WO2005056581A2 - Peptide able to specifically bind a chemokine receptor and use thereof - Google Patents

Abstract

The present invention relates to a peptide able to specifically bind a chemokine receptor consisting essentially in the sequence NPFYYLSFSP, or LLXXXFFXXX, a part thereof, a combination thereof and/or variants. Furthermore, it relates to a pharmaceutical composition comprising as an active substance a pharmaceutically effective amount of at least one of said peptide.

Description

Peptide able to specifically bind a chemokine receptor and use thereof FIELD OF THE INVENTION The present invention relates to a peptide able to specifically bind a chemokine receptor consisting essentially in the sequence NPFYYLSFSP, or LLXXXFFXXX, a part thereof, a combination thereof and/or variants. Furthermore, it relates to a pharmaceutical composition comprising as an active substance a pharmaceutically effective amount of at least one of said peptide.

BACKGROUND OF THE INVENTION

During the past 20 years, HIV-1 infection and the Acquired Immuno Deficiency Syndrome (AIDS) resulting of this infection have become a worldwide pandemic, with political and economic implications that transcend public health [Sleasman, J. W., et al. (2003). HIV-1 infection. J Allergy Clin Immunol 111(2 Suppl): S582-S592.]. AIDS constitutes one of the most serious crises currently facing the human development, and threatens to reverse progress in the most severely affected countries by decades [Piot, P., et al. (2001). The global impact of HIV/AIDS. Nature 410(6831): 968-973]. The HIV and AIDS affect not only the health of infected individuals but also the whole society in the field of public health, economy and education. At the macro-level, the HIV has sustained impacts on development, whether measured in terms of life expectancy or in terms of economic growth [Piot et al, 2001]. The search for an AIDS vaccine began more than 15 years ago. In spite of large concerted efforts, many difficulties were met during the development which had a huge impact on the progress of vaccine research. The key problem comes from the fact that there are no significant large population with well-defined resistance to HIV infection, and thus no immune parameters have been identified that correlate with protection [Nabel, G. J. (2001). Challenges and opportunities for development of an AIDS vaccine. Nature 410(6831): 1002- 1007]. The development of a vaccine without correlation to immunity or without a surrogate marker of protection in advance is possible but implies considerably more laborious research. The identification of immunogens that induce broad and long-lasting immunity has been another critical hurdle. Furthermore, the high degree of diversity of HIV virus makes difficult the creation of a vaccine that is universally effective against all HIV strains. Finally, the progress in vaccine research is subjected to limitation of appropriate animal models. In the absence of known immune correlates of protection, the stimulation of long- lived memory T-cells, both CF8+ CTLs and CD4+ memory helper T cells, will probably be needed for a highly effective AIDS vaccine [Nabel, 2001]. Because CTLs are more likely to be effective against internal viral proteins, attention has focused on the use of GAG proteins, which are structural proteins of the HIV, as immunogens for the CTL response. In addition, a strategy to induce broadly neutralizing antibodies will be required for highly effective, long- lasting immunity. The accessibility of the Env proteins on the surface of intact virions would make it an attractive target for neutralizing antibodies. HIV vaccines have been evaluated so far in over 70 phase I, five phase II and two in phase III clinical trials [Nabel, 2001]. Although neutralizing antibodies responses have been detected, their activity on primary R5 isolates has been minimal and also have been largely strain specific. CD8+ CTL responses have also been found but are not yet optimal.

Besides, despite the major impact of protease and reverse transcriptase inhibitors on HIV-1 treatment in recent years, these drugs cannot eradicate HIV-1 from infected individuals. The use of anti-viral tri-therapies (HAART) has dramatically decreased the mortality of HIV infected patients, especially in Western countries. However, the emergence of new resistant HIV-1 strains and the presence of drug-associated pathologies highlight the importance of the development of novel anti-HIV therapies. The use of chemical compounds as therapeutic drugs is limited by their toxicity or because they activate the immune system (in the case of chemokines).

Recently, it has been shown that chemokine receptor 5 (CCR5) plays a major role in the entry of the HIV virus into the host cell [Feng, Y, et al. (1996). HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science 272(5263): 872-877]. The chemokine receptors (CR) are a large branch of the rhodopsin family of the G-protein coupled receptors (GPCRs) [Stantchev, T. S. and C. C. Broder (2001). Human immunodeficiency virus type-1 and chemokines: beyond competition for common cellular receptors. Cytokine Growth Factor Rev 12(2-3): 219-243]. They are defined by their ability to induce signaling after relevant natural chemokine ligand binding. The CCR5 receptor is a member of the chemokine receptor group belonging to the seven transmembrane domain (7TM) G protein-coupled receptor (GPCR) superfamily that function in immune and inflammatory responses by regulating the activation and directed migration of leukocytes [Signoret, N., et al. (2000). Endocytosis and recycling of the HIV coreceptor CCR5. J Cell Biol 151(6): 1281-1294].

The natural high-affinity ligands of the CCR5 receptor are the chemokines RANTES, MIP-1 α, MIP-1 β and MCP-2 but none is selective.

CCR5 is expressed on the surface of macrophages, resting T cells with memory/effector phenotype (CD26^high CD45RA^low CD45R0⁺ Thl lymphocytes), CD4⁺ and CD8⁺ thymocytes, peripheral blood-derived dendritic cells, CD34⁺ hematopoietic progenitor cells, epidermal Langerhans cells and microglial cells. CCR5 is thought to be involved in the recruitment of leukocytes in a growing number of inflammatory diseases, such as rheumatoid arthritis, multiple sclerosis and asthma.

Furthermore, studies have shown that the -chemokines MIP-1 α, MIP-1 β and RANTES, the natural ligands of CCR5 receptor, are potent inhibitors of R5 HIV-1 replication in tissues culture [Blair, W. S., et al. (2000). HIV-1 entry: an expanding portal for drug discovery. Drug Discov Today 5(5): 183-194]. They inhibit HIV replication in peripheral blood mononuclear cells (PBMCs) but do not block infection of primary macrophage cultures [Simmons, G., et al (1997). Potent inhibition of HIV-1 infectivity in macrophages and lymphocytes by a novel CCR5 antagonist. Science 276(5310): 276-279].

The first modified RANTES, Met-RANTES [2-68], acts as an antagonist of RANTES mediated chemotaxis [Proudfoot, A. E., et al. (1996). Extension of recombinant human RANTES by the retention of the initiating methionine produces a potent antagonist. J Biol Chem 271(5): 2599-2603.] but its inhibition of HIV infection of PMBCs is weak compared to wild- type RANTES. Complete inhibition of PMBCs by HIV-1 strains SF-162 and E80 required more than 200 ng/ml of RANTES and more than 400 ng/ml of Met-RANTES [Simmons et al, 1997]. Aminooxypentane derivative of RANTES, (AOP)-RANTES [2-68] efficiently inhibits a range of R5 strains on PMBCs, macrophages and CCR5+ cell lines using concentration of more than 100 ng/ml [Simmons et al, 1997] but induces calcium mobilization and mediates chemotaxis in some CCR5+ cell lines [Simmons, G., et al. (2000). Co-receptor use by HIV and inhibition of HIV infection by chemokine receptor ligands. Immunol Rev 177: 112-126.]. The capacity of AOP-RANTES to down-modulate CCR5 and prevent its recycling correlates with its higher affinity for the receptor and its greater potency in inhibiting HIV infectivity [Proudfoot et al, 1999]. N-nonanoyl (NNY)-RANTES [2-68] is even more potent than the wild-type RANTES in terms of both anti- HIV properties and binding affinity to CCR5. Inhibition of virus infection in cultured human primary PMBCs occurred with plasma levels of 50 to 113 pM NNY-RANTES and 500 to 630 pM AOP- RANTES [Mosier, D. E., et al. (1999). Highly potent RANTES analogues either prevent CCR5 -using humanimmunodeficiency virus type 1 infection in vivo or rapidly select for CXCR4-using variants. J Virol 73(5): 3544-3550].

The mechanism of chemokine mediated inhibition of HIV-1 replication appears to be bimodal, with inhibition of virus entry resulting from direct competition for receptor binding, as well as chemokine-mediated down-regulation of the co-receptors [Blair et al., 2000]. However, there are several obstacles to overcome in terms of developing chemokines or chemokine-derived molecules into anti-HIV therapeutics. These includes problems of unwanted activation or interference with normal signaling of the inflammatory pathway, deleterious side effects due to ligand-chemokine receptor promiscuity and the reported potential of chemokine to enhance viral replication under certain circumstances [Eckert, D. M., et al. (2001). Mechanisms of viral membrane fusion and its inhibition. Annu Rev Biochem 70: 777-810.], [Blair, W. S., et al. (2000). HIV-1 entry: an expanding portal for drug discovery. Drug Discov Today 5 (5): 183-194].

Multiple domains in the N-terminal part (Nt) or in the ExtraCellular Loops (ECL) directly or indirectly contribute to its co-receptor activity. Coreceptor binding triggers the formation of prehairpin structure of triple-stranded coiledcoil in the N-terminal part of viral gp41 [Doms, R. W. (2002). Viral Pathogenesis: HIV attachement and entry. Medscape]. All primary HIV-1 isolates studied to date use the chemokines receptors CCR5 and CXCR4 (an other chemokine recptor) as co-receptors, although utilization of several other chemokine receptors has been demonstrated [Pierson, T. C, et al. (2003). HIV-1 entry inhibitors: new targets, novel therapies. Immunol Lett 85(2): 113-118].

This key role in the HIV infection has propelled CCR5 as a major target for drug development aiming at blocking viral infection. There have been several attempts to inhibit the interaction between of a cell bearing mammalian CCR5 and an HIV virus using antibodies directed against CCR5 or a portion thereof [international patent application WO9818826, in the name of Millenium Pharm Inc] and [Lee, B., et al. (1999). Epitope mapping of CCR5 reveals multiple conformational states and distinct but overlapping structures involved in chemokine and coreceptor function. J Biol Chem 274(14): 9617-9626.]. In this latter publication Lee et al. have shown that anti-CCR5 monoclonal antibodies (mAbs) whose epitopes include residues in the Nt domain strongly inhibit gpl20 binding to CCR5 but only moderately inhibit HIV-1 fusion and entry. This is the contrary of mAbs including residues in extracellular loop 2 (ECL2). This data suggest that the ability to block virus infection did not correlate with the ability to block gpl20 binding. It seems that other regions of the CCR5 co-receptor have functions that are necessary for the successful completion of viral-cell fusion and entry of the virus into the host cell.

Recently, another approach was to down-regulate surface expression of CCR5 on monocytes by contacting said monocytes with a sufficient amount of soluble CD40 binding protein [international patent application WO9932138]. Blood monocytes contacted with CD40 binding protein are less likely to become infected with macrophage-tropic virus and may protect bystander cells by producing chemokines that antagonize macrophage-tropic HIV-1 replication in monocytes as well as T cells. However, this approach has been shown to induce expression of the -chemokines MIP-1 , MIP-1 β and RANTES but none is selective for the CCR5 Receptor. Furthermore, as described in Eckert et al, 2001 and in Blair et al, 2000, it raises problems of unwanted activation or interference with normal signaling of the inflammatory pathway, deleterious side effects due to ligand-chemokine receptor promiscuity and the reported potential of chemokine to enhance viral replication under certain circumstances.

Thus novel therapeutic drugs are urgently needed to ameliorate the disease course in currently infected individuals and to prevent novel infections. The development of peptide ligands binding to the CCR5 receptor and inhibiting the HIV infection, which are neither agonists nor antagonists of the CCR5 receptor, can provide a very promising alternative to the development of new generation drug leads. Therefore, the object of the present invention is to provide a peptide ligand against the CCR5 receptor, for the treatment or prevention of AIDS, which does not have the above- mentioned drawbacks.

SUMMARY OF THE INVENTION

This object has been achieved by providing a peptide able to specifically bind a chemokine receptor consisting essentially in the sequence NPFYYLSFSP, or LLXXXFFXXX , a part thereof, a combination thereof and/or variants, and wherein X is an amino acid residue. Furthermore, the invention provides an isolated and purified nucleic acid sequence encoding the peptide, an expression vector comprising at least one copy of an isolated and purified nucleic acid sequence and a eukaryotic or prokaryotic host cell containing the peptide, the isolated and purified nucleic acid sequence and/or the expression vector. The invention further provides a pharmaceutical composition comprising as an active substance a pharmaceutically effective amount of at least one peptide according to the invention and the use of said pharmaceutical composition, for the preparation of a medicament for the treatment or prevention of a disease associated with the expression of the human CCR5 chemokine receptor. Another aspect of the present invention relates to a method for decreasing the infectability of a cell that expresses a human CCR5 chemokine receptor for a retrovirus that uses the human CCR5 chemokine receptor as a coreceptor, comprising contacting the cell with an effective amount of the peptide of the present invention, or with the pharmaceutical composition of the invention, sufficient to decrease expression of the human CCR5 chemokine receptor or sufficient to inhibit the interaction of a retrovirus with the human CCR5 chemokine receptor. DESCRIPTION OF THE FIGURES

Fig. 1 shows the selection of phages libraries on CHO-CCR5 cells.

A. Phage enrichment. The phage library CDX3KPCALLRYX10 was selected on CHO-CCR5 cells. The number of phage eluted is represented as ratio of output phage on input phage. An enrichment in eluted phage is observed during the rounds of selection. B. Selection strategy used for panning of second generation peptide. The CHO-CCR5 cells are incubated with the phage library XlO-CRl for 30 sec. NNY-RANTES (100 pM) is added and the mixture is incubated for 30 sec. The unbound phages are removed. The bound phages are eluted with *

200 mM TEA (C). The phages of round 3 (D, black columns) and phages of round 4 (D, grey columns) are then submitted to further selection using elution with lμM RANTES.

Fig. 2 represents the competition binding assay.

A. The binding affinity of selected peptides to CCR5 was measured by competition with 1251- MIP-1/3 (24 kcpm/well) on CHO-CCR5 cells (30O00 cells/well). The experiment was done in triplicat and in duplicat for NNY-RANTES. B. The binding affinity of the recombined peptide CR2 was measured by competition with 125I-RANTES (31 kcpm/well) on CHO-CCR5 cells (50O00 cells/well). The control peptide is an irrelevant 23-mer linear peptide. The experiment was done in 7-plicate.

Fig. 3 represents the fusion assay.

The formation of syncytia between HeLa-CD4-CCR5 cells and HeLa-Env-ADA cells was monitored by a measure of β -galactosidase activity. The fusion is expressed as value of optical density (A) or as percentage of positif control sample (100% of fusion) (B). The peptides CR1, CRl-lin (see table 4) did not show any inhibition of cell fusion (A). The recombinant peptide CR2 inhibited the formation of syncytia with an IC50 of about 5 μM (B). The experiments were done in triplicates. The control peptides are irrelevant 23-mer and 10- mer linear peptides. DMSO is a control buffer with the same concentrations of DMSO as in the peptide samples. Fig. 4 depicts the calcium release assay.

Changes in intracellular concentration of Ca2+ to response to various concentrations of peptides or vehicle are measured by calcium-dependant fluorescence in CHO-CCR5 cells loaded with Fura-2 dye. A. Peptide CRl-lin (10 μM ) or control peptide were added to the cells at 1 min and followed by addition of 3 μM NNY-RANTES at 3.5 min . The response of cells to the ligand was controlled by addition of 3 μM NNY-RANTES alone. B. Peptides or vehicle were added to the cells at 15 sec, followed by addition of 10 nM RANTES at 105 sec. HP2 and HP3 are irrelevant linear 23-mer and 10-mer control peptides. During the experiment, a slight variation of the base line was observed that is not related to the activity of peptides. The addition of any tested peptides caused an increase of intracellular concentration of calcium.

Fig. 5 depicts the down-modulation assay.

The down-regulation of CCR5 from the surface of stably transfected CHO cells was analysed upon 1 hour incubation with peptide ligands. Surface expression was measured by fluorescence using anti-CCR5 mAb. The control peptide is an irrelevant 23-mer linear peptide. The peptide CR2 as well as the control peptide did not induced internalization of the CCR5 receptor.

DETAILED DESCRIPTION OF THE INVENTION

As used herein, the terms "peptide", "protein", "polypeptide", "polypeptidic" and "peptidic" are used interchangeably to designate a series of amino acid residues connected to the other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues.

The term "specifically", as used herein, is meant that the peptide of the invention is able to bind specifically a chemokine receptor. It will be understood that the ability of a peptide of the invention to specifically bind a chemokine receptor can be assessed on, for example binding assays. Usually, the assay is based on a competition between a peptide of the invention and a radiolabelled ligand for binding to a chemokine receptor. Typically, competition curves are then generated, plotting the concentration of the peptide of the invention used along the x-axis, and the amount of radiolabelled ligand along the y-axis. From such experiments, the KD, the IC50 (i.e., the concentration of a peptide of the invention which displaces 50% of the radiolabelled ligand), or the IC90 (i.e., the concentration of a peptide of the invention which displaces 90% of the radiolabelled ligand) value may be calculated. There are many ways of expressing the binding affinity of ligands with which the skilled person will be well versed to calculate and which may be found in any basic pharmacology text book.

The present invention relates to a peptide able to specifically bind a chemokine receptor consisting essentially in the sequences NPFYYLSFSP (SEQ ID N° 1) or

LLXXXFFXXX (SEQ ID N° 2), a part thereof, a combination thereof and / or variants, and wherein X is an amino acid residue.

The letter X corresponds to amino acid residues that can be changed by conservative, or non- conservative amino acid substitutions, without impairing the inventive properties of the peptide of the invention. Preferably, X is an aliphatic amino acid.

The "chemokine receptor" refers to a group belonging to the seven transmembrane domain (7TM) G protein-coupled receptor (GPCR) superfamily that function in immune and inflammatory responses by regulating the activation and directed migration of leukocytes [Signoret et al, 2000]. The GPCR superfamily is likely the largest group of related cell- surface receptor molecules classified into numerous subfamilies according to their genetic sequence homology and to their functional ligand specificities [Stantchev et al, 2001]. The GPCRs are cell-surface receptors with the most diverse array of ligands, ranging from photons to amino acids, ions, organic odorants, nucleotides, nucleosides, peptides, bioactive lipids and proteins [Stantchev et al, 2001].

The chemokine receptors (CR), as already described, are a large branch of the rhodopsin family of the GPCRs [Stantchev et al, 2001]. They are defined by their ability to induce signaling after relevant chemokine ligand binding. The nomenclature of chemokine receptors designs two subclasses which are rooted by the specificity of their chemokines ligands: CC and CXC [Murphy, P. M., et al (2000). International union of pharmacology. XXII. Nomenclature for chemokine receptors. Pharmacol Rev 52(1): 145-176]. The ligands of the chemokine receptors are the chemokines (chemotactic cytokines) which have been subclassified into four groups according to the number and spacing of their cysteine residues in their sequences: C, CC, CXC and CX3C. The last three chemokines types have four conserved cysteines, whereas C chemokines have only two cysteines, corresponding to the 2nd and 4th cysteines in the other groups. A small group of chemokines have six cysteines. CXC and CX3C chemokines are distinguished by the presence of one (CXC) or three (CX3C) amino acids between the 1st and the 2nd cysteines, whereas the first two cysteines of CC chemokines are adjacent [Murphy et al, 2000]. The chemokine receptors can be also divided into three groups according to their function. The inflammatory/inducible group of CR are regulated by proinflammatory stimuli such as lipopolysaccharides and primary cytokines and are implicated in the innate and adaptive immunity. In the present invention the chemokine receptor will preferably be the human chemokine receptor 5 (CCR5) which belongs to inflammatory receptors. CCR5 is a member of the CC group of chemokines receptors. It is mostly homologous to the CCR2b (76% of identity) [Blanpain, C, et al. (2002). CCR5 and HIV infection. Receptors Channels 8(1): 19- 31]. The human CCR5 Open Reading Frame predicts a protein of 355 amino acids in length [Murphy et al., 2000]. The natural high-affinity ligands of the CCR5 receptor are the CC chemokines RANTES (Regulated upon Activation, Normal T-cells Expressed and Secreted), MIP-1 a, MIP-1/3 and MCP-2 (Monocytes Chemotactic Protein 2) but none is selective. Additional ligands include MCP-3, MCP-4, MCP- 1 and eotaxin.

The second group of homeostatic/constitutive receptors (such as CXCR4) is important in lymphocytes and dendritic cell trafficking in immune surveillance. Some other CRs form an overlapping group [Murphy et al, 2000]. The chemokine receptors range from 340 to 370 amino acids in length and the homology of sequence varies from 25 to 80% [Stantchev et al, 2001]. They have a relative acidic N-terminal segment with tyrosine sulfation motifs, potential N- linked glycosilation sites, a cysteine in each of the four extracellular regions (N- terminus and extracellular loops or ECLs), short basic third intracellular loop and several serines and threonines in the C-terminal tail [Farzan, M., et al (1999). Tyrosine sulfation of the amino terminus of CCR5 facilitates HIV-1 entry. Cell 96(5): 667-676]. The sequence of H₂N- DRYLAIVHA-COOH or a variation of it is present in the second intracellular loop [Murphy et al, 2000]. The crystal structure of CR is up to date unknown. However, many structural features have been determined. The N-terminus segment before the first cysteine is structurally disordered, whereas the C-terminus after the last cysteine forms an α-helice. The whole molecule is constrained by disulfide bridges between the 1st and the 3rd cysteine and between the 2nd and the 4th cysteine [Murphy et al, 2000].

A "part" of the peptide of the invention refers to a sequence containing less amino acids in length than the sequence of the peptide. This sequence can be used as long as it exhibits the same properties as the native sequence from which it derives. Preferably this sequence contains less than 90%, preferably less than 60%, in particular less than 30% amino acids in length than the respective sequence of the peptide of the invention.

The present invention also includes a variant of the peptide of the invention. The term "variant" refers to a peptide having an amino acid sequence that differ to some extent from a native sequence peptide, that is an amino acid sequence that vary from the native sequence by conservative amino acid substitutions, whereby one or more amino acids are substituted by another with same characteristics and conformational roles. The amino acid sequence variants possess substitutions, deletions, and/or insertions at certain positions within the amino acid sequence of the native amino acid sequence. Conservative amino acid substitutions are herein defined as exchanges within one of the following five groups: I. Small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro, Gly

II. Polar, positively charged residues: His, Arg, Lys

III. Polar, negatively charged residues: and their amides: Asp, Asn, Glu, Gin

IV. Large, aromatic residues: Phe, Tyr, Tip

V. Large, aliphatic, nonpolar residues: Met, Leu, He, Val, Cys.

The above-mentioned peptides of the invention may be identified and characterized using, for example, the phage display technology which is one of the most widely used method for the study of protein-protein interactions and for the isolation of ligands specific for diverse proteins and enzymes.

In the case of NPFYYLSFSP (SEQ ID N° 1), this peptide has been selected on CHO cells constitutively expressing high levels of the CCR5 receptor using a constrained 23-mer peptide library, CDX KPCALLRYXι₀, displayed on filamentous phage fd as fusion to the minor coat protein pill. Applicants have emphasised that the presence of the N-terminal cysteine loop might favour the selection of high affinity peptide specific for the receptor. From this library, the peptide NPFYYLSFSP, was identified using a specific elution method with the chemokine analogue NNY-RANTES. This selection method favoured the selection of a non-recombined phage. The recombined library containing the N-terminal cyclic domain did not provide the correct structural properties required for binding to the CCR5 receptor and therefore was disadvantageous for the selection. The presence of the disulfide bond might generate a steric hindrance preventing thus the binding to an accessible domain on the receptor. Another hypothesis is based on the sequence of exon-1 that contains defined amino acids flanking the three random amino acids. The presence of these amino acids might negatively influence on the selection of the random amino acids to form a peptide matching a binding site on the receptor. Perhaps, also, three random amino acids are not sufficient to select a binding peptide. These results clearly underline the selection power of the phage display method. This selection method allowed to discriminate between a recombined and a non-recombined phage and to select for a binding peptide that is specific for the target molecule. Besides, Applicants have surprisingly shown that it was possible to further increase the affinity of, for example NPFYYLSFSP (SEQ ID N° 1), for the CCR5 receptor by using in vitro evolution technique. NPFYYLSFSP peptide was evolved by the exon shuffling method using the Cre/lox system [Fisch, I., et al. (1996). A strategy of exon shuffling for making large peptide repertoires displayed on filamentous bacteriophage. Proceedings of the National Academy of Sciences of the United States of America 93(15): 7761-7766]. Using the recombination between the sequence of the peptide NPFYYLSFSP and a 10-mer linear peptide library it was possible to generate a new large recombined peptide library Xι₀-CR1 displayed on phage. In brief, Applicants have used a modified gene shuffling strategy for the construction of large peptide repertoires. To display a single polypeptide chain without being interrupted with the loxP site (coding for 12 amino acids), the loxP site was placed within a self-splicing intron. This intron is a self-splicing group I intron from Tetrahymena thermophila 26S rRNA, which undergoes accurate and efficient cleavage-ligation in bacteria. After the recombination of the two peptide repertoires the intron sequence containing the loxP site is removed during the RNA splicing. Nevertheless, 5 amino acids sequence (ALLRY) remains between the exon sequences after the intron splicing. Therefore, the recombined peptide library may comprise two variable peptide sequences with optionally a five amino acids residue spacer or linker domain (HD). The selection of this new evolved peptide library on CHO-CCR5 cells using the same selection conditions led to the isolation of non-recombined peptide harbouring only peptide NPFYYLSFSP. This selection pressure was not sufficient to discriminate between the recombined (about 50% of phage clones) and the non-recombined phage. As all the phage of the library contain the peptide NPFYYLSFSP, this constituted a background that prevented the selection of a recombined phage under these conditions.

Usually, the selection pressure can be increased by using more stringent washing steps, mostly by increasing the concentration of detergent. This cannot be applied when the selection is made on live cells. Therefore, to isolate recombined peptide with higher affinity for the CCR5 receptor a new selection strategy was devised. The strategy was based on the kinetics of the interaction peptide-receptor. The hypothesis was that the NPFYYLSFSP peptide has low affinity for the receptor and hence a high off-rate. Therefore, this background of low affinity peptide might be eliminated by binding of NNY-RANTES at low concentration. The recombined peptides with higher affinity are then subjected to a selection using elution with high concentration of NNY-RANTES.

This approach was successful and permitted the identification of a recombined peptide sequence LLDSTFFTADALLRYNPFYYLSFSP (SEQ ID N° 7) or peptide CR2. The selection was effective to remove the non-recombined phage and to select peptide with both exons. The selected SEQ ID N° 7 peptide exhibited higher binding affinity for the CCR5 receptor than the NPFYYLSFSP peptide. The binding assay showed that the peptide completely inhibited the binding of ¹²⁵I-RANTES at a concentration of 100 μM.

The peptides isolated by selection against CHO-CCR5 cells were tested in in vitro assays for their biological abilities. The following peptides of the invention: 1) NPFYYLSFSP (SEQ ID N° 1), 2) a particular variant of LLXXXFFXXX (SEQ ID N° 2) consisting in LLDSTFFTAD (SEQ ID N° 6), 3) and a particular variant of the combination sequence of LLXXXFFXXXALLRYNPFYYLSFSP (SEQ ID N°5) consisting in LLDSTFFTADALLRYNPFYYLSFSP (SEQ ID N° 7) have been tested for their ability to inhibit the interaction of a retrovirus, for example HIV, with the human CCR5 chemokine receptor. The anti-HIV activity of these peptides has been tested in a cell fusion assay where the inhibition of the syncytium formation between HeLa cells (expressing the Env protein of the HIV) and HeLa-CD4-CCR5 cells was measured. The results showed that the recombined peptide CR2 inhibited efficiently the cell fusion and prevented the formation of syncytia (Fig. 3). The cell fusion assay showed that the peptide inhibits cell fusion with an IC50 in the low micromolar range (about 5 μM). The binding affinity of the peptide for the CCR5 receptor is lower than its activity to inhibit the cell fusion. The Nt domain of the receptor is thought to play an important role in HIV-1 fusion and entry [Dragic, T. (2001). An overview of the determinants of CCR5 and CXCR4 co-receptor function. J Gen Virol 82 (Pt 8): 1807-1814]. The key region of CCR5 involved in both high affinity binding and signaling of RANTES is the ECL2 domain [Samson, M., et al. (1997). The second extracellular loop of CCR5 is the major determinant of ligand specificity. J Biol Chem 272(40): 24934-24941]. However, later mutation studies of amino acids in the Nt domain have shown to significantly reduce RANTES binding to CCR5 and the signaling

[Blanpain, C, et al. (1999). Multiple charged and aromatic residues in CCR5 amino-terminal domain are involved in high affinity binding of both chemokines and HIV-1 Env protein. J Biol Chem 274(49): 34719-34727]. The peptide CR2 might possibly bind amino acids residues in the Nt region of CCR5 receptor that are more important for the binding of the viral Env protein and for the fusion than for the binding of RANTES. Therefore, the steric hindrance applied by the peptide during the competition assay with RANTES might be weaker compared to fusion assay and this is expressed by higher IC₅₀ of binding.

Since these results have shown that peptide LLDSTFFTADALLRYNPFYYLSFSP exhibited a better inhibition activity when compared to the two other tested peptides NPFYYLSFSP and LLDSTFFTAD, the present invention also encompassed a combination of SEQ ID N° 1 and SEQ ID N° 2 consisting in NPFYYLSFSP-HD-LLXXXFFXXX, or LLXXXFFXXX-HD- NPFYYLSFSP, wherein HD is a linker domain. Preferably, the linker domain consists essentially in the peptidic sequence ALLRY.

However, it is also envisioned that the tested peptides NPFYYLSFSP and LLDSTFFTAD be directly linked together without a linker domain. In a preferred embodiment of the invention, a variant of LLXXXFFXXX consists essentially in the sequence LLDSTFFTAD (SEQ ID N°).

Preferably, the combination of SEQ ID N° 1 and SEQ ID N° 2 consists essentially in the sequence LLXXXFFXXXALLRYNPFYYLSFSP (SEQ ID N°5). A variant of this SEQ ID°5 consisting essentially in the sequence LLDSTFFTADALLRYNPFYYLSFSP (SEQ ID N°) is preferred.

The peptide according to the invention, as well as a part thereof, a combination thereof and/or variants thereof can be prepared by a variety of methods and techniques known in the art such as for example chemical synthesis or recombinant techniques as described in Maniatis et al. 1982, Molecular Cloning, A laboratory Manual, Cold Spring Harbor Laboratory.

Furthermore, since an inherent problem with native peptides (in L-form) is the degradation by natural proteases, the peptide of the invention may be prepared in order to include D-forms and/or "retro-inverso isomers" of the peptide. Preferably, retro-inverso isomers of short parts, variants or combinations of the peptide of the invention are prepared.

Protecting the peptide from natural proteolysis should therefore increase the effectiveness of the specific heterobivalent or heteromultivalent compound. A higher biological activity is predicted for the retro-inverso containing peptide when compared to the non-retro-inverso containing analog owing to protection from degradation by native proteinases. Furthermore they have been shown to exhibit an increased stability and lower immunogenicity [Sela M. and Zisman E., (1997) Different roles of D-amino acids in immune phenomena- FASEB J. 11,

449].

Retro-inverso peptides are prepared for peptides of known sequence as described for example in Sela and Zisman, (1997).

By "retro-inverso isomer" is meant an isomer of a linear peptide in which the direction of the sequence is reversed and the chirality of each amino acid residue is inverted; thus, there can be no end-group complementarity.

Also encompassed by the present invention are modifications of the peptide (which do not normally alter primary sequence), including in vivo or in vitro chemical derivitization of peptides, e. g., acetylation or carboxylation. Also included are modifications of glycosylation, e. g., those made by modifying the glycosylation patterns of a peptide during its synthesis and processing or in further processing steps, e. g., by exposing the peptide to enzymes which affect glycosylation e. g. , mammalian glycosylating or deglycosylating enzymes. Also included are sequences which have phosphorylated amino acid residues, e. g., phosphotyrosine, phosphoserine, or phosphothreonine.

The invention also includes analogs in which one or more peptide bonds have been replaced with an alternative type of covalent bond (a "peptide mimetic") which is not susceptible to cleavage by peptidases. Where proteolytic degradation of the peptides following injection into the subject is a problem, replacement of a particularly sensitive peptide bond with a noncleavable peptide mimetic will make the resulting peptide more stable and thus more useful as an active substance. Such mimetics, and methods of incorporating them into peptides, are well known in the art.

Also useful are amino-terminal blocking groups such as t-butyloxycarbonyl, acetyl, theyl, succinyl, methoxysuccinyl, suberyl, adipyl, azelayl, dansyl, benzyloxycarbonyl, fluorenylmethoxycarbonyl, methoxyazelayl, methoxyadipyl, methoxy suberyl, and 2,4,- dinitrophenyl. Blocking the charged amino-and carboxy-termini of the peptides would have the additional benefit of enhancing passage of the peptide through the hydrophobic cellular membrane and into the cell.

Optionally, the peptide as disclosed in the present invention may be conjugated to an agent which increases the accumulation of the peptide in a cell.

Such an agent can be a compound which induces receptor mediated endocytose such as for example the membrane transferrin receptor mediated endocytosis of transferrin conjugated to therapeutic drugs (Qian Z. M. et al, "Targeted drug delivery via the transferrin receptor-mediated endocytosis pathway" Pharmacological Reviews, 54, 561, 2002) or a cell membrane permeable carrier which can, be selected e. g. among the group of fatty acids such as decanoic acid, myristic acid and stearic acid, which have already been used for intracellular delivery of peptide inhibitors of protein kinase C (Ioannides CG. et al, "Inhibition of IL-2 receptor induction and IL-2 production in the human leukemic cell line Jurkat by a novel peptide inhibitor of protein kinase C" Cell Immunol., 131, 242, 1990) and protein-tyrosine phosphatase (Kole H.K. et al, "A peptide-based protein-tyrosine phosphatase inhibitor specifically enhances insulin receptor function in intact cells" J. Biol. Chem. 271, 14302, 1996) or among peptides. Preferably, cell membrane permeable carriers are used, more preferably a cell membrane permeable carrier peptide is used.

In case the cell membrane permeable carrier is a peptide then it will preferably be an arginine rich peptide. It has been recently shown in Futaki et al. (Futaki S. et al, "Arginine- rich peptides. An abundant source of membrane-permeable peptides having potential as carriers for intracellular protein delivery" J. Biol. Chem., 276, 5836, 2001), that the number of arginine residues in a cell membrane permeable carrier peptide has a significant influence on the method of internalization and that there seems to be an optimal number of arginine residues for the internalization, preferably they contain more than 6 arginines.

More preferably this peptide is an arginine rich peptide selected from the group comprising the HIV-TAT _48-57 peptide, the FHV-coat ₃₅.₄ peptide, the HTLV-II Rex _4-ι₆ peptide and the BMV gag _7-25 peptide.

The peptide of the invention may be conjugated to the cell membrane permeable carrier by a spacer. Usually the spacer will be a peptide.

Preferably recombinant techniques are employed to prepare a peptide of the invention, a part thereof, a combination thereof and/or variants. In this case, nucleic acid sequences encoding the polypeptides are preferably used. With regard to the method to practise recombinant techniques, see for example, Maniatis et al. 1982, Molecular Cloning, A laboratory Manual, Cold Spring Harbor Laboratory and commercially available methods.

Therefore the present invention also relates to an isolated and purified nucleic acid sequence encoding a peptide of the invention, a part thereof, a combination thereof and/or variants as described above. "An isolated and purified nucleic acid or nucleic acid sequence" refers to the state in which the nucleic acid sequence encoding the peptide of the invention will be. Nucleic acid or nucleic sequence will be free or substantially free of material with which they are naturally associated such as other polypeptides or nucleic acids with which they are found in their natural environment, or the environment in which they are prepared (e. g. cell culture) when such preparation is by recombinant DNA technology practised in vitro or in vivo. An isolated and purified nucleic acid or nucleic acid sequence encompassed by the present invention might be DNA, RNA, or DNA/RNA hybrid.

DNA which can be used herein is any polydeoxynuclotide sequence, including, e.g. double- stranded DNA, single-stranded DNA, double-stranded DNA wherein one or both strands are composed of two or more fragments, double-stranded DNA wherein one or both strands have an uninterrupted phosphodiester backbone, DNA containing one or more single-stranded portion(s) and one or more double-stranded portion(s), double-stranded DNA wherein the DNA strands are fully complementary, double-stranded DNA wherein the DNA strands are only partially complementary, circular DNA, covalently- closed DNA, linear DNA, covalently cross-linked DNA, cDNA, chemically- synthesized DNA, semi-synthetic DNA, biosynthetic DNA, naturally-isolated DNA, enzyme-digested DNA, sheared DNA, labeled DNA, such as radiolabeled DNA and fluorochrome-labeled DNA, DNA containing one or more non-naturally occurring species of nucleic acid.

DNA sequences that comprise a nucleotide sequence encoding a peptide of the invention can be synthesized by standard chemical techniques, for example, the phosphotriester method or via automated synthesis methods and PCR methods. The isolated and purified DNA sequence comprising a nucleotide sequence encoding a peptide according to the invention may also be produced by enzymatic techniques. Thus, restriction enzymes, which cleave nucleic acid molecules at predefined recognition sequences can be used to isolate nucleic acid sequences from larger nucleic acid molecules containing the nucleic acid sequence, such as DNA (or RNA) that codes for a of the invention.

Encompassed by the present invention is also a nucleic acid in the form of a polyribonucleotide (RNA), including, e.g., single-stranded RNA, cRNA, double- stranded RNA, double-stranded RNA wherein one or both strands are composed of two or more fragments, double-stranded RNA wherein one or both strands have an uninterrupted phosphodiester backbone, RNA containing one or more single-stranded portion(s) and one or more double-stranded portion(s), double-stranded RNA wherein the RNA strands are fully complementary, double-stranded RNA wherein the RNA strands are only partially complementary, covalently crosslinked RNA, enzyme-digested RNA, sheared RNA, mRNA, chemically-synthesized RNA, semi-synthetic RNA, biosynthetic RNA, naturally-isolated RNA, labeled RNA, such as radiolabeled RNA and fluorochrome-labeled RNA, RNA containing one or more non-naturally- occurring species of nucleic acid.

The present invention also includes variants of the aforementioned sequences, that is nucleotide sequences that vary from the reference sequence by conservative nucleotide substitutions, whereby one or more nucleotides are substituted by another with same characteristics.

The invention also encompasses allelic variants of the disclosed isolated and purified nucleic sequence; that is, naturally-occurring alternative forms of the isolated and purified nucleic acid that also encode peptides that are identical, homologous or related to that encoded by the isolated and purified nucleic sequences. Alternatively, non-naturally occurring variants may be produced by mutagenesis techniques or by direct synthesis.

The aforementioned isolated and purified nucleic acid sequence comprising a nucleotide sequence encoding a peptide of the invention may further comprise a nucleotide sequence encoding a cell membrane permeable carrier peptide.

Yet another concern of the present invention is to provide an expression vector comprising at least one copy of the isolated and purified nucleic acid sequence comprising a nucleotide sequence encoding a peptide as described above. Preferably the isolated and purified nucleic acid sequence is DNA.

As used herein, "vector", "plasmid" and "expression vector" are used interchangeably, as the plasmid is the most commonly used vector form.

The vector may further comprise a nucleotide sequence encoding a cell membrane permeable carrier peptide in accordance with the invention. The choice of an expression vector depends directly, as it is well known in the art, on the desired functional properties, e.g., peptide expression and the host cell to be transformed or transfected.

Additionally, the expression vector may further comprise a promoter operably linked to the isolated and purified DNA sequence. This means that the linked isolated and purified DNA sequence encoding the peptide of the present invention is under control of a suitable regulatory sequence which allows expression, i.e. transcription and translation of the inserted isolated and purified DNA sequence.

As used herein, the term "promoter" designates any additional regulatory sequences as known in the art e.g. a promoter and/or an enhancer, polyadenylation sites and splice junctions usually employed for the expression of the polypeptide or may include additionally one or more separate targeting sequences and may optionally encode a selectable marker. Promoters which can be used provided that such promoters are compatible with the host cell are e.g promoters obtained from the genomes of viruses such as polyoma virus, adenovirus (such as Adenovirus 2), papilloma virus (such as bovine papilloma virus), avian sarcoma virus, cytomegalovirus (such as murine or human cytomegalovirus immediate early promoter), a retrovirus, hepatitis-B virus, and Simian Virus 40 (such as SV 40 early and late promoters) or promoters obtained from heterologous mammalian promoters, such as the actin promoter or an immunoglobulin promoter or heat shock promoters. Enhancers which can be used are e.g. enhancer sequences known from mammalian genes (globin, elastase, albumin, a-fetoprotein, and insulin) or enhancer from a eukaryotic cell virus, e.g. the SV40 enhancer, the cytomegalovirus early promoter enhancer, the polyoma, and adenovirus enhancers.

A wide variety of host/expression vector combinations may be employed in expressing the DNA sequences of this invention. Useful expression vectors, for example, may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences. Suitable vectors include derivatives of SV40 and known bacterial plasmids, e. g., E. coli plasmids col El, pCRl, pBR322, pcDNA3, pMB9 and their derivatives, plasmids such as RP4; phage DNAs, e. g., the numerous derivatives of phage X, e. g., NM989, and other phage DNA, e. g., M13 and filamentous single stranded phage DNA; yeast plasmids such as the 2μ plasmid or derivatives thereof; vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from combinations of plasmids and phage DNAs, such as plasmids that have been modified to employ phage DNA or other expression control sequences; and the like.

Another concern of the present invention is to provide a eukaryotic or prokaryotic host cell containing the peptide according to the invention, the isolated and purified nucleic acid sequence of the invention and/or expression vector described herein.

Transformation or transfection of appropriate eukaryotic or prokaryotic host cells with an expression vector comprising an isolated and purified DNA sequence according to the invention is accomplished by well known methods that typically depend on the type of vector used. With regard to these methods, see for example, Maniatis et al. 1982, Molecular Cloning, A laboratory Manual, Cold Spring Harbor Laboratory and commercially available methods. The term "cell transfected" or "cell transformed" or "transfected/transformed cell" means the cell into which the extracellular DNA has been introduced and thus harbours the extracellular DNA. The DNA might be introduced into the cell so that the nucleic acid is replicable either as a chromosomal integrant or as an extra chromosomal element.

The peptide of the invention, a part thereof, a combination thereof and/or variants thereof, optionally conjugated to an agent which increases the accumulation of the peptide in a cell as described herein are preferably produced, recombinantly, in a cell expression system.

A wide variety of unicellular host cells are useful in expressing the DNA sequences of this invention. These hosts may include well known eukaryotic and prokaryotic hosts, such as strains of E. coli, Pseudomonas, Bacillus, Streptomyces, fungi such as yeasts, and animal cells, such as CHO, YB/20, NSO, SP2/0, RI. 1, B-W and L-M cells, African Green Monkey kidney cells (e. g., COS 1, COS 7, BSC1, BSC40, and BMT10), insect cells (e. g., Sf9), and human cells and plant cells in tissue culture. Preferably, the host cell is a bacterial cell, more preferably an E. coli cell. The present invention is also directed to a pharmaceutical composition comprising as an active substance a pharmaceutically effective amount of at least one peptide as described, optionally in combination with pharmaceutically acceptable carriers, diluents and adjuvants. "A pharmaceutically effective amount" refers to a chemical material or compound which, when administered to a human or animal organism induces a detectable pharmacologic and/or physiologic effect.

The respective pharmaceutically effective amount can depend on the specific patient to be treated, on the disease to be treated and on the method of administration. Further, the pharmaceutically effective amount depends on the specific peptide used, especially if the peptide additionally contains a drug as described or not. The treatment usually comprises a multiple administration of the pharmaceutical composition, usually in intervals of several hours, days or weeks. The pharmaceutically effective amount of a dosage unit of the polypeptide usually is in the range of 0.001 ng to 100 μg per kg of body weight of the patient to be treated. However, higher amounts up to 1 mg per kg of body weight of the patient are also envisioned since the peptides of the invention have practically no side effects. Preferably, in addition to at least one peptide as described herein, the pharmaceutical composition may contain one or more pharmaceutically acceptable carriers, diluents and adjuvants.

Acceptable carriers, diluents and adjuvants which facilitates processing of the active compounds into preparation which can be used pharmaceutically are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl orbenzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt- forming counter-ions such as sodium; metal complexes (e.g. Zn-protein complexes); and/or non-ionic surfactants such as TWEEN®, PLURONICS® or polyethylene glycol (PEG).

The form of administration of the pharmaceutical composition may be systemic or topical. For example, administration of such a composition may be various parenteral routes such as subcutaneous, intravenous, intradermal, intramuscular, intraperitoneal, intranasal, transdermal, buccal routes or via an implanted device, and may also be delivered by peristaltic means.

The pharmaceutical composition comprising a peptide, as described herein, as an active agent may also be incorporated or impregnated into a bioabsorbable matrix, with the matrix being administered in the form of a suspension of matrix, a gel or a solid support. In addition the matrix may be comprised of a biopolymer.

Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semi permeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g. films, or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2- hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and [gamma] ethyl-L-glutamate, non-degradable ethylene- vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT(TM) (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid.

The formulations to be used for in vivo administration must be sterile. This is readily accomplished for example by filtration through sterile filtration membranes.

It is understood that the suitable dosage of a peptide of the present invention will be dependent upon the age, sex, health, and weight of the recipient, kind of concurrent treatment, if any and the nature of the effect desired.

The appropriate dosage form will depend on the disease, the peptide, and the mode of administration; possibilities include tablets, capsules, lozenges, dental pastes, suppositories, inhalants, solutions, ointments and parenteral depots.

Since amino acid modifications of the amino acids of the peptide are also encompassed in the present invention, this may be useful for cross-linking the peptide of the invention to a water- insoluble matrix or the other macromolecular carriers, or to improve the solubility, adsorption, and permeability across the blood brain barrier. Such modifications are well known in the art and may alternatively eliminate or attenuate any possible undesirable side effect of the peptide and the like. While a preferred pharmaceutical composition of the present invention comprises a peptide as an active agent, an alternative pharmaceutical composition may contain an isolated and purified nucleic acid sequence comprising a nucleotide sequence encoding the peptide, as described herein, as an active agent. This pharmaceutical composition may include either the sole isolated and purified DNA sequence, an expression vector comprising said isolated and purified DNA sequence or a host cell previously transfected or transformed with an expression vector described herein. In this latter example, host cell will preferably be isolated from the patient to be treated in order to avoid any antigenicity problem. These gene and cell therapy approaches are especially well suited for patients requiring repeated administration of the pharmaceutical composition, since the said isolated and purified DNA sequence, expression vector or host cell previously transfected or transformed with an expression vector can be incorporated into the patient's cell which will then produce the protein endogenously.

Also encompassed by the present invention is the use of the pharmaceutical composition of the invention, for the preparation of a medicament for the treatment or prevention of a disease associated with the expression of the human CCR5 chemokine receptor. Such disease may be selected from the group comprising tumors, Crohn's disease, rheumatoid arthritis, asthma, multiple sclerosis and AIDS.

The peptide of the invention will generally be used in an amount to achieve the intended purpose. For use to treat or prevent a disease associated with the expression of the human CCR5 chemokine receptor, the peptide or the pharmaceutical compositions thereof, is administered or applied in a therapeutically effective amount. A "therapeutically effective amount" is an amount effective to ameliorate or prevent the symptoms, or prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure provided herein. For systemic administration, a therapeutically effective amount or dose can be estimated initially from in vitro assays. For example, a dose can be formulated in animal models to achieve a circulating concentration range that includes the IC50 as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Initial doses can also be estimated from in vivo data, e.g. animal models, using techniques that are well known in the art. One ordinarily skill in the art could readily optimise administration to humans based on animal data and will, of course, depend on the subject being treated, on the subject's weight, the severity of the disorder, the manner of administration and the judgement of the prescribing physician. The present invention also encompasses a method for decreasing the infectability of a cell that expresses a human CCR5 chemokine receptor for a retrovirus that uses the human CCR5 chemokine receptor as a coreceptor, comprising contacting the cell with an effective amount of the peptide of the present invention, or with the pharmaceutical composition of the invention, in order to decrease expression of the human CCR5 chemokine receptor or sufficient to inhibit the interaction of a retrovirus with the human CCR5 chemokine receptor. Preferably, the retrovirus is the HIV virus.

EXAMPLES

Example 1:

Material and Methods

Bacterial strains

The Escherichia coli strain TGI supE thi-1 Δ(lac-proA) Δ(mcrB-hsdSM)5 (rk^" πik^") [F' traD36 proAB lacI^qZΔM15] [Gibson TJ, 1984] was cultivated on TYE plates supplemented with 1% glucose at 37°C or in 2xTY liquid medium at 37°C with agitation.

Eucaryotic cells

The Chinese Hamster Ovary (CHO) cells were cultivated at 37°C in RPMI 1640 medium with Glutamax (Gibco) supplemented with 10% FBS (South American origin, Gibco), penicillin G (10 000 U/ml) and streptomycin sulphate (10 000 μg/ml). CHO cells expressing the CCR5 receptor, CHO-CCR5, were cultivated in the same medium supplemented with geneticin G- 418 sulphate (250 mg/ml).

Construction of the pUClox-Xl 0 library The library pUClox-XlO was constructed into the pUC19-21ox plasmid [Waterhouse P et al.,

1993]. The intron sequence was amplified by PCR with 0.5 μM primer pUClox-XlO encoding for the X,₀ library and oligo-3198 (Table 1) on M13 mICElO plasmid [Fisch I et al., 1996] using Tfl polymerase (0.025 U/μl of PCR, Epicentre). The reaction mixture was cycled 35 times: 30 sec at 95°C, 15 sec at 52°C and 45 sec at 68°C. The resulting PCR fragment was purified using Wizard PCR Preps DNA Purification System (Promega) and digested by restriction enzymes EcøRI and Sfil. The digested DNA was purified from 1% low melting agarose gel using Wizard system and precipitated by ethanol. The PCR insert was then subcloned into the S7I/EcoRI-digested pUC19-21ox plasmid purified using the same protocol. The ligation was performed using the T4 DNA ligase (BioLabs) at 16°C for 20 hours. The ligation mixture was extracted 3 times with PCI. Ligated DNA was precipitated with ethanol at -20°C, resuspended in H₂0 and transformed into E. coli. Table 1

fd-PCR FOR: 5 '-TAGCCCCCTTATTAGCGTTTGCCA-3 ' fd-PCR BACK: 5'-GCGATGGTTGTTGTTGTCATTGTCGGC-3'

fdSeql: 5'-ATTCCTTTAGTTGTTCC-3'

fdSeq3: 5'-ACAGACAGCCCTCATAG-3'

oligo 4445: 5 '-ACTTGGTACTGAACGGC-3 '

oligo 3198:

5 'CAGCGTCACCGGAATTCATACCTTACGAGTACTCCAAAACTAATCAATATA-3 '

pUClox-XlO:

5'-TGTATTACTCGCGGCCCAGCCGGCCATGGCCNNKN KNNKNNKNNKNNK NNKNNKNNKNNKGCTCTCTAAATAGCAATATTTACCTTTGGAG-3'

pelB BACK: 5'-GAAATACCTATTGCCTACG-3'

Table 1. Oligonucleotides used for the construction and characterization of different peptide libraries. N, equimolar mixture of all four bases; K, an equimolar mixture of G and T.

Electroporation

An over-night culture of E. coli TGI was diluted 1:100 in 100 ml 2xTY medium and grown till optical density, OD ₀o is 0.4 to 0.6. After incubation at 4°C for 20 min the bacteria were harvested by centrifugation (4470g, 20 min) and the pellet was resuspended in the same volume of 1 mM Hepes buffer. Similarly, the bacteria were harvested in 1/2 of initial volume of 1 mM Hepes buffer and than in 1/50 of volume of 1 mM Hepes containing 10% of glycerol, and finally in 1/100 of volume of Hepes-glycerol. The bacteria were freezed at -80° C or directly used for electroporation. 40 μl of electrocompetent E. coli were transformed with lμl of ligated DNA. The electroporations were done in 0.2 cm electrocuvettes (BioRad) at 2.5 kV, 200 Ω , 25 μF and with the time constant of about 5 msec. After electroporation, the bacteria were incubated in 2xTY broth for 1 hour at 37°C with agitation and then plated on TYΕ plates supplemented with 1% glucose and corresponding antibiotics. The competency of the bacteria was tested by transforming 2pg of the plasmid pNeb 193 (BioLabs). Phage purification

The bacteria harbouring the fd phage were cultivated in 2xTY broth containing tetracycline at 15 μg/ml, under agitation for 20 hours at 37°C. Phage were purified from the bacterial supernatant by precipitation with polyethylene glycol. 1/5 of the original volume of 20%

PEG6000/2.5 M NaCl was added to the phage supernatant. After 1 hour of incubation at 4°C, phage were harvested by centrifugation (4470g, 30 min) and resuspended in 1/10 of the original volume of PBS and precipitated in 1/5 of the volume of 20% PEG6000/2.5 M NaCl for 30 min. Finally, the phage pellet was resuspended in 1/100 of the original volume of PBS. To get the titre of the phage, E. coli in exponential phase of growing (OD₆₀o 0.4-0.5) were incubated with serial dilutions of phage for 30 min in 37°C water bath (without shaking) and than plated on TYE plates supplemented with 1% glucose and 15 μg/ml tetracycline.

Construction of the Xio-CRl phage library Approximately 2 x 10⁹ E. coli TGI harbouring pACYCaraCre plasmid and pUClox-XlO library plasmid were used to inoculate 100 ml 2xTY broth containing 100 μg/ml ampiciline, 25 μg/ml chloramphenicol, 1% (wt/vol) glucose and 2 g/1 glycerol. After overnight growth at 37°C, the culture was diluted to an OD₆₀₀ of 0.18 into 100 ml 2xTY broth containing 100 μg/ml ampiciline, 25 μg/ml chloramphenicol, 1% (wt/vol) glucose and 2 g/1 glycerol and was grown to an OD₆₀₀ of 0.5. Phage (3 x 10¹⁰ t. u.) expressing the peptide CR1 (fd-CRl) as fusion protein to the pill surface protein were then added and the culture was grown for 15 min at 37°C without shaking. The bacteria were then harvested by centrifugation (2860g, 15 min) to remove the excess of phage and resuspended in 100 ml 2xTY broth containing 100 μg/ml ampiciline, 25 μg/ml chloramphenicol, 15 μg/ml tetracycline, 2 g/1 glycerol and 0.5 g/1 L(+) arabinose (Fluka) and were grown for 24 hours at 30°C. The phage were harvested from the bacterial culture by PEG precipitation as already described. The efficiency of the recombination was checked by PCR screening using oligo-4445 and pelB Back (Table 1).

Sequencing The diversity of the peptide libraries was verified by DNA sequencing. The DNA of individual phage clones was amplified by PCR directly from bacterial colony using Tfl DNA polymerase (0.025 U/μl of PCR, Epicentre) and primers fdPCR FOR and fdPCR BACK (0.5 μM) (Table 1). The PCR cycle was the following: 10 min at 94°C, 30 cycles of 1 min at 94°C, 1 min at 55°C, 1 min at 72°C and 5 min at 65°C. The sequencing reactions were carried out using the Thermo Sequenase DYEnamic Direct cycle sequencing kit with 7-deaza-dGTP* (Amersham Pharmacia Biotech) on the PCR amplified DNA and by adding fluorescent primers fdseq2 or fdSeq3 (Table 1). The sequencing PCR cycle was the following: 5 min at 95°C and 35 cycles of 30 sec at 95°C, 15 sec at 52°C, 45 sec at 68°C. Sequencing reactions were analysed on DNA Sequencer Li-Cor 4200 (MWG-Biotech) and sequence analysis was performed using MacVector (Accelrys) and ClustalW (ch.embnet.org).

Selection of first generation peptide Prior to the selection on CHO-CCR5 cells three rounds of negative selection on CHO wt cells were performed. 10⁶ CHO wt cells were incubated 30 min with the phage library (10¹⁰ to 10¹¹ t.u. input phage). The cells were recovered by centrifugation (140g, 10 min) and the phage supernatant was used for following absorption on CHO wt cells. After the last selection on CHO wt the phage supernatant was added to 10⁶ CHO-CCR5 cells and incubated for 1.5 hour at room temperature (RT). Unbound phage were removed by washing the cells 5 times with PBS-2% BSA and 3 times with PBS. Bound phage were eluted with 100 nM n-Nonyl RANTES (2-68) (NNY-RANTES, Gryphon Sciences) during 30 min at RT and recovered by centrifugation (140g, 10 min). The cells were washed 5 times with PBS and resuspended in 0.6 ml of PBS. Remaining phage were eluted by adding 0.6 ml of 200 mM triethylamine (TEA), pH 12.0 for 20 min. Phage were immediately neutralised by adding an equal volume of 1 M Tris/HCl, pH 7.4. Phage eluted either with NNY-RANTES or TEA were used to infect 10 ml of exponentially growing E. coli TGI (OD₆₀₀ of 0.4 to 0.5) for 30 min at 37°C. Infected bacteria were plated on Nunc Bio-Assay dish (Gibco BRL) of TYE supplemented with 1% (wt/vol) glucose and 15 μg/ml tetracycline. After overnight growth at 37°C, the bacteria were harvested and used as an innoculum for 200 ml 2xTY broth containing 1% (wt/vol) glucose and 15 μg/ml tetracycline. The culture was grown for 30 hours at 30°C and produced phage were harvested by precipitation with polyethylene glycol as already described and used for further rounds of selection. The sequences of individuals phage clones from different selection rounds were determined by sequencing.

Selection of second generation peptide The selection of the second generation of peptides was done in two steps. First, 10⁶ CHO- CCR5 cells were incubated during 30 second with recombined phage library X_]0-CR1 (10¹⁰ t.u.) in cell culture medium supplemented with 1% BSA. Unbound phage were immediately removed by centrifugation (170g, 10 min). The cells were resuspended in the cell culture medium/ 1% BSA containing 100 pM NNY-RANTES (Gryphon Sciences) and incubated for 30 second. Eluted phage were removed by centrifugation (170g, 10 min). The remaining phage were eluted with 500 μl of 200 mM TEA, pH 12.0 and neutralised with an equal volume of 1 M Tris/HCl, pH 7.4. Phage were amplified and purified as already described and used for further rounds of selection. Second, TEA-eluted phage from the third and fourth round of selection were incubated with 10⁶ CHO-CCR5 cells for 5 minutes at 4°C. The unbound phage were removed by centrifugation (170g, 10 min) and bound phage were eluted with 1 μM NNY- RANTES (Gryphon Sciences) during 5 minutes. Amplification and purification of eluted phage was done as described above. The sequences of individuals phage clones from different selection rounds were determined by sequencing as already described.

Chemical synthesis of isolated peptides

The peptide were synthesised using solid phase Fmoc chemistry with free N-termini on AMS 422 Multiple Peptide Synthesiser (Abimed). After synthesis, the peptides were dried on air for about one day. The peptides were cleaved from the resin with a mixture of 94% TFA, 2.5 % H₂0, 2.5% EDT and 1% TES if the peptide contained cystein or methionin or with a mixture of 95% TFA, 2.5% H₂0 and 2.5% TES, otherwise. The cleavage was carried out for 2 hours by stirring vigorously the solution. The peptides were precipitated with frozen ether. After centrifugation, the peptides were resuspended in 50% acetic acid and lyophilised. The peptides were purified by reverse phase HPLC on Beckman Gradient Liquid Chromatograph 334 with column VP 250/10 Nucleosil 300-5 C₈ (Macherey-Nagel) or on HPLC with column Chromolith Performance RP-18e (Merck). The sequences of purified peptides were confirmed by mass spectrometry analysis (ESI-MS).

Competition binding assay The assay was carried out as described in [Hartley, O., et al (2003). Human immunodeficiency virus type 1 entry inhibitors selected on living cells from a library of phage chemokines. J Virol 77(12): 6637-6644]. 20 000-25 000 CHO-CCR5 cells were incubated overnight at 37°C in a 24-well plate coated with 10 μg/well poly-L-ornithine (Sigma). The binding assay was performed at 4°C by adding 14 pM ¹²⁵I-Mip-lβ (Amersham) or ¹²⁵I- RANTES (Amersham) and variable amounts of unlabeled peptides. After overnight culture, the cells were washed with cold binding buffer (0.5% BSA, 50 mM Hepes, 5 mM CaCl₂, 1 mM MgCl₂, pH 7.7) and incubated in the presence of the radioactive ligand and various concentrations of peptides during 3 hours at 4°C. The cells were washed with cold washing buffer (binding buffer, 0.5 M NaCl) and lysed with lysis buffer (8 mM urea, 3 mM HAc, 2% NP 40). The radioactivity of the lysate was counted with a Beckman Gamma 4000 scintillation counter. Experiments were performed in quadruplicate and 50% inhibitory concentration (IC₅₀) was derived from monophasic curves (one-site competition binding) fitted with Prism software (GraphPad).

Cell fusion assay

The viral envelope-mediated cell fusion assay was carried out as already described in [Hartley

O et al., 2003] with HeLa-p4-CCR5 (CMU, Geneva) and HeLa-Env-ADA (CMU, Geneva) cell lines. HeLa-p4-CCR5 were seeded in a 96-well plate (10⁴ cells/well). After overnight incubation at 37°C, the medium was removed and replaced with medium containing 10⁴ Hela- Env-ADA cells per well and peptides at different concentrations. After overnight incubation, the cells were washed with PBS and lysed with NP-40. The β-galactosidase activity was detected by addition of colori genie substrate CPRG (Bόringer). Experiments were performed in triplicate and dose-inhibition curves were fitted by using Prism software (GraphPad).

Calcium mobilization assay

10⁶ CHO-CCR5 cells were resuspended in 1 ml of Ca buffer (salt solution 5x (NaCl 715 mM,

KC1 30 mM, MgSO₄ 5 mM), HEPES IM, glucose 40%, sulfinpyrazone, CaCl₂ lrnM, pH 7.4) supplemented with 1% BSA and were loaded with 5 μl of a 1:1 mix of Fura-2-AM (Molecular Probes) and pluronic acid 10% (Sigma) during 45 min in dark at RT. After incubation, 1.5 ml of Ca buffer was added and the mixture was incubated for 15 min. 800 μl of cells (about 3 x 10⁶) were centrifuged 2 min at 2000 rpm and resuspended in 2.4 ml of 37°C warmed Ca²⁺ buffer and transferred to a fluorimeter cuvette. The changes in cytosolic free intracellular Ca²⁺ concentration ([Ca²⁺] were recorded after stimulation with peptide at different concentrations, followed 2 min later by stimulation with 100 nM RANTES. The fluorescence was measured at 505 nm (λ emission) and 340 nm (λ excitation). The Ca²⁺ assay that was performed for the recombined peptide was done following this protocol. The CHO-CCR5 cells were incubated in 96-well plate coated with poly-L-lysine. The medium was aspirated off and replaced with 100 μl of Ca loading buffer to which a 1:1 mix of Fluo-4 AM (Molecular Probes) and pluronic acid 10% (Sigma) was added. The cells were loaded for 1 hour in the dark. After incubation, the loading buffer is aspirated and replaced with the Ca buffer. The variation in cytosolic free intracellular Ca concentration is measured in a FLEX station. The ligands at different concentrations (diluted in Ca buffer) are added after 15 sec of baseline.

Downmodulation assay

CHO-CCR5 cells were incubated overnight at 37°C in a 24- well plate coated with 10 μg/well poly-L-ornithine (Sigma). The cell medium was aspirated off before addition of ligands at different concentrations. The plate was incubated for 1 hour at 37°C to allow internalization. The ligand solution was through out and the cells were fixed with 4% PFA at RT for 10 min. After washing 2 times with PBS for 5 min, the FACS buffer (BSA 1% (p/v), NaN₃ 0.05% in PBS) containing the anti-CCR5 3A9-PE antibody (Pharmingen), diluted 25x, was added to the cells and the plate was incubated for 1 hour on ice. The cells were washed 3 times with the FACS buffer for 1 to 2 min and the fluorescence was measured at 510 and 575 nm in a FLEX station.

Example 2:

Selection of phage-displayed peptide library First generation peptide. Applicants strategy emphasized that a natural ligand could serve as a competitor with phage-displayed peptide for binding to the receptor and thus for a selection of receptor binding peptides. Since NNY-RANTES binds specifically to the CCR5 receptor with a high affinity (EC₅₀ in the nM range), it is expected to compete with peptides of the phage population that bind either to the same binding site or to adjacent sites, due to the steric hindrance.

A phage library displaying the peptide library CDX₃KPCALLRYXι₀ as N-terminal fusion to the pill phage capside protein was constructed. The complexity of this library was 1.0 x 10⁹ different clones with about 70% of phage containing the whole library. This peptide library was selected on CHO cells stably expressing the CCR5 receptor. For a successful cell-surface selection, it has been demonstrated that pre-incubations of the phage library with mock transfected cells [Miescher S et al., 1998] decreases the background of phage binding to the cell and favours the selection towards the cell-surface target receptor. Here, the phage library was preselected on wild-type CHO cell line before being selected on CHO-CCR5 cells. The elution of CHO-CCR5 bound phage was done by competition with the analogue of the CCR5 natural ligand, n-nonanoyl-RANTES (NNY-RANTES) at 100 nM. For each round of selection on CHO-CCR5 cells, an enrichment expressed as the ratio phage output/input was observed. The enrichment factor calculated was 100 suggesting that the panning was effective (Fig. 1 A). Twenty single phage clones from round 4, eluted with NNY-RANTES were sequenced. The sequences showed that all phage clones displayed a unique 15-mer peptide sequence ALLRYNPFYYLSFSP. This peptide contains the 10 amino acids exon-2 sequence with the 5 amino acids (ALLRY) spacer sequence.

Design of novel recombined peptide library. In vitro evolution might allow the increase of binding affinity and biological activity of the selected peptide. The exon shuffling method [Fisch I et al., 1996] was used for the construction of a new peptide library based on the sequence of peptide CRl, with ten amino acids random library on the N-terminus: Xio-CRl. After recombination between the plasmid coding the novel ten amino acids library and the phage vector harbouring the peptide CRl by the Cre recombinase enzyme, the size of the novel recombined library Xι₀-CR1 was 1 x 10⁹ different clones. About 44% of phage clones were recombined as determined by PCR screening (data not shown). Eight sequences of exon- 1 and exon-2 peptides were analysed by sequencing (Table 2) and were shown to be different.

Table 2 1 . T G R T V L E E R T A L L R Y N P F Y Y L S F S P 2 . N W R S D T G R N V A L L R Y N P F Y Y L S F S P 3 . I H T N K A S R A G A L L R Y N P F Y Y L S F S P 4 . C A H T D C S W R Y A L L R Y N P F Y Y L S F S P 5 . V N H I G V Y G A R A L L R Y N P F Y Y L S F S P 6 . G V V L S V G W L Y A L L R Y N P F Y Y L S F S P 7 . C M L R I L G P L Y A L L R Y N P F Y Y L S F S P 8 . G V K M D T A S W V A L L R Y N P F Y Y L S F S P

Table 2. Peptide sequences of 8 individual phage clones of the peptide library Xι₀-CR1. The sequence encoded by exon-1 is in bold, whereas the sequence of peptide CRl is underlined. The amino acids are denoted in single letter code.

Second generation peptide library. Preliminary results have shown that the selection of the novel peptide library on the CHO-CCR5 cells under the same conditions have led to the isolation of non-recombined peptides harbouring only the sequence CRl (also named SEQ ID N°l) (data not shown). To increase the selection pressure the conditions were modified according to the kinetic of the binding ligand-receptor. Without negative selection on mock cells, the phage library Xio-CRl was incubated with CHO-CCR5 cells and phage with high off-rate were washed out by competition with NNY-RANTES at 100 pM (Fig. IB). Phages were then eluted by TEA and used for further three rounds of selection (selection A). To isolate peptide with higher affinity for the CCR5 receptor, the phage population of round 3 and 4 were used for further panning on CHO-CCR5 (selection B) where specific phage were eluted by addition of NNY-RANTES at high concentration (1 μM). An enrichment in eluted phage (output/input phage) was observed during the selection using elution by TEA (Fig. IC) as well as for the selections with elution by NNY-RANTES 1 μM (Fig. 1 D). Individual phage clones from this dual selection procedure were sequenced. A single peptide sequence, LLDSTFFTADALLRYNPFYYLSFSP (Sequence SEQ ID° 7), named peptide CR2, was identified in 94% and 81% of sequenced phage clones from round 4 (Table 3). Table 3

Table 3. Peptide sequences of individual phage clones from the library XlO-CRl selected on CHO-CCR5 cells. Four rounds of selection were done with elution by TEA. The round three (A) and four (B) of this selection were then used for further four rounds of panning by using elution with 1 μM NNY-RANTES. The sequences of exon-1 (left column) and of exon-2 (right column) are presented without the spacer sequence ALLRY. The frequency of the sequences is indicated. The amino acids are denoted in single letter code.

Characterization of synthetic peptides

Binding affinity. To determine the binding affinity of the selected peptides, a competition binding assay was performed using the MIP-1 β labelled with ¹²⁵I (Fig. 2A) or RANTES-¹²⁵I (Fig. 2B) as the tracer. At the concentrations used, any binding activity of the peptide CRl (NPFYYLSFSP) or CRl -lin (ALLRYNPFYYLSFSP) could be detected (Fig. 2 A). At the highest concentration of the peptides a competition with the tracer was observed. However, the lack of other experimental points could not confirm whether this is due to the real biological activity of the peptide or it is an experimental artefact. As a positive control, the chemokine analogue NNY-RANTES, inhibited binding of iodinated MIP-1 β with an IC ₀ of 1.3 nM. The control peptide did not show any binding activity at the concentrations used in this experiment.

The binding of RANTES- ¹²⁵I to CCR5 cells was almost completely inhibited by the peptide CR2 at 100 μM (Fig. 2B), the highest concentration used. In the absence of experimental values for higher concentration of CR2 and hence of the plateau, the IC₅₀ value could not be calculated. However, it can be estimated to be about 50 μM. No inhibitory activity was detected for lower concentrations of the peptide. The control peptide did not show any binding activity for CCR5 receptor. 100% of inhibition is shown by the CCR5 natural ligand, RANTES, at concentration of 320 nM.

Inhibition of cell fusion. The anti-HIV activity of the selected peptides was measured in an R5 -tropic envelope-mediated cell fusion assay. As for the binding assay, the solubility problem does not allow the use of very high concentrations of peptides to reach the plateau. The peptide CRl as well as the peptide CRl -lin did not shown any biological function (Fig. 3A). At the highest concentration, the peptides inhibited the cell fusion, however, this could be also due to the presence of DMSO in the samples. The control peptide did not presented any activity at the concentrations used for the experiment. The positive controls, AOP- RANTES and NNY-RANTES inhibited cell fusion, with IC₅₀ of 8 nM and 0.3 nM, respectively.

Further experiments with the second generation peptide, CR2, showed that this peptide efficiently inhibited the cell fusion and prevented the formation of syncytia (Fig. 3B). Its IC₅₀ was calculated to be ranging from 4.96 μM to 8.55 μM. The peptide CRl, as well as the peptide CR3 (LLDSTFFTAD, SEQ ID N° 6), the N-terminal part of the peptide CR2, did not showed any inhibitory activity in this assay. The buffer alone showed no biological activity (Fig. 3B, line DMSO).

Agonist/antagonist activity. The use of natural ligands of CCR5 as anti-HIV agents is compromised by the presence of side effects due to their agonistic activities. Binding of the ligand to the CCR5 receptor leads to the activation of intracellular pathways and among them to the liberation of calcium ions from the endoplasmic reticulum. Therefore, one way to detect the agonist or antagonist activity of a ligand is the measure of the concentration of intracellular calcium after ligand binding.

The addition of peptide CRl -lin at the concentration of 10 μM (Fig. 4 A) or peptide CRl, CR2 and Cr3 at various concentrations (Fig. 4B) to the CHO-CCR5 cells did not increase the intracellular concentration of Ca²⁺ ions. When NNY-RANTES at the concentration of 3 μM (Fig. 4A) or RANTES at the concentration of 10 nM (Fig. 4B) were added subsequently, the cells responded to this activation as shown by an increased fluorescence. No change in the concentration of intracellular Ca²⁺ was observed as response to the control peptides, or the vehicle. The pick of fluorescence due to the addition of RANTES is of the same height when the cells were treated before with the peptides. This means that the receptor was not desensitised by the peptide binding as it is the case with the natural ligand RANTES. These results suggest that the peptides CRl, CR2 or CR3 are neither agonists nor antagonists of the CCR5 receptor. Binding of these peptides to the CCR5 receptor would not block the pathway of inflammation, which needs to be activated for an immune response against other pathogens.

Down-modulation assay. Upon binding, natural ligands of the CCR5 receptor activate the receptor and hence the intracellular signalling pathways. They induce also the internalization of the receptor into the cytoplasm. Therefore, the ability of the peptide CR2 to induce the intemalisation of the CCR5 receptor was tested in the down-modulation assay. The expression of CCR5 on the surface of CHO cells was measured by fluorescence analysis using the CCR5-specific mAb 3A9. The assay (Fig. 5) have shown that the peptide CR2 was not able to induce the intemalisation of the CCR5 receptor. Likewise, the control peptide did not induce the down-modulation of the receptor. The N-terminal analogues of RANTES, Met-RANTES and AOP-RANTES, achieved 30% and 70%, respectively, of down-modulation of the CCR5 receptor.

Peptides. The following table 4 summarizes the sequences of the different peptides of the invention, which are able to specifically bind a chemokine receptor.

Table 4

Table 4. X is an amino acid residue and HD represents a linker domain.

While the invention has been illustrated by reference to specific and preferred embodiments, those skilled in the art will recognize that variations and modifications may be made through routine experimentation and practice of the invention. Thus, the invention is intended not to be limited by the foregoing description, but to be defined by the appended claims and their equivalents.

Claims

1. A peptide able to specifically bind a chemokine receptor consisting essentially in the sequences: a) NPFYYLSFSP (SEQ ID N° 1), or b) LLXXXFFXXX (SEQ ID N° 2), a part thereof, a combination thereof and/or variants, and wherein X is an amino acid residue.

2. The peptide of claim 1, characterized in that the combination of SEQ ID N° 1 and SEQ ID N° 2 consists in: a) NPFYYLSFSP-HD-LLXXXFFXXX (SEQ ID N° 3), or b) LLXXXFFXXX-HD-NPFYYLSFSP (SEQ ID N° 4), wherein HD is a linker domain .

3. The peptide of claim 2, characterized in that the hinge domain consists essentially in the peptidic sequence ALLRY.

4. The peptide of claims 1 to 3, characterized in that the combination consists essentially in the sequence LLXXXFFXXXALLRYNPFYYLSFSP (SEQ ID N°5).

5. The peptide of claim 1 , characterized in that a variant of LLXXXFFXXX consists essentially in the sequence LLDSTFFTAD (SEQ ID N°6).

6. The peptide of claim 4, essentially consisting in the sequence LLDSTFFTADALLRYNPFYYLSFSP (SEQ ID N°7).

7. The peptide of claims 1 to 6, characterized in that the chemokine receptor is the human chemokine receptor 5 (CCR5).

8. An isolated and purified nucleic acid sequence comprising a nucleotide sequence encoding the peptide of claims 1 to 7.

9. An expression vector comprising at least one copy of the isolated and purified nucleic acid sequence of claim 8.

10. A pharmaceutical composition comprising as an active substance a pharmaceutically effective amount of at least one peptide of claims 1-7 optionally in combination with pharmaceutically acceptable carriers, diluents and adjuvants.

11. The pharmaceutical composition of claim 10 for the treatment or prevention of a disease associated with the expression of the human CCR5 chemokine receptor.

12. Use of the pharmaceutical composition of claim 11, for the preparation of a medicament for the treatment or prevention of a disease associated with the expression of the human CCR5 chemokine receptor.

13. The use according to claim 12, characterized in that said disease is selected from the group comprising tumors, Crohn's disease, rheumatoid arthritis, asthma, multiple sclerosis and AIDS.

14. A method for decreasing the infectability of a cell that expresses a human CCR5 chemokine receptor for a retrovirus that uses the human CCR5 chemokine receptor as a coreceptor, comprising contacting the cell with an effective amount of the peptide of claims 1 to 7, or with the pharmaceutical composition of claims 10 and 11, in order to decrease expression of the human CCR5 chemokine receptor.

15. The method of claim 14, characterized in that the retrovims is the HTV vims.

16. A method for decreasing the infectability of a cell that expresses a human CCR5 chemokine receptor for a retrovims that uses the human CCR5 chemokine receptor as a coreceptor, comprising contacting the cell with an effective amount of a peptide of claims 1 to 7, or with the pharmaceutical composition of claims 10 and 11, in order to inhibit the interaction of a retrovims with the human CCR5 chemokine receptor.

17. The method of claim 16, characterized in that the retrovirus is the HTV vims.