WO2005053750A1

WO2005053750A1 - Inducible nucleic acid expression system

Info

Publication number: WO2005053750A1
Application number: PCT/GB2004/050031
Authority: WO
Inventors: Irene Gascón ESCOBAR
Original assignee: Genomica S.A.U.; Williams, Gareth Owen
Priority date: 2003-11-27
Filing date: 2004-11-29
Publication date: 2005-06-16
Also published as: GB0327585D0

Abstract

Nucleic acid constructs are described for providing an inducible siRNA expression system, to allow selective expression of siRNA sequences in a transgenic host. The invention permits conditional knockout or knock-down of a particular gene.

Description

In υcible nucleic acid expression system

FIELD OF THE INVENTION The present invention relates to an inducible nucleic acid system for use in selective down regulation of gene expression in cells and organisms. In particular, but not exclusively, the invention relates to an inducible siRNA (short interfering RNA) expression system.

BACKGROUND OF THE INVENTION

In 1998, Fire et al found that injection of double-stranded RNA into Caenorh hdiiis elegans led to an efficient sequence-specific gene silencing, which is referred to as RNA interference (RNAi) (Fire et al 1998). The RNAi phenomenon was recapitulated in Drosophila melartogaster embryo extracts, in which it was shown that long double stranded RNA (dsRNA) substrates could be cleaved into short interfering dsRNA species (siRJSIA) of 22 nucleotides, and that the introduction of chemically synthesized 21-nt and 22-nt siRNA to these extracts facilitated the degradation of the homologous RNA. These findings provided a new tool for studying gene function. Inference of gene expression by small interfering RNA is now recognized as a naturally occurring biological strategy for silencing alleles during the development in plants, invertebrates and vertebrates (Xia et al) . Gene targeting by homologous recombination is commonly used to determine gene function in mammals, but this is a costly and time-consuming process, Alternatively, the functions of many genes can be detemiined after mRLNA inhibition with ribozyme or antisense technologies. Although successful in some situations these tecl nologies have been difficult to apply universally. The advent of siRNA-directed "knockdown" has sparked a revolution in somatic cell genetics, allowing the inexpensive and rapid analysis of gene functions in mammals. Although the initial studies using this technology were done using direct transfection of double stranded RLNA, more recent publications have featured plasmads that stably express functional siRNA in mammalian cells (Sui et al 2002; Lee et al 2002, Paul et al 2002, Paddison et al 2002 and Brummelkamp et al 2002). Using RNAi vectors, transfected cells express both the siRNA and an antibiotic resistance gene allowing the selection of a homogeneous ceil population having knocked down the expression of a specific gene. The most convenient systems for expressing siRNA in cells take advantage of RNA polymerase III promoters, such as U6 and HI promoters. These promoters are commonly used for hi vivo transcription of siRNA, since pol III transcription is terminated by a stretch of four or five thymidines and this termination is important in avoiding a non-specific reaction with another endogenous or exogenous sequence. The plasmid vector system for siRNA has several advantages. First, it is a less expensive system since there is no need for continuous transfection of double stranded RNAi to achieve gene expression blockade. Second, the system is more efficient, since intracellular availability of siRNA does not depend on a single transfection experiment but on the transcription levels of a stably expressed vector. And third, theoretically, it could be possible to design inducible transcription systems for siRNA expression, based on the combination of pol III promoters and conditional DNA response elements (RE). Expression systems in which the expression of genes is induced by agents introduced from outside of cell, such as hormones, antibiotic, or heavy metals as well as by heat shock, have been well known in the art and traditionally applied to study gene expression in mammalian cells. Ohkawa and Taira have recently described the development of a pol III based plasmid conditional expression system. The system is based on the regulation of gene expression after the insertion of the bacterial tetracycline operon sequence into the U6 promoter. Myslinski et al identified in more detail the human HI promoter elements, they introduced a series of clustered mutations between positions -95 and -1 in the 5'- flanlcing region, showing that change in the sequence between -24 to -1 position had not effect in the HI RNA transcription in vitro. We have introduced the bacterial tetracycline operon sequence in this promoter position (-24 to -1) changing the wild type sequence to the bacterial tetracycline operon sequence and in two new position: In first nucleotide of HI promoter in -100 position and between to staff bind site and the proximal sequence element PSE (exactly in -70 position). SUMMARY OF THE INVENTION

According to a first aspect of the present invention, there is provided an isolated DNA sequence comprising a selectively inducible RNA polymerase promoter, and a sequence coding for an RNA sequence complementary to at least a portion of a selected mRNA sequence. Thus, the RNA sequence can be selectively expressed on induction of the promoter, to generate an antisense RNA sequence, thereby allowing RNA interference to take place. The RNA sequence is preferably an siRNA sequence. The RNA sequence may be from 19 to 24 nucleotides in length, preferably from 20 to 23 nt, and more preferably from 21 to 22 nt. The RNA sequence is preferably fully complementary to a portion of an mRNA sequence of the same length as the RNA sequence. The selection and design of appropriate siRNA sequences will be possible for those of skill in the art; many tools and utilities exist to assist in the design of such sequences. The DNA sequence preferably comprises a conditional response element (RE).

The RE is preferably responsive to an antibiotic; for example, tetracycline. Other antibiotic response elements may of course be used. Alternatively, the RE may be responsive to hormones, heavy metals, heat shock, and the like. Suitable REs will be lcnown to those skilled in the art. The RNA polymerase promoter is preferably an RNA polymerase III promoter; preferably HI or U6 promoter. Preferably the RE is located within the RNA polymerase promoter. Preferably the RE is located within an HI promoter; in this embodiment, the RE may be located between nt -24 and -1, before the first nt at position -100, or between the staff binding site and the PSE at position -70 of the HI promoter. The mRNA may be an endogenous gene, or may be exogenous. According to a further aspect of the invention, there is provided a vector comprising a DNA sequence comprising a selectively inducible RNA polymerase promoter, and a sequence coding for an RNA sequence complementary to at least a portion of a selected mRNA sequence. Further aspects of the invention provide eukaryotic cells containing the vector; and plants and animals transformed with the vector. The animals are preferably mammals, and conveniently may be mouse or human. According to a further aspect of the present invention, there is provided a method of down regulating gene expression in a cell, the method comprising exposing the cell to a substance which induces an exogenous RNA polymerase promoter to promote expression of an exogenous RNA sequence complementary to at least a portion of a selected mRNA sequence. The method may further comprise the step of introducing to the cell an exogenous DNA sequence comprising a selectively inducible RNA polymerase promoter, and a sequence coding for an RNA sequence complementary to at least a portion of a selected mRNA sequence. The mRNA sequence is preferably endogenous to the cell, but may be exogenous. Also provided by the present invention is a method of down regulating gene expression in an organism, the method comprising exposing the organism to a substance which induces an exogenous RNA polymerase promoter to promote expression of an exogenous RNA sequence complementary to at least a portion of a selected mRNA sequence. The organism is preferably an animal, preferably a mammal, and may be a mouse or a human animal. BRIEF DESCRIPTION OF THE DRAWINGS

These and other aspects of the invention will now be described by way of example only and without limitation, with reference to the accompanying drawings, which show: Figure 1. Region of the HI promoter where the Tetracycline Response Element was inserted (Insert 1 and 2) or swapped (Insert 3). Figure 2, Schematic representation of an experimental model used to test the inducible RNAi system. SW480 cells were transfected with a CMV-GFP vector and a clone with stable genome integration of both constructs (SW480G12) was selected. The SW480G12 clone was further transfected with an inducible RNAi vector (with Pol III driven expression through the HI promoter with the inserts in figure 1) expressing an siRNA specifically designed for GFP mRNA destruction. The result of the latter transfection was inhibition of GFP expression and thus loss of the green phenotype. Figure 3. The loss of the GFP phenotype in figure 2 was further reversed to a wildtype GFP phenotype by transfectmg a CMV-TetR vector. This construct drives the expression of the tet transact! vator that upon binding to the TetRE blocks the expression of the siRNA-GFP, therefore permitting the transcription of the GFP gene and the expression of the GFP protein. Figure 4. The addition of doxicyclin (1 μg/ml) to the cell culture results in the release of the TetR protein from the tetRE, leading to the transcription of the siRNA- GFP and to the destruction of the GFP mRNA through an RNAi mechanism, The final result is a loss of GFP phenotype.

DETAILED DESCRIPTION OF THE DRAWINGS

DESCRIPTION OF AN INDUCIBLE RNAi EXPRESSION SYSTEM A conditional/inducible RNAi expression system has an obvious advantageous application in the inhibition of so called house keeping genes, or in the inhibition of those genes required for cell survival or proliferation. Permanent inhibition of the expression of any of those genes, as occurs with the stable expression of non- conditional RNAi vectors, would lead to absence of cell growth or, directly, to cell death. This would make impossible the selection of stable transfectants and, therefore, the conditional study of the acute effect of blocking the expression of a single gene. iRNAi systems, as the one we describe here, circumvents this potential problem. After selection of a cell line stably expressing a plasmid containing an RNAi against a cellular gene, that RNAi will be kept silent until the addition of tetracycline. Then and only then will the siRNA be expressed, inhibiting the expression of the target gene. To obtain an siRNA-inducible vector we introduced a sequence of tetracycline- repressor-operator system that is part of the tetracycline-resistance operon. This DNA element is encoded by transposon 10 of Escherichia colt (Hillen et al 1984). After transfection and stable genomic integration of such a tetracycline inducible siRNA vector, the expression of siRNA is repressed in the absence of tetracycline and induced in the presence, this method allows for Iiighly controllable approach to gene knockdown. An application of our technology is the generation of in vivo inducible systems. For instance, traditional tetracycline inducible promoters have been widely used to condition the expression of single genes in the mouse. This type of system allows study of the in vivo consequences of expressing a single gene at a given time duiing mouse development. It also permits the study of the effects of expressing a gene in a tissue specific fashion.

MATERIALS AND METHODS Construction of modified ρUC19 vector. pUC19 with HygR, XJ6 promoter and siRNA GFP obtained in the lab.

Construction of inducible U6 vector The tetracycline-inducibie U6 promoter were constntcted by PCR with genomic

DNA as the template. The primers used were:

Sense 5 '-TTGCTCGGATCCTCTTTCCTGCGTTATC-3 '

Antisense posilion-1 S'-GCGCGGGATCCCGCGTCCTTTCCACAAGATATATAAC TCTATCAATGATAGAGTACTTTCAAGTTACGGTAAGCATATG-3' and

Antisense position-2 5'-TGCGTTCCTGTAGATAACCGTTTCTCTATCACTGATAG

GG AGATATAT AAAGCC AAGAAATCG A-3 ' . The conditions for amplification were 96°C 1 min, 55°C 1 min and 72°C 1 min and 30 cycle. The PCR product was purified using a Qiagen kit and ligated into the TOPO TA cloning (Invitrogen) according to the manufacture's protocol and the sequence was confirmed by sequence analysis. The plasmids were digested with BamHI and the cassette was cloned into the BamHI site in the modified pUC19. The resulting plasmid, which contains the Tet inducible U6 promoter, was designated pURI.

Construction of inducible HI vector The tetracycline-inducibie HI promoters were constructed by PCR using modified pUC19 3.5-H1 ygro with GFP siRNA as the template. We had developed 3 different constructs (generically called pHRI): 1. Construction of the pHRI-1 plasmid. Insertion of bacterial tetracycline RE (5'-TCCCTATCAGTGATAGAGA-3') immediately before the first nucleotide of HI promoter (-100 position). To this end, we amplified a PCR product about 1080 bp that contain the promoter region using the following primers: Sense 5'-GCGGATCAGATCCGAAAATGGAT-3' and Antisense 5'-GCGGGATCCGAGTGGTCTCATAC-3\ The PCR conditions (ProgramA) were 96 °C 1 min, 58°C 1 min and 72°C 2 min to 4 cycles and 96 °C 1 min, 54°C 1 min and 72°C 2 min to 30 cycles. The PCR product was purified using a Qiagen kit and used as template in a nester PCR. In the nester PCR we amplified the promoter region around the insertion point with two independent PCR. The nester primers were: Sensβ-1 5'-GCGGATCAGATCCGAAAATGGAT-3' and Antisense-1 5 'TCTCTATCACTGATAGGGAAATTCACTGGCCGTCGTT-3 ' Sense-2 5'-TCCCTATCAGTGATAGAGACATATTTGCATGTCGCTATG-3' Antisense-2 5'-GCGGGATCCGAGTGGTCTCATAC-3 ' . Sense-1 and Antisense-2 are complementary to Hi promoter sequences while Sense-2 and Antisense-1, in addition to HI sequences contain a sequence tail a TeT element. The primers were used to insert the Tet element in the native HI sequence. To this end, we followed a variation of the four oligo PCR protocol as known in the art, The PCR conditions were 96 °C 1 min, 56°C 1 min and 72°C 2 min to 40 cycles. The two RCR products (upstream and downstream filling fragments) were purified from 1.5 % Agarose gels, mixed at the same concentration and submitted to a filling step with the following conditions: 94 °C 1 min, 56°C 1 min and 72 °C 1 min during 10 cycles. The resulting unique DNA fragment containing a Tet element insertion was amplified with PCR program A in the presence of primer sense-1 and antisense-2.

2. Construction of the pHRI-2 plasmid. Insertion of bacterial tetracycline operon sequence between the staffb άmg site and PSE in -70 position. The same PCR product about 1080 bp that contain the promoter region was obtained as describe above. In nester PCR we applied primers: Sense-1 5'-GCGGATCAGATCCGAAAATGGAT-3' Antisense-1 5 '-TCTCTATCACTGATAGGGACATGCAAATATGAATTCAC TG-3 ' Sense-2 S'-TCCCTATCAGTGATAGAGATCGCTATGTGTTCTGGGAAAT C-3' Antisense-2 5'-GCGGGATCCGAGTGGTCTCATAC-3'. The PCR conditions were 96 °C 1 min, 56°C 1 min and 72°C 2 min to 40 cycles (PCR program B). The two PCR products (upstream and downstream filling fragments) were purified from 1.5 % Agarose gels, mixed at the same concentration and submitted to a filling step with the following conditions: 94 °C 1 min, 56°C 1 min and 72 °C 1 min during 10 cycles. The resulting unique DNA fragment containing a Tet element insertion was amplified with PCR program B in the presence of primer sense-1 and antisense-2. 3. Construction øfthepHRI-3 plasmid. Modification of HI promoter sequence from -24 to -1. pHRI-3 is not an insertion (as pHRI-1 and 2 are) but a sequence swapping. The following primers were used: Sense primer 5'-GCGGATCCGATCCGAAAATGGAT-3' Antisense primer 5' CGCGGATCCGATCTCTATCACTGATAGGGACTTA TAAGATTCCCAAATCC 3'. The conditions for amplification were 96°C 1 min, 55°C 1 min and 72°C 1 min and 30 cycle. All of PCR products were purified using a Qiagen kit and ligated into the TOPO TA cloning (Invitrogen) according to the manufacture's protocol. The TOPO TA plasmids, containing three HI promoter modifications, were digested with BamHI and the cassette was cloned into the BamHI site in the modified pUC19 3.5 Hl-GFP.

REFERENCES

Brummelkamp TR, Bernards R, Agami R. Stable suppression of tumorigenicity by virus-mediated RNA interference. Cancer Cell. 2002 Sep;2(3):243-7.

Fire A, Xu S, Montgomery MIC, Kostas SA, Driver SE, Melio CC. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 1998 Feb 19;391(6669):806-11.

Hillen W, Schollmeier K, Gatz C. Control of expression of the TnlO-encoded tetracycline resistance operon. II. Interaction of RNA polymerase and TET repressor with the tet operon regulatory region. J Mol BioL 1984 Jan 15;172(2):1S5-201. Lee NS, Dohjima T, Bauer G, Li H, Li MJ, Ehsani A, Salvaterra P, Rossi J, Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells. Nat Biotechnol. 2002 May;20(5):500-5.

Myslinski E, Ame JC, Krol A, Carbon P. An unusually compact external promoter for RNA polymerase III transcription of the human HIRNA gene. Nucleic Acids Res. 2001 Jun 15;29(12):2502-9.

Oh awa J, Taira K. Control of the functional activity of an antisense RNA by a tetracycline-responsive derivative of the human U6 snRNA promoter. Hum Gene Ther.2000 Mar 1 ; 11 (4):577-85.

Paddison PJ, Caudy AA, Harmon GJ. Stable suppression of gene expression by RNAi in mammalian cells. Proc Natl Acad Sci U S A. 2002 Feb 5;99(3): 1443-8. Epub 2002 Jan 29.

Paul CP, Good PD, Winer I, Engelke DR. Effective expression of small interfering RNA in human cells. Nat Biotechnol. 2002 May;20(5):505-8.

Sui G, Soohoo C, Affar el B, Gay F, Shi Y, Forrester WC, Shi Y. A DNA vector- based RNAi technology to suppress gene expression in mammalian cells. Proc Natl Acad Sci U S A. 2002 Apr 16;99(8):5515-20.

Xia H, Mao Q, Paulson HL, Davidson BL. siRNA-mediated gene silencing in vitro and in vivo. Nat Biotechnol. 2002 Oct;20(10):1006-10.

Claims

1. An isolated DNA sequence comprising a selectively inducible RNA polymerase promoter, and a sequence coding for an RNA sequence complementary to at least a portion of a selected mRNA sequence,

2. The sequence of claim 1, wherein the RNA sequence is an siRNA sequence.

3. The sequence of claim 1 or 2 wherein the RNA sequence is from 19 to 24 nucleotides in length.

4. The sequence of claim 3, wherein the RNA sequence is from 21 to 22 nt in length.

5. The sequence of any preceding claim, wherein the RNA sequence is fully complementary to a portion of an mRNA sequence of the same length as the RNA sequence.

6. The sequence of any preceding claim wherein the DNA sequence preferably comprises a conditional response element (RE).

7. The sequence of claim 6, wherein the RE is responsive to an antibiotic.

8. The sequence of claim 7, wherein the RE is responsive to tetracycline.

9. The sequence of any preceding claim, wherein the RNA polymerase promoter is an RJSf A polymerase III promoter.

10. The sequence of claim 9, wherein the RNA polymerase promoter is an HI promoter.

11. A vector comprising the DNA sequence of any preceding claim.

12. A eukaryotic cell comprising the vector of claim 11.

13. The cell of claim 12, wherein the cell is a mammalian cell.

14. An animal transformed with the vector of claim 11.

15. The animal of claim 14, wherein the animal is a mouse.

16. A method of down regulating gene expression in a cell, the method comprising exposing the cell to a substance which induces an exogenous RNA polymerase promoter to promote expression of an exogenous RNA sequence complementary to at least a portion of a selected mRNA sequence.

17. The method of claim 16, further comprising the step of introducing to the cell an exogenous DNA sequence comprising a selectively inducible RNA polymerase promoter, and a sequence coding for an RNA sequence complementary to at least a portion of a selected mRNA sequence.

18. A method of down regulating gene expression in an organism, the method comprising exposing the organism to a substance which induces an exogenous RNA polymerase promoter to promote expression of an exogenous RNA sequence complementary to at least a portion of a selected mRNA sequence.