WO2005049066A2 - Proteine impliquee dans le cancer du poumon - Google Patents

Proteine impliquee dans le cancer du poumon Download PDF

Info

Publication number
WO2005049066A2
WO2005049066A2 PCT/GB2004/004847 GB2004004847W WO2005049066A2 WO 2005049066 A2 WO2005049066 A2 WO 2005049066A2 GB 2004004847 W GB2004004847 W GB 2004004847W WO 2005049066 A2 WO2005049066 A2 WO 2005049066A2
Authority
WO
WIPO (PCT)
Prior art keywords
dudulin2
polypeptide
agent
activity
expression
Prior art date
Application number
PCT/GB2004/004847
Other languages
English (en)
Other versions
WO2005049066A3 (fr
Inventor
Jonathan Alexander Terrett
Original Assignee
Celltech R & D Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Celltech R & D Limited filed Critical Celltech R & D Limited
Publication of WO2005049066A2 publication Critical patent/WO2005049066A2/fr
Publication of WO2005049066A3 publication Critical patent/WO2005049066A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57423—Specifically defined cancers of lung
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)

Definitions

  • the present invention relates to methods for the treatment and/or prophylaxis of lung cancer comprising targeting of the polypeptide dudulin2, agents which interact with or modulate the expression or activity of the polypeptide, methods for the identification of such agents and the use of dudulin2 in the diagnosis of lung cancer.
  • Lung cancer is a leading cancer killer in both men and women with two major types: non-small cell lung cancer and small cell lung cancer.
  • Treatment is restricted to surgery where possible, and chemotherapy and radiotherapy.
  • the challenge is to develop better means to detect cancer early, to identify persons with premalignant disease so they can be monitored more closely and treated with chemopreventive drugs and to develop better therapies to treat lung cancer.
  • WO 01/72962 discloses the use of dudulin2 in the diagnosis and treatment of prostate and testes disorders including prostate and testes cancer. No specific utility is suggested in WO 01/53454, and EP 1074617 indicates that the sequences identified may have utility in detecting dudulin2 interacting proteins.
  • the present invention is based on the finding that dudulin2 represents a novel therapeutic target for the treatment and/or prophylaxis of lung cancer.
  • the invention provides a method for the treatment and/or prophylaxis of lung cancer comprising administering a therapeutically effective amount of an agent which interacts with or modulates the expression or activity of a dudulin2 polypeptide.
  • a dudulin2 polypeptide includes a polypeptide which: (a) comprises or consists of the amino acid sequence of SEQ ID NO: 1 ; or (b) is a derivative having one or more amino acid substitutions, modifications, deletions or insertions relative to the amino acid sequence of SEQ ID NO:l which retains the activity of dudulin2.
  • polypeptides includes peptides, polypeptides and proteins. These are used interchangeably unless otherwise specified.
  • Agents of use in the methods of the invention include without limitation, agents that are capable of interacting with (e.g. binding to, or recognising) a dudulin2 polypeptide or a nucleic acid molecule encoding a dudulin2 polypeptide, or are capable of modulating the interaction, expression, activity of a dudulin2 polypeptide or the expression of a nucleic acid molecule encoding a dudulin2 polypeptide.
  • agents include, without limitation, antibodies, nucleic acids (e.g. DNA and RNA), carbohydrates, lipids, proteins, polypeptides, peptides, peptidomimetics, small molecules and other drugs.
  • the invention also provides the use of an agent, which interacts with or modulates the expression or activity of a dudulin2 polypeptide for the manufacture of a medicament for the treatment and/or prophylaxis of lung cancer.
  • the agent is a small molecule.
  • the agent for use in the treatment and/or prophylaxis of lung cancer is an antibody that interacts with (i.e. binds to or recognises) or modulates the activity of a dudulin2 polypeptide. Accordingly, there is provided the use of an antibody that interacts with a dudulin2 polypeptide for use in the manufacture of a medicament for use in the treatment and/or prophylaxis of lung cancer.
  • an antibody that interacts with a dudulin2 polypeptide may be used to mediate antibody dependent cell cytotoxicity (ADCC) and complement dependent cytotoxicity (CDC). In such a case the antibody is preferably a full length naked antibody.
  • an antibody that interacts with dudulin2 polypeptides may be used to inhibit the activity of said polypeptides. Most prefened are antibodies that specifically interact with a dudulin2 polypeptide. Specifically interacting with (e.g.
  • dudulin2 antibodies can be used therapeutically alone or in combination with a cytotoxic factor(s) and/or cytokine(s).
  • dudulin2 antibodies can be conjugated to a therapeutic agent, such as a cytotoxic agent, a radionuclide or drug moiety to modify a given biological response.
  • the therapeutic agent is not to be construed as limited to classical chemical therapeutic agents.
  • the therapeutic agent may be a drug moiety which may be a protein or polypeptide possessing a desired biological activity.
  • Such moieties may include, for example and without limitation, a toxin such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin, maytansinoid (DM1), a protein such as tumour necrosis factor, ⁇ -interferon, ⁇ -interferon, nerve growth factor, platelet derived growth factor or tissue plasminogen activator, a thrombotic agent or an anti-angiogenic agent, e.g.
  • a toxin such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin
  • maytansinoid DM1
  • a protein such as tumour necrosis factor, ⁇ -interferon, ⁇ -interferon, nerve growth factor, platelet derived growth factor or tissue plasminogen activator, a thrombotic agent or an anti-angiogenic agent, e.g.
  • angiostatin or endostatin angiostatin or endostatin; angiogenin, gelonin, dolstatins, minor groove-binders, bis-iodo-phenol mustard, or, a biological response modifier such as a lymphokine, interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-6 (IL-6), granulocyte macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G- CSF), nerve growth factor (NGF) or other growth factor.
  • Therapeutic agents also include cytotoxins or cytotoxic agents including any agent that is detrimental to (e.g. kills) cells.
  • Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vinca alkaloids, e.g. vincristine, vinblastine, 4-desacetylvinblastine-3-carbohydrazide, vindesine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof.
  • vincristine vinblastine
  • 4-desacetylvinblastine-3-carbohydrazide vindesine
  • colchicin doxorubicin, daunorubicin, dihydroxy anthracin dione, mitox
  • Therapeutic agents also include, but are not limited to, anti-folates (e.g. aminopterin and methotrexate), antimetabolites (e.g. methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5- fluorouracil decarbazine, 5-fluoro-2'-deoxyuridine), alkylating agents (e.g.
  • anti-folates e.g. aminopterin and methotrexate
  • antimetabolites e.g. methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5- fluorouracil decarbazine, 5-fluoro-2'-deoxyuridine
  • alkylating agents e.g.
  • dactinomycin (formerly actinomycin), bleomycin, mithramycin, anthramycin (AMC), calicheamicins or duocarmycins, CC-1065, enediyenes, neocarzinostatin), and anti-mitotic agents (e.g. vincristine and vinblastine). See Garnett, 2001, Advanced drug Delivery Reviews 53:171-216 for further details.
  • Other therapeutic moieties may include radionuclides such as 131 I, U 1 ln and 90 Y, Lu 177 , Bismuth 213 , Bismuth 212 , Californium 252 , Iridium 192 and Tunsten 1 ⁇ /Rhenium 188 , 21 'astatine; or drugs such as but not limited to, alkylphosphocholines, topoisomerase I inhibitors, taxoids and suramin. Techniques for conjugating such therapeutic agents to antibodies are well known in the art (see, e.g.
  • cytotoxic agents such as radionuclides and prodrugs can be pre- targeted to tumours.
  • antibody-dependent enzyme-mediated prodrug therapy involves pre-targeting of pro-drugs to tumours (Niculescu-Duvaz et al., 1999, Anticancer Drug Des. 14:517-538; Syrigos et al, 1999, Anticancer Res. 19:605-613).
  • the antibodies for use in the invention include analogues and derivatives that are modified, for example but without limitation, by the covalent attachment of any type of molecule. Preferably, said attachment does not impair immunospecific binding.
  • an antibody can be conjugated to a second antibody to form an antibody heteroconjugate (see US 4,676,980).
  • the invention provides the therapeutic use of fusion proteins of the antibodies (or functionally active fragments thereof), for example but without limitation, where the antibody or fragment thereof is fused via a covalent bond (e.g. a peptide bond), at optionally the N- terminus or the C-terminus, to an amino acid sequence of another protein (or portion thereof; preferably at least a 10, 20 or 50 amino acid portion of the protein).
  • a covalent bond e.g. a peptide bond
  • the antibody, or fragment thereof is linked to the other protein at the N-terminus of the constant domain of the antibody.
  • an antibody fusion protein may facilitate depletion or purification of a polypeptide as described herein, increase half-life in vivo, and enhance the delivery of an antigen across an epithelial barrier to the immune system.
  • the fusion protein is an antibody fragment linked to an effector or reporter molecule
  • this may be prepared by standard chemical or recombinant DNA procedures in which the antibody fragment is linked either directly or via a coupling agent to the effector or reporter molecule either before or after reaction with the activated polymer as appropriate.
  • Particular chemical procedures include, for example, those described in WO 93/06231, WO 92/22583, WO 90/09195, WO 89/01476, WO 99/15549 and WO03/031581.
  • the linkage may be achieved using recombinant DNA procedures, for example as described in WO 86/01533 and EP 0392745.
  • Most preferably antibodies are attached to poly(ethyleneglycol) (PEG) moieties.
  • PEG poly(ethyleneglycol)
  • a modified Fab fragment is PEGylated, i.e. has PEG (poly(ethyleneglycol)) covalently attached thereto, e.g. according to the method disclosed in EP 0948544 [see also "Poly(ethyleneglycol) Chemistry, Biotechnical and Biomedical Applications", 1992, J. Milton Harris (ed), Plenum Press, New York, "Poly(ethyleneglycol) Chemistry and
  • a PEG modified Fab fragment has a maleimide group covalently linked to a single thiol group in a modified hinge region.
  • a lysine residue may be covalently linked to the maleimide group.
  • To each of the amine groups on the lysine residue may be attached a methoxypoly(ethyleneglycol) polymer having a molecular weight of approximately 20,000 Da.
  • Dudulin2 polypeptides or cells expressing said polypeptides can be used to produce antibodies, e.g. which specifically recognise said dudulin2 polypeptides.
  • Antibodies generated against a dudulin2 polypeptide may be obtained by administering the polypeptides to an animal, preferably a non-human animal, using well-known and routine protocols.
  • Anti-dudulin2 antibodies include functionally active fragments, derivatives or analogues and may be, but are not limited to, polyclonal, monoclonal, bi-, tri- or tetra-valent antibodies, humanized or chimeric antibodies, single chain antibodies, Fab fragments, Fab' and Fab' 2 fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies, and epitope-binding fragments of any of the above.
  • Humanized antibodies are antibody molecules from non-human species having one or more complementarity determining regions (CDRs) from the non-human species and a framework region from a human immunoglobulin molecule (see, e.g. US 5,585,089).
  • Antibodies include immunoglobulin molecules and immuno logically active portions of immunoglobulin molecules, i.e. molecules that contain an antigen binding site that specifically binds an antigen.
  • the immunoglobulin molecules of the invention can be of any class (e.g. IgG, IgE, IgM, IgD and IgA) or subclass of immunoglobulin molecule.
  • Monoclonal antibodies may be prepared by any method known in the art such as the hybridoma technique (Kohler & Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al, 1983, Immunology Today, 4:72) and the EBV-hybridoma technique (Cole et al, Monoclonal Antibodies and Cancer Therapy, p ⁇ 77-96, Alan R Liss, Inc., 1985).
  • Chimeric antibodies are those antibodies encoded by immunoglobulin genes that have been genetically engineered so that the light and heavy chain genes are composed of immunoglobulin gene segments belonging to different species. These chimeric antibodies are likely to be less anti genie.
  • Bivalent antibodies may be made by methods known in the art (Milstein et al, 1983, Nature 305:537-539; WO 93/08829, Traunecker et al, 1991, EMBO J. 10:3655-3659). Bi-, tri- and tetra-valent antibodies may comprise multiple specificities or may be monospecific (see for example WO 92/22853).
  • the antibodies for use in the invention may be generated using single lymphocyte antibody methods based on the molecular cloning and expression of immunoglobulin variable region cDNAs generated from single lymphocytes that were selected for the production of specific antibodies such as described by Babcook, J. et al, 1996, Proc. Natl. Acad. Sci.
  • the antibodies for use in the present invention can also be generated using various phage display methods known in the art and include those disclosed by Brinkman et al. (in J. Immunol. Methods, 1995, 182: 41-50), Ames et al. (J. Immunol. Methods, 1995, 184: 177- 186), Kettleborough et al. (Eur. J. Immunol. 1994, 24:952-958), Persic et al. (Gene, 1997 187 9-18), Burton et al.
  • dudulin2 polypeptides can be used for the identification of agents for use in the methods of treatment and/or prophylaxis according to the invention.
  • a further aspect of the invention provides methods of screening for anti-lung cancer agents that interact with a dudulin2 polypeptide comprising: (a) contacting said polypeptide with a candidate agent; and (b) determining whether or not the candidate agent interacts with said polypeptide.
  • the determination of an interaction between the candidate agent and dudulin2 polypeptide comprises quantitatively detecting binding of the candidate agent and said polypeptide.
  • a method of screening for anti-lung cancer agents that modulate the expression or activity of a dudulin2 polypeptide comprising: (i) comparing the expression or activity of said polypeptide in the presence of a candidate agent with the expression or activity of said polypeptide in the absence of the candidate agent or in the presence of a control agent; and (ii) determining whether the candidate agent causes the expression or activity of said polypeptide to change.
  • the expression and/or activity of a dudulin2 polypeptide is compared with a predetermined reference range or control.
  • the method further comprises selecting an agent, which interacts with a dudulin2 polypeptide or is capable of modulating the interaction, expression or activity of a dudulin2 polypeptide, for further testing for use in the treatment and/or prophylaxis of lung cancer.
  • an agent which interacts with a dudulin2 polypeptide or is capable of modulating the interaction, expression or activity of a dudulin2 polypeptide, for further testing for use in the treatment and/or prophylaxis of lung cancer.
  • the above screening methods are also appropriate for screening for anti-lung cancer agents which interact with or modulate the expression or activity of a dudulin2 nucleic acid molecule.
  • the invention also provides assays for use in drug discovery in order to identify or verify the efficacy of agents for treatment and/or prophylaxis of lung cancer. Agents identified using these methods can be used as lead agents for drug discovery, or used therapeutically.
  • dudulin2 polypeptide expression of a dudulin2 polypeptide can be assayed by, for example, immunoassays, gel electrophoresis followed by visualisation, detection of mRNA or dudulin2 polypeptide activity, or any other method taught herein or known to those skilled in the art. Such assays can be used to screen candidate agents, in clinical monitoring or in drug development. Agents can be selected from a wide variety of candidate agents. Examples of candidate agents include but are not limited to, nucleic acids (e.g. DNA and RNA), carbohydrates, lipids, proteins, polypeptides, peptides, peptidomimetics, small molecules and other drugs.
  • nucleic acids e.g. DNA and RNA
  • candidate agents include but are not limited to, nucleic acids (e.g. DNA and RNA), carbohydrates, lipids, proteins, polypeptides, peptides, peptidomimetics, small molecules and other drugs.
  • Agents can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the "one-bead one-compound” library method; and synthetic library methods using affinity chromatography selection.
  • the biological library approach is suited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, 1997, Anticancer Drug Des. 12:145; U.S. 5,738,996; and U.S. 5,807,683).
  • a small molecule includes chemical entities and new chemical entities (NCEs) such as compounds identified using any of the methods described below.
  • agents that interact with (e.g. bind to) a dudulin2 polypeptide are identified in a cell-based assay where a population of cells expressing a dudulin2 polypeptide is contacted with a candidate agent and the ability of the candidate agent to interact with the polypeptide is determined.
  • the ability of a candidate agent to interact with a dudulin2 polypeptide is compared to a reference range or control.
  • a first and second population of cells expressing a dudulin2 polypeptide are contacted with a candidate agent or a control agent and the ability of the candidate agent to interact with the polypeptide is determined by comparing the difference in interaction between the candidate agent and control agent.
  • this type of assay may be used to screen a plurality (e.g. a library) of candidate agents using a plurality of cell populations expressing a dudulin2 polypeptide.
  • this assay may be used to screen a plurality (e.g. a library) of candidate agents.
  • the cell for example, can be of prokaryotic origin (e.g. E. coli) or eukaryotic origin (e.g. yeast or mammalian).
  • the cells can express the dudulin2 polypeptide endogenously or be genetically engineered to express the polypeptide.
  • a dudulin2 polypeptide or the candidate agent is labelled, for example with a radioactive label (such as 32 P, 35 S or 125 I) or a fluorescent label (such as fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde or fluorescamine) to enable detection of an interaction between a polypeptide and a candidate agent.
  • agents that interact with e.g.
  • bind to) a dudulin2 polypeptide are identified in a cell-free assay system where a sample expressing a dudulin2 polypeptide is contacted with a candidate agent and the ability of the candidate agent to interact with the polypeptide is determined.
  • the ability of a candidate agent to interact with a dudulin2 polypeptide is compared to a reference range or control.
  • a first and second sample comprising native or recombinant dudulin2 polypeptide are contacted with a candidate agent or a control agent and the ability of the candidate agent to interact with the polypeptide is determined by comparing the difference in interaction between the candidate agent and control agent.
  • this assay may be used to screen a plurality (e.g. a library) of candidate agents using a plurality of dudulin2 polypeptide samples.
  • the polypeptide is first immobilized, by, for example, contacting the polypeptide with an immobilized antibody which specifically recognizes and binds it, or by contacting a purified preparation of polypeptide with a surface designed to bind proteins.
  • the polypeptide may be partially or completely purified (e.g. partially or completely free of other polypeptides) or part of a cell lysate.
  • polypeptide may be a fusion protein comprising the dudulin2 polypeptide or a biologically active portion thereof and a domain such as glutathionine-S-transferase.
  • the polypeptide can be biotinylated using techniques well known to those of skill in the art (e.g. biotinylation kit, Pierce Chemicals; Rockford, IL). The ability of the candidate agent to interact with the polypeptide can be duplicated by methods known to those of skill in the art.
  • a dudulin2 polypeptide is used as a "bait protein" in a two-hybrid assay or three hybrid assay to identify other proteins that bind to or interact with the dudulin2 polypeptide (see e.g. US 5,283,317; Zervos et al, 1993, Cell 72:223-232; Madura et al 1993, J. Biol. Chem. 268:12046-12054; Bartel et al, 1993, Bio/Techniques 14:920-924; Iwabuchi et al, 1993, Oncogene 8: 1693-1696; and WO 94/10300).
  • binding proteins are also likely to be involved in the propagation of signals by a dudulin2 polypeptide.
  • they may be upstream or downstream elements of a signalling pathway involving a dudulin2 polypeptide.
  • polypeptides that interact with a dudulin2 polypeptide can be identified by isolating a protein complex comprising a dudulin2 polypeptide (said polypeptide may interact directly or indirectly with one or more other polypeptides) and identifying the associated proteins using methods known in the art such as mass spectrometry or Western blotting (for examples see Blackstock, W. & Weir, M. 1999, Trends in Biotechnology, 17: 121-127; Rigaut, G. 1999, Nature
  • the ability of the candidate agent to interact directly or indirectly with the dudulin2 polypeptide can be determined by methods known to those of skill in the art.
  • the interaction between a candidate agent and a dudulin2 polypeptide can be determined by flow cytometry, a scintillation assay, an activity assay, mass spectrometry, microscopy, immunoprecipitation or western blot analysis.
  • agents that competitively interact with (i.e. competitively binding to) a dudulin2 polypeptide are identified in a competitive binding assay and the ability of the candidate agent to interact with the dudulin2 polypeptide is determined.
  • the ability of a candidate agent to interact with a dudulin2 polypeptide is compared to a reference range or control.
  • a first and second population of cells expressing both a dudulin2 polypeptide and a protein which is known to interact with the dudulin2 polypeptide are contacted with a candidate agent or a control agent.
  • the ability of the candidate agent to competitively interact with the dudulin2 polypeptide is then determined by comparing the interaction in the first and second population of cells.
  • an alternative second population or a further population of cells may be contacted with an agent which is known to competitively interact with a dudulin2 polypeptide.
  • agents that competitively interact with a dudulin2 polypeptide are identified in a cell-free assay system by contacting a first and second sample comprising a dudulin2 polypeptide and a protein known to interact with the dudulin2 polypeptide with a candidate agent or a control agent. The ability of the candidate agent to competitively interact with the dudulin2 polypeptide is then determined by comparing the interaction in the first and second sample.
  • an alternative second sample or a further sample comprising a dudulin2 polypeptide may be contacted with an agent which is known to competitively interact with a dudulin2 polypeptide.
  • the dudulin2 polypeptide and known interacting protein may be expressed naturally or may be recombinantly expressed; the candidate agent may be added exogenously, or be expressed naturally or recombinantly.
  • agents that modulate the interaction between a dudulin2 polypeptide and another agent for example but without limitation a protein, may be identified in a cell -based assay by contacting cells expressing a dudulin2 polypeptide in the presence of a known interacting agent and a candidate modulating agent and selecting the candidate agent which modulates the interaction.
  • agents that modulate an interaction between a dudulin2 polypeptide and another agent may be identified in a cell-free assay system by contacting the polypeptide with an agent known to interact with the polypeptide in the presence of a candidate agent.
  • a modulating agent can act as an antibody, a cofactor, an inhibitor, an activator or have an antagonistic or agonistic effect on the interaction between a dudulin2 polypeptide and a known agent.
  • the ability of the known agent to interact with a dudulin2 polypeptide can be determined by methods known in the art.
  • These assays, whether cell-based or cell-free can be used to screen a plurality (e.g. a library) of candidate agents.
  • a cell-based assay system is used to identify agents capable of modulating (i.e. stimulating or inhibiting) the activity of a dudulin2 polypeptide. Accordingly, the activity of a dudulin2 polypeptide is measured in a population of cells that naturally or recombinantly express a dudulin2 polypeptide, in the presence of a candidate agent. Preferably, the activity of a dudulin2 polypeptide is compared to a reference range or control.
  • the activity of a dudulin2 polypeptide is measured in a first and second population of cells that naturally or recombinantly express a dudulin2 polypeptide, in the presence of agent or absence of a candidate agent (e.g. in the presence of a control agent) and the activity of the dudulin2 polypeptide is compared.
  • the candidate agent can then be identified as a modulator of the activity of a dudulin2 polypeptide based on this comparison.
  • the activity of a dudulin2 polypeptide can be measured in a cell- free assay system where the dudulin2 polypeptide is either natural or recombinant.
  • the activity of a dudulin2 polypeptide is compared to a reference range or control.
  • the activity of a dudulin2 polypeptide is measured in a first and second sample in the presence or absence of a candidate agent and the activity of the dudulin2 polypeptide is compared.
  • the candidate agent can then be identified as a modulator of the activity of a dudulin2 polypeptide based on this comparison.
  • the activity of a dudulin2 polypeptide can be assessed by detecting its effect on a downstream effector, for example but without limitation, the level or activity of a second messenger (e.g.
  • cAMP intracellular Ca 2+ , diacylglycerol, IP 3 , etc.
  • detecting catalytic or enzymatic activity detecting the induction of a reporter gene (e.g. luciferase) or detecting a cellular response, for example, proliferation, differentiation or transformation where appropriate as known by those skilled in the art (for activity measurement techniques see, e.g. US 5,401,639).
  • the candidate agent can then be identified as a modulator of the activity of a dudulin2 polypeptide by comparing the effects of the candidate agent to the control agent.
  • Suitable control agents include PBS or normal saline.
  • agents such as an enzyme, or a biologically active portion thereof, which is responsible for the production or degradation of a dudulin2 polypeptide or is responsible for the post-translational modification of a dudulin2 polypeptide can be identified.
  • substantially pure, native or recombinantly expressed dudulin2 polypeptides nucleic acids or cellular extract or other sample comprising native or recombinantly expressed dudulin2 polypeptides or nucleic acids are contacted with a plurality of candidate agents (for example but without limitation, a plurality of agents presented as a library) that may be responsible for the processing of a dudulin2 polypeptide or nucleic acid, in order to identify such agents.
  • the ability of the candidate agent to modulate the production, degradation or post-translational modification of a dudulin2 polypeptide or nucleic acid can be determined by methods known to those of skill in the art, including without limitation, flow cytometry, radiolabelling, a kinase assay, a phosphatase assay, immunoprecipitation and Western blot analysis, or Northern blot analysis.
  • cells expressing a dudulin2 polypeptide are contacted with a plurality of candidate agents.
  • the ability of such an agent to modulate the production, degradation or post-translational modification of a dudulin2 polypeptide can be determined by methods known to those of skill in the art, as described above.
  • agents that modulate the expression of a dudulin2 polypeptide are identified in a cell-based assay system. Accordingly, a population of cells expressing a dudulin2 polypeptide or nucleic acid are contacted with a candidate agent and the ability of the candidate agent to alter expression of the dudulin2 polypeptide or nucleic acid is determined by comparison to a reference range or control.
  • a first and second population of cells expressing a dudulin2 polypeptide are contacted with a candidate agent or a control agent and the ability of the candidate agent to alter the expression of the dudulin2 polypeptide or nucleic acid is determined by comparing the difference in the level of expression of the dudulin2 polypeptide or nucleic acid between the first and second populations of cells.
  • the expression of the dudulin2 polypeptide or nucleic acid in the first population may be further compared to a reference range or control. If desired, this assay may be used to screen a plurality (e.g. a library) of candidate agents.
  • the cell for example, can be of prokaryotic origin (e.g. E.
  • the cells can express a dudulin2 polypeptide or nucleic acid endogenously or be genetically engineered to express a dudulin2 polypeptide or nucleic acid.
  • the ability of the candidate agents to alter the expression of a dudulin2 polypeptide or nucleic acid can be determined by methods known to those of skill in the art, for example and without limitation, by flow cytometry, radiolabelling, a scintillation assay, immunoprecipitation, Western blot analysis or Northern blot analysis.
  • agents that modulate the expression of a dudulin2 polypeptide or nucleic acid are identified in an animal model.
  • a first and second group of mammals are administered with a candidate agent or a control agent and the ability of the candidate agent to modulate the expression of the dudulin2 polypeptide or nucleic acid is determined by comparing the difference in the level of expression between the first and second group of mammals.
  • the expression levels of the dudulin2 polypeptides or nucleic acid in the first and second groups of mammals can be compared to the level of a dudulin2 polypeptide or nucleic acid in a control group of mammals.
  • the candidate agent or a control agent can be administered by means known in the art (e.g. orally, rectally or parenterally such as intraperitoneally or intravenously). Changes in the expression of a polypeptide or nucleic acid can be assessed by the methods outlined above.
  • a therapeutically effective amount of an agent can be determined by monitoring an amelioration or improvement in disease symptoms, to delay onset or slow progression of the disease, for example but without limitation, a reduction in tumour size. Techniques known to physicians familiar with lung cancer can be used to determine whether a candidate agent has altered one or more symptoms associated with the disease.
  • dudulin2 polypeptide may also be used in a method for the structure-based design of an agent, in particular a small molecule which acts to modulate (e.g. stimulate or inhibit) the activity of said polypeptide, said method comprising: 1) determining the three-dimensional structure of said polypeptide; 2) deducing the three-dimensional structure within the polypeptide of the likely reactive or binding site(s) of the agent; 3) synthesising candidate agents that are predicted to react or bind to the deduced reactive or binding site; and 4) testing whether the candidate agent is able to modulate the activity of said polypeptide. It will be appreciated that the method described above is likely to be an iterative process.
  • agents which interact with a dudulin2 polypeptide find use in the treatment and/or prophylaxis of lung cancer.
  • the agents will generally be administered in the form of a pharmaceutical composition.
  • a pharmaceutical composition comprising an agent which interacts with a dudulin2 polypeptide and a pharmaceutically acceptable diluent, excipient and /or carrier.
  • Pharmaceutical compositions may also find use as a vaccine and may comprise additional components acceptable for vaccine use and may additionally comprise one or more suitable adjuvants as known to the skilled person.
  • dudulin2 polypeptides and dudulin2 nucleic acids of use in treatment and/or prophylaxis are referred to as 'active agents'.
  • 'active agents' agents of use in the invention, dudulin2 polypeptides and dudulin2 nucleic acids of use in treatment and/or prophylaxis.
  • the composition will usually be supplied as part of a sterile, pharmaceutical composition that will normally include a pharmaceutically acceptable carrier. This composition may be in any suitable form (depending upon the desired method of administering it to a patient).
  • Active agents of the invention may be administered to a subject by any of the routes conventionally used for drug administration, for example they may be administered parenterally, orally, topically (including buccal, sublingual or transdermal, or using particle-mediated intracellular delivery directly into cells of the skin) or by inhalation. Particle mediated delivery is described by Haynes, JR, 2004, Expert Opinion on Biological Therapy, 4:889-900. The most suitable route for administration in any given case will depend on the particular active agent, the carcinoma involved, the subject, and the nature and severity of the disease and the physical condition of the subject.
  • the active agents may be administered in combination, e.g. simultaneously, sequentially or separately, with one or more other therapeutically active, e.g. anti-tumour, compounds.
  • compositions may be conveniently presented in unit dose forms containing a predetermined amount of an active agent of the invention per dose. Such a unit may contain for example but without limitation, 750mg/kg to O.lmg/kg depending on the condition being treated, the route of administration and the age, weight and condition of the subject.
  • Pharmaceutically acceptable carriers for use in the invention may take a wide variety of forms depending, e.g. on the route of administration.
  • Compositions for oral administration may be liquid or solid.
  • Oral liquid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for reconstitution with water or other suitable vehicle before use.
  • Oral liquid preparations may contain suspending agents as known in the art.
  • suspending agents such as powders, capsules and tablets
  • earners such as starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents, and the like may be included.
  • tablets and capsules represent the most advantageous oral dosage unit form in which case solid pharmaceutical carriers are generally employed.
  • active agents of the invention may also be administered by controlled release means and/or delivery devices.
  • Tablets and capsules may comprise conventional earners or excipients such as binding agents for example, syrup, acacia, gelatin, sorbitol, tragacanth, or polyvinylpyrrolidone; fillers, for example lactose, sugar, maize-starch, calcium phosphate, sorbitol or glycine; tableting lubricants, for example magnesium stearate, talc, polyethylene glycol or silica; disintegrants, for example potato starch; or acceptable wetting agents such as sodium lauryl sulphate.
  • the tablets may be coated by standard aqueous or non-aqueous techniques according to methods well known in normal pharmaceutical practice.
  • compositions of the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets, each containing a predetermined amount of the active agent, as a powder or granules, or as a solution or a suspension in an aqueous liquid, a non-aqueous liquid, an oil-in-water emulsion or a water- in-oil liquid emulsion.
  • Such compositions may be prepared by any of the methods of pharmacy but all methods include the step of bringing into association the active agent with the carrier, which constitutes one or more necessary ingredients.
  • the compositions are prepared by uniformly and intimately admixing the active agent with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product into the desired presentation.
  • a tablet may be prepared by compression or moulding, optionally with one or more accessory ingredients.
  • Pharmaceutical compositions suitable for parenteral administration may be prepared as solutions or suspensions of the active agents of the invention in water suitably mixed with a surfactant such as hydroxypropylcellulose.
  • Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • the pharmaceutical forms suitable for injectable use include aqueous or non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the composition isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
  • aqueous or non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the composition isotonic with the blood of the intended recipient
  • aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
  • Extemporaneous injection solutions, dispersions and suspensions may be prepared from sterile powders, granules and tablets.
  • Pharmaceutical compositions can be administered with medical devices known in the art.
  • a pharmaceutical composition of the invention can be administered with a needleless hypodermic injection device, such as the devices disclosed in US 5,399,163; 5,383,851; 5,312,335; 5,064,413; 4,941,880; 4,790,824; or 4,596,556.
  • a needleless hypodermic injection device such as the devices disclosed in US 5,399,163; 5,383,851; 5,312,335; 5,064,413; 4,941,880; 4,790,824; or 4,596,556.
  • Examples of well-known implants and modules useful in the present invention include: US 4,487,603, which discloses an implantable micro-infusion pump for dispensing medication at a controlled rate; US 4,486,194, which discloses a therapeutic device for administering medicaments through the skin; US 4,447,233, which discloses a medication infusion pump for delivering medication at a precise infusion rate; US 4,447,224, which discloses a variable flow implantable infusion apparatus for continuous drug delivery; US 4,439,196, which discloses an osmotic drug delivery system having multi-chamber compartments; and US 4,475,196, which discloses an osmotic drug delivery system. Many other such implants, delivery systems, and modules are known to those skilled in the art.
  • the pharmaceutical compositions of the invention can be formulated to ensure proper distribution in vivo.
  • the blood-brain barrier excludes many highly hydrophilic compounds and it may be preferable to deliver pharmaceutical compositions in liposomes.
  • the active agents of the invention are formulated in liposomes; in a more prefened embodiment, the liposomes include a targeting moiety.
  • the therapeutic compounds in the liposomes are delivered by bolus injection to a site proximal to the tumour. Liposomes may be stealth liposomes that are long-lived in vivo. For methods of manufacturing liposomes, see, e.g.
  • the liposomes may comprise one or more moieties which are selectively transported into specific cells or organs, thus enhancing targeted drug delivery (see, e.g. Ranade, VV. 1989, J. Clin. Pharmacol. 29:685).
  • exemplary targeting moieties include folate or biotin (see, e.g. U.S. Patent 5,416,016.); mannosides (Umezawa et al, 1988, Biochem. Biophys. Res. Commun. 153:1038); antibodies (Bloeman, PG. et al, 1995, FEBS Lett. 357:140; M.
  • compositions may be presented in unit-dose or multi-dose containers, for example in sealed ampoules and vials and to enhance stability, may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use.
  • the sterile liquid carrier may be supplied in a separate vial or ampoule and can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g. glycerol, propylene glycol and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils.
  • agents such as a local anaesthetic, preservative and buffering agents can be included the sterile liquid carrier.
  • compositions adapted for topical administration may be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, impregnated dressings, sprays, aerosols or oils, transdermal devices, dusting powders, and the like.
  • These compositions may be prepared via conventional methods containing the active agent.
  • they may also comprise compatible conventional carriers and additives, such as preservatives, solvents to assist drug penetration, emollients in creams or ointments and ethanol or oleyl alcohol for lotions.
  • Such earners may be present as from about 1% up to about 98% of the composition. More usually they will form up to about 80% of the composition.
  • compositions adapted for transdermal administration may be presented as discrete patches intended to remain in intimate contact with the epidermis of the recipient for a prolonged period of time.
  • the active agent may be delivered from the patch by iontophoresis.
  • the compositions are preferably applied as a topical ointment or cream.
  • the active agent may be employed with either a paraffinic or a water-miscible ointment base.
  • the active agent may be formulated in a cream with an oil-in-water cream base or a water-in-oil base.
  • Pharmaceutical compositions adapted for topical administration in the mouth include lozenges, pastilles and mouth washes.
  • Pharmaceutical compositions adapted for topical administration to the eye include eye drops wherein the active agent is dissolved or suspended in a suitable carrier, especially an aqueous solvent. They also include topical ointments or creams as above.
  • Pharmaceutical compositions suitable for rectal administration wherein the carrier is a solid are most preferably presented as unit dose suppositories.
  • Suitable earners include cocoa butter or other glyceride or materials commonly used in the art, and the suppositories may be conveniently formed by admixture of the combination with the softened or melted carrier(s) followed by chilling and shaping moulds. They may also be administered as enemas.
  • Pharmaceutical compositions adapted for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams or spray compositions. These may comprise emollients or bases as commonly used in the art.
  • Pharmaceutical compositions adapted for use as a vaccine may comprise adjuvants such as cytokines, chemokines, co-stimulatory molecules, or other rmmunomodulators that amplify and direct the immune response.
  • a pharmaceutical composition may comprise a dudulin2 polypeptide with a synergistic combination of cytokines that induce dendritic cell recruitment (e.g. GM-Colony Stimulating Factor) and co-stimulatory molecules that induce dendritic cell maturation (e.g. CD40L or agonistic anti-CD40) in combination with other Thl/cytotoxic T cell-supporting cytokines such as IL-12 and IL-15.
  • Dendritic cells pre- incubated with dudulin2 polypeptide may be generated ex vivo.
  • Other synergistic combinations are described in animal models (Berzofsky, et al, 2001, Nat. Rev. Immunol. 1, 209-219).
  • a pharmaceutical composition may also comprise a dudulin2 polypeptide, broad MHC class II binding such as pan-HLA- DR-binding peptide, endogenous helper epitopes, or enhanced helper epitopes.
  • the dosage to be administered of an active agent will vary according to the particular active agent, the type of lung cancer, the subject, and the nature and severity of the disease and the physical condition of the subject, the age, weight and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, tolerance/response to therapy, and the selected route of administration; and a physician will ultimately determine appropriate dosages to be used. This dosage may be repeated as often as appropriate.
  • compositions can be conveniently presented in unit dose forms containing a predetermined amount of an active agent of the invention per dose. If side effects develop the amount and/or frequency of the dosage can be altered or reduced, in accordance with normal clinical practice.
  • pharmaceutical compositions comprising antibodies can be administered to patients (e.g. , human subjects) at therapeutically or prophylactically effective dosages (e.g.
  • compositions may contain from 0.1% by weight, preferably from 10-60%, or more, by weight, of the active agent of the invention, depending on the method of administration. It will be recognized by one of skill in the art that the optimal quantity and spacing of individual dosages of an active agent of the invention will be determined by the nature and extent of the condition being treated, the form, route and site of administration, and the age and condition of the particular subject being treated, and that a physician will ultimately determine appropriate dosages to be used. This dosage may be repeated as often as appropriate. If side effects develop the amount and/or frequency of the dosage can be altered or reduced, in accordance with normal clinical practice.
  • Dudulin2 polypeptides may also be of use in the treatment and/or prophylaxis of lung cancer. Accordingly, provided is a method for the treatment and/or prophylaxis of lung cancer comprising administering a therapeutically effective amount of a composition comprising a dudulin2 polypeptide, preferably as a vaccine. Also provided is the use of a dudulin2 polypeptide for the manufacture of a medicament for the treatment and/or prophylaxis of lung cancer. Where they are provided for use with the methods of the invention dudulin2 are preferably provided in isolated form. More preferably the dudulin2 polypeptides have been purified to at least some extent.
  • Dudulin2 polypeptides can also be produced using recombinant methods, synthetically produced or produced by a combination of these methods.
  • Dudulin2 polypeptides may be provided in substantially pure form, that is to say free, to a substantial extent, from other proteins.
  • Recombinant dudulin2 polypeptides may be prepared by processes well known in the art from genetically engineered host cells comprising expression systems. Accordingly, the present invention also relates to expression systems which comprise a dudulin2 polypeptide or dudulin2 nucleic acid, to host cells which are genetically engineered with such expression systems and to the production of dudulin2 polypeptides by recombinant techniques.
  • Cell- free translation systems can also be employed to produce recombinant polypeptides (e.g. rabbit reticulocyte lysate, wheat germ lysate, SP6/T7 in vitro T&T and RTS 100 E. Coli HY transcription and translation kits from Roche Diagnostics Ltd., Lewes, UK and the TNT Quick coupled Transcription/Translation System from Promega UK, Southampton, UK.
  • recombinant dudulin2 polypeptide production host cells can be genetically engineered to incorporate expression systems or portions thereof for dudulin2 nucleic acids.
  • Such incorporation can be performed using methods well known in the art, such as, calcium phosphate transfection, D ⁇ AD-dextran mediated transfection, transvection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction or infection (see e.g. Davis et al, Basic Methods in Molecular Biology, 1986 and Sambrook et al, Molecular Cloning: A Laboratory Manual, 2 nd Ed., Cold Spring Harbour laboratory Press, Cold Spring Harbour, NY, 1989).
  • Representative examples of host cells include bacterial cells e.g. E.
  • Coli Streptococci, Staphylococci, Streptomyces and Bacillus subtilis cells
  • fungal cells such as yeast cells and Aspergillus cells
  • insect cells such as Drosophila S2 and Spodoptera Sf9 cells
  • animal cells such as CHO, COS, HeLa, C127, 3T3, HEK 293, BHK and Bowes melanoma cells
  • plant cells such as CHO, COS, HeLa, C127, 3T3, HEK 293, BHK and Bowes melanoma cells.
  • a wide variety of expression systems can be used, such as and without limitation, chromosomal, episomal and virus-derived systems, e.g.
  • the expression systems may contain control regions that regulate as well as engender expression.
  • any system or vector which is able to maintain, propagate or express a nucleic acid to produce a polypeptide in a host may be used.
  • the appropriate nucleic acid sequence may be inserted into an expression system by any variety of well-known and routine techniques, such as those set forth in Sambrook et al, supra.
  • Appropriate secretion signals may be incorporated into the dudulin2 polypeptide to allow secretion of the translated protein into the lumen of the endoplasmic reticulum, the periplasmic space or the extracellular environment. These signals may be endogenous to the dudulin2 polypeptide or they may be heterologous signals.
  • dudulin2 polypeptide If a dudulin2 polypeptide is to be expressed for use in cell-based screening assays, it is prefened that the polypeptide be produced at the cell surface. In this event, the cells may be harvested prior to use in the screening assay. If the dudulin2 polypeptide is secreted into the medium, the medium can be recovered in order to isolate said polypeptide. If produced intracellularly, the cells must first be lysed before the dudulin2 polypeptide is recovered.
  • Dudulin2 polypeptides can be recovered and purified from recombinant cell cultures or from other biological sources by well-known methods including, ammonium sulphate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, affinity chromatography, hydrophobic interaction chromatography, hydroxylapatite chromatography, molecular sieving chromatography, centrifugation methods, electrophoresis methods and lectin chromatography. In one embodiment, a combination of these methods is used. In another embodiment, high performance liquid chromatography is used.
  • an antibody which specifically binds to a dudulin2 polypeptide can be used to deplete a sample comprising a dudulin2 polypeptide of said polypeptide or to purify said polypeptide.
  • Techniques well-known in the art may be used for refolding to regenerate native or active conformations of the dudulin2 polypeptides when the polypeptides have been denatured during isolation and or purification.
  • dudulin2 polypeptides can be obtained from a biological sample from any source, such as and without limitation, a blood sample or tissue sample, e.g. lung tissue.
  • Dudulin2 polypeptides may be in the form of a 'mature' protein or may be part of a larger protein such as a fusion protein. It is often advantageous to include an additional amino acid sequence which contains secretory or leader sequences, a pre-, pro- or prepro- protein sequence, or a sequence which aids in purification such as an affinity tag, for example, but without limitation, multiple histidine residues, a FLAG tag, HA tag or myc tag. An additional sequence which may provide stability during recombinant production may also be used. Such sequences may be optionally removed as required by incorporating a cleavable sequence as an additional sequence or part thereof.
  • a dudulin2 polypeptide may be fused to other moieties including other polypeptides.
  • additional sequences and affinity tags are well known in the art.
  • Amino acid substitutions may be conservative or semi-conservative as known in the art and preferably do not significantly affect the desired activity of the polypeptide. Substitutions may be naturally occurring or may be introduced for example using mutagenesis (e.g. Hutchinson et al., 1978, J. Biol. Chem. 253:6551).
  • the amino acids glycine, alanine, valine, leucine and isoleucine can often be substituted for one another (amino acids having aliphatic side chains).
  • amino acids which can often be substituted for one another include but are not limited to: - phenylalanine, tyrosine and tryptophan (amino acids having aromatic side chains); - lysine, arginine and histidine (amino acids having basic side chains); - aspartate and glutamate (amino acids having acidic side chains); - asparagine and glutamine (amino acids having amide side chains); - cysteine and methionine (amino acids having sulphur-containing side chains); and - aspartic acid and glutamic acid can substitute for phospho-serine and phospho- threonine, respectively (amino acids with acidic side chains).
  • the substituted amino acid(s) do significantly affect the activity of the dudulin2 polypeptide and may be selected specifically to render dominant negative activity upon the peptide. In another embodiment, the substituted amino acid(s) may be selected specifically to render the polypeptide constitutively active.
  • modification of the amino acid sequence of epitopes of a dudulin2 polypeptide commonly refened to as epitope enhancement, is used to improve the efficacy of the vaccine. Modifications include naturally occurring modifications such as, and without limitation, post-translational modifications and also non-naturally occurring modifications such as may be introduced by mutagenesis.
  • a derivative of a dudulin2 polypeptide has at least 70% identity to the amino acid sequence shown in Figure 1 (SEQ ID NO:l), more preferably it has at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 98% identity.
  • Percentage identity is a well known concept in the art and can be calculated using, for example but without limitation, the BLASTTM software available from NCBI (Altschul, S.F. et al, 1990, J. Mol. Biol. 215:403-410; Gish, W. & States, DJ. 1993, Nature Genet. 3:266-272. Madden, T.L. et al, 1996, Meth. Enzymol.
  • a fragment of a dudulin2 polypeptide may also be of use in the methods of the invention and includes a fragment of a polypeptide having the amino acid sequence of SEQ ID NO:l, which has at least 70% homology over the length of the fragment.
  • said fragments are at least 10 amino acids in length, preferably they are at least 20, at least 30, at least 50 or at least 100 amino acids in length.
  • a fragment has at least 70% identity over its length to the amino acid sequence shown in Figure 1 (SEQ ID NO: 1), more preferably it has at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 98% identity.
  • a dudulin2 polypeptide is the active agent of a pharmaceutical composition for use in the treatment and/or prophylaxis of lung cancer, preferably recombinant dudulin2 polypeptides are used.
  • a dudulin2 polypeptide fused to another polypeptide such as, but not limited to, the protein transduction domain of the HIV/Tat protein which facilitates the entry of the fusion protein into a cell (Asoh, S.
  • the present invention provides a method of screening for and/or diagnosis or prognosis of lung cancer in a subject, and/or monitoring the effectiveness of lung cancer therapy, which comprises the step of detecting and/or quantifying in a biological sample obtained from said subject a dudulin2 polypeptide.
  • the dudulin2 polypeptide for use in the method of screening and/or diagnosis preferably: (a) comprises or consists of the amino acid sequence of SEQ ID NO: 1 ; (b) is a derivative having one or more amino acid substitutions, modifications, deletions or insertions relative to the amino acid sequence of SEQ ID NO: 1 which retains the activity of dudulin2; or (c) is a fragment of a polypeptide having the amino acid sequence of SEQ ID NO: 1, which is at least eight amino acids long and has at least 70% homology over the length of the fragment.
  • the expression is compared to a previously determined reference range.
  • the step of detecting comprises: (a) contacting the sample with a capture reagent that is specific for a polypeptide as defined in (a) to (c), above; and (b) detecting whether binding has occuned between the capture reagent and said polypeptide in the sample.
  • the captured polypeptide is detected using a directly or indirectly labelled detection reagent which may be immobilised on a solid phase.
  • a convenient means for detecting/quantifying a dudulin2 polypeptide involves the use of antibodies.
  • a dudulin2 polypeptide can be used as an immunogen to raise antibodies which interact with (bind to or recognise) said polypeptide using methods known in the art as described above.
  • the present invention provides the use of an antibody that specifically binds to at least one dudulin2 polypeptide for screening for and/or diagnosis of lung cancer in a subject or for monitoring the efficacy of an anti-lung cancer therapy.
  • the methods of diagnosis using an anti-dudulin2 polypeptide antibody can be used to identify an appropriate patient population for treatment according to the methods of the invention.
  • Dudulin2 antibodies can also be used, /nter alia, for the diagnosis of lung cancer by detecting dudulin2 expression in a biological sample of human tissue and/or in sub fractions thereof, for example but without limitation, membrane, cytosolic or nuclear subtractions.
  • the method of detecting a dudulin2 polypeptide in a biological sample comprises detecting and/or quantitating the amount of the dudulin2 polypeptide in said sample using a directly or indirectly labelled detection reagent.
  • a dudulin2 polypeptide can be detected by means of any immunoassay known in the art, including, without limitation, immunoprecipitation followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis, 2 dimensional gel electrophoresis, competitive and non-competitive assay systems using techniques such as Western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich” immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays and protein A immunoassays.
  • immunoassay known in the art, including, without limitation, immunoprecipitation followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis, 2 dimensional gel electrophoresis, competitive and non-competitive as
  • Detection of the interaction of an antibody with an antigen can be facilitated by coupling the antibody to a detectable substance for example, but without limitation, an enzyme (such as horseradish peroxidase, alkaline phosphatase, beta-galactosidase, acetylcholinesterase), a prosthetic group (such as streptavidin, avidin, biotin), a fluorescent material (such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, phycoerythrin), a luminescent material (such as luminol), a bioluminescent material (such as luciferase, luciferin, aequorin), a radioactive nuclide (such as 125 1, 131 I, " 1 In, 99 Tc) a positron emitting metal or a non- radioactive paramagnetic metal ion
  • kits comprising a capture reagent (e.g. an antibody) against a dudulin2 polypeptide as defined above.
  • a capture reagent e.g. an antibody
  • a kit may optionally comprise one or more of the following: (1) instructions for using the capture reagent for screening, diagnosis, prognosis, therapeutic monitoring or any combination of these applications; (2) a labelled binding partner to the capture reagent; (3) a solid phase (such as a reagent strip) upon which the capture reagent is immobilised; and (4) a label or insert indicating regulatory approval for screening, diagnostic, prognostic or therapeutic use or any combination thereof.
  • the anti-dudulin2 polypeptide capture reagent itself can be labelled with a detectable marker, e.g. a chemiluminescent, enzymatic, fluorescent, or radioactive moiety (see above).
  • a detectable marker e.g. a chemiluminescent, enzymatic, fluorescent, or radioactive moiety (see above).
  • detection and/or quantitation of a dudulin2 nucleic acid may be used in a method of screening for and/or diagnosis or prognosis of lung cancer in a subject, and/or monitoring the effectiveness of lung cancer therapy.
  • dudulin2 nucleic acids include those nucleic acid molecules which may have one or more of the following characteristics and thus may: d) comprise or consist of the DNA sequence of SEQ ID NO:2 or its RNA equivalent; e) have a sequence which is complementary to the sequences of d); f) have a sequence which codes for a dudulin2 polypeptide; g) have a sequence which shows substantial identity with any of those of d), e) and f); or h) is a fragment of d), e), f) or g), which is at least 15 nucleotides in length; and may have one or more of the following characteristics: 1) they may be DNA or RNA; 2) they may be single or double stranded; 3) they may be in substantially pure form.
  • dudulin2 nucleic acids may be provided in a form which is substantially free from contaminating proteins and/or from other nucleic acids; and 4) they may be with introns or without introns (e.g. as cDNA). Fragments of dudulin2 nucleic acids are preferably at least 20, at least 30, at least 50, at least 100 or at least 250 nucleotides in length.
  • the invention also provides the use of nucleic acids which are complementary to the dudulin2 nucleic acids described in (d)-(h) above, and can hybridise to said dudulin2 nucleic acids. Such nucleic acid molecules are refened to as "hybridising" nucleic acid molecules.
  • hybridising nucleic acid molecules can be useful as probes or primers.
  • Hybridising nucleic acid molecules may have a high degree of sequence identity along its length with a nucleic acid molecule within the scope of (d)-(h) above (e.g. at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity).
  • the use of hybridising nucleic acid molecules that can hybridise to any of the nucleic acid molecules discussed above, e.g. in hybridising assays, is also covered by the present invention.
  • Hybridisation assays can be used for screening, prognosis, diagnosis, or monitoring of therapy of lung cancer in a subject.
  • such a hybridisation assay comprises: i) contacting a biological sample, obtained from a subject, containing nucleic acid with a nucleic acid probe capable of hybridising to a dudulin2 nucleic acid molecule, under conditions such that hybridisation can occur; and ii) detecting or measuring any resulting hybridisation.
  • hybridising molecules are at least 10 nucleotides in length and are preferably at least 25 or at least 50 nucleotides in length. More preferably, the hybridising nucleic acid molecules specifically hybridise to nucleic acids within the scope of any one of (d) to (h), above. Most preferably, the hybridisation occurs under stringent hybridisation conditions.
  • the invention also provides a diagnostic kit comprising a nucleic acid probe capable of hybridising to RNA encoding a dudulin2 polypeptide, suitable reagents and instructions for use.
  • a diagnostic kit comprising in one or more containers a pair of primers that under appropriate reaction conditions can prime amplification of at least a portion of a dudulin2 nucleic acid molecule, such as by polymerase chain reaction (see e.g. Innis et al, 1990, PCR Protocols, Academic Press, Inc., San Diego, CA), ligase chain reaction (see EP 320,308) use of Q ⁇ replicase, cyclic probe reaction, or other methods known in the art.
  • primers are at least eight nucleotides long and will preferably be at least ten to twenty-five nucleotides long and more preferably fifteen to twenty- five nucleotides long.
  • primers of at least thirty or at least thirty- five nucleotides in length may be used.
  • the present invention provides the use of at least one dudulin2 nucleic acid in the manufacture of a medicament for use in the treatment and/or prophylaxis of lung cancer.
  • hybridising dudulin2 nucleic acid molecules are used as anti- sense molecules, to alter the expression of dudulin2 polypeptides by binding to complementary dudulin2 nucleic acids and can be used in the treatment and/or prophylaxis or prevention of lung cancer.
  • An antisense nucleic acid includes a dudulin2 nucleic acid capable of hybridising by virtue of some sequence complementarity to a portion of an RNA (preferably rnRNA) encoding a dudulin2 polypeptide.
  • the antisense nucleic acid can be complementary to a coding and/or non-coding region of an mRNA encoding such a polypeptide.
  • expression of a dudulin2 polypeptide is inhibited by use of antisense nucleic acids.
  • the present invention provides the therapeutic or prophylactic use of nucleic acids comprising at least eight nucleotides that are antisense to a gene or cDNA encoding a dudulin2 polypeptide.
  • symptoms of lung cancer may be ameliorated by decreasing the level or activity of a dudulin2 polypeptide by using gene sequences encoding a polypeptide as defined herein in conjunction with well-known gene "knock-out,” ribozyme or triple helix methods to decrease gene expression of the polypeptide.
  • ribozyme or triple helix molecules are used to modulate the activity, expression or synthesis of the gene, and thus to ameliorate the symptoms of lung cancer.
  • Such molecules may be designed to reduce or inhibit expression of a mutant or non-mutant target gene. Techniques for the production and use of such molecules are well known to those of skill in the art.
  • Endogenous dudulin2 polypeptide expression can also be reduced by inactivating or "knocking out" the gene encoding the polypeptide, or the promoter of such a gene, using targeted homologous recombination (e.g. see Smithies, et al, 1985, Nature 317:230-234; Thomas & Capecchi, 1987, Cell 51:503-512; Thompson et al, 1989, Cell 5:313-321; and Zijlstra et al, 1989, Nature 342:435-438).
  • targeted homologous recombination e.g. see Smithies, et al, 1985, Nature 317:230-234; Thomas & Capecchi, 1987, Cell 51:503-512; Thompson et al, 1989, Cell 5:313-321; and Zijlstra et al, 1989, Nature 342:435-438.
  • a mutant gene encoding a nonfunctional polypeptide (or a completely unrelated DNA sequence) flanked by DNA homologous to the endogenous dudulin2 gene (either the coding regions or regulatory regions of the gene encoding the polypeptide) can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that express the target gene in vivo. Insertion of the DNA construct, via targeted homologous recombination, results in inactivation of the target gene.
  • the nucleic acid is administered via gene therapy (see for example Hoshida, T. et al, 2002, Pancreas, 25:111-121; D uno, Y. 2002, Invest. Ophthalmol.
  • Gene therapy refers to administration to a subject of an expressed or expressible dudulin2 nucleic acid. Any of the methods for gene therapy available in the art can be used according to the present invention. Delivery of the therapeutic dudulin2 nucleic acid into a patient can be direct in vivo gene therapy (i.e. the patient is directly exposed to the nucleic acid or nucleic acid-containing vector) or indirect ex vivo gene therapy (i.e. cells are first transformed with the nucleic acid in vitro and then transplanted into the patient).
  • an expression vector containing the dudulin2 nucleic acid is administered in such a manner that it becomes intracellular, i.e. by infection using a defective or attenuated retroviral or other viral vectors as described, for example, in US 4,980,286 or by Robbins et al, 1998, Pharmacol. Ther. 80:35-47.
  • retroviral vectors that are known in the art are such as those described in
  • adenoviral vectors can be used which are advantageous due to their ability to infect non-dividing cells and such high-capacity adenoviral vectors are described in Kochanek (1999, Human Gene Therapy, 10:2451-2459).
  • Chimeric viral vectors that can be used are those described by Reynolds et al. (1999, Molecular Medicine Today, 1 :25 -31).
  • Hybrid vectors can also be used and are described by Jacoby et al. (1997, Gene Therapy, 4:1282-1283).
  • Direct injection of naked DNA or through the use of microparticle bombardment (e.g. Gene Gun®; Biolistic, Dupont) or by coating it with lipids can also be used in gene therapy.
  • Cell-surface receptors/transfecting compounds or through encapsulation in liposomes, microparticles or microcapsules or by administering the nucleic acid in linkage to a peptide which is known to enter the nucleus or by administering it in linkage to a ligand predisposed to receptor-mediated endocytosis See Wu & Wu, 1987, J. Biol. Chem., 262:4429-4432) can be used to target cell types which specifically express the receptors of interest.
  • a nucleic acid ligand compound comprising a dudulin2 nucleic acid
  • the ligand comprises a fusogenic viral peptide designed so as to disrupt endosomes, thus allowing the dudulin2 nucleic acid to avoid subsequent lysosomal degradation.
  • the dudulin2 nucleic acid can be targeted in vivo for cell specific endocytosis and expression by targeting a specific receptor such as that described in WO92/06180, WO93/14188 and WO 93/20221.
  • the nucleic acid can be introduced intracellularly and incorporated within the host cell genome for expression by homologous recombination (See Zijlstra et al, 1989, Nature, 342:435-428).
  • a gene is transfened into cells in vitro using tissue culture and the cells are delivered to the patient by various methods such as injecting subcutaneously, application of the cells into a skin graft and the intravenous injection of recombinant blood cells such as haematopoietic stem or progenitor cells.
  • Cells into which a dudulin2 nucleic acid can be introduced for the purposes of gene therapy include, for example, epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes and blood cells.
  • the blood cells that can be used include, for example, T-lymphocytes, B-lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryotcytes, granulocytes, haematopoietic cells or progenitor cells, and the like.
  • the pharmaceutical composition comprises a dudulin2 nucleic acid, said nucleic acid being part of an expression vector that expresses a dudulin2 polypeptide or chimeric protein thereof in a suitable host.
  • a nucleic acid has a promoter operably linked to the polypeptide coding region, said promoter being inducible or constitutive (and, optionally, tissue-specific).
  • a nucleic acid molecule is used in which the coding sequences and any other desired sequences are flanked by regions that promote homologous recombination at a desired site in the genome, thus providing for intrachromosomal expression of the nucleic acid (Roller & Smithies, 1989, Proc. Natl.
  • Dudulin2 nucleic acids may be obtained using standard cloning and screening techniques, from a cDNA library derived from mRNA in human cells, using expressed sequence tag (EST) analysis (Adams, M. et al, 1991, Science, 252:1651-1656; Adams, M. et al, 1992, Nature 355:632-634; Adams, M. et al, 1995, Nature, 377:Su ⁇ pl: 3-174).
  • EST expressed sequence tag
  • Dudulin2 nucleic acids can also be obtained from natural sources such as genomic DNA libraries or can be synthesized using well known and commercially available techniques.
  • the dudulin2 nucleic acids comprising coding sequence for dudulin2 polypeptides described above can be used for the recombinant production of said polypeptides.
  • the dudulin2 nucleic acids may include the coding sequence for the mature polypeptide, by itself; or the coding sequence for the mature polypeptide in reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre-, pro- or prepro-protein sequence, a cleavable sequence or other fusion peptide portions, such as an affinity tag or an additional sequence conferring stability during production of the polypeptide.
  • Prefened affinity tags include multiple histidine residues (for example see Gentz et al, 1989, Proc. Natl.
  • dudulin2 nucleic acids may also contain non-coding 5' and 3' sequences, such as transcribed, non-translated sequences, splicing and polyadenylation signals, ribosome binding sites and sequences that stabilize mRNA.
  • Dudulin2 polypeptide derivatives, above, can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of a dudulin2 nucleic acid such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein.
  • dudulin2 nucleic acid encoding a dudulin2 polypeptide may be obtained by a process which comprises the steps of screening an appropriate library under stringent hybridisation conditions with a labelled probe having the sequence of a dudulin2 nucleic acid as described in (d)-(h) above, and isolating full-length cDNA and genomic clones containing said nucleic acid sequence.
  • hybridisation techniques are well-known in the art.
  • One example of stringent hybridisation conditions is where attempted hybridisation is carried out at a temperature of from about 35°C to about 65°C using a salt solution of about 0.9M.
  • the skilled person will be able to vary such conditions as appropriate in order to take into account variables such as probe length, base composition, type of ions present, etc.
  • relatively stringent conditions such as low salt or high temperature conditions, are used to form the duplexes.
  • Highly stringent conditions include hybridisation to filter-bound DNA in 0.5M NaHPO 4 , 7% sodium dodecyl sulphate (SDS), ImM EDTA at 65°C, and washing in 0.1xSSC/0.1% SDS at 68°C (Ausubel F.M. et al, eds., 1989, Cunent Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3). For some applications, less stringent conditions for duplex formation are required. Moderately stringent conditions include washing in 0.2xSSC/0.1% SDS at 42°C (Ausubel et al, 1989, supra).
  • Hybridisation conditions can also be rendered more stringent by the addition of increasing amounts of formamide, to destabilise the hybrid duplex.
  • particular hybridisation conditions can be readily manipulated, and will generally be chosen as appropriate.
  • convenient hybridisation temperatures in the presence of 50% formamide are: 42°C for a probe which is 95-100% identical to the fragment of a gene encoding a polypeptide as defined herein, 37°C for 90-95% identity and 32°C for 70-90% identity.
  • an isolated cDNA sequence will be incomplete, in that the region coding for the polypeptide is cut short at the 5' end of the cDNA.
  • This technology uses cDNAs prepared from mRNA extracted from a chosen tissue followed by the ligation of an adaptor sequence onto each end. PCR is then carried out to amplify the missing 5 '-end of the cDNA using a combination of gene specific and adaptor specific oligonucleotide primers. The PCR reaction is then repeated using nested primers which have been designed to anneal with the amplified product, typically an adaptor specific primer that anneals further 3' in the adaptor sequence and a gene specific primer that anneals further 5' in the known gene sequence.
  • the products of this reaction can then be analysed by DNA sequencing and a full length cDNA constructed either by joining the product directly to the existing cDNA to give a complete sequence, or canying out a separate full length PCR using the new sequence information for the design of the 5' primer.
  • a further aspect of the invention relates to a vaccine composition of use in the treatment and/or prophylaxis of lung cancer.
  • a dudulin2 polypeptide or nucleic acid as described above can be used in the production of vaccines for treatment and/or prophylaxis of lung cancer.
  • Such material can be antigenic and/or immunogenic.
  • Antigenic includes a protein or nucleic acid that is capable of being used to raise antibodies or indeed is capable of inducing an antibody response in a subject.
  • Immunogenic material includes a protein or nucleic acid that is capable of eliciting an immune response in a subject.
  • the protein or nucleic acid may be capable of not only generating an antibody response but, in addition, a non-antibody based immune responses, i.e.
  • an antigenic or immunogenic polypeptide that are responsible for the antigenicity or immunogenicity of said polypeptide, i.e. an epitope or epitopes.
  • Amino acid and peptide characteristics well known to the skilled person can be used to predict the antigenic index (a measure of the probability that a region is antigenic) of a dudulin2 polypeptide.
  • the 'Peptidestructure' program Jameson and Wolf, 1988, CABIOS, 4(1):181
  • a technique refened to as 'Threading' Altuvia Y. et al, 1995, J. Mol. Biol.
  • the dudulin2 polypeptides may include one or more such epitopes or be sufficiently similar to such regions so as to retain their antigenic/immunogenic properties.
  • the dudulin2 polypeptide as the active agent of a pharmaceutical composition for use in a vaccine is a short peptide, preferably 5 to 20 amino acids long, more preferably 7 to 15 amino acids and most preferably 8 to 10 amino acids long.
  • Such a peptide may comprise a modified epitope to enhance the efficacy of the vaccine. Such modification can serve to (a) increase affinity of peptide for major histocompatibiltiy complex molecules; (b) increase T cell receptor triggering; or (c) inhibit proteo lysis of the peptide by serum peptidases.
  • the vaccine composition is preferably administered parenterally (e.g. subcutaneous, intramuscular, intravenous or intradermal injection) or by cellular transfection or infection using a bacterial or a viral vector, such as an adenoviral vector, comprising a dudulin2 nucleic acid sequence.
  • the present invention provides: a) the use of such a vaccine in inducing an immune response in a subject; and b) a method for the treatment and/or prophylaxis of lung cancer in a subject, or of vaccinating a subject against lung cancer which comprises the step of administering to the subject an effective amount of a dudulin2 polypeptide or nucleic acid, preferably as a vaccine.
  • a method for the treatment and/or prophylaxis of lung cancer in a subject, or of vaccinating a subject against lung cancer which comprises the step of administering to the subject an effective amount of a dudulin2 polypeptide or nucleic acid, preferably as a vaccine.
  • Figure 1 shows the amino acid sequence of dudulin2 (SwissProt Accession No. Q9NVB5; SEQ ID NO:l).
  • the tandem peptide is shown in bold and underlined typeface and the mass match in bold Italics.
  • Figure 2 shows a nucleic acid sequence of dudulin2 (SEQ ID NO:2).
  • Figure 3 shows the distribution of dudulin2 mRNA in normal tissues, a foetal lung cell line (MRC5), lung cancer cell lines (NCIH23, SHP77, CALU, DMS114 & A549 cells) and lung cancer samples; mRNA levels were quantified by real time RT-PCR and are expressed as the number of copies ng "1 cDNA.
  • Example 1 - Isolation of Dudulin2 Protein from an Osteosarcoma Cell Line Proteins in osteosarcoma membranes were separated by SDS-PAGE and analysed.
  • la Cell culture The human primary osteogenic sarcoma cell line, Saos-2 (ECACC Cat. No. 89050205), was cultured in McCoy's 5 A + 10% FBS.
  • the cells were grown at 37°C in a humidified atmosphere of 95% air and 5% carbon dioxide.
  • lb - Cell fractionation and plasma membrane generation Purified membrane preparations were isolated from the cell lines.
  • Adherent cells (2 x 10 8 ) were washed three times with PBS and scraped using a plastic cell lifter. Cells were centrifuged at 1000 x g for 5 min at 4°C and the cell pellet was resuspended in homogenisation buffer (250 mM Sucrose, lOmM HEPES, ImM EDTA, lmM Vanadate and 0.02%) azide, protease inhibitors). Cells were fractionated using a ball bearing homogeniser (8.002 mm ball, HGM Lab equipment) until approx.
  • homogenisation buffer 250 mM Sucrose, lOmM HEPES, ImM EDTA, lmM Vanadate and 0.02%
  • Membranes were fractionated using the method described by Pasquali et al fPasquali C. et al, 1999 J. Chromatography 722: pp 89-102). The fractionated cells were centrifuged at 3000 x g for 10 min at 4°C and the postnuclear supernatant was layered onto a 60% sucrose cushion and centrifuged at 100 000 x g for 45 min. The membranes were collected using a pasteur pipette and layered on a preformed 15 to 60% sucrose gradient and spun at 100 000 x g for 17hrs.
  • Proteins from the fractionated sucrose gradient were run on a 4-20% ID gel (Novex) and subject to western blotting; those fractions containing alkaline phosphatase and transferrin immunoreactivity but not oxidoreductase II or calnexin immunoreactivity were pooled and represented the plasma membrane fraction.
  • ID-gel analysis Plasma membrane fractions that had transferrin immunoreactivity but no oxidoreductase II or calnexin immunoreactivity were identified and pooled.
  • This pool which represented the plasma membrane fraction was diluted at least four times with lOmM HEPES, ImM EDTA ImM Vanadate, 0.02% Azide and added to a SW40 or SW60 tube and centrifuged at 100 000 x g for 45min with slow acceleration and deceleration. The supernatant was removed from the resulting membrane pellet and the pellet washed three times with PBS-CM. The membrane pellet was solubilised in 2% SDS in 63mM TrisHCl, pH 7.4. A protein assay was performed followed by the addition of mercaptoethanol (2% final), glycerol (10%) and bromophenol blue (0.0025% final) was added. A final protein concentration of 1 microgram/microlitre was used for ID-gel loading.
  • Id - ID-gel technology Protein or membrane pellets were solubilised in ID-sample buffer (approximately lmg/ml) and the mixture heated to 95°C for 5 min. Samples were separated using ID-gel electrophoresis on pre-cast 8-16% gradient gels purchased from Bio-Rad (Bio-Rad Laboratories, Hemel Hempstead, UK). A sample containing 30-50 micrograms of the protein mixtures obtained from a detergent extract were applied to the stacking gel wells using a micro-pipette. A well containing molecular weight markers (10, 15, 25, 37, 50, 75, 100, 150 and 250 kDa) was included for calibration by interpolation of the separating gel after imaging.
  • ID-sample buffer approximately lmg/ml
  • Sypro Red (Molecular Probes, Inc., Eugene, Oregon) is a suitable alternative dye for this purpose.
  • a digital image of the stained gel was obtained by scanning on a Storm Scanner (Molecular Dynamics Inc, USA) in the blue fluorescence mode. The captured image was used to determine the area of the gel to excise for in-gel proteolysis. le - Recovery and analysis of selected proteins Each vertical lane of the gel was excised using a stainless steel scalpel blade. Proteins were processed using in-gel digestion with trypsin (Modified trypsin, Promega, Wisconsin, USA) to generate tryptic digest peptides. Recovered samples were divided into two. Prior to MALDI analysis samples were desalted and concentrated using C18 Zip TipsTM (Millipore, Bedford, MA). Samples for tandem mass spectrometry were purified using a nano LC system (LC Packings, Amsterdam, The Netherlands) incorporating C18 SPE material.
  • Recovered peptide pools were analysed by MALDI-TOF-mass spectrometry (Voyager STR, Applied Biosystems, Framingham, MA) using a 337 nm wavelength laser for desorption and the reflectron mode of analysis. Pools were also analyzed by nano-LC tandem mass spectrometry (LC/MS/MS) using a Micromass Quadrupole Time-of-Flight (Q-TOF) mass spectrometer (Micromass, Altrincham, UK).
  • MALDI-TOF-mass spectrometry Voyager STR, Applied Biosystems, Framingham, MA
  • LC/MS/MS nano-LC tandem mass spectrometry
  • Q-TOF Micromass Quadrupole Time-of-Flight
  • Criteria for database identification included: the cleavage specificity of trypsin; the detection of a suite of a, b and y ions in peptides returned from the database, and a mass increment for all Cys residues to account for carbamidomethylation.
  • masses detected in MALDI-TOF mass spectra were assigned to tryptic digest peptides within the proteins identified.
  • tandem mass spectra of the peptides were interpreted manually, using methods known in the art.
  • Example 2 Normal Tissue Distribution and Disease Tissue Upregulation of Dudulin2 using Quantitative RT-PCR (Taqman) Analysis Clinical lung cancer samples were from Ardais Corp. (Lexington, MA). Real time RT-PCR was used to quantitatively measure dudulin2 expression in lung tumour tissues and in normal tissues.
  • the primers used for PCR were as follows: Sense, 5'- tcaatgtcatctctgcctggac- 3', (SEQ ID NO:3) Antisense, 5'- aggcatagaagcagacgaagag - 3' (SEQ ID NO:4) Reactions containing 5ng cDNA, SYBR green sequence detection reagents (PE Biosystems) and sense and antisense primers were assayed on an ABI7700 sequence detection system (PE Biosystems). The PCR conditions were 1 cycle at 50°C for 2 min, 1 cycle at 95°C for 10 min, and 40 cycles of 95°C for 15s, 65°C for lmin.
  • dudulin2 is a marker for the diagnosis of, and a target for the therapeutic intervention of, lung cancer.
  • Example 3 Cloning of Dudulin2 cDNA from a lung carcinoma cell line An ORF encoding the dudulin2 polypeptide was amplified from cDNAs prepared from the lung carcinoma cell line A-549 by PCR, using Herculase Hotstart DNA polymerase (Stratagene) and the following primers: dudulin2 sense 5'-agtagctgggattacaggcacg -3' (SEQ ID NO:5) and dudulin2 antisense 5'-ctgctcttctcttaacgtacgg -3' (SEQ ID NO:6).
  • the thermal cycling parameters were 1 cycle of 94°C for 2 min, 60 cycles of 94°C for 30s, 55°C for 30s, 72°C for 2 min, and 1 cycle of 72°C for 7 min.
  • PCR products were cloned into a TA cloning vector (pCR4-topo, Invitrogen) and the DNA sequence verified.
  • Example 4 Subcellular localisation of Dudulin2
  • the dudulin2 ORF was cloned into a mammalian GFP expression vector (pQBI 25fNl, Qbiogene) such that the C-terminus of dudulin2 was in frame with the GFP ORF encoded by the vector.
  • Dudulin2 was amplified by PCR with Pfu Turbo DNA polymerase (Stratagene), using dudulin2/pCR4-topo plasmid as a template and the following primers: dudulin2 GFP sense 5'-ccatggtaccgccaccatgccagaagagatggacaag-3' (SEQ ID NO: 7) and dudulin2 GFP antisense 5'-ccatgaattcgtacgtggctcgtctctcggcc-3' (SEQ ID NO:8).
  • the thermal cycling parameters were 1 cycle of 94°C for 2 min, 30 cycles of 94°C for 30s, 50°C for 30s, 72°C for 90s, and 1 cycle of 72°C for 7 min.
  • the PCR product was purified by electrophoresis on a 1.5% agarose gel, followed by gel extraction (Qiagen), and then digested with Kpnl and EcoRI restriction endonucleases. The digested product was then cloned into pQBI f25Nl vector that had been digested with the same enzymes, and the sequence of the recombinant clone (dudulin2/pQBIf25Nl) verified.
  • A-549 human lung carcinoma cells and MDA-MB-468 breast carcinoma cells were transiently transfected with dudulin2/pQBIf25Nl plasmid DNA using FuGene 6 reagent (Boehringer Mannheim) according to the manufacturer's instructions. Transfected cells were grown overnight at 37°C in an atmosphere of 95%) air and 5% CO 2 to allow expression of the dudulin2-GFP fusion protein. Cells were then washed with PBS, fixed with 4% paraformaldehyde/PBS and processed for fluorescent microscopy. Dudulin2-GFP protein shows a predominantly cytoskeletal localisation. The restricted expression profile of dudulin-2 mRNA indicates the suitability of this protein as a therapeutic target in lung cancer. Further, its intracellular localisation makes it accessible to the MHC peptide antigen presentation system, enabling therapeutic intervention via peptide immunisation or DNA vaccine technology.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Hematology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Hospice & Palliative Care (AREA)
  • Organic Chemistry (AREA)
  • Cell Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

L'invention concerne de nouvelles utilisations de la duduline 2 dans le diagnostic, le criblage, le traitement et la prophylaxie du cancer du poumon. L'invention concerne également des compositions comprenant de la duduline 2, en particulier des vaccins et des agents interagissant avec l'expression ou l'activité de la duduline 2 ou modulant l'expression de l'activité de la duduline 2, ou modulant l'expression de l'acide nucléique codant la duduline 2.
PCT/GB2004/004847 2003-11-18 2004-11-16 Proteine impliquee dans le cancer du poumon WO2005049066A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB0326834.9 2003-11-18
GBGB0326834.9A GB0326834D0 (en) 2003-11-18 2003-11-18 A protein involved in lung cancer

Publications (2)

Publication Number Publication Date
WO2005049066A2 true WO2005049066A2 (fr) 2005-06-02
WO2005049066A3 WO2005049066A3 (fr) 2005-07-14

Family

ID=29764007

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2004/004847 WO2005049066A2 (fr) 2003-11-18 2004-11-16 Proteine impliquee dans le cancer du poumon

Country Status (2)

Country Link
GB (1) GB0326834D0 (fr)
WO (1) WO2005049066A2 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001053454A2 (fr) * 2000-01-21 2001-07-26 Hyseq, Inc. Procedes et elements ayant trait a des polypeptides et des polynucleotides de type recepteurs couples a une proteine g
WO2001072962A2 (fr) * 2000-03-24 2001-10-04 Fahri Saatcioglu Molecules d'acide nucleique specifiques de la prostate ou des testicules, polypeptides, techniques de diagnostic, et traitement therapeutique

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001053454A2 (fr) * 2000-01-21 2001-07-26 Hyseq, Inc. Procedes et elements ayant trait a des polypeptides et des polynucleotides de type recepteurs couples a une proteine g
WO2001072962A2 (fr) * 2000-03-24 2001-10-04 Fahri Saatcioglu Molecules d'acide nucleique specifiques de la prostate ou des testicules, polypeptides, techniques de diagnostic, et traitement therapeutique

Also Published As

Publication number Publication date
WO2005049066A3 (fr) 2005-07-14
GB0326834D0 (en) 2003-12-24

Similar Documents

Publication Publication Date Title
US8263071B2 (en) Protein involved in ovarian cancer
AU2003249072B2 (en) PTK7 protein involvement in carcinoma
US20070142276A1 (en) Protein involved in carcinoma
US20090258019A1 (en) Diagnosis of carcinoma using RAIG1 polypeptides
US20070141061A1 (en) Protein involved in carcinoma
US20090214540A1 (en) Protein involved in cancer
WO2005105143A2 (fr) Protéine impliquée dans le cancer
WO2005049066A2 (fr) Proteine impliquee dans le cancer du poumon
WO2006000753A2 (fr) Proteine impliquee dans le cancer du colon, colorectal, des ovaires, des poumons et/ou du foie
US20070269431A1 (en) Protein Involved In Cancer
WO2006003427A1 (fr) Proteine impliquee dans le carcinome
GB2455634A (en) Treatment of cancer
WO2005019257A1 (fr) Proteine impliquee dans le cancer du pancreas

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase