to alternative metabolic pathways whose existence is unknown, or, secondly, that the inhibited enzyme is not limiting for the metabolic pathway. The suitability of a gene product as target can therefore not be predicted, even when its gene function is known.
It is an object of the present invention to identify targets for fungicides and to provide methods which are suitable for identifying fungicidally active compounds.
The import mechanism of nuclear encoded proteins into mitochondria is a complex cellular process starting from the synthesis of messenger RNA (gene transcription) in the nucleus to the transportation of the precursor proteins into the mitochondria where they exert their physiological function. It is estimated that most of the 1000 mitochondrial proteins from eucaryotic cells are concerned with this mechanisms. Thus, it requires a dynamic process that must first recognize the respective RNA-precursor molecules to be targeted to mitochondria from the other RNA-molecules present in the cyto- sol of cell. Afterwards, in a second step the translation into the protein sequence together with the translocation across the mitochondrial membranes and the correct folding of the resulting protein functionally active has to be accomplished. This dynamic process is still under investigation. In this task, the yeast S. cerevisiae constitutes a very good model system.
To date, three mitochondrial transport protein complexes have been described to be responsible for the translocation of nuclear encoded proteins into yeast mitochondria (for review, Truscott KN, Brandner K, Pfanner N., Mechanisms of protein import into mitochondria.Curr Biol. 2003 Apr 15;13(8):326-37):
1. the TOM complex comprising the subunits Tom 70, Tom 20, Tom 22, Tom 40, Tom 5, Tom 6, Tom 7, responsible for the translocation across the mitochondrial outer membrane
2. the TIM 23 complex comprising the subunits Tim 17, Tim 23, Tim 44, Tim 50, which is responsible for the translocation of nuclear encoded proteins across the inner membrane of mitochondria
3. the TIM 22 complex made with Tim 54, Tim 18, Tim22 responsible for the targeting of nuclear gene encoded protein in the inner membrane of mitochondria.
Several components from these complexes have been shown to be essential for the yeast survival.
However, whether these complexes are also essential for pathogenic fungi, specifically phytopathogenic fungi is not known to date.
The synthesis of the protein precursors to be imported in mitochondria is still a subject of investigations (for review, Beddoe T, Lithgow T., Delivery of nascent polypeptides to the mitochondrial surface, Biochim Biophys Acta. 2002 Sep 2;1592(1 ):35-9). Up to now, these investigations permits to conclude that 2 models are co-existing:
According to the so called post-translational mechanism, the protein precursor is synthesized in an inactive form in the cytosol prior import into the mitochondria. In the mitochondria, the transportation of the precursor is assumed by several chaperone proteins
Under the "co-translational mechanism", the protein precursor is synthesized during the import in the mitochondria due to cytosolic ribosomes that encounter the mitochondrial transport TOM complex.
The signal permitting the recognition of mitochondrial protein precursors from other precursors present in the cytosol resides in the protein precursor itself. This signal may take the form of a an amino acid extension called hereinafter signal sequence, which is either cleaved off after the import in the mitochondria or still present within the mature proteins (Schatz et al., Science. 1996 Mar 15;271(5255):1519-26; Neupert W. , Protein import into mitochondria. Annu Rev Biochem. 1997;66:863-917; Pfanner et al. Nat Rev Mol Cell Biol. 2001 May;2(5): 339-49) . To date, it is not known, whether the mitochondrial protein import system is also essential for the phythopathogenic fungi or not. Furthermore, there are also no detailed information about the respective signal sequences.
Surprisingly, it was found that these complexes are also essential in the plant pathogen Fusarium graminearum.
In addition there are no convenient test systems available, which can be used to detect inhibition of these complex transport system that is also suitable for high throughput screening, because high sophisticated strategies are required to analyze such a complex mechanism.
For example, a frequently used strategy consists of the analysis of the import of a chimeric protein in vitro in a reconstituted system made with pure mitochondria from yeast (for example Leuenberger D, Bally NA, Schatz G, Koehler CM., Different import pathways through the mitochondrial intermembrane space for inner membrane proteins, EMBO J. 1999 Sep 1,18(1 ):4816-22).
For this purpose, a chimeric protein made with a known signal sequence fused to a protein, which was then afterwards used for identification via antibodies in vitro, was synthesized by in vitro transcription. Then, the import of the nascent polypeptide into isolated mitochondria is carried out in specific conditions permitting the understanding of the mechanism. This strategy permits to identify precisely the involvement of the various subunit of the TOM and the TIM 22 complex. Specific inhibitors (for example valinomycin) have also been used in this system to demonstrate that this mechanism is requiring energy to import the precursor into the mitochondria. The strategy is very powerful for the understanding of the mitochondrial import mechanism . However the efficiency of the import of the chimeric protein is very low in such a reconstituted system. Thus the technology often requires the use of radiolabelled compounds such as (S35) methionine to reach enough sensitivity for the signal detection.
The above-mentioned system as a whole is very sophisticated and therefore not appropriate for a standard use such as identification of inhibitors of mitochondrial protein import complexes, e.g. in a high throughput screening.
Another difficulty is the choice of an appropriate signal sequence to be fused to a marker protein. The signal sequence must be long enough to ensure the targeting of the marker protein into the mitochondria without disturbing the intrinsic properties of the marker protein used for the detection. Comparative analysis of known signal se- quences showed that they are very different from one another, (von Heijne G, Step- puhn J, Herrmann RG, Domain structure of mitochondrial and chloroplast targeting peptides, Eur J Biochem. 1989 Apr 1;180(3):535-45). They generally contain 10 to 80 amino acids with a high level hydrophobic, basic and hydroxylated amino acids associated into an alpha helix structure that appears to be essential for the recognition by the Tom 20 complex (von Heijne G, Steppuhn J, Herrmann RG, Domain structure of mitochondrial and chloroplast targeting peptides, Eur J Biochem. 1989 Apr 1;180(3):535- 45; Abe Y, Shodai T, Muto T, Mihara K, Torii H, Nishikawa S, Endo T, Kohda D, Structural basis of presequence recognition by the mitochondrial protein import receptor Tom20.Cell. 2000 Mar 3;100(5):551-60). Among all signal sequences known to date, no consensus amino acid sequence have been identified and it is still difficult to recognize a mitochondrial protein by single analysis of the primary or the secondary structure of a protein sequence. Thus the identification of a signal sequence in the N-terminus of a protein precursor and the precise length of the signal sequence remains a difficult prediction.
Some of the definitions used in the description are now defined at this point.
Protein complexes, which are responsible for the translocation of nuclear encoded proteins into mitochondria, are herein referred to as MPC. The term MPC designates fungal and yeast protein complexes, which are responsible for the translocation of nuclear encoded proteins into mitochondria. Preferably, MPC designates the mitochondrial transport protein complexes TOM, TIM23 and/or TIM 22, most preferably the mitochondrial transport protein complexes TOM and TIM23.
The terms "fungi fungus" as used herein below comprises yeast and fungi, such as phathogenic fungi and yeast and non-pathogenic fungi and yeast. Preferred filamen- tous fungi are non-pathogenic fungi, such as those selected from the genera Neuro- spora (e.g. Neurospora crassa). Preferred pathogenic fungi are pathogenic fungi such as human pathogens Candida species (e.g. Candida albicans) and Aspergillus species (e.g. Aspergillus fumigatus) and phytopathogenic fungi, wherein the phytopathogenic fungi are preferred. Preferred phytopathogenic fungi are such as those selected from the genera Alternaria, Podosphaera, Sclerotinia, Physalospora, Blumeria, Botrytis, Corynespora; Colletotrichum; Diplocarpon; Elsinoe; Diaporthe; Sphaerotheca; Cerco- spora; Sphaerotheca; Leveillula; Mycosphaerella; Phyllactinia; Gloeosporium; Gymno- sporangium, Leptothryium, Podosphaera; Gloeodes; Cladosporium; Phomop- sis;Phytophthora; Erysiphe; Fusarium; Verticillium; Glomerella; Drechslera; Bipolaris; Peronospora; Phaeoisariopsis; Sphaceloma; Pseudocercosporella; Pseudoperono- spora; Puccinia; Typhula; Pyricularia; Rhizoctonia; Stagonospora; Uncinula; Ustilago; Gaeumannomyces or Fusarium, more preferably those from the genera and species Alternaria, Podosphaera, Sclerotinia, Physalospora, for example Physalospora canker, Blumeria, for example Blumeria graminis, Botrytis, for example Botrytis cinerea, Cory- nespora, for example Corynespora melonis; Colletotrichum; Diplocarpon, for example Diplocarpon rosae; Elsinoe, for example Elsinoe fawcetti, Diaporthe, for example Diaporthe citri; Sphaerotheca; Cercospora; Erysiphe, for example Erysiphe cichoracea- rum; Sphaerotheca, for example Sphaerotheca fuliginea; Leveillula, for example Leveil- lula taurica; Mycosphaerella; Phyllactinia, for example Phyllactinia kakicola; Gloespo- rium, for example Gloesporium kaki; Gymnosporangium, for example Gymnosporan- gium yamadae, Leptothryium, for example Leptothryium pomi, Podosphaera, for ex- ample Podosphaera leucotricha; Gloeodes, for example Gloeodes pomigena;
Cladosporium, for example Cladosporium carpophilum; Phomopsis; Phytophthora, for example Phytophthora infestans; Verticillium; Glomerella, for example Glomerella cin- gulata; Drechslera; Bipolaris; Peronospora; Phaeoisariopsis, for example Phaeoisariopsis vitis; Sphaceloma, for example Sphaceloma ampelina; Pseudocerco- sporella, for example Pseudocercosporella herpotrichoides; Pseudoperonospora; Puc- cinia; Typhula; Pyricularia, for example Pyricularia oryzae (Magnaporthe grisea); Rhizoctonia; Stagonospora, for example Stagonospora nodorum; Uncinula, for example Uncinula necator; Ustilago; Gaeumannomyces species, for example Gaeumanno- myces graminis and Fusarium species, for example Fusarium dimerium, Fusarium merismoides, Fusarium lateritium, Fusarium decemcellulare, Fusarium poae, Fusarium tricinctum, Fusarium sporotrichioides, Fusarium chlamydosporum, Fusarium monili- forme, Fusarium proliferatum, Fusarium anthophilum, Fusarium subglutinans, Fusarium nygamai, Fusarium oxysporum, Fusarium solani, Fusarium culmorum, Fusarium sam- bucinum, Fusarium crookwellense, Fusarium avenaceum ssp. avenaceum, Fusarium avenaceum ssp. aywerte, Fusarium avenaceum ssp. nurragi, Fusarium hetrosporum, Fusarium acuminatum ssp. acuminatum, Fusarium acuminatum ssp. armeniacum, Fusarium longipes, Fusarium compactum, Fusarium equiseti, Fusarium scripi, Fusarium polyphialidicum, Fusarium semitectum and Fusarium beomiforme and Fusarium graminearum. Equally preferred are yeasts such as those selected from the group con- sisting of the genera and species Saccharomyces such as Saccharomyces cerevisiae, Schizosaccheromyces such as Schizosaccharomyces pombe or Pichia such as Pichia pastoris or Pichia methanolica.
We have found that this object is achieved by the provision of expression cassettes comprising
a) a promotor facilitating expression in eukaryotes;
b) a nucleic acid sequence encoding a signal sequence that directs transport into the mitochondria of a fungi; and
c) a nucleic acid sequence encoding a reporter protein
wherein all three elements are functionally linked together. Optionally, the expression cassette also comprises a terminator d). Said expression cassettes are used in a method for the identification of antifungal agents. A functional linkage is understood to mean the sequential arrangement of promoter, the signal sequence and the sequence encoding the protein to be transported in the mitochondria, and (optionally) terminator in such a manner that each of the regulatory elements can, upon expression of the coding sequence, fulfill its function for the recombi- nant expression of the nucleic acid sequence. Direct linkage in the chemical sense is not necessarily required for this purpose. Preferred arrangements are those in which the signal sequence functionally linked to the nucleic acid sequence encoding a protein to be transported in the mitochondrial matrix is positioned downstream of the sequence which acts as promoter, so that the two sequences are linked covalently to each other. The distance between the promoter sequence and the nucleic acid sequence to be expressed recombinantly is preferably less than 100 base pairs, especially preferably less than 50 base pairs, and very especially preferably less than 10 base pairs. The distance between the terminator sequence and the nucleic acid sequence to be expressed recombinantly is preferably less than 100 base pairs, especially preferably less than 50 base pairs, and very especially preferably less than 10 base pairs. The distance between the signal sequence and the nucleic acid sequence encoding the protein to be transported in the mitochondria is preferably less than 100 base pairs, especially preferably less than 50 base pairs, and very especially preferably less than 10 base pairs. However, further sequences which, for example, exert the function of a linker with certain restriction enzyme cleavage sites, or of a signal peptide, may also be positioned between the sequences, which are functionally linked to each other, such as the signal sequence and the reporter protein. What is also optionally possible is to insert a DNA fragment encoding parts or the complete of the full length sequence of the protein originally linked to the signal sequence between the nucleic acid sequence cod- ing for the singal sequence and the nucleic acid sequence encoding the reporter protein.
In a preferred embodiment, the signal sequence b) has a length between 20 and 120 amino acid residues, preferably between 35 and 100 amino acid residues, more pref- erably 50 and 80 amino acid residues, most preferably between 55 and 74 amino acid residues
Further preferred is a signal sequence b) comprising
(i) between 20%-40%, preferably 23%-37%, more preferably 25%-35% and most preferably 27%-33% of hydrophobic amino acids selected from the group consisting of A, I, L, F, W, V and M;
(ii) between 20%-40%, preferably 22%-38%, more preferably 25%-37% and most preferably 27%-35% of polar amino acids selected from the group consisting of N, C, Q, S, T and Y; (iii) between 0%-10%; preferably 0%-5%, more preferably 0%-3% and most preferably 0%-1 ,5% of acidic amino acids selected from the group consisting of D and E; and
(iv) between 5%-25%; preferably 7%-20%, more preferably 10%-18% and most preferably 13%-16% of basic amino acids selected from the group consisting of K and R.
In a further preferred embodiment, the signal sequence is encoded by
l-a) a nucleic acid sequence with the nucleic acid sequence shown in SEQ ID NO:1; SEQ ID NO:7, SEQ ID NO:13 or SEQ ID NO:19; or
l-b) a nucleic acid sequence which, on the basis of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO:2; SEQ ID NO:8, SEQ ID NO:14 or SEQ ID NO:20 by back translation; or
l-c) a functional equivalent of the nucleic acid sequence SEQ ID NO:1 , which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:2; or
l-d) a functional equivalent of the nucleic acid sequence SEQ ID NO:7, which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:8; or
l-e) a functional equivalent of the nucleic acid sequence SEQ ID NO:13, which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO: 14; or
l-f) a functional equivalent of the nucleic acid sequence SEQ ID NO:19, which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:20.
In a particular preferred embodiment, the N-terminal part is encoded by a nucleic acid sequence as set forth in l-a), l-b), l-c), l-d), l-e) or l-f) and as an amino acid composition as set forth in i), ii), iii) or iv).
The term "functional equivalents" in relation to the SEQ ID NO:1; SEQ ID NO:7, SEQ ID NO: 13, SEQ ID NO: 15 or SEQ ID NO: 19 describes nucleic acid sequences encod- ing a polypeptide having the function of N-terminal part of a signal sequence, which directs the transport of a protein in the mitochondrial matrix. The term "identity" or "homology" between two nucleic acid sequences or polypeptide sequences is defined by the identity of the nucleic acid sequence/polypeptide sequence by in each case the entire sequence length, which is calculated by alignment with the aid of the program algorithm GAP (Wisconsin Package Version 10.0, Univer- sity of Wisconsin, Genetics Computer Group (GCG), Madison, USA), setting the following parameters:
Gap Weight: 8 Length Weight: 4
Average Match: 2,912 Average Mismatch:-2,003
The term homology when used herein is the same as the term identity.
The functional equivalents of the nucleic acid sequence SEQ ID NO:1 set forth in l-c) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:2.
The functional equivalents of the nucleic acid sequence SEQ ID NO:7 set forth in l-d) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:8.
The functional equivalents of the nucleic acid sequence SEQ ID NO:13 set forth in l-e) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:14.
The functional equivalents of the nucleic acid sequence SEQ ID NO:19 set forth in l-f) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:20.
"Functional equivalents" in relation to the SEQ ID NO:1; SEQ ID NO:7, SEQ ID NO: 13, SEQ ID NO:15 or SEQ ID NO: 19 furthermore describe nucleic acid sequences which hybridize under standard conditions with the nucleic acid sequence or portions of the nucleic acid sequence set forth in SEQ ID NO:1; SEQ ID NO:7, SEQ ID NO: 13, SEQ ID NO:15 or SEQ ID NO:19 encoding a polypeptide having the function of a signal sequence, which directs the transport of a protein functionally linked to said signal se- quence in the mitochondrial matrix.
It is advantageous to use short oligonucleotides of a length of 10-50 bp, preferably 15- 40 bp, for example of the conserved or other regions, which can be determined via comparisons with other related genes in a manner known to the skilled worker for the hybridization. Alternatively, it is also possible to use longer fragments of the nucleic acids according to the invention or the complete sequences for the hybridization. These standard conditions vary depending on the nucleic acid used, viz. oligonucleotide, longer fragment or complete sequence, or depending on which type of nucleic acid, viz. DNA or RNA, is being used for the hybridization. Thus, for example, the melting tem- peratures for DNA:DNA hybrids are approx. 10°C lower than those of DNA:RNA hybrids of equal length.
Standard conditions are understood to mean, depending on the nucleic acid, for example temperatures between 42 and 58°C in an aqueous buffer solution with a concentra- tion of between 0.1 and 5 x SSC (1 x SSC = 0.15 M NaCl, 15 mM sodium citrate, pH 7.2) or additionally in the presence of 50% formamide such as, for example, 42°C in 5 x SSC, 50% formamide. The hybridization conditions for DNA:DNA hybrids are advantageously 0.1 x SSC and temperatures of between approximately 20 °C and 45 °C, preferably between approximately 30 °C and 45 °C. The hybridization conditions for DNA: RNA hybrids are advantageously 0.1 x SSC and temperatures of between approximately 30°C and 55 °C, preferably between approximately 45°C and 55°C. These temperatures stated for the hybridization are melting temperature values which have been calculated by way of example for a nucleic acid with a length of approx. 100 nucleotides and a G + C content of 50% in the absence of formamide. The experimental conditions for DNA hybridization are described in specialist textbooks of genetics such as, for example, Sambrook et al., "Molecular Cloning", Cold Spring Harbor Laboratory, 1989 and can be calculated using formulae known to the skilled worker, for example as a function of the length of the nucleic acids, the type of the hybrids or the G + C content. The skilled worker can find more information on hybridization in the following text- books: Ausubel et al. (eds), 1985, Current Protocols in Molecular Biology, John Wiley & Sons, New York; Hames and Higgins (eds), 1985, Nucleic Acids Hybridization: A Practical Approach, IRL Press at Oxford University Press, Oxford; Brown (ed), 1991, Essen- tial Molecular Biology: A Practical Approach, IRL Press at Oxford University Press, Oxford.
A functional equivalent is furthermore also understood to mean, in particular, natural or artificial mutations of the relevant nucleic acid sequences of the signal sequences as set forth in SEQ ID NO:1; SEQ ID NO:7, SEQ ID NO:13, SEQ ID NO:15 or SEQ ID NO: 19 and its homologs from other organisms , wherein mutations comprise substitutions, additions, deletions, inversions or insertions of one or more nucleotide residues. This may also lead to a modification of the corresponding amino acid sequence of the signal sequences by substitution, insertion or deletion of one or more amino acids.
Thus, the scope of the present invention also extends to, for example, those nucleotide sequences which are obtained by modification of the nucleic acid sequence of the selection marker described by SEQ ID NO:1; SEQ ID NO:7, SEQ ID NO:13 or SEQ ID NO: 19 respectively. The purpose of such a modification can be, for example, the insertion of further cleavage sites for restriction enzymes, the removal of excess DNA, or the addition of further sequences. Said nucleic acid sequences should still maintain the desired function as of a signal sequence, which directs the transport of a protein in the mitochondria.
The signal sequence b) can be derived from any protein, which has to be imported into the mitochondria. Thus, it is possible, to determine experimentally the signal sequences of inner mitochondrial proteins to find a suitable signal sequence.
Preferably, the signal sequence is the signal sequence of a protein with the biological activity of ferredoxin, which is preferably encoded by
ll-a) a nucleic acid sequence with the nucleic acid sequence shown in SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:21 ; or
I l-b) a nucleic acid sequence which, on the basis of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:16, SEQ ID NO:22 by back translation; or
ll-c) a functional equivalent of the nucleic acid sequence SEQ ID NO:3, which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:4; or
ll-d) a functional equivalent of the nucleic acid sequence SEQ ID NO:9, which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO: 10; or ll-e) a functional equivalent of the nucleic acid sequence SEQ ID NO:15, which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO: 16; or
ll-f) a functional equivalent of the nucleic acid sequence SEQ ID NO:21 , which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:22.
"Functional equivalents" in relation to the SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO: 15 or SEQ ID NO:21 describe nucleic acid sequences encoding a polypeptide having the function of mitochondrial ferredoxin.
The functional equivalents of the nucleic acid sequence SEQ ID NO:3 set forth in ll-c) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:4.
The functional equivalents of the nucleic acid sequence SEQ ID NO:9 set forth in ll-d) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO: 10.
The functional equivalents of the nucleic acid sequence SEQ ID NO:15 set forth in ll-e) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO: 16.
The functional equivalents of the nucleic acid sequence SEQ ID NO:21 set forth in ll-f) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:22.
"Functional equivalents" in the present context furthermore describe nucleic acid se- quences which hybridize under standard conditions with the nucleic acid sequence SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:21 or portions of the nucleic acid sequence SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO: 15 or SEQ ID NO:21 encoding a polypeptide having the function of ferredoxin.
Suitable hybridization conditions are those set forth above.
A functional equivalent is furthermore also understood to mean, in particular, natural or artificial mutations of the relevant nucleic acid sequences of the signal sequences as set forth in SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO: 15 or SEQ ID NO:21 and its ho- mologs from other organisms , wherein mutations comprise substitutions, additions, deletions, inversions or insertions of one or more nucleotide residues. This may also lead to a modification of the corresponding amino acid sequence of the signal sequences by substitution, insertion or deletion of one or more amino acids.
Thus, the scope of the present invention also extends to, for example, those nucleotide sequences which are obtained by modification of the nucleic acid sequence of the selection marker described by SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:21 respectively. The purpose of such a modification can be, for example, the insertion of further cleavage sites for restriction enzymes, the removal of excess DNA, or the addition of further sequences. Said nucleic acid sequences should still maintain the desired function as of the C-terminal part of a signal sequence, which directs the transport of a protein in the mitochondrial matrix.
In an especially preferred embodiment, the signal sequences, which directs the trans- port of a protein in the mitochondrial matrix, is derived from a nucleic acid sequence comprising ll-a) a nucleic acid sequence with the nucleic acid sequence shown in SEQ ID NO:5, SEQ ID NO:11, SEQ ID NO:17 or SEQ ID NO:23; or
lll-b) a nucleic acid sequence which, on the basis of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:16, SEQ ID NO:22 by back translation; or
lll-c) a functional equivalent of the nucleic acid sequence SEQ ID NO:3, which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:6; or lll-d) a functional equivalent of the nucleic acid sequence SEQ ID NO:9, which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:12; or
lll-e) a functional equivalent of the nucleic acid sequence SEQ ID NO:15, which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO: 18; or
lll-f) a functional equivalent of the nucleic acid sequence SEQ ID NO:21 , which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:24.
"Functional equivalents" in relation to the SEQ ID NO:5, SEQ ID NO:11, SEQ ID NO:17 or SEQ ID NO:23 describe nucleic acid sequences encoding a protein with the activity of ferredoxin having a signal sequence, which directs the transport of a protein in the mitochondrial matrix.
The functional equivalents of the nucleic acid sequence SEQ ID NO:5 set forth in lll-c) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:6
The functional equivalents of the nucleic acid sequence SEQ ID NO:11 set forth in lll-d) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:12.
The functional equivalents of the nucleic acid sequence SEQ ID NO:17 set forth in lll-e) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:18. The functional equivalents of the nucleic acid sequence SEQ ID NO:23 set forth in lll-f) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:6 by back translation having at least an identity of 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:24.
"Functional equivalents" in the present context furthermore describe nucleic acid se- quences which hybridize under standard conditions with the nucleic acid sequence SEQ ID NO:5, SEQ ID NO:11, SEQ ID NO: 17 or SEQ ID NO:23 or portions of the nucleic acid sequence SEQ ID NO:5, SEQ ID NO:11, SEQ ID NO:17 or SEQ ID NO:23 encoding a signal sequence, which directs the transport of a protein in the inner- mitochondrial matrix.
Suitable hybridization conditions are those set forth above.
A functional equivalent is furthermore also understood to mean, in particular, natural or artificial mutations of the relevant nucleic acid sequences of the signal sequences as set forth in SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:21 and its ho- mologs from other organisms , wherein mutations comprise substitutions, additions, deletions, inversions or insertions of one or more nucleotide residues. This may also lead to a modification of the corresponding amino acid sequence of the signal sequences by substitution, insertion or deletion of one or more amino acids.
Thus, the scope of the present invention also extends to, for example, those nucleotide sequences which are obtained by modification of the nucleic acid sequence of the selection marker described by SEQ ID NO:5, SEQ ID NO:11, SEQ ID NO:17 or SEQ ID NO:23 respectively. The purpose of such a modification can be, for example, the inser- tion of further cleavage sites for restriction enzymes, the removal of excess DNA, or the addition of further sequences.
Examples of suitable promoters are fungal promoters such as AUG1 , GPD-1 , PX6, TEF, CUP1, PGK, GAP1, TPI, PHO5, AOX1, GAL10/CYC1, CYC1, OliC, ADH, TDH, Kex2, MFa, GAL or NMT or combinations of the abovementioned promoters (Degryse et al., Yeast 1995 Jun 15; 11 (7):629-40; Romanos et al. Yeast 1992 Jun;8(6):423-88; Benito et al. Eur. J. Plant Pathol. 104, 207-220 (1998); Cregg et al. Biotechnology (N Y) 1993 Aug;11(8):905-10; Luo X., Gene 1995 Sep 22; 163(1): 127-31; Nacken et al., Gene 1996 Oct 10;175(1-2): 253-60; Turgeon et al., Mol Cell Biol 1987 Sep;7(9):3297-305).
A preferred fungal promoter is the GAL -promotor. The term reporter proteins are readily quantifiable proteins. The transformation efficacy or the expression site or timing can be assessed by means of these genes via growth assay, fluorescence assay, chemoluminescence assay, bioluminescence assay or resistance assay or via a photometric measurement (intrinsic color) or enzyme activity.
Preferred in this context are reporter proteins (Schenbom E, Groskreutz D. Mol Biotechnol. 1999; 13(1):29-44) such as "green fluorescent protein" (GFP) (Gerdes HH and Kaether C, FEBS Lett. 1996; 389(1 ):44-47; Chui WL et al., Curr Biol 1996, 6:325-330; Leffel SM et al., Biotechniques. 23(5):912-8, 1997), variants or derivates of green fluo- rescent marker protein (such as eGFP, GFP or cGFP) or lacZ, LUC, GUS, CAT, Oriti- din 5'Monophosphatdecarboxylase or Nitrat Reduktase, more preferred green fluorescent marker protein and variants or derivates of green fluorescent marker protein.
Suitable terminator are fungal fungal terminators such as the transcription terminator NMT, Gcy1, TrpC, AOX1, nos, PGK or CYC1 (Degryse et al., Yeast 1995 Jun 15; 11(7):629-40; Brunelli et al. Yeast 1993 Dec9(12): 1309-18; Frisch et al., Plant Mol. Biol. 27 (2), 405-409 (1995); Scorer et al., Biotechnology (N.Y.) 12 (2), 181-184 (1994), GenBank Ace. Number Z46232; Zhao et al. GenBank Ace Number : AF049064; Punt et al., (1987) Gene 56 (1), 117-124), more preferably fungal terminators selected from the group consisting of the AOX1-, nos-, PGK-, TrpC- and the CYC1 -terminator, most preferably the CYC-1 terminator.
Besides promotor or terminator, the expression cassettes may also contain functional elements. "Functional elements" are herein understood as meaning by way of example but not by limitation origins of replication and selection markers, functionally linked to the nucleic acid sequence in accordance with the invention direct or by means of a linker optionally comprising a protease cleavage site. "Selection markers" confer resistance to antibiotics or other toxic compounds: examples which may be mentioned in this context are the neomycin phosphotransferase gene, which confers resistance to the aminoglycoside antibiotics neomycin (G 418), kanamycin, paromycin (Deshayes A et al., EMBO J. 4 (1985) 2731-2737), the sul gene encoding a mutated dihydropteroate synthase (Guerineau F et al., Plant Mol Biol. 1990; 15(1):127-136), the hygromycin B phosphotransferase gene (Gen Bank Accession NO: K 01193) and the she ble resis- tance gene, which confers resistance to the bleomycin antibiotics, e.g. zeocin. Further examples of selection marker genes are genes which confer resistance to 2- deoxyglucose-6-phosphate (WO 98/45456) or phosphinothricin and the like, or those which confer a resistance to antimetabolites, for example the dhfr gene (Reiss, Plant Physiol. (Life Sci. Adv.) 13 (1994) 142-149). Examples of other genes which are suit- able are trpB or hisD (Hartman SC and Mulligan RC, Proc Natl Acad Sci U S A. 85 (1988) 8047-8051). Another suitable gene are the mannose phosphate isomerase gene (WO 94/20627) or the ODC (ornithine decarboxylase) gene (McConlogue, 1987 in: Current Communications in Molecular Biology, Cold Spring Harbor Laboratory, Ed.) or the Aspergillus terreus deaminase (Tamura K et al., Biosci Biotechnol Biochem. 59 (1995) 2336-2338) . Ori or "origin of replication" ensure the multiplication of the expression cassettes or vectors according to the invention in yeast, for example the ARS1 ori in yeast (Nucleic Acids Research, 2000, 28(10): 2060-2068).
All embodiments of the above-referred expression cassettes will herein after be referred to as "expression cassette according to the invention".
The expression cassettes according to the invention are also understood as meaning analogs which can be brought about, for example by a combination of the individual nucleic acid sequences on a polynucleotide (multiple constructs), on a plurality of poly- nucleotides in a cell (cotransformation) or by sequential transformation.
Also in accordance with the invention are vectors comprising at least one copy of the signal sequences b), if the expression vector comprises suitable promotor sequences and optionally suitable terminator sequences as defined above and/or the expression cassettes according to the invention.
Examples of suitable vectors for use in fungi are pYepSed (Baldari, et al., (1987) Embo J. 6:229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30:933-943), pJRY88 (Schultz et al., (1987) Gene 54:113-123), and pYES derivatives, pGAPZ derivatives, pPICZ derivatives and the vectors of the "Pichia Expression Kit" (Invitrogen Corporation, San Diego, CA). Vectors for use in filamentous fungi are described in: van den Hondel, C.A.M.J. J. & Punt, P. J. (1991 ) "Gene transfer systems and vector development for filamentous fungi", in: Applied Molecular Genetics of Fungi, J.F. Peberdy, et al., eds., p. 1-28, Cambridge University Press: Cambridge.
Another embodiment of the invention is a transgenic fungi comprising at least signal sequence b) and/or one expression cassette according to the invention and/or at least one vector according to the invention.
In this context, the introduction, into the organisms in question (transformation) of signal sequence b) and/or one expression cassette according to the invention and/or at least one vector according to the invention can be effected in principle by all methods with which the skilled worker is familiar.
The term "transformation" describes in the present context a process for introducing heterologous DNA into a eukaryotic cell. The term transformed cell describes not only the product of the transformation process per se, but also all of the transgenic progeny of the transgenic organism generated by the transformation. In the case of fungi, the skilled worker will find suitable methods in the textbooks by Sambrook, J. et al. (1989) "Molecular cloning: A laboratory manual", Cold Spring Harbor Laboratory Press, by F.M. Ausubel et al. (1994) "Current protocols in molecular biology", John Wiley and Sons, by D.M. Glover et al., DNA Cloning Vol.1, (1995), IRL Press (ISBN 019-963476-9), by Kaiser et al. (1994) Methods in Yeast Genetics, Cold Spring Habor Laboratory Press or Guthrie et al. "Guide to Yeast Genetics and Molecular Biology", Methods in Enzymology, 1994, Academic Press. In the case of the transformation of filamentous fungi, methods of choice are firstly the generation of protoplasts and transformation with the aid of PEG (Wiebe et al. (1997) Mycol. Res. 101 (7): 971-877; Proctor et al. (1997) Microbiol. 143, 2538-2591) and secondly the transformation with the aid of Agrobacterium tumefaciens (de Groot et al. (1998) Nat. Biotech. 16, 839-842).
The transgenic fungi generated by transformation with one of the above-described em- bodiments of an expression cassette according to the invention or with a vector according to the invention are subject matter of the present invention. The use of transgenic organisms in the assay systems described below is likewise subject matter of the present invention.
A further embodiment of the invention is the use of a transgenic organism according to the invention in a method of identifying fungicides.
In a preferred embodiment, this method comprises the following steps:
a) applying a test substance to the transgenic organism according to the invention, in which transcription of the nucleic acid sequence encoding a reporter protein has been initiated,
b) monitoring the amount of reporter protein; and
c) selecting test substances, which bring about significant decrease in the amount of reporter protein in the mitochondria of the transgenic organism of a).
If the transport in the mitochondria is blocked, there is a significant decrease in the ac- tively folded reporter protein. If the transport in the mitochondria is not blocked, there is a detectable amount of actively folded reporter protein.
Significant decrease means in the present context that a reduction of the reporter protein in the transformed organism in relation to the corresponding transgenic organism of the same species, which is not incubated with the test substance of at least 20%, advantageously at least 30%, preferably at least 50%, especially preferably at least 70% and very especially preferably at least 90%, or 100% reduction (blocking) is achieved using an inhibitor concentration of not more than lO^M, preferably not more than lO^M, more preferably not more than 10"°M and most preferably not more than 10"7M.
Preferably, the monitoring of test substances, which bring about significant decrease in the amount of reporter protein in the mitochondria of the transgenic organism of a) can done by comparing the amount of reporter protein present in the transgenic organism incubated with a test substance with the amount of reporter protein present in the transgenic organism, which is not incubated with the test substance
Furthermore, a transgenic organism according to the present invention, which is incubated with a known inhibitor can serve as "positive" control for selection of a suitable inhibitor.
In a particularly preferred embodiment, the reporter protein is green fluorescent marker protein, variants or derivates of green fluorescent marker protein, luciferase (see above, claim 3, what would be also preferred) and the monitoring of step b) is done by fluorometry or flow-cytometry (for reference see Curr Opin Biotechnol. 2003 Feb;14(1):5-12. Ibrahim SF, van den Engh G).
It is also possible, in the method according to the invention, to employ a plurality of test compounds in a method according to the invention. If a group of test compounds affects the target, then it is either possible directly to isolate the individual test compounds or to divide the group of test compounds into a variety of subgroups, for exam- pie when it consists of a multiplicity of different components, in order to reduce the number of the different test compounds in the method according to the invention. The method according to the invention is then repeated with the individual test compound or the relevant subgroup of test compounds. Depending on the complexity of the sample, the above-described steps can be carried out repeatedly, preferably until the subgroup identified in accordance with the method according to the invention only comprises a small number of test compounds, or indeed just one test compound.
All above-mentioned embodiments of the method of identifying fungicides are herein below termed as "method according to the invetion".
The method according to the invention can advantageously be carried out as an HTS procedure, which makes possible the simultaneous testing of a multiplicity of different compounds.
The use of supports which contain one or more transgenic organisms according to the invention lends itself to carrying out an HTS in practice. The support used is solid or liquid, it is preferably solid and especially preferably a microtiter plate. The abovemen- tioned supports are also the subject matter of the present invention. In accordance with the most widely used technique, 96-well microtiter plates, which, as a rule, can comprise volumes of from 50 to 500 μl, are used. Besides the microtiter plates, the further components of an HTS system which match the 96-well microtiter plates, such as a large number of instruments, materials, automatic pipetting devices, robots, automated plate readers and plate washers, are commercially available.
In addition to the HTS methods based on microtiter plates, what are known as "free- format assays" or assay systems where no physical barriers exist between the samples such as, for example, in Jayaickreme et al., Proc. Natl. Acad. Sci U.S.A. 19 (1994)
161418; Chelsky, "Strategies for Screening Combinatorial Libraries", First Annual Conference of The Society for Biomolecular Screening in Philadelphia, Pa. (Nov. 710, 1995); Salmon et al., Molecular Diversity 2 (1996), 5763 and US 5,976,813, may also be used.
All of the substances which have been identified via a method according to the invention can subsequently be checked for their fungicidal action in a further in-vivo activity assay. One possibility consists in assaying the substance in question in agar diffusion tests as described, for example, by Zahner, H. 1965 Biologie der Antibiotika, Berlin, Springer Verlag. The assay is carried out with a culture of a filamentous phytopathogenic fungus, preferably a culture of a phytopathogenic fungus. It is possible to identify the fungicidal action for example via reduced growth. The term phytopathogenic fungus is understood as meaning, in this context, the following genera and species: Alternaria species, Podosphaera species, Sclerotinia species, Physalospora canker on vegeta- bles and fruit, Botrytis cinerea (gray mold) on strawberries, vegetables, ornamentals and grapevines, Corynespora melonis on cucumbers, strawberries; Colletotrichum species on cucumbers; Diplocarpon rosae on roses; Elsinoe fawcetti and Diaporthe citri on citrus fruit; Sphaerotheca species on cucumbers, cucurbits, strawberries and roses; Uncinula necator on cucumbers, Cercospora species on peanuts, sugar beet, auber- gines and date plums; Erysiphe cichoracearum and Sphaerotheca fuliginea on cucurbits, Leveillula taurica on pimento; Mycosphaerella species on apples and Japanese apricot; Phyllactinia kakicola, Gloesporium kaki on Japanese apricot; Gymnosporan- gium yamadae, Leptotthrydium pomi, Podosphaera leucotricha and Gloedes pomigena on apples; Cladosporium carpophilum on pears and Japanese apricot; Phomopsis species on pears; Phytophthora species on citrus fruit, potatoes, onions; Phytophthora infestans on potatoes and tomatoes, Erysiphe graminis (powdery mildew) on cereals, Fusarium and Verticillium species on a variety of plants, Glomerella cingulata on tea; Drechslera or Bipolaris species on cereals, Mycosphaerella species on bananas and peanuts, Plasmopara viticola on grapevines and grapefruits, Peronospora species on onions, spinach and chrysanthemums; Phaeoisariopsis vitis and Spaceloma ampelina on grapefruits; Pseudocercosporella herpotrichoides on wheat and barley, Pseudoperonospora species on hops and cucumbers, Puccinia species and Typhula species on cereals, Pyrenophora teres on barley, Pyricularia oryzae on rice, Rhizoctonia species on cotton, rice and turf, Stachosporium nodorum on wheat, Uncinula necator on grapevines, Ustilago species on cereals and sugar cane, Gaeumannomyces graminis on oats and beet, and Venturia species (scab) on apples and pears.
The invention furthermore relates to nucleic acid sequences as target for fungicides encoding a polypeptide homologue to Tim 17 of the mitochondrial membrane complex comprising:
a) a nucleic acid sequence with the nucleic acid sequence shown in SEQ ID NO:25; or
b) a nucleic acid sequence which, on the basis of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO:26 by back translation; or
c) a functional equivalent of the nucleic acid sequence SEQ ID NO:25, which can be derived from an amino acid sequence by back-translation that has at least an identity of 74% with the SEQ ID NO:26.
and nucleic acid sequence as target for fungicides encoding a polypeptide homologue to Tom 20 of the mitochondrial membrane complex comprising:
d) a nucleic acid sequence with the nucleic acid sequence shown in SEQ ID NO:27; or
e) a nucleic acid sequence which, on the basis of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO:28 by back translation; or
f) a functional equivalent of the nucleic acid sequence SEQ ID NO:27, which can be derived from an amino acid sequence by back-translation that has at least an identity of 60% with the SEQ ID NO:28
A polypeptide homologue toTim 17 of the mitochondrial membrane describes a poly- peptid, which is an essential subunit of the TIM 23 complex responsible for the translocation of nuclear encoded proteins across the inner membrane of mitochondria.
A polypeptide with the activity of Tom 20 of the mitochondrial membrane complex de- scribes a polypeptide, which an essential subunit of the TOM complex, which is responsible for the translocation across the mitochondrial outer membrane. The functional equivalents of the nucleic acid sequence SEQ ID NO:25 set forth in c) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:26 by back translation having at least an identity of 74%, 75%, 76%, 77%, 78% or 79% preferably of 80%, 81%, 82%, 83%, 84%, 85% or 86 more preferably of 87%, 88%, 89% or 90% and most preferably of 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:26.
The functional equivalents of the nucleic acid sequence SEQ ID NO:27 set forth in e) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:28 by back translation having at least an identity of 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:28.
The invention furthermore relates to the use of nucleic acid sequences as target for fungicides encoding a polypeptide homologue to Tim 17 of the mitochondrial membrane complex in a method according to the invention said nucleic acid sequence comprising:
a) a nucleic acid sequence with the nucleic acid sequence shown in SEQ ID NO:25; or
b) a nucleic acid sequence which, on the basis of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO:26 by back translation; or
c) a functional equivalent of the nucleic acid sequence SEQ ID NO:25, which can be derived from an amino acid sequence by back-translation that has at least an identity of 50% with the SEQ ID NO:26.
and to the use of nucleic acid sequences as target for fungicides encoding a polypeptide homologue to Tom 20 of the mitochondrial membrane complex in a method according to the invention said nucleic acid sequence comprising:
d) a nucleic acid sequence with the nucleic acid sequence shown in SEQ ID NO:27; or
e) a nucleic acid sequence which, on the basis of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO:28 by back translation; or f) a functional equivalent of the nucleic acid sequence SEQ ID NO:27, which can be derived from an amino acid sequence by back-translation that has at least an identity of 50% with the SEQ ID NO:28.
The functional equivalents of the nucleic acid sequence SEQ ID NO:25 set forth in c) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:26 by back translation having at least an identity of 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:26
An examples of a functional equivalents of SEQ ID NO: 25 is the nucleic acid se- quences of
Saccharomyces.cerevisiae (http://db.yeastgenome.org, Ace. No.:YJL143W Chr 10)
An example of a functional equivalent of SEQ ID NO: 26 is the amino acid sequence of Saccharomyces.cerevisiae (http://www.ncbi.nlm.nih.gov, Ace. No.: CAA89438)
The functional equivalents of the nucleic acid sequence SEQ ID NO:27 set forth in e) can be deduced from a functional equivalent of the amino acid sequence shown in SEQ ID NO:28 by back translation having at least an identity of 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65% preferably of 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% more preferably of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% and most preferably of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the SEQ ID NO:28
Examples of a functional equivalents of SEQ ID NO: 27 are the nucleic acid sequences of
Saccharomyces.cerevisiae (http://db.yeastgenome.org; Ace. No: YGR082W) and Neurospora crassa (http://www.ncbi.nlm.nih.gov/entrez; Ace. No: XM_326486)
Examples of a functional equivalent of SEQ ID NO: 28 are the amino acid sequences of Saccharomyces.cerevisiae (http://www.ncbi.nlm.nih.gov; Ace. No.:CAA97084) and Neurspora crassa (http://www.ncbi.nlm.nih.gov/entrez; Ace. No.:XP_326487)
These sequences are herein incorporated by reference.
The invention furthermore relates to compounds identified by the methods according to the invention. These compounds are hereinbelow referred to as "selected compounds". They have a molecular weight of less than 1 000 g/mol, advantageously less than 500 g/mol, preferably less than 400 g/mol, especially preferably less than 300 g/mol. Fungicidally active compounds have a Ki value of less than 1 mM, preferably less than 1 μM, especially preferably less than 0.1 μM, very especially preferably less than 0.01 μM.
The selected compounds are suitable for controlling phytopathogenic fungi. Examples of phytopathogenic fungi are those mentioned above.
The selected compounds can also be present in the form of their agriculturally useful salts. Agriculturally useful salts which are suitable are mainly the salts of those cations, or the acid addition salts of those acids, whose cations, or anions, do not adversely affect the fungicidal action of the fungicidally active compounds identified via the methods according to the invention.
All of the compounds identified via the above methods can, if they contain chiral centers, be subject matter of the present invention in the form of pure enantiomers or di- astereomers or in the form of their mixtures and as racemates.
The selected compounds can be chemically synthesized substances or substances produced by microorganisms and can be found, for example, in cell extracts of, for example, plants, animals or microorganisms. The reaction mixture can be a cell-free extract or comprise a cell or cell culture. Suitable methods are known to the skilled worker and are described generally for example in Alberts, Molecular Biology the cell, 3rd Edi- tion (1994), for example chapter 17.
Possible test compounds can be expression libraries such as, for example, cDNA expression libraries, peptides, proteins, nucleic acids, antibodies, small organic substances, hormones, PNAs or the like (Milner, Nature Medicin 1 (1995), 879-880; Hupp, Cell. 83 (1995), 237-245; Gibbs, Cell. 79 (1994), 193-198 and references cited therein).
Fungicidal compositions which comprise the selected compounds demonstrate very good control of phytopathogenic fungi, especially at high application rates. In crops such as wheat, rice, maize, soybean and cotton, they act against phytopathogenic fungi without inflicting any significant damage on the crop plants. This effect is observed in particular at low application rates. Whether the fungicidal active ingredients found with the aid of the methods according to the invention act as nonselective or as selective fungicides depends, inter alia, on the application rate, the selectivity and other factors. The substances can be used for controlling the pathogenic fungi which have already been mentioned above. Depending on the application method in question, the selected compounds, or compositions comprising them, can advantageously be used for eliminating the phytopathogenic fungi which have already been mentioned at the outset.
The invention furthermore relates to a method of preparing the fungicidal composition which has already been mentioned above, which comprises formulating selected compounds with adjuvants which are suitable for the formulation of fungicides.
The selected compounds can be formulated for example in the form of directly spray- able aqueous solutions, powders, suspensions, also highly concentrated aqueous, oily or other suspensions or suspoemulsions or dispersions, emulsifiable concentrates, emulsions, oil dispersions, pastes, dusts, materials for spreading or granules and applied by means of spraying, atomizing, dusting, spreading or pouring. The use forms depend on the intended use and the nature of the selected compounds; in each case, they should guarantee the finest possible distribution of the selected compounds. The fungicidal compositions comprise a fungicidally active amount of at least one selected compound and auxiliaries conventionally used in the formulation of fungicidal compositions.
For the preparation of emulsions, pastes or aqueous or oily formulations and dispersible concentrates (DC), the selected compounds can be dissolved or dispersed in an oil or solvent, it being possible to add further formulation auxiliaries for homogenization purposes. However, it is also possible to prepare liquid or solid concentrates of selected compound, if appropriate solvents or oil and, optionally, further auxiliaries, and these concentrates are suitable for dilution with water. The following can be mentioned: emulsifiable concentrates (EC, EW), suspensions (SC), soluble concentrates (SL), dispersible concentrates (DC), pastes, pills, wettable powders or granules, it being possible for the solid formulations either to be soluble or dispersible (wettable) in water. In addition, suitable powders or granules or tablets can additionally be provided with a coating which prevents abrasion or premature release of the active ingredient.
In principle, the term "auxiliaries" is understood as meaning the following classes of compounds: antifoam agents, thickeners, wetters, stickers, dispersants, emulsifiers, bactericides and/or thixotropic agents. The skilled worker is familiar with the meaning of the abovementioned agents.
SLs, EWs and ECs can be prepared by simply mixing the constituents in question; powders can be prepared by mixing or grinding in specific types of mills (for example hammer mills). DCs, SCs and SEs are usually prepared by wet milling, it being possi- ble to prepare an SE from an SC by addition of an organic phase which may comprise further auxiliaries or selected compounds. The preparation is known. Powders, materials for spreading and dusts can advantageously be prepared by mixing or concomi- tantly grinding the active substances together with a solid carrier. Granules, for example coated granules, impregnated granules and homogeneous granules, can be prepared by binding the selected compounds to solid carriers. The skilled worker is familiar with further details regarding the preparation, which are mentioned for example in the following publications: US 3,060,084, EP-A 707445 (for liquid concentrates), Browning, "Agglomeration", Chemical Engineering, Dec. 4, 1967, 147-48, Perry's Chemical Engineer's Handbook, 4th Ed., McGraw-Hill, New York, 1963, pages 8-57 and et seq. WO 91/13546, US 4,172,714, US 4,144,050, US 3,920,442, US 5,180,587, US 5,232,701, US 5,208,030, GB 2,095,558, US 3,299,566, Klingman, Weed Control as a Science, John Wiley and Sons, Inc., New York, 1961, Hance et al., Weed Control Handbook, 8th Ed., Blackwell Scientific Publications, Oxford, 1989 and Mollet, H., Grubemann, A., Formulation technology, Wiley VCH Verlag GmbH, Weinheim (Federal Republic of Germany), 2001.
The skilled worker is familiar with a multiplicity of inert liquid and/or solid carriers which are suitable for the formulations according to the invention, such as, for example, liquid additives such as mineral oil fractions of medium to high boiling point such as kerosene or diesel oil, furthermore coal tar oils and oils of vegetable or animal origin, aliphatic, cyclic and aromatic hydrocarbons, for example paraffin, tetrahydronaphthalene, alky- lated naphthalenes or their derivatives, alkylated benzenes or their derivatives, alcohols such as methanol, ethanol, propanol, butanol and cyclohexanol, ketones such as cyclohexanone, or strongly polar solvents, for example amines such as N- methylpyrrolidone or water.
Examples of solid carriers are mineral earths such as silicas, silica gels, silicates, talc, kaolin, limestone, lime, chalk, bole, loess, clay, dolomite, diatomaceous earth, calcium sulfate, magnesium sulfate, magnesium oxide, ground synthetic materials, fertilizers such as ammonium sulfate, ammonium phosphate, ammonium nitrate, ureas and products of vegetable origin such as cereal meal, tree bark meal, wood meal and nut- shell meal, cellulose powders or other solid carriers.
The skilled worker is familiar with a multiplicity of surface-active substances (surfactants) which are suitable for the formulations according to the invention such as, for example, alkali metal salts, alkaline earth metal salts or ammonium salts of aromatic sulfonic acids, for example lignosulfonic acid, phenolsulfonic acid, naphthalenesulfonic acid and dibutylnaphthalenesulfonic acid, and of fatty acids, of alkyl- and alkylarylsul- fonates, of alkyl sulfates, lauryl ether sulfates and fatty alcohol sulfates, and salts of sulfated hexa-, hepta- and octadecanols and of fatty alcohol glycol ethers, condensates of sulfonated naphthalene and its derivatives with formaldehyde, condensates of naph- thalene or of the naphthalenesulfonic acids with phenol and formaldehyde, polyoxyethylene octylphenol ether, ethoxylated isooctyl-, octyl- or nonylphenol, alkylphenyl polyglycol ethers, tributylphenyl polyglycol ethers, alkylaryl polyether alcohols, isotride- cyl alcohol, fatty alcohol/ethylene oxide condensates, ethoxylated castor oil, polyoxyethylene alkyl ethers or polyoxypropylene alkyl ethers, lauryl alcohol polyglycol ether acetate, sorbitol esters, lignin-sulfite waste liquors or methylcellulose.
The fungicidal compositions, or the active ingredients, can be applied curatively, eradi- catively or protectively.
Depending on the intended aim of the control measures, the season, the target plants and the growth stage, the application rates of fungicidal active ingredient (= substances and/or composition) amount to 0.001 to 3.0, preferably 0.01 to 1.0, kg/ha.
The invention is illustrated in greater detail by the examples which follow, but is not limited thereto.
What follows is a brief description of the recombinant methods on which the use examples hereinbelow are based.
Cloning methods such as, for example, restriction cleavages, the isolation of DNA, aga- rose gel electrophoreses, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linking DNA fragments, transformation of E. coli cells, bacterial cultures, sequence analysis of recombinant DNA and Southern and Western blots were carried out as described by Sambrook et al. Cold Spring Harbor Laboratory Press, (1989) and Ausubel, F.M. et al., Current Protocols in Molecular Biol- ogy, Greene Publishing Assoc. and Wiley-lnterscience (1994); ISBN 0-87969-309-6.
Moreover, all of the chemicals used hereinbelow were obtained in analytical-grade quality from Fluka (Neu-Ulm), Merck (Darmstadt), Roth (Karlsruhe), Serva (Heidelberg) and Sigma (Deisenhofen), unless otherwise specified. Solutions were prepared with purified, pyrogen-free water, hereinbelow referred to as H2O, from a Milli-Q Water System water purification system (Millipore, Eschborn). Restriction enzymes, DNA- modifying enzymes and molecular biology kits were obtained from AGS (Heidelberg), Amersham (Braunschweig), Biometra (Gδttingen), Roche (Mannheim), Genomed (Bad Oeynnhausen), New England Biolabs (Schwalbach Taunus), Novagen (Madison, Wis- consin, USA), Perkin-Elmer (Weiterstadt), Promega (Madison, Wisconsin, USA),
Pharmacia (Freiburg), Qiagen (Hilden) and Stratagene (Heidelberg). Unless otherwise specified, they were used in accordance with the manufacturer's instructions.
All of the media and buffers used for the recombinant experiments were sterilized ei- ther by filter sterilization or by heating in the autoclave.
Examples Example 1- construction of expression plasmid pLACδ comprising a reporter protein fused with a signal sequence
A recombinant version of the Green Fluorescent Protein (GFP) was obtained as followed:
A 174 bp DNA fragment encoding the peptide leader sequence (the first 58 amino acids from N-terminus) of the yeast YAH1 (SwissProt; Q12184), a protein encoded by a nuclear gene and localised in the mitochondrial matrix of the yeast cells (Barros MH and Nobrega FG (1999), Gene 233(1 -2): 197-203; Lange H, er a/. (2000) Proc Natl Acad Sci U S A 97(3): 1050-5), was amplified by PCR using the oligonucleotide primers:
Lac 78 (5'cccgaattcatgctgaaaattgttactcg 3') (SEQ ID NO: 29) and
Lac 79 (5'ttattctagatttccatggggcctggtttcggttttttcaaatggccgt 3') (SEQ ID NO:30)
A 734 bp DNA fragment encoding the Green Fluorescent Protein (GFP) was amplified by PCR using the plasmid pEGFP-N2 (Genbank; U57608) and the oligonucleotide primers:
Lac 84 (5'cgccaccatggtgagcaagggcgaggagctgtt 3') (SEQ ID NO:31)and
Lac 85 (5'tatgatctagagtcgcggccgctttacttgtacagctcg 3')(SEQ ID NO:32)
The PCR products were assembled in frame with the Nco I restriction sites present in the oligonucleotides Lac 79 and Lac 84 and cloned in the expression plasmid pYes2 (Invitrogen) using the restriction sites EcoR / and Xba I present in the oligonucleotides Lac 78 and Lac 85, respectively. In the resulting plasmid pLACδ, the recombinant gene encoding the chimeric protein preYAH1-GFP corresponding to the leader sequence of YAH1 fused to GFP in the N-terminus is under the control of the galactose (Gal 1) promoter and cytochrome C1 terminator.
Example 2- construction of plasmid pLAC10 comprising a reporter protein without a signal sequence
Plasmid pLAC10 containing the cDNA of the protein marker (GFP) without mitochondrial leader sequence was created in analogy to the procedure set forth in example 1. To do so the GFP DNA fragment was amplified by PCR using the plasmid pEGFP-N2 (Genbank; U57608) and the oligonucleotide primers Lac 89 (5'aaaagaattcatggtgagcaagggcgagga 3') (SEQ ID NO:33)and
Lac 85 (see above, SEQ ID NO:32).
The PCR fragment was cloned in the expression plasmid pYes2 using the restriction enzymes EcoR I and Xba I.
Example 3- Transformation of the yeast Saccharomyces cerevisiae
The Saccharomyces cerevisiae strain INVSd (genotype MATa, his3delta1, Ieu2, trp1- 289,ura3-52) was obtained from Invitrogen GmbH. The strain was transformed with the plasmid pLACδ or pLACIO using the protoplast transformation method according to Ausubel et al. (Current Protocols in Molecular Biology, Ausubel et al. (eds), 1985, Current Protocols in Molecular Biology, John Wiley & Sons, New York).
The recombinant strains INVSd -pLacδ and INVSd -pLadO were isolated on selective medium due to their capability to grow in the absence of uracile by the plasmid complementation (pYES 2) as indicated by the supplier (Invitrogen GmbH).
Example 4- Cell culture and production of the recombinant GFP in mitochondria / Evaluation of the test system
The strain INVSd -pLacδ was cultured in liquid medium M-SD-1 (made with Minimal SD Base containing 2% glucose as carbon source (Ref 630411.Clontech) supple- mented with -Ura Do Supplement (630416, Clontech) and 2% Galactose). The culture was incubated at 28°C with 200 rpm. In this conditions, the production of GFP does not occur during the early phases of the culture since the Gall promoter is repressed by the presence of glucose in the medium.
In the strain INVSd -pLacδ, GFP fused with the signal sequence is produced when the recombinant yeast is using galactose as the major carbon source. This event occurred generally during the late log-phase of culture since the yeast use preferentially the glucose as the first carbon source. After 36h, the green fluorescence corresponding to the production of GFP was observed in the strain INVSd -pLacδ using an an AxlOSSCkop microscope (Zeiss) with a filter 450-490 nm.
In the same conditions, a low level of fluorescence was observed with strain INVSd - pLadO after δOh of culture.
The fluorescence was followed during the culture with a PolarStar spectrophotometer from BMG Labtechnologies using an excitation and an emission wavelength of 465 nm and 520 mn, respectively. Example 5- Localization of the recombinant GFP into mitochondria of the yeast INVSd -pLacδ was verified by microscopic observation
For this purpose, the yeast INVSd -pLacδ was cultured as described above and sub- cellular fractions of the recombinant strain were obtained by differential centrifigution as described previously (Zinser and Daum (Yeast. 1995 May;11(6):493-536; Dumas B, Cauet G, Lacour T, Degryse E, Laruelle L, Ledoux C, Spagnoli R, AchstetterT, Eur J Biochem. 1996 Jun 1 ;23δ(2):495-504). The recombinant cells were collected at the end of the culture and broken according to classical techniques (as set forth in Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley- lnterscience (1994); ISBN 0-67969-309-6). The cell extract was cleared by several centrifugation steps (3x (2000xg, 10 min). Then, the supernatant was centrifuged at 10 OOOxg for 20 min. to pellet the mitochondria. The soluble fraction was finally centrifuged at 150 OOOxg for 1h to pellet the microsomes; the remaining supernatant corresponded to the cytosolic fraction of the cells. This technology permits the separation of 3 sub- cellular fractions, namely the mitochondrial , the microsomal and the cytosolic fractions with a good yield of purity to perform further investigations. The microsomal and mitochondrial sub-cellular fractions were suspended with a solution containing 50 mM Tris buffer pH7.4 and sorbitol 0,6M to reach a protein concentration of about 10 mg/ml. Then, 50 Dg of each subcellular fractions were used for microscopic observations to visualize the fluorescence of the chimeric GFP using an AxlOSSCkop microscope (Zeiss) with a filter 450-490nm as described above The mitochondrial fraction was the only one to show the typical fluorescence of GFP indicating that the GFP is localized in the mitochondria of the recombinant cells.
Example 5- high-throughput test system for identification of antifungal agents
A test system using the yeast strain INVSd -pLacβ to identify or optimise modulators of the mitochondrial protein import has been developed in a micro plate format. The culture of INVSd -pLacδ was performed in classical micro plates (96 wells) using 200 i M-SD1 as described above. After 24h of culture test compounds are added to the micro-culture in a concentration range (mM to μM) to avoid toxicity. The incubation is fur- ther conducted for 24h.
Then, the fluorescence of the micro-cultures is analysed by flow-cytometry, a technology permitting the precise measurement of the fluorescence of single cells for a given number of cells.
Aliquots containing precisely 10000 cells were analysed for each micro-culture. The flow-cytometer permitted to measure the fluorescence of each cells individually. The measurement was automatically stopped as soon as 10000 cells were analysed. The repartition of the fluorescence among the population of the 10000 cells was registered by implementing the fluorescence intensity of each cells.
In a first step, the cells of INVSd -pLacδ cultured without test compounds and inhibitor presenting significant fluorescence intensity were counted and compared with wild type strain INVSd. The measurements indicated that the fluorescence relating to the GFP fused with the signal sequence of INVSd -pLacδ can be identified and quantified in the respective diagrams (region from 50AU to 1000 AU) in comparison to the wild type strain INVSd presenting a basal fluorescence (from 0 AU to 50 AU).
It has to be noticed that the fluorescence intensity is not equal for each individual cells of the micro-culture. This can be explained simply by the fact that the galactose induction at the molecular level may not start exactly at the same time depending on the physiological state of individual cells (cells in mitosis, or younger cells generated in the late log phase of the culture may not have enough galactose available to produce the recombinant GFP).
In a second step, antimycin (1 mM) was used to validate the test system. The com- pound is known to inhibit the ATP synthesis and consequently prevents the formation of the membrane potential of inner mitochondrial membrane, which is essential to import protein precursor in mitochondria.
The fluorescence pattern of cells of INVSd -pLacδ cultured with antimycin was different from the fluorescence pattern of cells of INVSd -pLacδ cultured without the inhibitor antimycin (region 50 AU to 1000 AU), Actually, the fluorescence was significantly reduced, to the basic level observed for the wild-type strain INVSd.
Example 6
DSM:4527 can be used as F. Graminearum wild-type strain.
The genes encoding Tom 20 and Tim 17 homologues from Fusarium graminearum have been identified by systematic sequencing of a cDna library of Fusarium graminea- rum. The respective sequences are set forth in SEQ ID NO: and SEQ ID NO:
A - Generation of the knock-out plasmid
To generate the Tim 17- knock-out plasmid, the oligonucleotide primers
Fus14δ2 5' ATAAGAATGCGGCCGCgtatcaagggtttccgcaa 3' (SEQ ID NO:34) and Fus14δ3 5' AAATGGCGCGCCtgaaatacaagaggcccag 3' (SEQ ID NO:35)
were used to amplify by PCR a 516 bp DNA fragment from the gene encoding Tim 17 from Fusamirum graminearum. The fragment was cloned into the vector pUCmini-Hyg (as described PCT/EP/03/07026) using the restriction sites Notl and Asd , present in Fus14δ2 and Fus14δ3, respectively. The resulting plasmid, Tim 17- knock-out plasmid, was used to transform Fusarium graminearum as described in PCT/EP/03/0702δ.
To generate the Tom 20- knock-out plasmid, the oligonucleotide primers
Fusδl 5' ATAAGAATGCGGCCGCtttgcctcctgaacccta 3' (SEQ ID NO:36) and
Fusδ2 5' AAATGGCGCGCCgcgagacagtgaactcat 3' (SEQ ID NO:37)
were used to amplify by PCR a 495 bp DNA fragment from the gene encoding Tom20 of Fusamirum graminearum. The fragment was cloned into the vector pUCmini-Hyg (as described in (PCT/EP/03/0702δ) using the restriction sites Notl and Asd , present in the Fus81 and Fus82, respectively. The resulting plasmid, Tom 20- knock-out plasmid, was used to transform Fusarium graminearum as described in Example 3.
To generate the PKS-knock-out plasmid used as a control for Fusarium graminearum transformation, a 490 bp DNA fragment of the gene encoding the polyketide synthase from Fusarium graminearum (as described in PCT/EP/03/0702δ) was amplified by PCR using the oligonucleotide primers
Lac 205: 5' ATAAGAATGCGGCCGCatggctagtatcgtaccaga 3' (SEQ ID NO:3δ)
Lac 206: 5' AAATGGCGCGCCcgtcaaaggtgttgcagttg 3' (SEQ ID NO:39)
The fragment was cloned into the vector the pUCmini-Hyg (as described in PCT/EP/03/0702δ) using the restriction sites Notl and Asd, present in Lac 205 and Lac 206, respectively.
B-Gene disruption based on homologous recombination in Fusarium graminearum
The Tim 17- knock-out plasmid, the Tom 20- knock-out plasmid and the PKS-knock-out plasmid were linearized with the restriction enzymes SgrA1, Xhol and Eco47lll located in the middle of the DNA inserts, respectively.
The transformation was performed as described in PCT/EP/03/0702δ. 50 ml of CM-medium (Leach et al., 1982, J. Gen. Microbiol. 128: 1719-1729) were inoculated with approximately 105 conidia, and incubated for 2 days at 28°C, 140 rpm. Resulting hyphae were homogenized in a Warring-Blender; 200 ml CM were inoculated with 10 ml hyphal suspension, and incubated overnight at 24°C. Mycel were trapped on a sterile filter, and washed two times with sterile water. 2 g of the hyphae were resus- pended in 20 ml Driselase/Glucanase (Interspex Products, San Maneo, USA; 5% / 3% in 700 mM NaCl, pH 5.6), and digested 21/2 to 3 h at 2δ°C, 75 rpm. Undigested hyphal were removed from the protoplast suspension by filtration through gauze and Nybold membrane (50 μm pore size). The protoplast suspension were combined with 700 mM NaCl and again passed through the gauze and the Nybold membrane. The protoplasts were pelleted by centrifugation (1300 x g) in a swing-out Rotor and washed two times with ice-cold NaCl 700 mM and centrifuge (630 x g). Then the protoplasts were resus- pended in STC (O.δ M sorbitol, 50 mM Tris-HCI pH δ.0, 50 mM CaCI2) and store on ice until transformation .
For transformation, protoplasts were resuspended in 4 parts STC and 1 part SPTC (O.δ M sorbitol, 40% polyethylene glycol 4000, 50 mM Tris-HCI pH 6.0, 50 mM CaCI2) at a concentration of 0.5-2 x 10δ/ml; 30μg of the linearized UGP- and gpmkl knock-out plasmids were added to 100 μl of the protoplast suspension in 10 ml tubes. After mix- ing, samples were incubated on ice for 30 min. 1 ml SPTC was mixed to the suspension and incubated at room temperature for 20 min. Protoplasts were mixed gently into 200 ml regeneration medium ( 0.1% (w/v) yeast extract, 0.1% (w/v) caseinhydrolysate, 34.2% (w/v) sucrose, 1.6% (w/v) granulated Agar) at 43°C and spread on a 94 mm plates (20 ml per plate). The plates were incubated at 2δ°C. After 12-24 h, the plates were overlaid with 10 ml per plate water based selective medium (16g/l granulated agar, 100mg/l Hygromycin and further incubated at 2δ°C until transformants were obtained, which were transferred to fresh CM-Hyg-plates (consisting of CM-media, 100μg/ml hygromycin and 2% (w/v) Agar. The transformants were isolated by single spore isolation. For generation of conidia, the transformants were cultivated on SNA plates (Nirenberg, 1981 , Canadian J. Botany 59: 1599-1609) under UV-light 7-14 days at 1δ°C. Dilutions of conidia were plated on CM-Hyg plates, and single colonies were transferred from these plates to fresh CM-Hyg plates..
The characterization of the recombinant clones was performed via PCR analysis as described previously (see example 4 of PCT/EP/03/0702δ) To do so, primers specific for Tom 20 gene, Tim 17 gene and PKS gene corresponding to the 5' flanking region and 3' flanking region of the genomic DNA fragments homologous to the DNA inserts of Tim 17- knock-out plasmid, Tom 20- knock-out plasmid and PKS-knock-out plasmid, were designed as followed:
Ef-Tim17 5'tttctgcatgggtgccatcggt3' (SEQ ID NO:40) Er-Tim17 5" atgtcagccagtcgttgttcgt 3' (SEQ ID NO:41 ) Ef-Tom20 5' gcaggatagaccttgagaccct 3' (SEQ ID NO:42) Er-Tom20 5' gacgtaatattctccgtcactc 3' (SEQ ID NO:43)
Ef-Pks : 5' ATAAGAATGCGGCCGCgccctcgaaacagcttacga 3" (SEQ ID NO:44) Ef-Pks : 5' AAATGGCGCGCCacagtatccgtctgctccat 3' (SEQ ID NO:45)
And used in combination with the primers
Lac 93 5' gtcaggcaactatggatgaacgaaatagac 3' (for Ef-Tim17 or Ef-Tom20 or Ef-Pks) (SEQ ID NO:46)
Lac 92 5' cggctacactagaaggacagtatttggta 3'(for Er-Tim17 or Er-Tom20 or Er-Pks) (SEQ ID NO:47)
specifc for the vector the pUCmini-Hyg.
In the control experiment consisting to the disruption of the PKS gene, more than δ0% of the transfomants were found to present the disrupted PKS gene due to the integration of the PKS-knock-out plasmid in the PKS locus by homologous recombination.
In the same conditions, the genes encoding Tom 20 and Tim17 could not been disrupted by homologous recombination with the Tom 20- knock-out plasmid and Tim 17- knock-out plasmid, respectively. Instead, 100 % of the transformants were found to present ectopic insertion of the knock-out plasmids. Thus, transformants bearing a disrupted copy of the Tom 20 or Tim17 genes are not viable.
Sequence listing
Sequence* Organism* Description*
SEQ ID NO:1 nucleic acid sequence N SC
SEQ ID NO:2 amino acid sequence N SC
SEQ ID NO:3 nucleic acid sequence C SC
SEQ ID NO:4 amino acid sequence C SC
SEQ ID NO:5 nucleic acid sequence N+C SC
SEQ ID NO:6 amino acid sequence N+C SC
SEQ ID NO:7 nucleic acid sequence N FG
SEQ ID NO:β amino acid sequence N FG
SEQ ID NO:9 nucleic acid sequence C FG
SEQ ID NO:10 amino acid sequence C FG
SEQ ID NO:11 nucleic acid sequence N+C FG
SEQ ID NO:12 amino acid sequence N+C FG
SEQ ID NO:13 nucleic acid sequence N CA
SEQ ID NO:14 amino acid sequence N CA
SEQ ID NO:15 nucleic acid sequence C CA
SEQ ID NO:16 amino acid sequence C CA
SEQ ID NO:17 nucleic acid sequence N+C CA
SEQ ID NO:1δ amino acid sequence N+C CA
SEQ ID NO:19 nucleic acid sequence N MG
SEQ ID NO:20 amino acid sequence N MG
SEQ ID NO:21 nucleic acid sequence C MG
SEQ ID NO:22 amino acid sequence C MG
SEQ ID NO:23 nucleic acid sequence N+C MG
SEQ ID NO:24 amino acid sequence N+C MG
SEQ ID NO:25 nucleic acid sequence Tim 17 FG
SEQ ID NO:26 amino acid sequence Tim 17 FG
SEQ ID NO:27 nucleic acid sequence Tom 20 FG
SEQ ID NO:2β amino acid sequence Tom 20 FG
*) N= leader sequence C= ferredoxin (mature protein) N+C = ferredoxin precursor (leader sequence and ferredoxin) SC = Saccharomyces cerevisiae FG = Fusarium graminearum CA = Candida albicans MG = Magnaporthe grisea

Claims

We claim:
1. An expression cassette comprising a) a promotor facilitating expression in eukaryotes; b) a nucleic acid sequence encoding a signal sequence that directs transport into the mitochondria of yeast or fungi; and c) a nucleic acid sequence encoding a reporter protein wherein all three elements are functionally linked together.
2. An expression cassette according to claim 1 additionally comprising d) a terminator which facilitates transcription termination in eukaryotes, which is functionally linked to the nucleic acid sequence c).
3. An expression cassette according to claim 1 or 2, wherein the signal sequence b) has a length between 20 and 120 amino acid residues.
4. An expression cassette as claimed in any of claims 1 , 2 or 3, wherein the signal sequence b) comprises (i) between 20%-40% of hydrophobic amino acids selected from the group consisting of A, I, L, F, W, V and M;
(i) between 20%-40% of polar amino acids selected from the group consisting of N, C, Q, S, T and Y;
(i) between 0%-10% of acidic amino acids selected from the group consisting of D and E; and
(i) between 5%-25% of basic amino acids selected from the group consisting of K and R.
5. An expression cassette as claimed in any of claims 1 to 4, wherein the signal sequence b) comprises a) a nucleic acid sequence with the nucleic acid sequence shown in SEQ ID NO:1; SEQ ID NO:7, SEQ ID NO:13 or SEQ ID NO:19; or b) a nucleic acid sequence which, on the basis of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO:2; SEQ ID NO:δ, SEQ ID NO:14 or SEQ ID NO:20 by back translation; or c) a functional equivalent of the nucleic acid sequence SEQ ID NO:1 , which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:2; or d) a functional equivalent of the nucleic acid sequence SEQ ID NO:7, which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:δ; or e) a functional equivalent of the nucleic acid sequence SEQ ID NO: 13, which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO: 14; or f) a functional equivalent of the nucleic acid sequence SEQ ID NO: 19, which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:20.
6. An expression cassette as claimed in any of claims 1 to 5, wherein the signal sequence b) is the signal sequence of a protein with the activity of ferredoxin.
7. An expression cassette as claimed in claim 6, wherein the protein with the activity of ferredoxin is encoded by a) a nucleic acid sequence with the nucleic acid sequence shown in SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:21; or b) a nucleic acid sequence which, on the basis of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:16, SEQ ID NO:22 by back translation; or c) a functional equivalent of the nucleic acid sequence SEQ ID NO:3, which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:4; or d) a functional equivalent of the nucleic acid sequence SEQ ID NO:9, which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO: 10; or e) a functional equivalent of the nucleic acid sequence SEQ ID NO:15, which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO: 16; or f) a functional equivalent of the nucleic acid sequence SEQ ID NO:21 , which can be derived from an amino acid sequence by back-translation that has at least an identity of 56% with the SEQ ID NO:22.
δ. An expression cassette as claimed in any of claims 1 to 7, characterized in that the a nucleic acid sequence is encoding green fluorescent marker protein, variants or derivates of green fluorescent marker protein.
9. An expression cassette as claimed in any of claims 1 to δ, wherein the promotor a) is selected from the group consisting of the GPD-1-, PX6-, TEF-, CUP1-, PGK- , GAP1-, TPI, PHO5-, AOX1, GAL10/CYC-1, CYC1, ONC-, ADH-, TDH-, Kex2-, MFa-, Gal and the NMT-promotor.
10. An expression cassette as claimed in any of claims 1 to 9, wherein the terminator of element c) is selected from the group consisting of the AOX1-, nos-, PGK-, TrpC-, Gal and the CYC1 -terminator.
11. A vector comprising an expression cassette as claimed in any of claims 1 to 10.
12. A transgenic fungi or yeast comprising an expression cassette as claimed in any of claims 1 to 10 or a vector as claimed in claim 11.
13. Use of the transgenic organism according to claim 12 in a method of identifying fungicides.
14. A method of identifying pesticides, comprising the following steps: a) applying a test substance to the transgenic organism according to claim xx, b) monitoring the amount of reporter protein; and c) selecting test substances, which bring about reduced amount of reporter protein in the mitochondria of the transgenic organism of a).
15. A method of identifying fungicides according to claim 14, wherein the reporter protein is green fluorescent marker protein or luciferase, variants or derivates of green fluorescent marker protein or luciferase.
16. A method of identifying fungicides as claimed in any of claims 14 to 15, wherein the monitoring of step b) is done by spectrophotometry, fluorometry or cytometry.
17. A method as claimed in any of claims 14 to 16, wherein the substances are identified in a high-throughput screening.
16. A nucleic acid sequence as target for fungicides encoding a polypeptide with the activity of Tim 17 of the mitochondrial membrane complex comprising: a) a nucleic acid sequence with the nucleic acid sequence shown in SEQ ID NO:25; or b) a nucleic acid sequence which, on the basis of the degeneracy of the ge- netic code, can be derived from the amino acid sequence shown in SEQ ID NO:26 by back translation; or c) a functional equivalent of the nucleic acid sequence SEQ ID NO:25, which can be derived from an amino acid sequence by back-translation that has at least an identity of 74% with the SEQ ID NO:26.
19. A nucleic acid sequence as target for fungicides encoding a polypeptide with the activity of Tom 20 of the mitochondrial membrane complex comprising: a) a nucleic acid sequence with the nucleic acid sequence shown in SEQ ID NO:27; or b) a nucleic acid sequence which, on the basis of the degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO:2δ by back translation; or c) a functional equivalent of the nucleic acid sequence SEQ ID NO:25, which can be derived from an amino acid sequence by back-translation that has at least an identity of 60% with the SEQ ID NO:2δ.
20. Use of a nucleic acid sequence as target for fungicides encoding a polypeptide with the activity of Tim 17 of the mitochondrial membrane complex comprising: a) a nucleic acid sequence as claimed in claim 18; or b) a functional equivalent of the nucleic acid sequence SEQ ID NO:25, which can be derived from an amino acid sequence by back-translation that has at least an identity of 50% with the SEQ ID NO:26.
21. Use of a nucleic acid sequence as target for fungicides encoding a polypeptide with the activity of Tom 20 of the mitochondrial membrane complex comprising: a) a nucleic acid sequence as claimed in claim 19; or b) a functional equivalent of the nucleic acid sequence SEQ ID NO:27, which can be derived from an amino acid sequence by back-translation that has at least an identity of 50% with the SEQ ID NO:28.
22. A process for the preparation of a fungicidal composition, which comprises formu- lating an inhibitor of a mitochondrial transport protein with adjuvants, which are suitable for the formulation of fungicides.
23. A method for controlling harmful fungi, which comprises treating the fungi, or the materials, plants, soils or seeds to be protected from fungal infection, with an ef- fective amount of a inhibitor of a mitochondrial transport protein or a composition which can be prepared by a method as claimed in claim 22.
PCT/EP2004/014826 2004-01-12 2004-12-30 Test system for the identification of antifungal agents WO2005068635A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP04000414.5 2004-01-12
EP04000414 2004-01-12

Publications (2)

Publication Number Publication Date
WO2005068635A2 true WO2005068635A2 (en) 2005-07-28
WO2005068635A3 WO2005068635A3 (en) 2005-11-03

Family

ID=34778176

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2004/014826 WO2005068635A2 (en) 2004-01-12 2004-12-30 Test system for the identification of antifungal agents

Country Status (1)

Country Link
WO (1) WO2005068635A2 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002053728A2 (en) * 2000-12-29 2002-07-11 Elitra Pharmaceuticals, Inc. Gene disruption methodologies for drug target discovery

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002053728A2 (en) * 2000-12-29 2002-07-11 Elitra Pharmaceuticals, Inc. Gene disruption methodologies for drug target discovery

Non-Patent Citations (12)

* Cited by examiner, † Cited by third party
Title
BARROS M H ET AL: "YAH1 of Saccharomyces cerevisiae: a new essential gene that codes for a protein homologous to human adrenodoxin" GENE, ELSEVIER BIOMEDICAL PRESS. AMSTERDAM, NL, vol. 233, no. 1-2, 11 June 1999 (1999-06-11), pages 197-203, XP004173080 ISSN: 0378-1119 *
COHEN JARED S ET AL: "Expression of green fluorescent protein from a recoded gene inserted into Saccharomyces cerevisiae mitochondrial DNA" MITOCHONDRION (KIDLINGTON), vol. 1, no. 2, August 2001 (2001-08), pages 181-189, XP002278014 ISSN: 1567-7249 *
DATABASE PROTEIN [Online] 2 July 2003 (2003-07-02), GALAGAN: "Mitochondrial import receptor subunit Tom20" XP002278018 retrieved from NCBI Database accession no. XP326487 *
HUANG S-G: "Development of a high throughput screening assay for mitochondrial membrane potential in living cells" JOURNAL OF BIOMOLECULAR SCREENING, LARCHMONT, NY, US, vol. 7, no. 4, August 2002 (2002-08), pages 383-389, XP002271198 ISSN: 1087-0571 *
LAGIER MICHAEL J ET AL: "Mitochondrial-type iron-sulfur cluster biosynthesis genes (IscS and IscU) in the apicomplexan Cryptosporidium parvum." MICROBIOLOGY (READING), vol. 149, no. 12, December 2003 (2003-12), pages 3519-3530, XP002278013 ISSN: 1350-0872 (ISSN print) *
LEFEBVRE-LEGENDRE LINNKA ET AL: "F1-catalysed ATP hydrolysis is required for mitochondrial biogenesis in Saccharomyces cerevisiae growing under conditions where it cannot respire." MOLECULAR MICROBIOLOGY, vol. 47, no. 5, March 2003 (2003-03), pages 1329-1339, XP002278011 ISSN: 0950-382X (ISSN print) *
LUDOVICO P ET AL: "Assessment of mitochondrial membrane potential in yeast cell populations by flow cytometry" MICROBIOLOGY 2001 UNITED KINGDOM, vol. 147, no. 12, 2001, pages 3335-3343, XP002278017 ISSN: 1350-0872 *
OKAMOTO KOJI ET AL: "The sorting of mitochondrial DNA and mitochondrial protein in zygotes: Preferential transmission of mitochondrial DNA to the medial bud" JOURNAL OF CELL BIOLOGY, vol. 142, no. 3, 10 August 1998 (1998-08-10), pages 613-623, XP002325432 ISSN: 0021-9525 *
POLCICOVA KATARINA ET AL: "The delivery of ADP/ATP carrier protein to mitochondria probed by fusions with green fluorescent protein and beta-galactosidase." FEMS YEAST RESEARCH, vol. 4, no. 3, December 2003 (2003-12), pages 315-321, XP002278015 ISSN: 1567-1356 (ISSN print) *
SIRK DANIEL P ET AL: "Flow cytometry and GFP: A novel assay for measuring the import and turnover of nuclear-encoded mitochondrial proteins in live PC12 cells." CYTOMETRY, vol. 56A, no. 1, November 2003 (2003-11), pages 15-22, XP009029799 ISSN: 0196-4763 (ISSN print) *
TAKAYA NAOKI ET AL: "Cytochrome P450nor, a novel class of mitochondrial cytochrome P450 involved in nitrate respiration in the fungus Fusarium oxysporum" ARCHIVES OF BIOCHEMISTRY AND BIOPHYSICS, vol. 372, no. 2, 15 December 1999 (1999-12-15), pages 340-346, XP002278016 ISSN: 0003-9861 *
TZSCHOPPE KATHRIN ET AL: "Yeast translational activator Cbs2p: Mitochondrial targeting and effect of overexpression" BIOLOGICAL CHEMISTRY, vol. 381, no. 12, December 2000 (2000-12), pages 1175-1183, XP009029898 ISSN: 1431-6730 *

Also Published As

Publication number Publication date
WO2005068635A3 (en) 2005-11-03

Similar Documents

Publication Publication Date Title
Peng et al. Harpin-elicited hypersensitive cell death and pathogen resistance require the NDR1 and EDS1 genes
Hoffmann et al. Transcriptional autoregulation and inhibition of mRNA translation of amino acid regulator gene cpcA of filamentous fungus Aspergillus nidulans
Basse Dissecting defense-related and developmental transcriptional responses of maize during Ustilago maydis infection and subsequent tumor formation
Rhee et al. Structure and nuclear localization signal of the SK13 antiviral protein of Saccharomyces cerevisiae
Nolting et al. A MADS box protein interacts with a mating-type protein and is required for fruiting body development in the homothallic ascomycete Sordaria macrospora
Boyce et al. The vtc4 gene influences polyphosphate storage, morphogenesis, and virulence in the maize pathogen Ustilago maydis
Yehuda et al. A transformation system for the biocontrol yeast, Candida oleophila, based on hygromycin B resistance
WO2005068635A2 (en) Test system for the identification of antifungal agents
Fujimoto et al. Tagging quantitative loci controlling pathogenicity in Magnaporthe grisea by insertional mutagenesis
Kamiya et al. Quantitative Y2H screening: cloning and signal peptide engineering of a fungal secretory LacA gene and its application to yeast two-hybrid system as a quantitative reporter
Flipphi et al. Functional analysis of alcS, a gene of the alc cluster in Aspergillus nidulans
US20060068393A1 (en) Mevalonate kinase as a target for fungicides
US7435557B2 (en) Methods of identifying inhibitors of GTP cyclohydrolase I and II
WO1998018927A1 (en) Candida albicans proteins associated with virulence and hyphal formation and uses thereof
WO2005005629A2 (en) Uridyl glucose pyrophosphorylase as target for fungicides
US20050089854A1 (en) Homoaconitase as a target for fungicides
Milne et al. The wheat multi-pathogen resistance gene, Lr67res, confers a novel gain-of-function phenotype involving anion fluxes
Liao et al. Barley powdery mildew effector CSEP0162 targets multivesicular body-associated MON1 important for immunity
Harashima et al. Pleiotropic deficiencies of the laccase-derepressed mutant lah-1 are caused by constitutively increased expression of the cross-pathway control gene cpc-1 in Neurospora crassa
Köhler Specific ubiquitin-dependent protein degradation requires a trimeric CandA complex in Aspergillus nidulans
US20030140370A1 (en) Fungal glyoxal oxidases
DE10232773A1 (en) Proteins of the ubiquitin proteosome metabolic pathway, useful as targets for identifying fungicides for use in plant protection, also new nucleic acids, proteins and fungicides
Kumasaruge Molecular Cloning and Functional Characterization of Brassica UBC13 Genes
CHEN et al. A potential hyphal fusion protein complex with an important role in development and virulence interacts with autophagy related proteins in Fusarium pseudograminearum
Harashima et al. control gene cpc-1 in Neurospora crassa

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase