WO2005066346A1

WO2005066346A1 - Primer for nucleic acid amplification, primer set for nucleic acid amplification and method of testing cancer therewith

Info

Publication number: WO2005066346A1
Application number: PCT/JP2004/014741
Authority: WO
Inventors: Takeshi Nagasaka; Nagahide Matsubara; Noriaki Tanaka
Original assignee: Takeshi Nagasaka; Nagahide Matsubara; Noriaki Tanaka
Priority date: 2003-12-26
Filing date: 2004-10-06
Publication date: 2005-07-21

Abstract

A method of readily detecting with high accuracy any mutation of codon 599 of BRAF gene. There are further provided, for use in this method, a primer for nucleic acid amplification, primer set for nucleic acid amplification and reagent kit for detection of mutation of BRAF gene codon 599. There are still further provided a method of detecting genetic mutation in combination with detection of any mutation of codon 12 and codon 13 of KRAS gene, a primer for use in this method, etc.

Description

Specification

Primer for nucleic acid amplification, primer set for nucleic acid amplification, and method for detecting cancer using the same

Technical field

The present invention relates to a method for determining the presence or absence of a mutation at codon 599 of the BRAF gene (hereinafter abbreviated as “mutation” as appropriate), which is used in the field of clinical laboratory tests for cancer, and a nucleic acid used for the method. The present invention relates to an amplification primer, a nucleic acid amplification primer set, and a reagent kit for determining the presence or absence of a mutation in BRAF gene codon 599.

The present invention further relates to the above method combined with the detection of a mutation in the KRAS gene, a nucleic acid amplification primer, a nucleic acid amplification primer set, and a reagent kit for use in the method.

Background art

[0002] It is known that the pathway of a phosphorylating enzyme having a cascade of RAS-RAF-MEK-ERK-MAP is an important pathway for regulating cell differentiation, growth and proliferation. The RAS gene, which encodes the RAS protein, has been mutated in various human tumors. It is known that when a mutation occurs in the RAS gene, intracellular phosphorylation is abnormally enhanced, and the regulatory functions such as cell differentiation, growth, and proliferation are impaired. Mutations in the RAS gene have been reported to occur in 15% of all human tumors. The BRAF gene, which is located downstream of the RAS gene and encodes the BRAF protein, is an oncogene activated by the RAS gene.If a mutation occurs in the BRAF gene, intracellular phosphorylation abnormally increases, It is known that regulatory functions such as cell differentiation, growth, and proliferation are impaired. Mutations in the BRAF gene have been reported to occur in 70% of melanomas and 10% of colorectal cancers. Thus, mutations in the RAS gene and BRAF gene are presumed to be closely related to human tumor formation.

It has been reported that mutations in codon 599 (conversion of valine to glutamic acid; “V599E”) account for 80% of mutations in the BRAF gene.

[0003] Mutations in the KRAS gene, which is a type of RAS gene, include mutations at codons 12 and 13. It is reported that the difference accounts for more than 90%. This hotspot has been suggested to be biologically distinct from other less frequent BRAF mutations, as cancer cells with the BRAF gene V599E can grow without functional RAS. In addition, the V599E mutation of BR AF has been found in sporadic colorectal cancer (CRC) having a mutation in the KRAS gene (Non-patent Documents 1 and 2).

[0004] Conventionally, direct sequence method, SSCP method, WAVE method and the like have been known as a method for detecting the mutation at codon 599 of the BRAF gene or codon 12 or codon 13 of the KRAS gene. There is a problem S in terms of both the time required for detection and the cost. In recent years, a technique described in Non-Patent Document 3 has been known as a method for detecting a mutation at codon 12 of the KRAS gene with high sensitivity and good reproducibility.

[0005] Non-Patent Document 1: Rajagopalan, Η ·, Bardelli, A., Lengauer, C., Kinzler, K.W., Vogelstein,

B., and Velculescu, V.E. 2002.Tumorigenesis: RAF / RAS

oncogenesandmismatchrepair status.Nature418: 934.

Non-Patent Document 2: Yuen, S.T., Davies, H., Chan, T.L., Ho, J.W., Bignell, G.R., Cox,

C. 'Stephens, P., Edkins, S., Tsui, W.W., Chan, A.S., et al. 2002.Similarity of the phenotypic patterns associated with BRAF and KRAS mutations in

colorectalneoplasia. Cancer Res 62: 6451-6455.

Non-Patent Document 3: "Oncogene" 1991 Jun, 6 (6), 1079-1083 Therefore, specific mutations such as codon 599 of the BRAF gene, codon 12 and codon 13 of the KRAS gene can be efficiently performed at low cost. In addition, there is a need for a method of detecting with high accuracy.

Disclosure of the invention

[0006] Therefore, an object of the present invention is to provide a method for simply and accurately detecting a specific mutation of the specific gene as described above, particularly a mutation of codon 599 of the BRAF gene. Another object of the present invention is to provide a nucleic acid amplification primer, a nucleic acid amplification primer set, and a BRAF gene codon 599 mutation detection reagent kit for use in this test method. Another object of the present invention is to provide a method for detecting a gene mutation which is useful for diagnosing cancer such as colorectal cancer and predicting the possibility of its onset or progression.

[0007] In a powerful situation, the present inventors acted on the BRAF gene, Amplification of the BRAF gene using a primer set for nucleic acid amplification containing the primers for nucleic acid amplification into which the BRAF gene has been introduced by the normal PCR method, or by nested PCR method, semi-nested PCR method, or double PCR method It has been found that the mutation of codon 599 can be easily and accurately detected, and the presence or absence of the mutation of codon 599 of the BRAF gene can be determined easily and accurately.

[0008] That is, according to the primer set for nucleic acid amplification containing the primer for nucleic acid amplification, if there is a mutation in codon 599 of the BRAF gene, the amplification product of the BRAF gene in the primer set for nucleic acid amplification is converted to a specific restriction enzyme. Does not recognize, and if there is no mutation at codon 599 of the BRAF gene, the specific restriction enzyme recognizes the BRAF gene amplification product of the nucleic acid amplification primer set. Then, the primer set for nucleic acid amplification generates an amplification product of the BRAF gene having a different sequence depending on the presence or absence of the mutation at codon 599 of the BRAF gene, so that the specific restriction enzyme generates restriction enzyme fragments of different lengths. I do. Therefore, by detecting the restriction enzyme fragment using the restriction fragment length polymorphism, the mutation at codon 599 of the BRAF gene can be detected, and the presence or absence of the mutation at codon 599 of the BRAF gene can be determined.

[0009] Further, in the method for detecting a mutation at codon 599 of the BRAF gene using this nucleic acid amplification primer set,

1) a first step of amplifying the BRAF gene nucleic acid using the first nucleic acid amplification primer set and treating the amplified product of the BRAF gene with a specific restriction enzyme;

2) Next, the reaction mixture treated with the specific restriction enzyme is subjected to nucleic acid amplification of the BRAF gene using the second primer set for nucleic acid amplification, and the amplified product of the BRAF gene is subjected to the specific restriction enzyme treatment. A second step of treating with

3) Next, a third step of detecting a restriction enzyme fragment of the amplification product of the BRAF gene,

If there is a mutation in codon 599 of the BRAF gene in the first step, the restriction enzyme does not recognize the amplification product of the primer set for nucleic acid amplification, and if there is no mutation in codon 599 of the BRAF gene, The restriction enzyme recognizes the amplification product of the primer set. Then, the presence or absence of the mutation at codon 599 of the BRAF gene As a result, the primer set for nucleic acid amplification generates an amplification product of the BRAF gene having a different sequence, so that the specific restriction enzyme generates restriction enzyme fragments having different lengths. Therefore, the presence or absence of the mutation at codon 599 of the BRAF gene can be determined by detecting the restriction enzyme fragment using the restriction fragment length polymorphism.

[0010] Further, in the method for detecting a mutation at codon 599 of the BRAF gene using the nucleic acid amplification primer set, in the second step, a mismatch different from the mismatch of the nucleic acid amplification primer set used in the first step is used. Is used. As a result, the restriction enzyme recognizes a site other than codon 599 of the BRAF gene regardless of the presence or absence of the mutation of codon 599 in the second step.

In the second step, restriction enzyme fragments of different lengths generated in the first step due to the presence or absence of the mutation at codon 599 of the BRAF gene will be amplified. As a result, a large amount of amplification products of different lengths are produced due to the presence or absence of the mutation at codon 599 of the BRAF gene. Therefore, a restriction enzyme fragment obtained by digesting this amplification product with a restriction enzyme is converted into a restriction enzyme fragment. By detecting a long polymorphism or the like, the presence or absence of a mutation at codon 599 of the BRAF gene can be determined with higher accuracy.

In addition, when the second step is performed, the detection sensitivity is higher than when only the first step is performed. Is relatively low, and cells or tissues derived from the patient's blood, serum, serum, feces, semen, saliva, sputum, cerebrospinal fluid, etc. are collected to determine the presence or absence of codon 599 mutations in the BRAF gene can do. Therefore, it is possible to make a minimally invasive diagnosis (the burden on the patient is small).

[0011] In another embodiment, the method of the present invention for detecting a mutation at codon 599 of the BRAF gene comprises:

1) If there is a mutation in codon 599 of the BRAF gene, the restriction enzyme Btsl does not recognize the amplification product of the BRAF gene by the primer set for nucleic acid amplification, and if there is no mutation in codon 599 of the BRAF gene, the nucleic acid Amplification products obtained by using the first primer set for nucleic acid amplification by which the restriction enzyme Btsl recognizes the amplification product of the BRAF gene by the amplification primer set are cut with the restriction enzyme Btsl,

2) Next, the amplified product of the BRAF gene by the first primer set for nucleic acid amplification is subjected to a second nucleic acid amplification with a type II, whereby the codon 599 of the BRAF gene is obtained. A method for detecting a mutation at codon 599 of the BRAF gene, characterized by amplifying an amplification product having a mutation at a higher rate.

[0012] By treating with the restriction enzyme Btsl in the second step, a nucleic acid amplification product in which no mutation at codon 599 of the BRAF gene is observed (that is, a normal nucleic acid amplification product) is cleaved by the restriction enzyme. In the nucleic acid amplification step in the third step, only the gene having a mutation at codon 599 of the BRAF gene will be amplified, thereby strongly amplifying even a small amount of the gene having a mutation at codon 599 of the BRAF gene. Become.

As described above, the detection sensitivity is higher in the case where the second step is performed than in the case where only the first step is performed. The cells and tissues derived from the patient's blood, knee fluid, serum, feces, semen, saliva, sputum, cerebrospinal fluid, etc. are collected to determine the presence or absence of mutations in codon 599 of the BRAF gene. Judgment ability S can. Therefore, it is possible to make a minimally invasive diagnosis (the burden on the patient is small).

[0013] A method for determining mutations in codons 12 and 13 of the KRAS gene using the nucleic acid amplification product obtained in the third step includes:

(A) using the nucleic acid amplification product obtained in the third step, again performing a restriction enzyme Mval and Bgllde treatment, a method of detecting with restriction enzyme length polymorphism (RFLP),

(B) The nucleic acid amplification product obtained in the third step is typically represented by the SSCP method, the WAVE method, or the method of judging a mutation using an oligo chip.

[0014] In the present invention, the presence or absence of a mutation in the BRAF gene codon 599 is determined with high accuracy using the BRAF gene codon 599 mutation detection reagent kit containing the above-described nucleic acid amplification primer set, a restriction enzyme, and a DNA polymerase. Can be.

According to the detection method of the present invention, a nucleic acid amplification primer, a nucleic acid amplification primer set, and a BRAF gene codon 599 mutation detection reagent kit for use in the detection method, the mutation of codon 599 of the BRAF gene The detection can be performed easily and accurately, and the mutation at codon 599 of the BRAF gene can be detected accurately to determine the presence or absence of the mutation.

[0016] As described above, primers for nucleic acid amplification and a detection method can be similarly designed for codons 12 and 13 of the KRAS gene described in detail for the BRAF gene. However, two mismatches are introduced into the primer for the KRAS gene. That is, according to the primer for nucleic acid amplification containing two specific mismatches or the primer set for nucleic acid amplification containing the primer for nucleic acid amplification, if there is a change in codon 12 of the KRAS gene, If the amplification product of the KRAS gene by the nucleic acid amplification primer set 1 is not recognized by the specific first restriction enzyme (for example, Mval) and there is a mutation in codon 13 of the KRAS gene, the specific first nucleic acid If the amplification product of the KRAS gene by the amplification primer set is not recognized by a specific second restriction enzyme (for example, Bgll) and there is no mutation in codon 12 or codon 13 of the KRAS gene, the specific Specific first and second restriction enzymes (Mval and Bgll) recognize the amplification product of the KRAS gene by the nucleic acid amplification primer set (1).

[0018] In this case, the specific first nucleic acid amplification primer set generates an amplification product of the KRAS gene having a different sequence depending on the presence or absence of a mutation at codons 12 and 13 of the KRAS gene. One restriction enzyme generates restriction enzyme fragments of different lengths based on the presence or absence of a mutation at codon 12 of the KRAS gene, and the specific second restriction enzyme generates a restriction fragment at codon 13 of the KRAS gene. Based on the presence or absence, different length restriction fragments are generated. Therefore, by detecting the restriction enzyme fragment using a restriction enzyme fragment length polymorphism or the like, mutation of codon 12 and codon 13 of the KRAS gene can be detected by one operation, and codon 12 and codon 13 of the KRAS gene can be detected. The presence or absence of the mutation can be determined in a smaller number of nucleic acid amplification steps.

When detecting mutations at codons 12 and 13 of the KRAS gene using the primer set for nucleic acid amplification, for example,

(1) First step: a step of performing nucleic acid amplification of the KRAS gene using a first nucleic acid amplification primer set;

(2) the second step: a step of treating the KRAS gene amplification product obtained in the first step with the specific restriction enzymes (Mval and Bgll);

(3) Third step: The step of converting the reaction solution treated with the restriction enzymes Mval and Bgll in the second step into 铸 and amplifying the KRAS gene nucleic acid using the second nucleic acid amplification primer set Do.

[0020] In the third step, when treated with the restriction enzyme Mval in the second step, KR When the amplification products of the KRAS gene having different restriction enzyme fragment lengths generated due to the presence or absence of the codon 12 mutation in the AS gene are amplified and treated with the restriction enzyme Bgll in the second step, the KRAS gene Amplification products with different restriction enzyme fragment lengths, which are generated depending on the presence or absence of the mutation at codon 13, are amplified.

[0021] In addition, when the second step is performed, the detection sensitivity is higher than when only the first step is performed. Therefore, in addition to directly collecting cancer cells and tissues, Cells and tissues derived from the patient's blood, sperm fluid, serum, feces, semen, saliva, sputum, cerebrospinal fluid, etc., from which the proportion of cells is relatively low, are collected and analyzed for codons 12 and 13 of the KRAS gene. S ability to determine the presence or absence of mutation. Therefore, it is possible to make a minimally invasive diagnosis (the burden on the patient is small).

[0022] A method for determining mutations in codon 12 and codon 13 of the KRAS gene using the nucleic acid amplification product obtained in the third step,

(B) A typical method is to use the SSCP method or an oligo chip to determine the mutation of the nucleic acid amplification product obtained in the third step.

Therefore, before or after each step for detecting the mutation of codon 599 of the BRAF gene, or at the same time or in parallel therewith, the mutation of codon 12 and codon 13 of the KRAS gene is detected. be able to. For example, the method of the present invention may be performed before or after each step for detecting a mutation at codon 599 of the BRAF gene, or simultaneously or in parallel therewith.

1) If there is a mutation at codon 12 of the KRAS gene, the specific first restriction enzyme does not recognize the amplification product of the KRAS gene by the first nucleic acid amplification primer set, and the mutation occurs at codon 13 of the KRAS gene. If there is, the specific second restriction enzyme does not recognize the amplification product of the KRAS gene by the first nucleic acid amplification primer set, and there must be no mutation in codon 12 or codon 13 of the KRAS gene. For example, the amplification product of the KRAS gene by the first nucleic acid amplification primer set can be used for the first nucleic acid amplification such that it recognizes both the specific first restriction enzyme and the specific second restriction enzyme. The amplification product obtained using the primer set is cleaved with the first and second restriction enzymes, 2) Next, the amplification product having a mutation at codon 12 and / or codon 13 of the KRAS gene is obtained by performing amplification of the KRAS gene by the first nucleic acid amplification primer set into a type II and performing second nucleic acid amplification. Perform the steps for the detection of codon 12 and codon 13 mutations in the KRAS gene, characterized by amplifying the product at a greater rate; The method may further include a step of comparing the result with the result regarding the presence or absence of a mutation at codons 12 and 13 of the KRAS gene.

[0024] As described above, the kit of the present invention, the primer for nucleic acid amplification for use in the method, the primer set for nucleic acid amplification, and the above-described primer set for nucleic acid amplification, a restriction enzyme, and a DNA polymerase are provided. According to this, the presence or absence of mutations at codons 12 and 13 of the KRAS gene as well as mutations at codon 599 of the BRAF gene can be accurately determined with fewer operations.

Brief Description of Drawings

FIG. 1 is a schematic diagram showing an outline of a method for detecting a mutation at codon 599 of the BRAF gene according to the present invention.

FIG. 2 is a diagram showing detection of a mutation at codon 599 of the BRAF gene according to the present invention.

FIG. 3 is a schematic diagram showing an outline of the method for detecting mutations at codons 12 and 13 of the KRAS gene according to the present invention.

FIG. 4 is a diagram showing detection of mutations at codons 12 and 13 of the KRAS gene according to the present invention.

[FIG. 5] (A), (B), (C), and (D) constitute one table. Of the experiments on samples from sporadic colorectal cancer patients described in Example 2, 21 cases of BRAF A summary of the results for the sample with the mutation and 72 samples with the KRAS mutation is shown. Black squares indicate promoter methylation and blank squares indicate no promoter methylation.

BEST MODE FOR CARRYING OUT THE INVENTION

(Detection principle)

As described above, the present invention acts on the BRAF gene and introduces a mismatch into the nucleotide sequence.

Cross-section paper (rules) Mutation of the codon 599 of the BRAF gene, and in some cases, by using a primer set for nucleic acid amplification that contains primers for nucleic acid amplification and, in some cases, further acts on the KRAS gene and also includes primers for nucleic acid amplification with mismatches introduced into bases In some cases, mutations in codons 12 and 13 of the KRAS gene are detected.

[0027] An example of a method for detecting a mutation in a gene by introducing a mismatch into a primer for nucleic acid amplification will be described. If there is a primer for nucleic acid amplification that originally amplifies a certain gene, one or more bases in the base sequence are converted. Then, when the gene is amplified using the primer set for nucleic acid amplification including the primer for nucleic acid amplification, if there is a mutation in a specific codon of the gene, the primer set for nucleic acid amplification removes the mutation. The gene is amplified based on the accompanying nucleotide sequence. On the other hand, if there is no mutation in a specific codon of the gene, the primer set for amplifying the nucleic acid amplifies the gene based on a base sequence without the mutation. As such a primer, for example, in the sequence containing the BRAF gene shown in SEQ ID NO: 5, a sequence in which adenine (A) at base number 425 is substituted with guanine (G) is used, and the substituted base is used. And primers for nucleic acid amplification prepared with a base sequence that does not include base numbers 428 to 430, including the base sequence that includes the base number.

[0028] Then, based on the presence or absence of the mutation of the specific codon, the amplification product of the gene has a different base sequence. The amplification product of the gene when the specific codon of the gene has a mutation does not recognize a specific restriction enzyme, and the amplification product of the gene when the codon of the gene has no mutation is not recognized. In some cases, the specific restriction enzyme recognizes a specific palindrome of the amplification product. Then, if the specific codon of the gene has a mutation, the amplification product of the gene will have one fragment by the restriction enzyme, but if the specific codon of the gene has a mutation, The amplified product of the gene has two fragments due to restriction enzymes. At this time, the total fragment length of these two fragments is almost equal to the length of the above one fragment. When the above-mentioned primer of the BRAF gene is used, Btsl can be used as the restriction enzyme. Thus, the presence or absence of a mutation at a specific codon of this gene can be determined. [0029] When it is desired to examine mutations of two consecutive codons as in the case of the KRAS gene, two or more bases in the base sequence are converted. Then, when the gene is amplified using a primer set for nucleic acid amplification (primer set for nucleic acid amplification) containing the primer for nucleic acid amplification, if there is a mutation in a specific first codon of the gene, The primer set for nucleic acid amplification amplifies the gene based on the nucleotide sequence with the mutation. Further, when the gene is amplified using a primer set for nucleic acid amplification containing the primer for nucleic acid amplification, if the specific second codon of the gene has a mutation, the primer set for nucleic acid amplification is Then, the gene is amplified based on the base sequence with the mutation. On the other hand, if there is no mutation in either the specific first codon or the specific second codon of the gene, the set of primers for nucleic acid amplification is based on the nucleotide sequence without the mutation. Try to amplify the gene.

[0030] Then, based on the presence or absence of the mutation of the specific first codon and the presence or absence of the mutation of the specific second codon, the amplification product of the gene has a different base sequence. As such a primer, for example, in the sequence containing the KRAS gene shown in SEQ ID NO: 11, adenine (A) at base number 466 is replaced with cytosine (C) and guanine (G) at base number 467 is used. A primer for nucleic acid amplification prepared by using a sequence in which is substituted with cytosine (C) and comprising a base sequence containing the two substituted bases and excluding base numbers 470 to 475.

Next, a specific first restriction enzyme or a specific second restriction enzyme is allowed to act on the amplification product of the gene thus obtained.

At this time, the specific first restriction enzyme is not recognized for the amplification product of the gene when the specific first codon of the gene has a mutation, and the specific first codon of the gene is not recognized. For the amplified product of a gene without codon mutation, the specific first restriction enzyme will recognize the specific first palindrome structure of the amplified product

[0032] Then, when the specific first codon of the gene has a mutation, the number of fragments of the amplification product of the gene by the restriction enzyme is one, but the first characteristic of the gene is If there is a mutation at a certain codon, the fragment of the amplification product of that gene

Two. At this time, the total fragment length of these two fragments is almost equal to the length of the above one fragment.

Similarly, a specific second restriction enzyme is not recognized for an amplification product of a gene when the specific second codon of the gene has a mutation, and the specific specific codon of the gene is not recognized. For the amplification product of a gene in which there is no mutation in the second codon, the specific second restriction enzyme will recognize the specific second palindrome structure of the amplification product

[0034] Then, when the specific second codon of the gene has a mutation, the number of fragments of the amplification product of the gene by the restriction enzyme is one, but the second characteristic of the gene is If there is a mutation at a certain codon, there will be two fragments of the amplification product of the gene by the restriction enzyme. At this time, the total fragment length of these two fragments is almost equal to the length of the above one fragment. When the above-mentioned primer for the KRAS gene is used, Mval or BstNI can be used as the first restriction enzyme, and Bgll can be used as the second restriction enzyme.

In this way, two mutations at a specific first codon and a specific second codon of this gene can be detected in one operation, and two mutations at a specific first codon and a specific second codon of this gene can be detected. The presence or absence of a mutation at a location can be determined with a single operation.

[0035] (Secondary PCR)

In the present invention, as described above, when a specific codon of a gene has a mutation, one long restriction enzyme fragment is generated, and when there is no mutation in a specific codon of the gene, two restriction fragments are generated. Although short restriction enzyme fragments are generated, these restriction enzyme fragments are amplified using another combination of primer sets for nucleic acid amplification. At this time, a mismatch is introduced into one of the nucleic acid amplification primers. This time, regardless of the presence or absence of a specific codon mutation in the gene, the specific restriction enzyme recognizes a palindrome other than the specific one in the amplification product. , Introduce a mismatch.

Then, if the specific codon of the gene is mutated, the amplification product of the gene will have two restriction fragments, but if the specific codon of the gene is not mutated, There are three fragments of the gene amplification product due to restriction enzymes. At this time, the total fragment length of these three fragments is almost equal to the above two fragment lengths.

[0036] In addition, when there is a mutation in the codon of the specific first codon or the specific second codon of the gene, one long restriction enzyme fragment is generated, and the specific codon of the gene is generated. If neither the first codon nor the codon of the particular second codon is mutated, two short restriction fragments are generated, but these restriction fragments are used for different combinations of nucleic acid amplification. Amplify using primer set. At this time, usually, a primer set for nucleic acid amplification (a second primer set for nucleic acid amplification) for amplifying the restriction enzyme fragment treated with the specific first restriction enzyme and the specific second restriction enzyme are used. The primer set for nucleic acid amplification (third nucleic acid amplification primer set) for amplifying restriction enzyme fragments treated with enzymes is a different nucleic acid amplification primer set.

[0037] A mismatch is introduced into one nucleic acid amplification primer of the second nucleic acid amplification primer set. This time, with or without the mutation of the specific first codon of the gene, the specific first restriction enzyme is different from the specific first one place in the amplification product. A mismatch is introduced to recognize the palindrome structure at each point.

Similarly, a mismatch is introduced into one of the third nucleic acid amplification primer sets in the third nucleic acid amplification primer set. This time, regardless of the presence or absence of the mutation of the specific second codon of the gene, the specific second restriction enzyme is different from the specific second one in the amplification product in another one. A mismatch is introduced to recognize the palindrome structure of.

Then, when the specific first codon of the gene has a mutation, the number of fragments of the amplification product of the gene by the specific first restriction enzyme becomes three, If the specific first codon of the offspring is not mutated, the amplification product of the gene will have two fragments with the specific first restriction enzyme. At this time, the total fragment length of these three fragments is almost equal to the above two fragment lengths.

Similarly, when the specific second codon of the gene has a mutation, the number of fragments of the amplification product of the gene by the specific second restriction enzyme becomes three, but If there is no mutation in the second codon of the gene, the number of fragments of the amplification product of the gene by the specific second restriction enzyme is two. At this time, the total fragment length of these three fragments is almost equal to the above two fragment lengths. [0039] In this method, different restriction enzyme fragments generated based on the presence or absence of the mutation are amplified in a large amount, regardless of the ratio of mutation of a specific codon of the original gene. Therefore, even if the ratio of specific codon mutations in the original gene is low, the difference in the amplification product based on the presence or absence of the specific codon mutation in the gene becomes significant, and the specific codon mutation in the gene becomes significant. Can be detected with high sensitivity.

(Example of Specific Detection Primer and Method)

One example of a method for detecting a mutation at codon 599 of the BRAF gene is shown in FIG. The region containing codon 599 of the BRAF gene is amplified with a primer set for nucleic acid amplification consisting of two primers for nucleic acid amplification (Figure 1 (a)).

Here, 599S is a nucleic acid amplification primer represented by SEQ ID NO: 2, and the 18851-th power of the complementary strand of the BRAF gene is also the 18878-th site (the 1713-th to 171426-th sites of the original strand of the BRAF gene). ).

Here, SEQ ID NO: 1 shows the 18601st base sequence at the 18900th position of the complementary chain of this BRAF gene.

At this time, the first base of the primer for nucleic acid amplification represented by SEQ ID NO: 2 binds to position 18878 of the complementary strand of the BRAF gene, and the 28th base of the primer for nucleic acid amplification represented by SEQ ID NO: 2 Binds to position 18851 of the complementary strand of the BRAF gene.

[0041] This 599S does not recognize the restriction enzyme Btsl (B.T.I.S'Wan) for the amplification product of the gene when the codon 599 of the BRAF gene has a mutation, and It is designed so that the restriction enzyme Btsl recognizes one specific palindrome of the amplified product of the gene when there is no mutation in Don 599.

Specifically, of the 599S, the base corresponding to the 18852th base of the complementary strand of the BRAF gene (corresponding to 171425th base of the original strand of the BRAF gene) is guanine (the _27th base of the primer of SEQ ID NO: 2). Has been converted to.

[0042] Further, 599wtAS is a nucleic acid amplification primer represented by SEQ ID NO: 3, and the 18747th position of the complementary strand of the BRAF gene also corresponds to the 18772th position (the 171505th position of the original strand of the BRAF gene). Et 171530 th (M).

At this time, the first base of the nucleic acid amplification primer represented by SEQ ID NO: 3 is BRAF It binds to the site corresponding to position 18772 of the complementary strand of the gene, and the base position 28 of the primer for nucleic acid amplification represented by SEQ ID NO: 3 binds to the site corresponding to position 18747 of the complementary strand of the BRAF gene.

The linkage of nucleotides (bases) by 599S is performed from upstream to downstream, and the linkage of nucleotides (bases) by 599wtAS is performed from downstream to upstream. 171399th power, etc. 171530th part is amplified.

Then, when the amplified product of the BRAF gene is treated with the restriction enzyme Btsl, a single 132 bp restriction enzyme fragment is generated for the amplified product of the BRAF gene having a mutation at codon 599, For the amplified product of the gene when there is no mutation at codon 599 of the BRAF gene, two restriction fragments of 34 bp and 98 bp are generated (Fig. L (b)).

Next, one restriction enzyme fragment having a mutation at codon 599 of the BRAF gene and two restriction enzyme fragments having no mutation at codon 599 of the BRAF gene, Amplification is performed using a set of primers for nucleic acid amplification different from the above-mentioned primer set for nucleic acid amplification (FIG. 1 (c)). Here, 599S is a primer for amplifying nucleic acid represented by SEQ ID NO: 2 described above, and is located at position 18851 of the complementary strand of the BRAF gene at position 18878 (corresponding to the site from position 171399 to position 171426 of the BRAF gene) To join.

On the other hand, 599mtAS is a nucleic acid amplification primer represented by SEQ ID NO: 4, and corresponds to a site corresponding to the 18749th position of the complementary strand of the BRAF gene and the 18774th position (the 171503th position of the original strand of the BRAF gene). 171528th position).

At this time, the first base of the nucleic acid amplification primer represented by SEQ ID NO: 4 binds to a site corresponding to position 18774 of the complementary strand of the BRAF gene, and the nucleic acid amplification primer represented by SEQ ID NO: 2 The 26th base binds to the site corresponding to 18749 in the complementary strand of the BRAF gene.

Regardless of the presence or absence of the mutation at codon 599 of the BRAF gene, the restriction enzyme Btsl is designed so that the amplified product of the BRAF gene recognizes one palindrome structure different from the specific one described above. Have been. Specifically, of the 599mtAS, the base corresponding to the 18764th base of the complementary strand of the BRAF gene is converted to guanine (the 11th base of the primer of SEQ ID NO: 4). Ligation of nucleotides (bases) by 599S is performed from upstream to downstream, and ligation of nucleotides (bases) by 599mtAS is performed from downstream to upstream, and the BRAF gene is amplified by a PCR reaction.

[0045] Then, when the amplification product was treated with the restriction enzyme Btsl, two restriction enzyme fragments of 112bp and 18bp were generated for the amplification product of the gene having a mutation in codon 599 of the BRAF gene. When the codon 599 of the BRAF gene has no mutation, three restriction enzyme fragments of 34 bp, 78 bp, and 18 bp are generated for the amplified product of the gene (Fig.

When these restriction fragments were detected using restriction enzyme length polymorphism (RFLP), a 78 bp restriction enzyme fragment was detected in a sample without mutation, and a 112 bp fragment was detected in a sample with mutation. Thus, the presence or absence of a mutation in codon 599 of the BRAF gene can be determined based on this difference (FIG. 2 (a)).

Inspection of the nucleotide sequences of the 112 bp band and the 78 bp band reveals that those with a mutation at codon 599 have the second thymine at codon 599 converted to adenine (Fig. 2 (b )).

Similarly, FIG. 3 shows an example of a method for detecting a mutation at codon 12 and a mutation at codon 13 of the KRAS gene by a single operation.

A region containing codons 12 and 13 of the KRAS gene represented by SEQ ID NO: 6 (160 bases from the 454th base to 613th base of the KRAS gene, from the 1st base of codon 1 to the 1st base of codon 54 ) Is amplified with a set of nucleic acid amplification primers consisting of two nucleic acid amplification primers (Fig. 3 (a)). Here, 12 & 13SP are primers for nucleic acid amplification represented by SEQ ID NO: 7, and correspond to the 486th to 486th positions of the KRAS gene, that is, the codons of the KRAS gene represented by SEQ ID NO: 6. A region corresponding to the fourth to 33rd sequence of the region containing 12 and codon 13 (actually, the fourth to 33rd sequence of the region containing codon 12 and codon 13 of the KRAS gene represented by SEQ ID NO: 6) A) The amplification product of the gene when there is a mutation in codon 12 of the KRAS gene: It does not recognize the restriction enzyme Mval, and b) the restriction enzyme Bgll (B.J.I.) for gene amplification products when there is a mutation in codon 13 of the KRAS gene. L. one) does not recognize, and c) For the amplification product of the gene in which neither codon 12 nor codon 13 of the KRAS gene is mutated, the specific first one palindrome of the amplification product The structure (the 488th CCWGGZGGWCC of the KRAS gene and the 488th CCWGGZGGWCC) is designed to be recognized by the restriction enzyme Mval, and the specific second single palindrome structure of the amplified product (the 482th power of the KRAS gene) The 492nd GCCNNNNNGGCZCGGNNNNNCCG) is designed to be recognized by the restriction enzyme Bgll.

[0048] Specifically, of 12 & 13SP, the base corresponding to the 484th base of the KRAS gene is converted into cytosine (the 28th base of the primer of SEQ ID NO: 7), and the 483rd base of the KRAS gene is converted. Is converted to cytosine (the 27th base of the primer of SEQ ID NO: 7).

By the former conversion, the difference in the amplification product due to the presence or absence of the mutation at codon 12 can be identified by Mval (or BstNI (BS'T'N'Wan)). Differences in amplification products due to presence or absence can be identified by Bgll.

WMAS is a primer for nucleic acid amplification represented by SEQ ID NO: 8, and is located at positions 549 to 576 of the KRAS gene, that is, at positions 96 to 123 of the KRAS gene represented by SEQ ID NO: 6. Binds to the site (actually, the site of the 123rd sequence from the 96th position of the KRAS gene region represented by SEQ ID NO: 6; the first base of SEQ ID NO: 8 is represented by SEQ ID NO: 6 And the base at position 28 in SEQ ID NO: 8 binds to position 96 in the KRAS gene region represented by SEQ ID NO: 6). Ligation of nucleotides (bases) by 12 & 13SP is performed from upstream to downstream, and ligation of nucleotides (bases) by WildAS is performed from downstream to upstream, and the KRAS gene is amplified by a PCR reaction.

[0049] Then, when the KRAS gene amplification product was treated with the restriction enzyme Mval (or BstNI), the gene amplification product when the KRAS gene had a mutation at codon 12 had one 120bp Two restriction enzyme fragments, 29 bp and 91 bp, were generated for the amplified product of the KRAS gene when a restriction enzyme fragment was generated and there was no mutation in codon 12 of the KRAS gene. (Figure 3 (b)).

On the other hand, when the KRAS gene amplification product was treated with the restriction enzyme Bgll, a single 120 bp restriction enzyme fragment was generated for the gene amplification product when the KRAS gene codon 13 had a mutation. When the KRAS gene has no mutation at codon 13, two restriction enzyme fragments of 32 bp and 88 bp are generated for the amplified product of the gene (Fig. 3 (c)).

(Amplification of Fragment by First Restriction Enzyme)

Next, in the above-mentioned step, one restriction enzyme fragment produced by treatment with the restriction enzyme Mval (or BstNI) when there is a mutation in codon 12 of the KRAS gene, and a mutation in codon 12 of the KRAS gene The two restriction enzyme fragments without the primer set are amplified using a primer set for nucleic acid amplification different from the above-mentioned primer set for nucleic acid amplification (corresponding to the "second nucleic acid amplification primer set") (Fig. 3 (d)). . Here, 12 & 13SP is a primer for nucleic acid amplification represented by the aforementioned SEQ ID NO: 7, a site corresponding to the 486th position from the 457th position of the KRAS gene, that is, a codon of the KRAS gene represented by the SEQ ID NO: 6. Site corresponding to the 4th to 33rd sequences of the region containing 12 and codon 13 (actually the 4th sequence of the region containing codons 12 and 13 of the KRAS gene represented by SEQ ID NO: 6) Site of the complementary strand).

On the other hand, 12mtAS is a primer for nucleic acid amplification represented by SEQ ID NO: 9, and is located at positions 549 to 576 of the KRAS gene, that is, the 96th position 123rd position of the KRAS gene represented by SEQ ID NO: 6. Binds to the site (actually, the site of the 123rd sequence from the 96th position of the KRAS gene region represented by SEQ ID NO: 6; the first base of SEQ ID NO: 8 is represented by SEQ ID NO: 6 It binds to position 123 in the KRAS gene region, and the 28th base in SEQ ID NO: 8 binds to position 96 in the KRAS gene region represented by SEQ ID NO: 6), regardless of the presence or absence of codon 12 mutation in the KRAS gene For the KRAS gene amplification product, the restriction enzyme Mval (or BstNI) is designed to recognize one palindrome structure different from the specific first one.

[0051] Specifically, of the 12mtAS, the base corresponding to the 103rd base of the KRAS gene represented by SEQ ID NO: 6 was converted to cytosine (the 21st base of the primer of SEQ ID NO: 8). The base corresponding to the 104th base of the KRAS gene is converted to cytosine (the 20th base of the primer of SEQ ID NO: 8).

Ligation of nucleotides (bases) by 12 & 13SP is performed from upstream to downstream, ligation of nucleotides (bases) by 12mtAS is performed from downstream to upstream, and the KRAS gene is amplified by a PCR reaction.

[0052] Then, when the amplification product was treated with the restriction enzyme Mval (or BstNI), the amplification product of the gene having a mutation in codon 12 of the KRAS gene had 99bp and 21bp. Restriction enzyme fragments are generated, and three restriction enzyme fragments of 29 bp, 60 bp and 21 bp are generated for the amplified product of the KRAS gene without codon 12 mutation (Fig. 3 (f )).

When these restriction fragments were detected by electrophoresis using agarose gel or polyacrylamide gel, a 60 bp restriction fragment was detected in the sample without mutation, and a 99 bp restriction fragment was detected in the sample with mutation. Based on this difference, the presence or absence of a mutation in codon 12 of the KRAS gene can be determined based on this difference (FIG. 4 (a)). In addition, when examining the nucleotide sequence as an example of a band having a mutation at codon 12, it is found that, for those having a mutation at codon 12, the second guanine at codon 12 is converted to adenine ( Figure 4 (b)).

(Amplification of Fragment by Second Restriction Enzyme)

Next, one restriction enzyme fragment produced by treatment with the restriction enzyme Bgll and having a mutation at codon 13 of the KRAS gene, The two restriction enzyme fragments are amplified with a nucleic acid amplification primer set different from the above-described nucleic acid amplification primer set (equivalent to the “third nucleic acid amplification primer set”) (FIG. 3 (e)). Here, 12 & 13SP is a nucleic acid amplification primer represented by SEQ ID NO: 7 described above, and corresponds to the 486th position to the 457th position of the KRAS gene, that is, the codon of the KRAS gene represented by SEQ ID NO: 6. A region corresponding to the fourth to 33rd sequence of the region containing 12 and codon 13 (actually, the fourth to 33rd sequence of the region containing codon 12 and codon 13 of the KRAS gene represented by SEQ ID NO: 1) (The site of the complementary strand of the sequence). On the other hand, 13mtAS is a primer for nucleic acid amplification represented by SEQ ID NO: 5, and is located at positions 549 to 576 of the KRAS gene, that is, at position 96 to 123 of the KRAS gene represented by SEQ ID NO: 6. (Actually, the 96th position of the KRAS gene region represented by SEQ ID NO: 6 is also the site of the 123rd sequence, and the first base of SEQ ID NO: 8 is the KRAS represented by SEQ ID NO: 6). It binds to position 123 in the gene region, and the 28th base in SEQ ID NO: 8 binds to position 96 in the KRAS gene region represented by SEQ ID NO: 6), regardless of the presence or absence of codon 13 mutation in the KRAS gene. For the KRAS gene amplification product, the restriction enzyme Bgll is designed to recognize one palindrome structure different from the specific second one.

Specifically, of the 13mtAS, the base corresponding to the 113th base of the KRAS gene represented by SEQ ID NO: 6 was converted to guanine (the 11th base of the primer of SEQ ID NO: 10), The base corresponding to the 105th base of the KRAS gene represented by 6 is converted to guanine (the 19th base of the primer of SEQ ID NO: 10), and the 103rd base of the KRAS gene represented by SEQ ID NO: 6 is converted. The base corresponding to is converted to cytosine (the 21st base of the primer of SEQ ID NO: 10).

Ligation of nucleotides (bases) by 12 & 13SP is performed from upstream to downstream, ligation of nucleotides (bases) by 13mtAS is performed from downstream to upstream, and the KRAS gene is amplified by a PCR reaction.

[0055] Then, when the amplification product is treated with the restriction enzyme Bgll, two restriction enzyme fragments of 106bp and 14bp are generated for the amplification product of the gene in which the codon 13 of the KRAS gene has a mutation. On the other hand, three restriction enzyme fragments of 32 bp, 74 bp and 14 bp are generated from the amplified product of the KRAS gene when there is no mutation in codon 13 (FIG. 3 (g)).

When these restriction fragments were detected by electrophoresis using agarose gel or polyacrylamide gel, a 74 bp restriction fragment was detected in the sample without mutation, and a 106 bp restriction fragment was detected in the sample with mutation. Based on this difference, the presence or absence of a mutation in codon 13 of the KRAS gene can be determined based on this difference (FIG. 4 (c)). In addition, the base sequence, which is an example of a band with a mutation at codon 13, was examined. Then, if there is a mutation in codon 13, the second guanine at codon 132 is converted to adenine, which is increased by S (Fig. 4 (d)).

(Synthesis of Nucleic Acid Amplification Primer)

The primer for nucleic acid amplification in the present invention can be synthesized by a known method. For example, a solid phase chemical synthesis method such as a phosphate triester method, a phosphate amidite method, and a phosphate group site-protection method can be used. Can be. Specifically, it can be synthesized using an oligonucleotide synthesizer (Expedite Model 8909, manufactured by Applied Biosystem).

(Method for detecting mutation)

In the present invention, a method for detecting mutations at codon 599 of the BRAF gene and, optionally, codons 12 and 13 of the KRAS gene can be performed by preparing a sample, extracting a gene (genomic DNA), and It consists of amplification, cleavage of the amplified product with restriction enzymes, and detection of gene mutation.

[0058] (Test sample 'preparation of pathological sample)

The human sample used in the test method of the present invention is not particularly limited as long as it contains a gene encoding a BRAF protein (BRAF gene) and, in some cases, a KRAS gene. Specific examples include tissues collected from a living body, such as cancer tissues such as colorectal cancer removed by surgery, biopsy materials (biopsy tissues) used for endoscopy, etc. before surgery, and surgical specimens. It is preferably used in terms of effective use of the sample. In addition, blood, knee fluid, serum, feces, semen, saliva, sputum, cerebrospinal fluid, or a reaction solution in which the BRAF gene is amplified by a nucleic acid amplification reaction using these, are also examples of the sample.

[0059] (DNA extraction)

DNA to be subjected to the detection method of the present invention can be obtained by crushing tissue from a human sample as described above using a blender, and then extracting the DNA by a known gene extraction method such as the phenol-chloroform method. Such DNA can be used as a test sample.

[0060] (Gene Amplification of Nucleic Acid)

In the present invention, a known method can be used as a BRAF gene amplification method, and examples thereof include a PCR method, a NASBA method, and a LAMP method. Preferably, the PCR method Is used.

[0061] (Nested PCR method)

In the present invention, PCR for amplifying a nucleic acid by PCR can be a nested PCR method.

Nested PCR is a method in which a two-step PCR is performed using an outer primer and an inner primer. Set primers inside and perform the next PCR.

PCR is a technique for amplifying a specific fragment based on the specificity of two primer pairs facing each other at appropriate intervals.However, mis-splicing sometimes occurs due to the similar sequence of primers, and amplification along with amplification of the target sequence. Non-specific amplification occurs. When nested PCR is performed using the PCR product containing this non-specific fragment as type III, the probability of the presence of a sequence similar to the nested primer in the non-specific fragment is extremely low. Only the target sequence can be successfully picked up from the "sea of noise" of the amplification. Therefore, the nested PCR method is an effective method in the case where the background is easily generated, or in the case of PCR.

[0062] In the present invention, a normal PCR method may be used, and in addition to nested PCR, semi-nested PCR and dub / le PCR may be used.

[0063] (Restriction enzyme)

As a restriction enzyme, if there is a mutation in a specific codon (such as codon 599 of the BRAF gene) of the gene for which the mutation is to be detected, the amplification product by the nucleic acid amplification primer set including the nucleic acid amplification primer is not recognized, and If there is no mutation at a specific codon, a specific restriction enzyme that recognizes the amplification product is used. For example, the amplification product of the BRAF gene amplification is treated with the restriction enzyme Btsl. The optimal temperature of Btsl is around 37 ° C. The amplification product obtained by the KRAS gene amplification is treated with a restriction enzyme Mval to detect a mutation at codon 12. The optimum temperature of Mval is around 37 ° C. For detection of codon 13 mutation, treat with restriction enzyme Bgll. The optimum temperature of Bgll is around 37 ° C.

(Detection of Restriction Enzyme Fragment of BRAF Gene)

The fragment treated with the restriction enzyme is detected using restriction fragment length polymorphism or the like. (Mutation detection reagent 'mutation detection reagent kit)

The present invention also includes a mutation detection reagent and a mutation detection reagent kit used in the method for detecting a mutation at codon 599 of the BRAF gene. Examples of the mutation detection reagent include any of the reagents used in the method of the present invention, such as a nucleic acid amplification primer that amplifies a region containing codon 599 of the BRAF gene, a DNA polymerase, an exonuclease, and a label for detecting a nucleic acid. It may be. The reagents and kits of the present invention can also include a mutation detection reagent and a mutation detection reagent kit used in the method for detecting mutations at codons 12 and 13 of the KRAS gene. Examples of the mutation detection reagents include any reagents used in the method of the present invention, such as nucleic acid amplification primers for amplifying a region containing codon 12 and codon 13 of the KRAS gene, DNA polymerase, exonuclease, and a label for nucleic acid detection. It can be any of.

[0066] The mutation detection reagent kit used in the method for detecting a mutation at codon 599 of the BRAF gene uses at least two or more of all the reagents used in the detection method of the present invention as a kit. Should be fine. In addition, DNA labeled with a fluorescent label may be included in the kit.

The kit of the present invention preferably comprises a nucleic acid amplification primer set for amplifying at least a region containing codon 599 of the BRAF gene of the present invention (and optionally a nucleic acid for amplifying a region containing codon 12 and codon 13 of the KRAS gene). Examples including amplification primer sets)

Hereinafter, the present invention will be described in more detail with reference to Examples, but the present invention is not limited to these Examples. Genomic genes were extracted and purified from cancerous and normal mucous membranes obtained from surgery for colorectal cancer patients.

Example 11 (BRAF gene)

(Primer design)

In primary PCR to detect mutation at codon 599 of BRAF gene, 599S (sequence No. 2) and 599wtAS (SEQ ID NO: 3) primers were used:

599 S: TAAAAATAGGTGATTTTGGTCTAGCTGC

599wtAS: CCAAAAATTTAATCAGTGGAAAAATA

In this example, the mutation at codon 599 was introduced by introducing a mismatch that converts the 599S primer, which corresponds to A (adenine), located 3 bases upstream of codon 599 of the BRAF gene, to G (guanine). We decided to create a recognition site for the no gene amplification product by the restriction enzyme Btsl.

[0069] Using 5 µl of the gene amplification product obtained by the primary PCR, the first restriction enzyme treatment (primary restriction enzyme treatment) was performed with the restriction enzyme Btsl. Next, in the secondary PCR, the primers 599S (SEQ ID NO: 2) and 599mtAS (SEQ ID NO: 4) in FIG. 1 were used:

599mtAS: AAAAATTTAAGCAGTGGAAAAATAGC

In this example, semi-nested PCR or double PCR was used. In this example, by introducing a mismatch that converts the 11th base of 599 mtAS to G (guanine), the restriction enzyme Btsl of the gene amplification product at a site other than codon 599 regardless of the presence or absence of codon 599 mutation. To create a recognition site. As a result, the amplification product of the primary PCR is amplified, so that the presence or absence of the mutation can be more remarkably determined, and the restriction enzyme reaction can be confirmed.

[0070] (Primary PCR)

10-fold concentration of PCR buffer solution, 1.5 mM MgCl, 0. ImM deoxynucleotide 3

2

Phosphoric acid (dNTP), 0.2 μΜ 599S primer (Toshimi IJ number 2), 0.2 μΜ 599 wtAS primer (SEQ ID NO: 3), 1.25 U Taq polymerase (Ampli-Taq Gold; Perkin-Elmer , Foster City, CA) and approximately 100 ng of the BRAF gene (DNA), and the PCR solution was 25 μl. The PCR was performed at 95 ° C for 11 minutes, followed by repeating the cycle of 95 ° C for 30 seconds → 58 ° C for 30 seconds → 72 ° C for 30 seconds 30 times to amplify the gene. As a result, an amplification product of 130 bp was obtained (FIG. 1 (a)).

[0071] (Primary restriction enzyme treatment)

Cleavage with the restriction enzyme Btsl (New Englannd Biolabs) was performed using 5 μl of 25 μl of the amplification product solution containing the amplification product obtained by the above PCR. [0072] 10 times concentration of NE buffer solution (buffer) 3/1, 100 times concentration of BSA 0.3 μl, restriction enzyme 31 (1011 // 11) 0.2 / il, distilled water 21.5 / il, primary PCR A total of 30 μΐ was used, using 5 / il of 25 / il of the gene amplification solution containing the obtained amplification product. The cleavage reaction was performed for 2 hours at 37 ° C, the optimal temperature of Btsl (Fig. 1 (b)).

[0073] (Secondary PCR)

599S (SEQ ID NO: 2) and 599mtAS (SEQ ID NO: 4) were used as primers to amplify the primary PCR amplification product for detecting mutation of codon 599.

10-fold concentration of PCR buffer, 1.5 mM MgCl, 0.1 ImM deoxynucleotide 3

2

Phosphoric acid, 0.2μΜ 599S primer (Toshimi system 1J number 2), 0.2μΜ 599mtAS primer one (Tori self column number 4), 1.25U Taq polymerase (Ampli-TaqGold; Perkin-Elmer, Foster City, CA) Then, the amplified product cut by the above-mentioned primary restriction enzyme treatment was converted into a 铸 type (1 μl) to make a total of 25 μΐ of the PCR solution. The PCR was performed at 95 ° C for 11 minutes, followed by repeating the cycle of 95 ° C for 30 seconds → 53 ° C for 30 seconds → 72 ° C for 30 seconds 26-30 times to amplify the gene (Figure l). (c)).

[0074] 3 μl of a 10-fold concentration of NE buffer solution, 0.3 μl of a 100-fold concentration of BSA, 0.2 μl of a restriction enzyme Btsl (10 μ / μ1), 1.5 μl of distilled water, and amplification products obtained by primary PCR Was used to obtain a total of 30 μl. The cleavage reaction was performed at 37 ° C, the optimal temperature of Btsl, for 6 hours or more (Fig. 1 (d)).

(Detection of restriction enzyme fragment)

The above restriction enzyme fragment treated with the restriction enzyme was detected by restriction fragment length polymorphism.

[0076] In the case of a mutation having codon S at codon 599, three types of fragments of 78 bp, 34 bp, and 18 bp are detected by the secondary restriction enzyme treatment. On the other hand, when all codons 599 have mutations, the ability to detect two types of fragments, 112 bp and 18 bp, is actually the fact that some of all codons 599 have mutating ability S In this case, four types of fragments, 112 bp, 78 bp, 34 bp, and 18 bp, are detected.

Basically, when the 112 bp fragment is recognized as having the same strength as the 78 bp fragment and more strongly, it is determined that the codon 599 has a mutation. The results are shown in FIG.

According to this example, 78 bp and 112 bp fragments were detected in the left lane of 540, and it was determined that a codon 599 mutation was present. In the remaining 5 lanes, only the 78 bp fragment was detected, and the codon 599 mutation was detected. It was determined to be none.

As described above, according to the present example, it was confirmed that the presence or absence of the codon 599 mutation in the BRAF gene can be accurately determined by detecting the mutation at codon 599 in the BRAF gene.

Example 11 (KRAS gene)

(Primer design)

A region containing codons 12 and 13 (bases 470 to 475 of the sequence shown in SEQ ID NO: 11) of the KRAS gene represented by SEQ ID NO: 11 For nucleic acid amplification comprising two primers for nucleic acid amplification Amplify with the primer set (Fig. 3 (a)).

[0080] The primers 12 & 13SP used this time are primers for nucleic acid amplification represented by 5'-ACTGAATATAAACTTGTGGTA GTTGGCCCT (SEQ ID NO: 7). In the sequence containing the KRAS gene represented by SEQ ID NO: 11, Sequences in which adenine (A) is replaced with cytosine (C) and guanine (G) having base number 467 is replaced with cytosine (C) are positions 440 to 469.

[0081] This primer is used for a) when the restriction enzyme Mval is not recognized for the amplification product of the gene when codon 12 of the KRAS gene has a mutation, and b) when the codon 13 of the KRAS gene has a mutation. The amplification product of the gene does not recognize the restriction enzyme Bgll, and c) the amplification product of the gene when there is no mutation in codon 12 or codon 13 of the KRAS gene. The first specific palindrome (the 467th force and the 471st CCWGG / GGWCC of SEQ ID NO: 11) is designed to be recognized by the restriction enzyme Mval, and the second specific It is designed so that the restriction enzyme Bgll recognizes the palindrome structure at the position (465th position 475th position G CCNNNNNGGC / CGGNNNNNCCG of SEQ ID NO: 11).

[0082] The other of the primers used for the primary PCR

WildAS: AACAAGATTTACCTCTATTGTTGGATCA (SEQ ID NO: 8). This is the complementary strand of the 532nd sequence and the 559th sequence of the nucleotide sequence shown in SEQ ID NO: 11.

[0083] The gene amplification product obtained by the primary PCR is used for detecting mutations at codons 12 and 13 respectively, and the first restriction enzyme treatment (primary Restriction enzyme treatment was performed, and the first restriction enzyme treatment (primary restriction enzyme treatment) was performed with Bgll to detect mutations at codon 13.

[0084] Next, in the secondary PCR, primers of 12 & 13SP (system 1J number 7) and 12mt AS (SEQ ID NO: 9) were used for mutation detection at codon 12.

12 & 13SP: ACTGAATATAAACTTGTGGTAGTTGGCCCT

12mtAS: AACAAGATTTACCTCTATTCCTGGATCA

For the detection of codon 13 mutations, primers of 12 & 13SP and 13mtAS (SEQ ID NO: 10) were used:

12 & 13SP: ACTGAATATAAACTTGTGGTAGTTGGCCCT

13mtAS: AACAAGATTTGCCTCTATGGCTGGATCA

[0085] In this example, semi-nested PCR or double PCR was used. In this example, a mutation for codon 12 mutation detection was introduced by introducing a mismatch that converts the 19th and 20th bases of 12mtAS to C (cytosine), regardless of the presence or absence of codon 12 mutation. We decided to create a recognition site for the gene amplification product using the restriction enzyme Mval at a site other than codon 12. This is because, in the present example, the KRAS gene mutation is detected by using a restriction enzyme length polymorphism (RF LP). In the case of restriction enzyme length polymorphisms (RFLPs), it is desirable to be able to determine the ability of the restriction enzyme treatment to be performed reliably. Restriction enzyme recognition sites were artificially created to confirm that the operation was successful. This can confirm the restriction enzyme reaction.

[0086] (Primary PCR)

10 times concentration of PCR buffer solution, 1.5mM MgCl, 0.

2

Acid, 0.2 μΜ of 12 & 13SP (Toshimi system 1J number 2), 0.2 μΜ of WildAS (Tori self system number 3), 1.25 U Taq polymerase (Ampl TaqGold; Perkin-Elmer, Foster City, CA) and almost 100 ng of the KRAS gene (DNA) was used, and the PCR solution was 25 μl. The PCR was performed at 95 ° C for 11 minutes, and then repeated 30 times at 95 ° C for 30 seconds → 58 ° C for 30 seconds → 72 ° C for 30 seconds to amplify the gene. As a result, a 120 bp amplification product was obtained (FIG. 3 (a)).

[0087] Using 5 µl of 25 µl of the amplification product liquid containing the amplification product obtained by the above PCR, cleavage with the restriction enzyme MvaI (Takara) for mutation detection of codon 12 was performed. Thirteen mutations were cut with the restriction enzyme Bgll (Takara).

(Primary Restriction Enzyme Treatment for Codon 12 Mutation Detection)

₁ l of 10-fold concentration NEbuffer2, 0.5 μl of restriction enzyme Mval (5 U / μ1), 3.5 μl of distilled water, 25 μl of gene amplification solution containing the amplification product obtained by primary PCR Of these, 5 μl was used to make a total of 20 μl. The cleavage reaction was performed at 37 ° C, which is the optimum temperature of Mval, for 2 hours (Fig. 3 (b)).

[0089] (Primary restriction enzyme treatment for codon 13 mutation detection)

NEbuffer2 mu 1 of 10-fold concentration, restriction enzyme Bgll (5U / μ 1) 0. 5 μ 1, distilled water 3. 5 mu 1, of the amplification product obtained by the primary PCR Included gene amplification solution 25 _beta 1 of Of these, 5 _β1 was used to make a total of 20 μ1. The cleavage reaction was performed for 2 hours at 37 ° C, which is the optimal temperature of Bgll (Fig. 3 (c)).

[0090] (Secondary PCR for codon 12 mutation detection)

12 & 13SP (SEQ ID NO: 7) and 12mtAS (SEQ ID NO: 9) were used as primers to amplify the primary PCR amplification product for detecting the mutation of codon 12.

10x PCR buffer, 1.5mM MgCl, 0.

2

Acid, 0.2 μΜ of 12 & 13SP (Toshimi IJ number 7), 0.2 / iΜ of 12mtAS primer (Tokimi IJ number 9), 1.25 U Taq polymerase (Ampl TaqGold; Perkin-Elmer , Foster City, Calif.) And the amplified product cut by the primary restriction enzyme treatment for the detection of mutations at codon 12 were made into type I (1 μl), and the PCR solution was made 25 μl in total. PCR was performed at 95 ° C for 11 minutes and then 95. The gene was amplified by repeating the cycle for 30 seconds at C → 30 seconds at 53 ° C → 30 seconds at 72 ° C for 26-30 times (Fig. 3 (d)).

[0091] (Secondary PCR for codon 13 mutation detection)

12 & 13SP (SEQ ID NO: 7) and 13mtAS (SEQ ID NO: 10) were used as primers for amplifying the primary PCR amplification product for detecting the mutation of codon 13.

10x PCR buffer, 1.5mM MgCl, 0. Acid, 0.2 μΜ of 12 & 13SP (Toshimi system IJ number 7), 0.2 / i M of 13mtAS primer (Toshimi system lj number 10), 1.25 U Taq polymerase (Ampl Taq Gold; Perkin-Elmer , Foster City, Calif.) And the amplified product cut by the primary restriction enzyme treatment for the detection of codon 12 mutations were converted into type I (1 μl), and the total PCR solution was 25 μl. The PCR was performed at 95 ° C for 11 minutes, then at 95 ° C for 30 seconds → 53. 30 seconds in C → 72. The gene was amplified by repeating the cycle for 30 seconds at C 26 30 times (Fig. 3 (e)).

[0092] (Secondary restriction enzyme treatment for codon 12 mutation detection)

3 μl of 10-fold concentration NEbuffer, 1 μl of restriction enzyme Mval (5 U / μ1), 1 μl of distilled water, primary Ρ Secondary for detection of mutation in codon 12 contained in amplification product obtained by CR A total of 30 μl was prepared using 25 μl of a gene amplification solution obtained by PCR. The cleavage reaction was carried out at 37 ° C, which is the optimum temperature of Mval, for 6 hours or more (Fig. 3 (f)).

[0093] (Secondary restriction enzyme treatment for codon 13 mutation detection)

3 μl of 10-fold concentration of NEbuffer, 1 μl of restriction enzyme Bgll (5U / / i 1), 1 μl of distilled water, 2 for detection of mutations in codon 13 contained in amplification products obtained from primary PCR Next, a total of 30 _{β1 was prepared} using 25 _β1 of the gene amplification solution obtained by PCR. The cleavage reaction was performed at 37 ° C, which is the optimal temperature of Bgll, for 6 hours or more (Fig. 3 (g)).

[0094] The restriction enzyme fragment treated with the restriction enzyme was detected by restriction enzyme fragment length polymorphism.

[0095] (Detection of KRAS gene codon 12 mutation)

If there is no mutation in codon 12 by the secondary restriction enzyme treatment, 60 bp, 29 bp, and 21 bp fragments are detected. On the other hand, when all the codons 12 have mutations, two types of fragments, 99 bp and 21 bp, are detected.However, in actuality, most of the cases include the KRAS gene from normal tissues. , 99bp, 60bp, 29bp, and 21bp are detected. In fact, a force of 120 bp or 91 bp may be observed. This is due to a poor restriction enzyme treatment or an excessive amount of type III.

Basically, when a 99 bp fragment is found, it is determined that there is a mutation at codon 12. The results are shown in FIG.

[0096] According to this example, 99bp and 60bp fragments were detected in the second to fourth lanes from the right, It was determined that there was a mutation in codon 12, and only the 60 bp fragment was detected in the rightmost lane, and it was determined that there was no mutation in codon 12.

[0097] (Detection of mutation in codon 13 of KRAS gene)

If there is no mutation in codon 13 by the secondary restriction enzyme treatment, three types of fragments of 74 bp, 32 bp and 14 bp are detected. On the other hand, when all the codons 13 have mutations, two types of fragments, 106 bp and 14 bp, are detected.However, in most cases, the fragment contains the KRAS gene from normal tissue, , 106 bp, 74 bp, 32 bp and 14 bp are detected. In practice, fragments of 120 bp and 88 bp may be observed. This is due to poor restriction enzyme treatment or excessive amount of type III.

Basically, when a 106 bp fragment is detected, it is determined that there is a mutation at codon 13. The results are shown in FIG. 4 (c).

[0098] According to this example, a 106 bp, 74 bp fragment was detected in the third to fourth lanes from the right, it was determined that there was a mutation at codon 13, and only a 74 bp fragment was detected in the rightmost lane, It was determined that codon 13 had no mutation.

[0099] Example 2

The DNA used as type I in this experiment was extracted from tumor tissue and corresponding normal mucosa samples from 234 patients who underwent therapeutic surgery. Samples of both tumor and normal mucosal tissues were stored at -80 ° C and DNA was extracted by standard procedures including proteinase K digestion and phenolic chloroform extraction.

[0100] The experimental method was similar to that described in Example 1. However, in the primary PCR, Taq polymerase was used at 0.625 U and type II DNA was used at 50 ng. 30 hectares at C, 30 heaps at 58 ° C, 72. At 30 ° C., 30 cycles of cycling were carried out 30 times, and then the mixture was further reacted (at 72 ° C. for 5 minutes).

Tumor staging was based on the Duke's specification.

[0101] FIG. 5 shows a summary of the results.

Of the 234 CRC patient samples, 21 (9%) had a BRAF V599E mutation and 72 (31%) had a KRAS gene mutation. Table 1 shows the breakdown. [0102] [Table 1]

G34A G12S 5 (2,1)

G34T G12C 2 (0.9)

[0103] In all cases of the BRAF gene mutation, the T to A transversion of the base at position 1796 (V599E) was performed. Of the 72 KRAS mutations, 51 (71%) had a G to A transition, 17 (24%) had a G to T transversion, and 7 (10%) had a G to T transversion. It was a transversion from G to C. As previously reported by other investigators, no single patient had mutations in both BRAF and KRAS.

Therefore, the 234 cases examined could be divided into the following subgroups: the group with a mutation in the BRAF gene (BRAF-mt), the group with a mutation in the KRAS gene (KRAS-mt), and these genes Group without any mutation (Wt). Table 3 shows these three groups and the relevant clinicopathological features, including MSI status.

[0104] [Table 2]

[0105] Of the 21 CRC cases with BRAF-mt, 16 (76%) had MSI-H, while most of the other two groups had MSI-L / MSS. Most CRC patients with BRAF mutations (76%) or KRAS mutations (64%) were older than 65 years. Only 45% of CRC patients who were wild-type with respect to both BRAF and KRAS were over 65 years old. Regarding gender, BRAF-mt CRC was more frequent in women than in men (Table 2). Right colon is predilection of tumors with BRAF mutation (76./ _0), no pronounced than with respect KRAS mutations (44%), a top-low for tumors of the wild type for both genes (23%) (Table 2). Regarding histological grade, BRAF-mt is pathologically moderately differentiated (33%) or well differentiated (10%) in poorly or mucinous (57%) CRC. ) Was more frequent than CRC. Tumor stage was not associated with mutation status.

[0106] The samples examined for mutations in the BRAF and KRAS genes contained MINT1, MINT2, MINT31, CACNA1G, pl6 ^INK4a , pl4 ^ARF , COX2, DAPK and MGMT, and the 5 'and 3' regions of the hMLHl promoter region. Methylation at 9 loci The status was assessed and the results were assessed based on whether the CRC in question had a BRAF or KRAS mutation (Table 3).

[Table 3]

BRAF-mtKR -mt soda

(n = 39) 19 (90) 10 (14)

MJNT1

Ml orchid

MINT3!

CAC View G

M (n = 39) Class 18 12 (1?) Pl6 r9 ^{(6 /} <0,0001

U (n = 195) 3 (14) Sir 132 (94)

In the table, "M" indicates that the promoter is methylated, and "U" indicates that the promoter is not methylated. Value ²¹ is based on Chi-square test.

hMLHl promoter regions 5 and 3, and MINT1, MINT2, MINT 31, Methylation of CACNA1G, pl6, and pl4 was very common in the BRAF-mt group (P <0.0001). Methylation of the 3 ′ region of hMLH1 was observed almost exclusively in the BR AF-mt group (BRAF-mt = 76%; KRAS_mt = 0%; Wt = 1%; P <0.0001). In comparison with the wild-type group, the KRAS mutation was statistically correlated with MINT2, pl6 ^INK4a , and pl4 ^ARF methylation, as was the BRAF mutation. Methylation of MGMT was only associated with the KRAS_mt group (P = 0.007). C〇X2 and DAPK promoter methylation did not correlate with either group. Table 3 shows the statistical results for a 3 × 2 qualitative correlation table. This correlation table highlights the fact that there are differences between wild type tumors for BRAF mutations, KRAS mutations and both genes. The specific differences described above were evident by examining the proportions in this table, and these differences were confirmed to be statistically significant by individual two-gnore comparison using a 2 × 2 table.

[0109] The frequency of methylation of the 11 promoters among the three groups was determined (Table 4).

[0110] [Table 4]

Supras methyl ft 遗 ¾ 子廒 ¥¥ average »

(Subclass) (Average no of methylated! O ci) S.E. 95% C.I

S longitudinal-mn = 21 >> 7.2 0.31 6,6-7.9 <0.0001

A¾ 5-mt (n = 72) 1.8 0.17 1.5-2.1

Wl fn = 141 i 1.0 0.12 0.79-1J

[0111] In the table, "SE" indicates a standard error. value. Go to Wilcoxon / Kruskal-Wallis' test.

Of the 234 CRCs, 93 (40%) CRC samples showed either KRAS or BRAF mutations. Twenty-one cases of BRAF-mt showed methylation at one or more loci, and the average number of methylated loci was 7.2 (SE = 0.31, 95% CI = 6 6—7.9.). 72 cases of KRAS-mt have 1.8 methylated loci (SE = 0.17, 95% CI = 1.5-2.1), and Wt 141ί It had 1.0 methinolay locus (SE = 0.12, 95% CI = 0.79-1.3). Therefore, there was a significant difference in the average number of methylated loci in the BRAF-mt, KRAS_mt and Wt subgroups (Wilcoxon / Kruskato Wallis' test, P <0.0001).

[0112] Therefore, the presence or absence of mutations in the BRAF and KRAS genes is detected by the method of the present invention. By doing so, it is possible to predict MINT1, MINT2, MINT31, CACNA1G, pl6, pl4, COX2, DAPK, and MGMT, and the level of methyl chloride in the 5 ′ and 3 ′ regions of the hMLH1 promoter region. In addition, by examining a sample derived from a subject by the method of the present invention, the likelihood of cancer development, its type, site, and the like can be predicted.

Industrial applicability

The production of the nucleic acid amplification primer, the nucleic acid amplification primer set, and the kit for detecting the mutation of codon 599 of the BRAF gene (and the mutation of codon 12 and codon 13 of the KRAS gene) of the present invention are carried out in the pharmaceutical industry and in the pharmaceutical industry. It can be used in the field of technology. A method for detecting a mutation at codon 599 (and mutations at codons 12 and 13 of the KRAS gene) of the BRAF gene of the present invention, a primer for nucleic acid amplification, a primer set for nucleic acid amplification, and a BRAF gene for use in this detection method The codon 599 mutation (and KRAS gene codon 12 and codon 13 mutation) detection kits can be usefully used in the medical industry.

[0114] This application is based on Japanese Patent Application No. 2003-435628 filed on December 26, 2003, and the contents described in the specification and claims of Japanese Patent Application No. 2003-435628 are as follows. , All of which are included in this specification.

Claims

The scope of the claims

[1] A primer for nucleic acid amplification used to detect a mutation at codon 599 of the BRAF gene,

If there is a mutation in codon 599 of the BRAF gene, the amplification product of the BRAF gene by the nucleic acid amplification primer set including the nucleic acid amplification primer is not recognized by the specific restriction enzyme, and the codon 599 of the BRAF gene is not recognized. If there is no mutation, an amplification product of the BRAF gene by a nucleic acid amplification primer set including the nucleic acid amplification primer is recognized by the specific restriction enzyme.

[2] The primer for nucleic acid amplification according to claim 1, wherein the specific restriction enzyme is Btsl.

[3] In the sequence containing the BRAF gene shown in SEQ ID NO: 5, a sequence in which adenine (A) at base number 425 is substituted with guanine (G) is used, and the base sequence containing the substituted base is included. A primer for nucleic acid amplification prepared with a nucleotide sequence that does not include base numbers 428 to 430.

[4] A primer set for nucleic acid amplification used to detect a mutation at codon 599 of the BRAF gene,

If there is a mutation at codon 599 of the BRAF gene, the amplification product of the BRAF gene by the nucleic acid amplification primer set is not recognized by the specific restriction enzyme, and if there is no mutation at codon 599 of the BRAF gene, A primer set for nucleic acid amplification, wherein an amplification product of the BRAF gene by the nucleic acid amplification primer set is recognized by the specific restriction enzyme.

[5] The primer set for nucleic acid amplification according to claim 4, wherein the specific restriction enzyme is Btsl.

[6] In the sequence containing the BRAF gene shown in SEQ ID NO: 5, a sequence in which adenine (A) at base number 425 is replaced with guanine (G) is used, and the base sequence containing the replaced base is included. A primer set for nucleic acid amplification prepared with a base sequence that does not include base numbers 428 to 430.

[7] The primer set for nucleic acid amplification according to any one of claims 416, further comprising the following primer set:

A primer set for nucleic acid amplification used for detecting codon 12 and codon 13 mutations of the KRAS gene in one operation,

If there is a mutation in codon 12 of the KRAS gene, if the amplification product of the KRAS gene by the primer set for nucleic acid amplification is not recognized by the specific first restriction enzyme, and if there is a mutation in codon 13 of the KRAS gene, If the amplification product of the KRAS gene by the nucleic acid amplification primer set is not recognized by the specific second restriction enzyme and there is no mutation in codon 12 or codon 13 of the KRAS gene, the nucleic acid amplification A nucleic acid amplification primer, wherein the amplification product of the KRAS gene by the primer set is recognized by the specific first restriction enzyme and the specific second restriction enzyme.

[8] The primer set for nucleic acid amplification according to any one of claims 416, further comprising the following primer set:

If there is a mutation at codon 12 of the KRAS gene, the amplification product of the KRAS gene by the primer set for nucleic acid amplification including the primer for nucleic acid amplification is not recognized by the restriction enzyme Mval or BstNI, and the mutation at codon 13 of the KRAS gene is made. If the KRAS gene amplification product by the nucleic acid amplification primer set including the nucleic acid amplification primer is not recognized by the restriction enzyme Bgll, and there is no mutation in codon 12 or codon 13 of the KRAS gene, A primer for nucleic acid amplification by the primer set for nucleic acid amplification including the primer for nucleic acid amplification, wherein the primer is recognized by the restriction enzymes Mval and Bgll and the amplification product of the KRAS gene is cleaved.

^ —

[9] The primer set for nucleic acid amplification according to any one of claims 4 to 6, further comprising the following primer set:

Used to detect mutations in codons 12 and 13 of the KRAS gene in a single operation As a primer for nucleic acid amplification, adenine (A) at base number 466 and cytosine (C) and guanine (G) at base number 467 in the sequence containing the KRAS gene shown in SEQ ID NO: 11 A primer set comprising a nucleic acid amplification primer prepared using a sequence substituted with cytosine (C), including the two substituted nucleotides, and excluding nucleotides 470 to 475.

[10] A method for detecting a mutation at codon 599 of the BRAF gene,

If there is a mutation in codon 599 of the BRAF gene, the specific restriction enzyme does not recognize the amplification product of the BRAF gene by the primer set for nucleic acid amplification, and if there is no mutation in codon 599 of the BRAF gene, The specific restriction enzyme recognizes the amplification product of the BR AF gene by the primer set for nucleic acid amplification,

Depending on the presence or absence of the codon 599 mutation in the BRAF gene, the amplification product of the BRAF gene by the nucleic acid amplification primer set generates restriction enzyme fragments of different lengths, and the restriction enzyme fragment is converted into a restriction fragment length polymorphism. BR characterized by detecting using

A method for detecting a mutation at codon 599 of the AF gene.

[11] The BRA according to claim 10, wherein Btsl is used as the restriction enzyme.

A method for detecting a mutation at codon 599 of the F gene.

[12] A method for detecting a mutation at codon 599 of the BRAF gene,

1) using the first nucleic acid amplification primer set, performing nucleic acid amplification of the BRAF gene, and treating the amplification product of the BRAF gene with a specific restriction enzyme;

2) Next, the reaction solution treated with the specific restriction enzyme is subjected to nucleic acid amplification of the BRAF gene using the second primer set for nucleic acid amplification, and the amplified product of the BRAF gene is subjected to the specific amplification. A second step of treating with a restriction enzyme;

In the first step, for the BRAF gene having a mutation at codon 599, the BRAF gene amplified by the first nucleic acid amplification primer set is not recognized by the restriction enzyme, and the BRAF gene having no mutation at codon 599 is used. For the gene, the first nuclear A method for detecting a mutation at codon 599 of the BRAF gene, wherein the restriction enzyme recognizes an amplification product of the BRAF gene by an acid amplification primer set.

13. The codon 599 of the BRAF gene according to claim 12, wherein in the second step, the specific restriction enzyme recognizes a site other than the codon 599 of the BRAF gene in the amplification product of the BRAF gene. Method for detecting mutations.

[14] A method for detecting a mutation at codon 599 of the BRAF gene,

2) Next, the amplification product having a mutation at codon 599 of the BRAF gene is obtained by performing the second nucleic acid amplification using the amplification product of the BRAF gene obtained by the first primer set for nucleic acid amplification as a type II. A method for detecting a mutation at codon 599 of the BRAF gene, wherein the mutation is amplified at a large rate.

[15] Before or after each step for detecting the mutation at codon 599 of the BRAF gene, or simultaneously or in parallel with them.

1) If there is a mutation in codon 12 of the KRAS gene, the amplification product of the KRAS gene by the first nucleic acid amplification primer set is not recognized by the specific first restriction enzyme, and the codon 13 of the KRAS gene is mutated. If there is, the specific second restriction enzyme does not recognize the amplification product of the KRAS gene by the first nucleic acid amplification primer set, and there must be no mutation in codon 12 or codon 13 of the KRAS gene. For example, the amplification product of the KRAS gene by the first nucleic acid amplification primer set can be used for the first nucleic acid amplification such that it recognizes both the specific first restriction enzyme and the specific second restriction enzyme. The amplification product obtained using the primer set is cleaved with the first and second restriction enzymes,

2) Next, the KRAS gene amplification product obtained by the first nucleic acid amplification primer set is subjected to a second nucleic acid amplification with a type II, thereby having a mutation at codon 12 and / or codon 13 of the KRAS gene. The amplification product is amplified at a higher rate. After performing each step for detecting mutations in codons 12 and 13 of the KRAS gene, the results of the presence or absence of mutations in codon 599 of the BRAF gene, 1 15. The method of any one of claims 1014, further comprising comparing the result with the presence or absence.

[16] The method according to claim 15, wherein the specific first restriction enzyme is Mval, and the specific second restriction enzyme is Bgll.

[17] As a nucleic acid amplification primer set for amplifying the KRAS gene, in the sequence containing the KRAS gene shown in SEQ ID NO: 11, adenine (A) at base number 466 is replaced with cytosine (C) and base number Using a sequence in which guanine (G) at position 467 is replaced with cytosine (C), a nucleic acid created with a base sequence containing the two substituted bases and excluding base numbers 470 to 475 17. The method according to claim 15, wherein a primer set including an amplification primer is used.

[18] The gene to be amplified is biopsy tissue, surgical specimen, blood, knee fluid, serum, feces, semen, saliva, sputum, cerebrospinal fluid, or a reaction in which the BRAF gene was amplified by nucleic acid amplification using these 18. The method for detecting a mutation at codon 599 of the BRAF gene according to any one of claims 10 to 17, wherein the mutation is derived from one of the forces selected from the solution.

[19] The mutation detection of the BRAF gene codon 599 containing the primer set for nucleic acid amplification according to claim 1, the restriction enzyme Btsl, and DNA polymerase, or the codon 599 of BRAF gene and the codon of KRAS gene Reagent kit for detecting mutations at 12 and codon 13