WO2005040833A1

WO2005040833A1 - Regulation of human metastin recognising receptors

Info

Publication number: WO2005040833A1
Application number: PCT/EP2004/011250
Authority: WO
Inventors: Noriyuki Yamamoto; Hiroko Matsumoto; Fumihiko Hayashi; Masaomi Tajimi
Original assignee: Bayer Healthcare Ag
Priority date: 2003-10-21
Filing date: 2004-10-06
Publication date: 2005-05-06

Abstract

Reagents which regulate human metastin recognising receptor and reagents which bind to human metastin recognising receptor gene products can play a role in preventing, ameliorating, or correcting dysfunctions or diseases including, but not limited to, urological disorder or disease such as detrusor overactivity (overactive bladder), urinary incontinence, neurogenic detrusor oeractivity (detrusor hyperflexia), idiopathic detrusor overactivity (detrusor instability), benign prostatic hyperplasia, and lower urinary tract symptoms.

Description

REGULATION OF HUMAN METASTIN RECOGNISING RECEPTORS

TECHNICAL FIELD OF THE INVENTION

The present invention relates to modulators of human metastin recognising receptors. More particularly, the present invention relates to modulators of human metastin recognising receptors and use of such modulators for the treatment or prevention of urological disorder or disease such as detrusor overactivity (overactive bladder), urinary incontinence, neurogenic detrusor oeractivity (detrusor hyperflexia), idiopathic detrusor overactivity (detrusor instability), benign prostatic hyperplasia, and lower urinary tract symptoms.

BACKGROUND OF THE INVENTION

G-Protein Coupled Receptors

Many medically significant biological processes are mediated by signal transduction pathways that involve G-proteins (Lefkowitz, Nature 351, 353-354, 1991). The family of G-protein coupled receptors (GPCR) includes receptors for hormones, neurotransmitters, growth factors, and viruses. Specific examples of GPCRs include receptors for such diverse agents as dopamine, calcitonin, adrenergic hormones, endothelin. cAMP, adenosine,- acetylcholine, serotonin, histamine, thrombin, kinin, ' follicle stimulating hormone, opsins, endothelial differentiation gene-1, rhodopsins, odorants, cytomegalovirus, , G-proteins themselves, effector proteins such as phospholipase C, adenyl cyclase, and phosphodiesterase, and actuator proteins such as protein kinase A and protein kinase C.

GPCRs possess seven conserved membrane-spanning domains connecting at least eight divergent hydrophilic loops. GPCRs (also known as 7TM receptors) have been characterized as including these seven conserved hydrophobic stretches of about 20 to 30 amino acids, connecting at least eight divergent hydrophilic loops. Most GPCRs have single conserved cysteine residues in each of the first two extracellular loops, which form disulfide bonds that are believed to stabilize functional protein structure. The seven transmembrane regions are designated as TM1. TM2, TM3, TM4, TM5, TM6, and TM7. TM3 has been implicated in signal transduction.

Phosphorylation and lipidation (palmitylation or famesylation) of cysteine residues can influence signal transduction of some GPCRs. Most GPCRs contain potential phosphorylation sites within the third cytoplasmic loop and/or the carboxy terminus. For several GPCRs, such as the β- adrenergic receptor, phosphorylation by protein kinase A and/or specific receptor kinases mediates receptor desensitization. For some receptors, the ligand binding sites of GPCRs are believed to comprise hyαYophilic sockets formed by several GPCR transmembrane domains. The hydrophilic sockets are surrounded by hydrophobic residues of the GPCRs. The hydrophilic side of each GPCR transmembrane helix is postulated to face inward and form a polar ligand binding site. TM3 has been implicated in several GPCRs as having a ligand binding site, such as the TM3 aspartate residue. TM5 serines, a TM6 asparagine, and TM6 or TM7 phenylalanines or tyrosines also are . implicated in ligand binding.

GPCRs are coupled inside the cell by heterotrimeric G-proteins to various intracellular enzymes,- ion channels, and transporters (see Johnson et al., Endoc. Rev. 10, 317-331, 1989). Different G- protem alpha-subunits preferentially stimulate particular effectors to modulate various biological functions in a cell. Phosphorylation of cytoplasmic residues of GPCRs is an important mechanism for the regulation of some GPCRs. For example, in one form of signal transduction, the effect of hormone binding is the activation inside the cell of the enzyme, adenylate cyclase. Enzyme activation by hormones is dependent on the presence of the nucleotide GTP. GTP also influences hormone binding. A G-protein connects the hormone receptor to adenylate cyclase. G-protein exchanges GTP for bound GDP when activated by a hormone receptor. The GTP-carrying form then binds to activated adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed by the G-protein itself, returns the G-protein to its basal, inactive form. Thus, the G-protein serves a dual role, as an intermediate that relays the signal from receptor to effector, and as a clock that controls the duration of the signal.

Over the past 15 years, nearly 350 therapeutic agents targeting GPCRs receptors have been successfully introduced onto the market. This indicates that these receptors have an established, proven history as therapeutic targets.

GPR54

GPR54, also known as metastm receptor, KiSS receptor, AXOR12, or HOT7T175 (Nature 411:613, 2001; JBC 276:28969, 2001; JBC 276:34631, 2001), maps on chromosome 19, at 19pl3.3. The protem (398 aa) contains one Rhodopsin-like GPCR superfa ily motif.

Although the mRNA of GPR54 is known to be expressed in spinal cord (JBC 276:34631, 2001), its role in the bladder regulation is unknown.

Mrss

Dong et al. (Cell 106:619, 2001) identified, in the mouse and human genomes, a family of G protein-coupled receptors (GPCRs) related to the MAS1 oncogene (Mrg family GPCRs), including ^■ mouse MrgCl l. Several pseudogenes were also identified. A subset of Mrgs was expresseα in specific subpopulations of sensory neurons that detect painful stimuli. The expression patterns of these genes thus revealed an unexpected degree of molecular diversity among nociceptive neurons. Some Mrgs could be specifically activated in heterologous cells by RFamide neuropeptides such as NPFF and NPAF, which are analgesic in vivo. Mouse MrgCl l can be activated by a metastin peptide (KiSS(l 12-121)) (ProNAS 99:14740, 2002). The rat ortholog of MrgCl l, rat sensory neuron-specific GPCR 1 (rSNSRl), is expressed in a subset of dorsal root ganglia sensory neurons (Nature Neurosci 5:201, 2002). Their roles in the bladder regulation are unknown.

KiSSl and metastin ■ KiSSl is a human metastasis suppressor gene that suppresses metastases of melanomas and breast carcinomas without affecting tumorigenicity. Using a modified subtractive hybridization approach, Lee et al. (J Nat Cancer hist 88:1731, 1996) isolated a cDNA expressed in hybrid chromosome 6- C8161 cells but not in parental C8161 cells. They designated the cDNA KiSSl. The KiSSl protein consists of 145 amino acids. Northern blot analysis revealed that KiSSl was expressed as a 1-kb mRNA in chromosome 6-C8161 hybrid cell lines as well as in normal placenta tissue. Low levels of smaller transcripts were observed in pancreas and kidney. Lee et al. (J Nat Cancer Inst 88:1731, 1996) did not detect KiSSl expression in any cell line capable of metastasizing in athymic nude mice. Lee et al. (J Nat Cancer Inst 88:1731, 1996) observed that expression of KiSSl in C8I61 melanoma cells suppressed metastasis, suggesting that KiSSl plays a role in the regulation of cancer metastasis in human malignant melanoma. Lee and Welch (Cancer Res 57:2384, 1997) demonstrated that expression of KiSSl in human breast carcinoma cells reduced metastatic potential by 95% compared to control cells but did not suppress tumorigenicity. The authors concluded that KiSSl also functions as a metastasis suppressor gene in at least some human breast cancers. Ohtaki et al. (Nature 411:613, 2001) demonstrated that KiSSl encodes a carboxy-termmally amidated peptide with 54 amino acid residues, which they isolated from human placenta as the endogenous ligand of an orphan G protein-coupled receptor (GPR54). They named the truncated form of KiSSl 'metastin.' Metastin inhibits chemotaxis and invasion of GPR54-transfected CHO cells in vitro and attenuates pulmonary metastasis of GPR54-transfected B16-BL6 melanomas in vivo. Although metastin-like immunoreactivity is known to be expressed in laminae I and II of the spinal cord dorsal horn (Neurosci Lett 335:197, 2003), and the expression of KiSSl mRNA in normal bladder epithelium has been demonstrated (Am J Phathol 162:609, 2003), roleof KiSSl/metasitin in the bladder function is unknown. Urinary Incontinence

Urinary incontinence (UI) is the involuntary loss of urine. Urge urinary incontinence (UUI) is one of the most common types of UI together with stress urinary incontinence (SUT) which is usually caused by a defect in the urethral closure mechanism. UUI is often associated with neurological disorders or diseases causing neuronal damages such as dementia, Parkinson's disease, multiple sclerosis, stroke and diabetes, although it also occurs in individuals with no such disorders. One of the usual causes of UUI is overactive bladder (OAB) which is a medical condition referring to the symptoms of frequency and urgency derived from abnormal contractions and instability of the detrusor muscle. There are several medications for urinary incontinence on the market today mainly to help treating UUI. Therapy for OAB is focused on drugs that affect peripheral neural control mechanisms or . those that act directly on bladder detrusor smooth muscle contraction, with a major emphasis on development of anticholinergic agents. These agents can inhibit the parasympathetic nerves which control bladder voiding or can exert a direct spasmolytic effect on the detrusor muscle of the , bladder. This results in a decrease in intravesicular pressure, an increase in capacity and a reduction in the frequency of bladder contraction. Orally active anticholinergic drugs such as propantheline (ProBanthine), tolterodine tartrate (Detrol) and oxybutynin (Ditropan) are the most commonly prescribed drugs. However, their most serious drawbacks are unacceptable side effects such as dry mouth, abnormal visions, constipation, and central nervous system disturbances. These side effects lead to poor compliance. Dry mouth symptoms alone are responsible for a 70% non- compliance rate with oxybutynin. The inadequacies of present therapies highlight the need for novel, efficacious, safe, orally available drugs that have fewer side effects.

Benign Prostatic Hyperylacia

Disease Summary

^' Benign prostatic hyperplacia (BPH) is the benign nodular hyperplasia of the periurethral prostate gland commonly seen in men over the age of 50. The overgrowth occurs in the central area of the prostate called the transition zone, which wraps around the urethra. BPH causes variable degrees of bladder outlet obstruction resulting in progressive lower urinary tract syndromes (LUTS) characterized by urinary frequency, urgency, and nocturia due to incomplete emptying and rapid refilling of the bladder. Bladder outlet obstruction induces bladder hypertrophy and NGF production in the bladder (J Clin Invest 88:1709, 1991). This NGF sensitizes C-fiber sensory afferent neurons to induce detrusor overactivity (J Urol 165:975, 2001). This might be one of several causes for irritative symptoms in LUTS. The actual cause of BPH is unknown but may involve age-related alterations in balance of steroidal sex hormones.

The selective αl-adrenoceptor antagonists, such as prazosin, indoramin and tamsulosin are used as an adjunct in the symptomatic, treatment of urinary obstruction caused by BPH, although they do not affect on the underlying cause of BPH. In BPH, increased sympathetic tone exacerbates the degree of obstruction of the urethra through contraction of prostatic and urethral smooth muscle. These compounds inhibit sympathetic activity, thereby relaxing the smooth muscle of the urinary

, tract. Uroselective αl -antagonists and ocl -antagonists with high tissue selectivity for lower urinary tract smooth muscle that do not provoke hypotensive side-effects should be developed for the treatment.

Drugs blocking dihydrotestosterone have been used to reduce the size of the prostate. 5α-reductase inhibitors such as finasteride are prescribed for BPH. These agents selectively inhibit 5α-reductase which mediates conversion of testosterone to dihydrotestosterone, thereby reducing -plasma dihydrotestosterone levels and thus prostate growth. The 5α-reductase inhibitors do not bind to androgen receptors and do not affect testosterone levels nor do they possess feminizing side- effects.

Androgen receptor antagonists are used for the treatment of prostatic hyperplasia due to excessive action or production of testosterone. Various antiandrogens are under investigation for BPH including chlormadione derivatives with no estrogenic activity, orally-active aromatase inhibitors, luteinizing hormone-releasing hormone (LHRH) analogues.

Lower Urinary Tract Symptoms

BPH causes variable degrees of bladder outlet obstruction, resulting in progressive lower urinary tract symptoms (LUTS) characterized by urinary frequency, urgency, and nocturia due to incomplete emptying and rapid refilling of the 'bladder. It was suggested that one of the major causes of LUTS induced by partial outlet obstruction is a markedly enhanced spinal reflex of the bladder neuronal cirquit (J Urol 160:34, 1998; J Urol 162:1890, 1999). SUMMARY OF THE INVENTION

It is an object of the present invention to provide reagents and methods for regulating a metastin recognising receptor. This and other objectives of the invention are provided by one of the embodiments described below.

One embodiment of the invention is a method of screening for agents which can decrease or regulate the activity of a metastin recognising receptor, thus useful for treating the diseases associated with the activity of metastin recognising receptors, which is urological disorder or disease such as urinary incontinence, urge urinary incontinence, overactive bladder, and be ign prostatic hyperplasia. A test compound is contacted with a any human metastin recognising re- ceptor polypeptide. Binding of the test compound to the polypeptide is detected. A test conn pound which binds to the polypeptide is identified as a potential therapeutic agent for decreasing the activity of a human metastin recognising receptor and for treating urological disorders.

Another embodiment of the invention is a method of screening for agents which may be useful for treating diseases associated with the activity of metastm recognising receptor, which is urological disorder or disease such as urinary incontinence, urge urinary incontinence, overactive bladder, and benign prostatic hyperplasia. A test compound is contacted with an any human metastin recognising receptor polynucleotide. Binding of the test compound to the polynucleotide is detected. A test compound which binds to the polynucleotide is identified as a potential therapeutic agent for decreasing the activity of a human metastm recognising receptor and for treating urological disorders. *

Another embodiment of the invention is a method of screening for agents which may be useful for treating diseases associated with the activity of metastin recognising receptor, which is urological disorder or disease such as urinary incontinence, urge urinary incontinence, overactive bladder, and benign prostatic hyperplasia. A test compound is contacted with a cell expressing human metastin recognizing receptor polypeptide. Binding of the test compound to the cell is detected. A test compound which binds to the cell is identified as a potential therapeutic agent for decreasing the activity of a human metastin recognising receptor and for treating urological disorders.

Yet another embodiment of the invention is a reagent that modulates the activity of a human metastm recognising receptor polypeptide or polynucleotide. Such reagent can be identified by any of the above-mentioned method and useful to treat urological disorders. Further embodiment of the invention is a pharmaceutical composition for the treatnient of urological disorders. The composition comprises the above-metnioned reagent and a pharmaceutically acceptable carrier.

Another embodiment of the invention is a use of the above-mentioned reagent in the preparation of a medicament for modulating the activity of human metastin recognising receptor in a urological disorder. The urological disorder can be at least one selected from the group consisting of a disorder caused by overactive bladder, urinary incontinence, detrusor hyperflexia, detrusor instability, benign prostatic hyperplasia, and one of lower urinary tract symptoms.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig. 1 shows expression profile of KiSSl and GPR54 in rat tissues

Fig. 2 shows effect of intrathecal injection of metastin(45-54) on bladder function in anesthetized rats.

Fig. 3 shows effect of intraveous injection of metastm(45-54) on bladder function in anesthetized rats.

Fig. 4 shows hexamethoniurn inhibited metastin(45-54)-induced bladder contraction.

DETAILED DESCRIPTION OF THE INVENTION

It is a discovery of the present invention that human metastin recognising receptors can be regulated to control urological disorders or diseases, such as detrusor overactivity (overactive bladder), urinary incontinence, neurogenic detrusor oeractivity (detrusor hyperflexia), idiopathic detrusor overactivity (detrusor instability), benign prostatic hyperplasia, and lower urinary tract symptoms.

The expression of KiSS-1 in normal bladder epithelium has been demonstrated (Am J Phathol 2003, 162:609). Metastin-like immunoreactivity is demonstrated in rat spinal cord dorsal horn (Neurosci Lett 2003, 335:197).

Messenger RNA of GPR54 is expressed in spinal cord (J Biol Chem 2001, 276:28969) (J Biol Chem 2001, 276:34631). Further, GPR54 is reported to couple to Gq, which decreases the activation threshold of neurons by activation of PLC/TP3/Ca2+/PKC pathway (J Biol Chem 2001, 276:28969) (J Biol Chem 2001, 276:34631). The mouse MrgCll can be activated by a metastin peptide (KiSS(l 12-121)) (ProNAS 99.'1^"4740, 2002). The rat ortholog of mouse MrgCl 1, rat sensory neuron-specific GPCR 1 (rSNSRl) (Nature Neurosci5:201, 2002), is expressed in a subset of dorsal root ganglia sensory neurons.

The present inventors discovered that the expression of KiSS was detected in bladder, DRG and spinal cord (brain as a positive control) by RT-PCR analysis, but that of GPR54 was observed only in spinal cord.

The present inventors administered metastin(45-54) peptide intrathecally or intraveniously in anesthetized rats. In both cases, dose-dependent bladder contraction was observed. Pretreatment with hexamethonium prevented the metastin(45-54) peptide-induced bladder contraction, demonstrating that metastin(45-54) does not contract bladder directly.

The present invention demonstrated that stimulation of metastin recognising receptors in spinal cord activated bladder efferent neurons to induce bladder contraction.

This strongly suggests that metastin recognising receptors are involved in the spinal reflex mechanism of detrusor overactivity. The present invention provides a link between human metastin recognising receptors and treatment of urological disorders using modulator that inhibit human metastin recognising receptor signaling. Metastin recognising receptors can be regulated to control urological disorder or disease such as detrusor overactivity (overactive bladder), urinary incontinence, neurogenic detrusor oeractivity (detrusor hyperflexia), idiopathic detrusor overactivity (detrusor instability), benign prostatic hyperplasia, and lower urinary tract symptoms.

DEFINITION

Urological disorders as used herein can be diseases of the bladder including but not limited to urinary incontinence including overactive/oversensitive bladder, overflow urinary incontinence, stress urinary incontinence caused by dysfunction of the bladder, urethra or central/peripheral nervous system. .

As used herein a urological disorder can be a disorder of the prostate including but not limited to "a prostate disorder" which refers to an abnormal condition occurring in the male pelvic region characterized by, e.g., male sexual dysfunction and/or urinary symptoms. This disorder may be manifested in the form of genitourinary inflammation (e.g., inflammation of smooth muscle cells) as in several common diseases of the prostate including prostatitis, benign prostatic hyperplasia and cancer, e.g., adenocarcinoma or carcinoma, of the prostate. As used herein the term "metastin recognizing receptor" refers to receptor to which meta_Stm(45- 54) peptide can bind and includes, but not limited to GPR54 and Mrgs. Other metastin recognizing receptors can be found by homology search-based approach, subtraction cloning approach, or expression cloning approach and they are defined by a receptor binding assay with the membrane fraction from recombinant cells expressing one of metastm recognizing receptors as done for GPR54 (Nature 411:613, 2001; JBC 276:34631, 2001) by the criteria of Kd to [^l25T\- metastin(45-54) below 100 nM.

Polypeptides

"GPR54" or "GPR54 polypeptide" as used herein refer to receptor also known as metastin receptor, KiSS receptor, AXOR12, or HOT7T175 (Nature 411:613, 2001; JBC 276:28969, 2001; JBC 276:34631, 2001). "GPR54" or "GPR54 polypeptide" also include polypeptide that comprise at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 400, 500, 600, 700, 800, 900, or 1000 contiguous amino acid shown in SEQ ED NO: 2 or a biologically active variant thereof, as defined below. "GPR54" or "GPR54 polypeptide" is encoded by any polynucleotide being selected from the group consisting of:

a) a polynucleotide encoding a human metastin recognising receptor polypeptide comprising an amino acid sequence selected from the group constisting of: amino acid sequences which are at least about 50% identical to the amino acid sequences shown in SEQ ID NO:2 ; and the amino acid sequences shown in SEQ ID NO:2;

b) a polynucleotide comprising the sequences of SEQ ID NO: 1 ;

c) a polynucleotide which hybridizes under stringent conditions to a polynucleotide specified in (a) and (b) and encodes a human metastin recognising receptor;

d) a polynucleotide the nucleic acid sequence of which deviates from the nucleic acid sequences specified in (a) to (c) due to the degeneration of the genetic code and encodes a human metastin recognising receptor; and

e) a polynucleotide, which represents a fragment, derivative or allelic variation of a nucleic acid sequence specified in (a) to (d) and encodes a human metastm recognising receptor.

"Mrgs" or "Mrg polypeptides" as used herein refer to mouse MrgCl l and its rat ortholog, rat sensory neuron-specific GPCR 1 (rSNSRl) and their human counterparts. It also includes polypeptide that comprise at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250^', 275, 300, 400, 500, 600, 700, 800, 900, or 1000 contiguous amino acid shown in SEQ ID NO: 4 and 6 or a biologically active variant thereof, as defined below.

"Mrgs" or "Mrg polypeptides" is encoded by any polynucleotide being selected from the group consisting of:

a) a polynucleotide encoding a human metastin recognising receptor polypeptide comprising an amino acid sequence selected from the group constisting of: amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO:4 or 6 ; and the amino acid sequence shown in SEQ ID NO:4 or 6;

b) a polynucleotide comprising the sequence of SEQ ID NO: 3 or 5;

c) a polynucleotide which hybridizes under stringent conditions to a polynucleotide specified in (a) and (b) and encodes a human metastm recognising receptor;

e) a polynucleotide, which represents a fragment, derivative or allelic variation of a nucleic acid sequence specified in (a) to (d) and encodes a human metastin recognising receptor. A metastin recognising receptor polypeptide of the invention therefore can be a portion of a metastin recognising receptor protein, a full-length metastin recognising receptor protein, or a fusion protein comprising all or a portion of a metastin recognising receptor protem.

Biologically Active Variants

Human metastin recognising receptor polypeptide variants that are biologically active, e.g., retain the ability to bind with metastin, also are metastin recognising receptor polypeptides. Preferably, naturally or non-naturally occurring metastin recognising receptor polypeptide variants have amino acid sequences which are at least about 50, 55, 60, 65, or 70, preferably about 75, 80, 85, 90, 96, 96, 98, or 99% identical to any one of the amino acid sequence shown in SEQ ID NO: 2 or 4 or 6 or a fragment thereof. Percent identity between a putative metastm recognising receptor polypeptide variant and an amino acid sequence of SEQ ID NOs: 2 or 4 or 6 is determined by conventional methods. See, for example, Altschul et al., Bull. Math. Bio. 48:603 (1986), and . Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915 (1992). Briefly, two ammo acid sequences are aligned to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of 1, and the "BLOSUM62" scoring matrix of Henikoff & Henikoff, 1992.

Those skilled in the art appreciate that there are many established algorithms available to align two

^• 5 amino acid sequences. The "FASTA" similarity search algorithm of Pearson & Lipman is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant. The FASTA algorithm is described by Pearson & Lipman, Proc. Nat'l Acad. Sci: USA 85:2444(1988), and by Pearson, Meth. Enzymol. 183:63 (1990). Briefly, FASTA first characterizes sequence similarity

10 by identifying regions shared by the query sequence (e.g., SEQ ID NO: 2 or 4 or 6) and a test sequence that have either the highest density of identities (if the ktup variable is 1) or pairs of identities (if ktup=2), without considering conservative amino acid substitutions, insertions, or deletions. The ten regions with the highest density of identities are then rescored by comparing the similarity of all paired amino acids using an amino acid substitution matrix, and the ends of the

15 regions are "frimmed" to include only those residues tha contribute to the highest score. If there are several regions with scores greater than the "cutoff value (calculated by a predetermined formula based upon the length of the sequence the ktup value), then the trimmed initial regions are examined to determine whether the regions can be joined to form an approximate alignment with gaps. Finally, the highest scoring regions of the two amino acid sequences are aligned using a

20 . modification - of the Needleman-Wunsch-Sellers algorithm (Needleman & Wunsch, J. Mol. Biol.48:444 (1970); Sellers, SIAM J. Appl. Math.26:787 (1974)), which allows for amino acid insertions and deletions. Preferred parameters for FASTA analysis are: ktup=l, gap opening penalty=10, gap extension penalty=l, and substitution matrix=BLOSUM62. These parameters can be introduced into a FASTA program by modifying the scoring matrix file ("SMATRTX"), as

25 explained in Appendix 2 of Pearson, Meth. Enzymol. 183:63 (1990).

FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above. For nucleotide sequence comparisons, the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.

Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or 30 deletions. Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine. Amino acid insertions or deletions are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of a metastin recognising receptor polypeptide can be found using computer programs well known in the art, such as DNASTAR software. Whether an amino acid change results in a biologically active metastm recognising receptor polypeptide can readily be determined by assaying for functional activity, as described for example, in the "Functional Assays" section, below.

Fusion Proteins

Fusion proteins are useful for generating antibodies against metastin recognising receptor polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins that interact with portions of a metastin recognising receptor polypeptide. Protein affinity chromatography or library-based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.

A metastm recognising receptor polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond. The first polypeptide segment comprises at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 400, 500, 600, 700, 800, 900, or 1000 contiguous amino acids of any one of the sequences shown in SEQ ID NO: 2, 4, and 6 or of a biologically active variant, such as those described above. The first polypeptide segment also can comprise full-length metastin recognising receptor protein.

The second polypeptide segment can be a full-length protem or a protein fragment. Proteins commonly used in fusion protein construction include β-galactosidase, β-glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT). Additionally, epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags. Other fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and heφes simplex virus (HSV) BP16 protein fusions. A fusion protein also can be engineered to contain a cleavage site located between the metastin recognising receptor polypeptide-encoding sequence and the heterologous protein sequence, so that the metastin recognising receptor polypeptide can be cleaved and purified away from the heterologous moiety. A fusion protein can be synthesized chemically, as is known in the art. Preferably, a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology. Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises coding sequences of SEQ ID NO: 2 or 4 or 6 in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art. Many kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WI), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL International Corporation (MIC; Watertown, MA), and Quantum Biotechnologies (Montreal, Canada; 1-888-DNA-KITS).

Identification of Species Homologs

Species homologs of human metastin recognising receptor polypeptide can be obtained using metastin recognising receptor polypeptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of metastin recognising receptor polypeptide, and expressing the cDNAs as is known in the art.

Polynucleotides

A metastin recognising receptor polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a metastm recognising receptor polypeptide. A coding sequence for human metastin recognising receptor is shown in SEQ ID NO: 1, 3, or 5.

Degenerate nucleotide sequences encoding human metastin recognising receptor polypeptides, as well as homologous nucleotide sequences which are at least about 50, 55, 60, 65, 70, preferably about 75, 90, 96, 98, or 99% identical to the nucleotide sequence shown in SEQ ID No 1, 3, or 5 or its complement also are metastin recognising receptor polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2. Complementary DNA (cDNA) molecules, species homologs, and variants of metastin recognising receptor polynucleotides that encode biologically active metastin recognising receptor polypeptides also are metastin recognising receptor polynucleotides. Identification of Polynucleotide Variants and Homologs

Variants and homologs of the metastin recognising receptor polynucleotides described above also are metastin recognising receptor polynucleotides. Typically, homologous metastin recognising receptor polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known metastin recognising receptor polynucleotides under stringent conditions, as is known in the art. For example, using the following wash conditions-2X SSC (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, room temperature twice, 30 minutes each; then 2X SSC, 0.1% SDS, 50°C once, 30 minutes; then 2X SSC, room temperature twice, 10 minutes each-homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches.

Species homologs of the metastin recognising receptor polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast. Human variants of metastin recognising receptor polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the T_m of a double-stranded DNA decreases by 1-1.5 °C with every 1% decrease in homology (Bonner et al., J. Mol. Biol. 81, 123 (1973). Variants of human metastin recognising receptor polynucleotides or metastin recognising receptor polynucleotides of other species can therefore be identified by hybridizing a putative homologous metastin recognising receptor polynucleotide with a polynucleotide having a any one of the nucleotide sequences of SEQ ID Nos 1 and 3 or the complement thereof to form a test hybrid. The melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.

Nucleotide sequences which hybridize to metastin recognising receptor polynucleotides or their complements following stringent hybridization and/or wash conditions also are metastin recognising receptor polynucleotides. Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.

Typically, for stringent hybridization conditions a combination of temperature and salt concentration should be chosen that is approximately 12-20 °C below the calculated T_m of the hybrid under study. The T_m of a hybrid between a metastin recognising receptor polynucleotide having one nucleotide sequence selected from the group consisting of SEQ ID Nos : 1 and 3 or the complement thereof and a polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for exampld, ^"using the equation of Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390 (1962):

T_m = 81.5 °C - 16.6(log₁₀[Na⁺]) + 0.41(%G + C) - 0.63(%formamide) - 600/1), where / = the length of the hybrid in basepairs.

Stringent wash conditions include, for example, 4X SSC at 65 °C, or 50% formamide, 4X SSC at 42 °C, or 0.5X SSC, 0.1% SDS at 65 °C. Highly stringent wash conditions include, for example, 0.2X SSC at 65 °C.

Preparation of Polynucleotides

A metastin recognising receptor polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids. Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer.

Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated metastin recognising receptor polynucleotides. For example, restriction enzymes and probes can be used to isolate polynucleotide fragments, hich comprise metastin recognising receptor nucleotide sequences.

Isolated polynucleotides are in preparations that are free or at least 70, 80, or 90% free of other molecules.

Human metastin recognising receptor cDNA molecules can be made with standard molecular biology techniques, using metastin recognising receptor mRNA as a template. Human metastin recognising receptor cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template.

Alternatively, synthetic chemistry techniques can be used to synthesize metastin recognising receptor polynucleotides. The degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode a metastin recognising receptor polypeptide having, for example, any one of the amino acid sequences shown in SEQ ID NOs: 2 and 4 or a biologically active variant thereof.

Obtaining Polypeptides Human metastin recognising receptor polypeptides can be obtained, for example, by puriiication from human cells, by expression of metastin recognising receptor polynucleotides, or by direct chemical synthesis.

Protein Purification

Human metastin recognising receptor polypeptides can be purified from any cell that expresses the polypeptide, including host cells that have been transfected with metastin recognising receptor expression constructs. A purified metastin recognising receptor polypeptide is separated from^' other compounds that normally associate with the metastin recognising receptor polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electro- phoresis. A preparation of purified metastin recognising receptor polypeptides is at least 80% pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS-pplyacrylamide gel electrophoresis.

Expression of Polynucleotides

To express a metastin recognising receptor polynucleotide, the polynucleotide can be inserted into an expression vector that contains the necessary elements for the transcription and translation of the inserted coding sequence. Methods that are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding metastin recognising receptor polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1989.

A variety of expression vector/host systems can be utilized to contain and express sequences encoding a metastin recognising receptor polypeptide. These include, but are not limited to, microorganisms, such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems. The control elements or regulatory sequences are those non-translated regions of the vector enhancers, promoters, 5 ' and 3 ' untranslated regions - which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, can be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the BLUESCRJPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life Technologies) and the like can be used. The baculovirus polyhedrin promoter can be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (e.g., heat shock, RUBISCO, and storage protein genes) or from plant viruses (e.g., viral promoters or leader sequences) can be cloned into the vector. In mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding a metastin recognising receptor polypeptide, vectors based on SV40 or EBV can be used with an appropriate selectable marker.

^' Bacterial and Yeast Expression Systems

In bacterial systems, a number of expression vectors can be selected depending upon the use intended for the metastm recognising receptor polypeptide. For example, when a large quantity of a metastin recognising receptor polypeptide is needed for the induction of antibodies, vectors which direct high level expression of fusion proteins that are readily purified can be used. Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRJPT (Stratagene). In a BLUES CRJDPT vector, a sequence encoding the metastin ^' recognising receptor polypeptide can be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of /3-galactosidase so that a hybrid protein is produced. pIN vectors (Van Heeke & Schuster, J. Biol. Chem. 264, 5503-5509, 1989) or pGEX vectors (Promega, Madison, Wis.) also can be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. Proteins made in such systems can be designed to include heparin, thrombin, or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.

In the yeast Saccharomyces cerevisiae, a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used. For reviews, see Ausubel et al. (1989) and Grant et al, Methods Enzymol. 153, 516-544, 1987. Plant and Insect Expression Systems

If plant expression vectors are used, the expression of sequences encoding metastin recognising receptor polypeptides can be driven by any of a number of promoters. For example, viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu, EMBO J. 6, 307-311, 1987). Alternatively, plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al, EMBO J. 3, 1671-1680, 1984; Broglie et al, Science 224, 838-843, 1984; Winter et al, Results Probl Cell Differ. 17, 85-105, 1991). These constructs can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection. Such techniques are described in a number of generally available reviews (e.g. , Hobbs or Murray, in McGRAW HILL YEARBOOK OF SCIENCE AND TECHNOLOGY, McGraw Hill, New York, N.Y., pp. 191-196, 1992).

An insect system also can be used to express a metastin recognising receptor polypeptide. For example, in one such system Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae. Sequences encoding metastin recognising receptor polypeptides can be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of metastin recognising receptor polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein. The recombinant viruses can then be used to infect S. frugiperda cells or Trichoplusia larvae in which metastin recognising receptor polypeptides can be expressed (Engelhard et al, Proc. Nat. Acad. Sci. 91, 3224-3227, 1994).

Mammalian Expression Systems

A number of viral-based expression systems can be used to express metastm recognising receptor polypeptides in mammalian host cells. For example, if an adenovirus is used as an expression vector, sequences encoding metastin recognising receptor polypeptides can be ligated into an adenovirus transcription/translation complex comprising the late promoter and tripartite leader sequence. Insertion in a non-essential El or E3 region of the viral genome can be used to obtain a viable virus that is capable of expressing a metastin recognising receptor polypeptide in infected host cells (Logan & Shenk, Proc. Natl Acad. Sci. 81, 3655-3659, 1984). If desired, transcription enhancers, such as the Rous sarcoma virus (RSV) enhancer, can be used to increase expression in mammalian host cells.

Human artificial chromosomes (HACs) ^'also can be used to deliver larger fragments of DNA than can be contained and expressed in a plasmid. HACs of 6M to 10M are constructed and delivered to cells via conventional delivery methods (e.g., liposomes. polycationic amino polym'ers, or vesicles).

Specific initiation signals also can be used to achieve more efficient translation of sequences encoding metastin recognising receptor polypeptides. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding a metastin recognising receptor polypeptide, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals (including the ATG initiation codon) should be provided. The initiation codon should be in the correct reading frame to ensure translation of the entire insert. Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used (see Scharf et al, Results Probl. Cell Differ. 20, 125-162, 1994).

Host Cells

A host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed metastin recognising receptor polypeptide in the desired fashion. Such modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation. Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function. Different host cells that have specific cellular machinery and characteristic mechanisms for post-translational activities (e.g., CHO, HeLa, MDCK, HEK293, and WI38), are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, VA 20110-2209) and can be chosen to ensure -the correct modification and processing of the foreign protein.

Stable expression is preferred for long-term, high-yield production of recombinant proteins. For example, cell lines which stably express metastin recognising receptor polypeptides can be transformed using expression vectors which can contain viral origins' of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells can be allowed to grow for 1-2 days in an enriched medium before they are switched to a selective medium. The purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced metastin recognising receptor sequences. Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to trie cell type. See, for example, ANIMAL CELL CULTURE, R.I. Freshney, ed., 1986.

Any number of selection systems can be used to recover transformed cell, lines.

These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler et al, Cell 11, 223-32, 1977) and adenine phosphoribosyltransferase (Lowy et al, Cell 22, 817-23, 1980) genes which can be employed in tk^~ or aprf cells, respectively. Also, antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection. For example, dhfr confers resistance to methotrexate (Wigler et al, Proc. Natl. Acad. Sci. 77, 3567-70, 1980), npt confers resistance to the aminoglycosides, neomycin and G-418 (Colbere-Garapin et al, J. Mol. Biol. 150, 1-14, 1981), and als and pat confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murray, 1992, supra). Additional selectable genes have been described. For example, trpB allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, Proc. Natl. Acad. Sci. 55, 8047-51, 1988). Visible markers such as anthocyanins, β-glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific, vector system (Rhodes et al, Methods Mol. Biol. 55, 121-131, 1995).

Detecting Expression

Although the presence of marker gene expression suggests that the metastin recognising receptor polynucleotide is also present, its presence and expression may need to be confirmed. For example, if a sequence encoding a metastin recognising receptor polypeptide is inserted within a marker gene sequence, transformed cells containing sequences that encode a metastin recognising receptor polypeptide can be identified by the absence of marker gene function. Alternatively, a marker gene can be placed in tandem with a sequence encoding a metastin recognising receptor polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the metastin recognising receptor polynucleotide.

Alternatively, host cells which contain a metastin recognising receptor polynucleotide and which express a metastin recognising receptor polypeptide can be identified by a variety of procedures lαiown to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques that include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protem. For example, the presence of a polynucleotide sequence encoding a metastin recognising receptor polypeptide can be detected by DNA-DNA or DNA-RNA hybridizaτion or amplification using probes or fragments or fragments of polynucleotides encoding a metastin recognising receptor polypeptide. Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding a metastin recognising receptor polypeptide to detect transformants that contain a metastin recognising receptor polynucleotide.

A variety of protocols for detecting and measuring the expression of a metastin recognising receptor polypeptide, using either polyclonal or monoclonal antibodies specific for the polypeptide, are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RJA); and fluorescence activated cell sorting (FACS). A two-site, monoclonal-based immunoassay using monoclonal antibodies reactive to two non-interfering epitopes on a metastin recognising receptor polypeptide can be used, or a competitive binding assay can be employed. These and other assays are described in Hampton et al, SEROLOGICAL METHODS: A LABORATORY MANUAL, APS Press, St. Paul, Minn., 1990) and Maddox et al, J. Exp. Med. 755, 1211-1216, 1983).

A wide variety of labels and conjugation techniques are known by those skilled in the art and can be used in various nucleic acid and amino acid assays. Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding metastin recognising receptor polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide. Alternatively, sequences encoding a metastin recognising receptor polypeptide can be cloned into a vector for the production of an mRNA probe. Such vectors are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.

Expression and Purification of Polypeptides

Host cells transformed with nucleotide sequences encoding a metastin recognising receptor polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture. The polypeptide produced by a transformed cell can be secreted or contained ntracellularly depending on the sequence and/or the vector used. As will be understood by those of skill in the art, expression vectors containing polynucleotides which encode metastin recognising receptor polypeptides can be designed to contain signal sequences which direct secretion of soluble metastin recognising receptor polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound metastin recognising receptor polypeptide.

As discussed above, other constructions can be used to join a sequence encoding a metastin recognising receptor polypeptide to a nucleotide sequence encoding a polypeptide domain which will facilitate purification of soluble proteins. Such purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Coφ., Seattle, Wash.). Inclusion of cleavable linker sequences such as those specific for Factor Xa or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the metastin recognising receptor polypeptide also can be used to facilitate purification. One such expression vector provides for expression of a fusion protein containing a metastin recognising receptor polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification by IMAC (immobilized metal ion affinity chromatography, as described in Porath et al, Prot- Exp. Purif 3, 263-281, 1992), while the enterokinase cleavage site provides a means for purifying the metastin recognising receptor polypeptide from the fusion protein. Vectors that contain fusion proteins are disclosed in Kroll et al, DNA Cell Biol. 72, 441-453, 1993.

Chemical Synthesis

Sequences encoding a metastin recognising receptor polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al, Nucl. Acids Res. Symp. Ser. 215-223, 1980; Horn et al. Nucl. Acids Res. Symp. Ser. 225-232, 1980). Alternatively, a metastin recognising receptor polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques (Merrifield, J. Am. Chem. Soc. 85, 2149-2154, 1963; Roberge et al, Science 269, 202-204, 1995). Protein synthesis can be performed using manual techniques or by automation.. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer). Optionally, fragments of metastin recognising receptor polypeptides can be separately synthesized and combined using chemical methods to produce a full-length molecule.

The newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, PROTEINS: STRUCTURES AND MOLECULAR PRINCIPLES, WH Freeman and Co., New York, N.Y., 1983). The composition of a synthetic metastin recognising receptor polypeptide can be confirmed by amino acid analysis or sequencing (έ.g^' ., the Ed an degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the metastin recognising receptor polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein.

Production of Altered Polypeptides

As will be understood by those of skill in the art, it may be advantageous to produce metastin recognising receptor polypeptide-encoding nucleotide sequences possessing non-naturally occurring codons. For example, codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life that is longer than that of a transcript generated from the naturally occurring sequence.

The nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter metastin recognising receptor polypeptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product. DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences. For example, site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.

Antibodies

Any type of antibody known in the art can be generated to bind specifically to an epitope of a metastin recognising receptor polypeptide. "Antibody" as used herein includes intact immuno- globulin molecules, as well as fragments thereof, such as Fab, F(ab')₂, and Fv, which are capable of binding an epitope of a metastin recognising receptor polypeptide. Typically, at least 6, 8, 10, or 12 contiguous amino acids are required to form an epitope. However, epitopes which involve non-contiguous amino acids may require more, e.g., at least 15, 25, or 50 amino acids.

An antibody which specifically binds to an epitope of a metastin recognising receptor polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots, ELISAs, radioirhmunoassays, immunohistochemical assays, immunoprecipitations. or other immunochemical assays known in the art. Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody that specifically binds to the immunogen.

Typically, an antibody which specifically binds to a metastm recognising receptor polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with

^' other proteins when used in an immunochemical assay. Preferably, antibodies which specifically bind to metastin recognising receptor polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a metastin recognising receptor polypeptide from solution.

Human metastin recognising receptor polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies. If desired, a metastin recognising receptor polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin. Depending on the host species, various adjuvants can be used to increase the immunological response. Such adjuvants include, but are not limited to, Freund's adjuvant, mineral gels (e.g., aluminum hydroxide), and surface active substances (e.g. lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol). Among adjuvants used in humans, B.CG (bacilli Calmette-Guerin) and Corynebacterium parvum are especially useful.

Monoclonal antibodies that specifically bind to a metastin recognising receptor polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture.- These techniques include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler et al, Nature 256, 495-497, 1985; Kozbor et al, J. Immunol Methods 81, 31-42, 1985; Cote et al, Proc. Natl Acad. Sci. 80, 2026-2030, 1983; Cole et al, Mol. Cell Biol. (52, 109-120, 1984).

In addition, techniques developed for the production of "chimeric antibodies," the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and. biological activity, can be used (Morrison et al, Proc. Natl Acad. Sci. 81, 6851-6855, 1984; Neuberger et al, Nature 312, 604-608, 1984; Takeda et al, Nature 314, 452-454, 1985). Monoclonal and other antibodies also can be "humanized" to prevent a patient from mounting an immune response against the antibody when it is used therapeutically. Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions. Alternatively, humanized antibodies can be produced using recombinant methods, as described in GB2188638B. Antibodies that specifically bir to a metastin recognising receptor polypeptide can contain ' antigen binding sites which are either partially or fully humanized, as disclosed in U.S. 5,565,332.

Alternatively, techniques described for the production of single chain antibodies can be adapted using methods known in the art to produce single chain antibodies that specifically bind to metastin recognising receptor polypeptides. Antibodies with related specificity, but of distinct idiotypic composition, can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl. Acad. Sci. 55, 11120-23, 1991).

Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al, 1996, Eur. J. Cancer Prev. 5, 507-11). Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol. 15, 159-63. Construction of bivalent, bispecific single-chain antibodies is taught in Mallender & Voss, 1994, J. Biol. Chem. 269, 199-206.

A nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below. Alternatively, single-chain antibodies can be produced directly using, for example, filamentous phage technology (Verhaar et al, 1995, Int. J. Cancer 61, 497-501; Nicholls et al, 1993, J. Immunol Meth. 165, 81-91).

Antibodies which specifically bind to metastin recognising receptor polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi et al, Proc. Natl. Acad. Sci. 86, 3833-3837, 1989; Winter et al, Nature 349, 293-299, 1991).

Other types of antibodies can be constructed and used therapeutically in methods of the invention. For example, chimeric antibodies can be constructed as disclosed in WO 93/03151. Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the "diabodies" described in WO 94/13804, also can be prepared.

Antibodies according to the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which a metastin recognising receptor polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.

Antisense Olisonucleotides

Antisense oligonucleotides are nucleotide sequences that are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of metastin recognising receptor gene products in the cell.

Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5 ' end of one nucleotide with the 3 ' end of another nucleotide with non-phosphodiester internucleotide linkages such alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol. Biol 20, 1-8, 1994; Sonveaux, Meth. Mol. Biol. 26, 1-72, 1994; Uhlmann et al, Chem. Rev. 90, 543-583, 1990.

Modifications of metastin recognising receptor gene expression can be obtained by designing antisense oligonucleotides that will form duplexes to the control, 5', or regulatory regions of the metastin recognising receptor gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons. Therapeutic advances using triplex DNA have been described in the literature (e.g., Gee et al, in Huber & Carr, MOLECULAR AND IMMUNOLOGIC APPROACHES, Futura Publishing Co., Mt. Kisco, N.Y., 1994). An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.

Precise complementarity is not required for successful complex formation between an antisense oligonucleotide and the complementary sequence of a metastin recognising receptor polynucleotide. Antisense oligonucleotides which comprise, for example, 2, 3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to a metastin recognising receptor polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent metastin recognising receptor nucleotides, can provide sufficient targeting specificity for metastin recognising receptor mRNA. Preferably, each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 7, or 8 or more nucleotides in length. Non- complementary intervening sequences are preferably 1, 2, 3, or 4 nucleotides in length. One skilled in the art can easily use the calculated melting point of an antisense-sense pair to determine the degree of mismatching which will be tolerated between a particular antisense oligonucleotide and a particular metastin recognising receptor polynucleotide sequence.

Antisense oligonucleotides can be modified without affecting their ability to ^'hybridize to a metastin recognising receptor polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule. For example, internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose. Modified bases and/or sugars, such as arabinose instead of ribose, or a 3', 5 '-substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide. These modified oligonucleotides can be prepared by methods well known in the art. See, e.g., Agrawal et al, Trends Biotechnol. 70, 152-158, 1992; Uhlmann et al, Chem. Rev. 90, 543-584, \990,- lMmwr et al, Tetrahedron. Lett. 275, 3539-3542, 1987.

Ribozymes

Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236, 1532-1539; 1987; Cech, Ann. Rev. Biochem. 59, 543-568; 1990, Cech, Curr. Opin. Struct. Biol 2, 605-609; 1992, Couture & Stinchcomb, Trends Genet. 12, 510-515, 1996. Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al, U.S. Patent 5,641,673). The mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.

The coding sequence of a metastin recognising receptor polynucleotide can be used to generate ribozymes that will specifically bind to mRNA transcribed from the metastin recognising receptor polynucleotide. Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al. Nature 334, 585-591, 1988). For example, the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme. The hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201).

Specific ribozyme cleavage sites within a metastin recognising receptor RNA target can be identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target RNA containing the cleavage site can be evaluated for secondary structural features which may render the target inoperable. Suitability of candidate metastin recognising receptor RNA targets also can be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays. Longer complementary sequences can be used to increase the affinity of the hybridization sequence for the target. The hybridizing and cleavage regions of the ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.

Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozymercontaining DNA construct into cells in which it is desired to decrease metastin recognising receptor expression. Alternatively, if it is desired that the cells stably retain the DNA construct, the construct can be supplied on a plasmid and maintained as a separate element or integrated into the genome of the cells, as is known in the art. A ribo- zyme-encoding DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.

As taught in Haseloff et al, U.S. Patent 5,641,673, ribozymes can be engineered so that ribozyme expression will occur in response to factors that induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells.

Differentially Expressed Genes

Described herein are methods for the identification of genes whose products interact with human metastin recognising receptor. Such genes may represent genes that are differentially expressed in disorders including, but not limited to, overactivity of bladder, hyperflexia, benign prostatic hypeφlasia, and CNS disorders. Further, such genes may represent genes that are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions. In addition, the human metastin recognising receptor gene or gene product may itself be tested for differential expression.

The degree to which expression differs in a normal versus a diseased state need only be large enough to be visualized via standard characterization techniques such as differential display techniques. Other such standard characterization techniques by which expression differences may be visualized include but are not limited to, quantitative RT (reverse transcriptase), PCR, and Northern analysis.

Identification of Differentially Expressed Genes

To identify differentially expressed genes total RNA or, preferably, mRNA is isolated from tissues of interest. For example, RNA samples are obtained from tissues of experimental subjects and from corresponding tissues of control subjects. Any RNA isolation technique that does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Ausubel et al, ed., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, Inc. New York, 1987-1993. Large numbers of tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski, U.S. Patent 4,843,155.

Transcripts within the collected RNA samples that represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et al, Proc. Natl. Acad. Sci. U.S.A. 85, 208-12, 1988), subtractive hybridization (Hedrick et al, Nature 308, 149-53; Lee et al, Proc. Natl. Acad. Sci. U.S.A. 88, 2825, 1984), and, preferably, differential display (Liang & Pardee, Science 257, 967-71, 1992; U.S. Patent 5,262,311)..

The differential expression information may itself suggest relevant methods for the treatment of disorders involving the human metastin recognising receptor. For example, treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human metastin recognising receptor. The differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human metastin recognising receptor gene or gene product are up-regulated or down-regulated. Screening Methods

The invention provides assays for screening test compounds that bind to or modulate the activity of a metastin recognising receptor polypeptide or a metastin recognising receptor polynucleotide. A test compound preferably binds to a metastin recognising receptor polypeptide or polynucleotide. More preferably, a test compound decreases or increases functional activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound. >

Test Compounds

Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity. The compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound" library method, and synthetic library methods using affinity chromatography selection. The biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.

Methods for the synthesis of molecular libraries are well known in the art (see, for example, DeWitt et al, Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et α/., J. Med. Chem. 37, 2678, 1994; Cho et al, Science 261, 1303, 1993; Carell et al, Angew. Chem. Int. Ed. Engl. 33, 2059, 1994; Carell et al, Angew. Chem. Int. Ed. Engl 33, 2061; Gallop et al, J. Med. Chem. 37, 1233, 1994). Libraries of compounds can be presented in solution (see, e.g., Houghten, BioTechniques 13, 412-421, 1992), or on beads (Lam, Nature 354, 82-84, 1991), chips (Fodor, Nature 364, 555-556, 1993), bacteria or spores (Ladner, U.S. Patent 5,223,409), plasmids (Cull et al, Proc. Natl. ^■ Acad. Sci. U.S.A. 89, 1865-1869, 1992), or phage (Scott & Smith, Science 249, 386-390, 1990; Devlin, Scz^'ercce 249, 404-406, 1990); Cwirla et al, Proc. Natl Acad. Sci. 97, 6378-6382, 1990; Felici, J Mol. Biol. 222, 301-310, 1991; and Ladner, U.S. Patent 5,223,409). High Throughyut Screening

Test compounds can be screened for the ability to bind to metastin recognising receptor polypeptides or polynucleotides or to affect metastin recognising receptor activity or metastin recognising receptor gene expression using high throughput screening. Using high throughput screening, many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened. The most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 μl. In addition to the plates, many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format. Alternatively, "free format assays," or assays that have no physical barrier between samples, can be used. For example, an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by Jayawickreme et al, Proc. Natl. Acad. Sci. U.S.A. 19, 1614-18 (1994). The cells are placed under agarose in petri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose. The combinatorial ■ compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors.

Another example of a free format assay is described by Chelsky, "Strategies for Screening Combinatorial Libraries: Novel and Traditional Approaches," reported at the First Annual Conference of The Society for Biomolecular Screening in Philadelphia, Pa. (Nov. 7-10, 1995). Chelsky placed, a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.

Another high throughput screening method is described in Beutel et al, U.S. Patent 5,976,813. In this method, test samples are placed in a porous matrix. One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support. When samples are introduced to the porous matrix they diffuse sufficiently slowly, such that the assays can be performed without the test samples running together. - Binding Assays

For binding assays, the test compound is preferably a small molecule that binds to the metastin recognising receptor polypeptide such that normal biological activity is prevented. Examples of such small molecules include, but are not limited to, small peptides or peptide-like molecules.

In binding assays, either the test compound or the metastin recognising receptor polypeptide can comprise a detectable label, such as a fluorescent, radioisbtopic, chemiluminescent, or enzymatic label, .such as horseradish peroxidase, alkaline phosphatase, or luciferase. Detection of a test compound that is bound to the metastin recognising receptor polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.

Alternatively, binding of a test compound to a metastin recognising receptor polypeptide can be determined without labeling either of the interactants. For example, a microphysiometer can be used to detect binding of a test compound with a metastin recognising receptor polypeptide. A microphysiometer (e.g., Cytosensor™) is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a metastin recognising receptor polypeptide (McConnell et al, Science 257, 1906-1912, 1992).

Determining the ability of a test compound to bind to a metastin recognising receptor polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal Chem. 63, 2338-2345, 1991, and Szabo et al, Curr. Opin. Struct. Biol. 5, 699-705, 1995). BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcore™). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.

In yet another aspect of the invention, a metastin recognising receptor polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem. 268, 12046-12054, 1993; Bartel et al, BioTechniques 14, 920-924, 1993; Iwabuchi et al, Oncogene 8, 1693-1696, 1993; and Brent W094/10300), to identify other proteins which bind to or interact with the metastin recognising receptor polypeptide and modulate its activity.

The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay utilizes two different DNA constructs. For example, in one construct, polynucleotide encoding a metastin recognising receptor polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e.g., GAL-4). In the other construct a DNA sequence that encodes an unidentified protein ("prey" or "sample") can be fused to a polynucleotide that codes for the activation domain of the known transcription factor. If the "bait" and the "prey" proteins are able to interact in vivo to form an protein-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein that interacts with the metastin recognising receptor polypeptide.

It may be desirable to immobilize either the metastin recognising receptor polypeptide (or polynucleotide) or the test compound to facilitate separation of bound from unbound forms of one or both of the interactants, as well as to accommodate automation of the assay. Thus, either the metastin recognising receptor polypeptide (or polynucleotide) or the test compound can be bound to a solid support. Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads). Any method known in the art can be used to attach the polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absoφtion, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support. Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a metastin recognising receptor polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.

In one embodiment, the metastin recognising receptor polypeptide is a fusion protein comprising a domain that allows the metastin recognising receptor polypeptide to be bound to a solid support. For example, glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed metastin recognising receptor polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above. Alternativέly, the complexes can be dissociated from the solid support before binding is determined.

Other techniques for immobilizing proteins or polynucleotides on a solid support also can be used in the screening assays of the invention. For example, either a metastin recognising receptor polypeptide (or polynucleotide) or a test compound can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated metastin recognising receptor polypeptides (or polynucleotides) or test compounds can be prepared from biotin-NHS(N-hydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies which specifically bind to a metastm recognising receptor polypeptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.

Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies which specifically bind to the metastin recognising receptor polypeptide or test compound, enzyme-linked assays which rely on detecting an activity of the metastin recognising receptor polypeptide, and SDS gel electrophoresis under non-reducing conditions.

Screening for test compounds which bind to a metastin recognising receptor polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises a metastin recognising receptor polypeptide or polynucleotide can be used in a cell-based assay system. A metastin recognising receptor polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a metastin recognising receptor polypeptide or polynucleotide is determined as described above.

Functional Assays

Test compounds can be tested for the ability to increase or decrease a biological effect of a human metastin recognising receptor. Such biological effects can be deteπnined for example using functional assays such as those described below. Functional assays can be carried out after contacting either a purified metastin recognising receptor polypeptide, a cell membrane preparation, or an intact cell with a test compound. A test compound which increases or decreases a functional activity of a metastin recognising receptor polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent. Ion channels can be tested functionally in living cells. Polypeptides comprising amiiiό acid sequences encoded by open reading frames of the invention are either expressed endogeneously in appropriate reporter cells or are introduced recomb nantly. Channel activity can be monitored by concentration changes of the permeating ion, by changes in the transmembrane electrical potential gradient, or by measuring a cellular response (e.g., expression of a reporter gene or secretion of a neurotransmitter) triggered or modulated by the polypeptide's activity.

The activity of ion channel proteins in cells can be determined, for example, by loading the cells with an ion-sensitive fluorescent indicator. Fluorescent indicators can be loaded into cells in 96- well plates or another container, and the activity of ion channel proteins in the presence or absence of various test compounds can be simply and rapidly determined. See, e.g., U.S. Patent 6,057,114. Ion channel currents result in changes of electrical membrane potential (V_m) which can be monitored directly using potentiometric fluorescent probes. These electrically charged indicators (e.g., the anionic oxonol dye DiBAC₄(3)) redistribute between extra- and intracellular compartments in response to voltage changes across the membrane in which the ion channel resides. The equilibrium distribution is governed by the Nernst-equation. Thus, changes in membrane potential results in concomitant changes in cellular fluorescence. Again, changes in V_m might be caused directly by the activity of the target ion channel or through amplification and/or prolongation of the signal by channels co-expressed in the same cell.

Another approach to determining the activity of ion channel proteins involves the electrophysio- logical determination of ionic currents. Cells which endogenously express a metastin recognising receptor can be used to study the effects of various test compounds or metastin recognising receptor polypeptides on endogenous ionic currents attributable to the activity of metastin recognising receptors. Alternatively, cells which do not express metastm recognising receptor can be employed as hosts for the expression of metastin recognising receptor, whose activity can then be studied by electrophysiological or other means. Cells preferred as host cells for the heterologous expression of metastin recognising receptor are preferably mammalian cells such as COS cells, mouse L cells, CHO cells (e.g., DG44 cells), human embryonic kidney cells (e.g., HEK293 cells), African green monkey cells and the like; amphibian cells, such as Xenopus laevis oocytes; or cells of yeast such as S. cerevisiae or P. pastoris. See, e.g., U.S. Patent 5,876,958.

Electrophysiological procedures for measuring the current across a cell membrane are well known. A preferred method is the use of a voltage clamp as in the whole-cell patch clamp technique. Non-calcium currents can be eliminated by established methods so as to isolate the ionic current flowing through ion channel proteins. In the case of heterologously expressed metastin recognising receptor, ionic currents resulting from endogenous ion channel proteins can be suppressed by known pharmacological or electrophysiological techniques. See, e.g.,^' U.S. Patent 5,876,958.

A further activity of the metastin recognising receptor which can be assessed is its ability to bind various ligands, including test compounds. The ability of a test compound to bind metastin recognising receptor or fragments thereof may be determined by any appropriate competitive binding analysis (e.g., Scatchard plots), wherein the binding capacity and/or affinity is determined in the presence and absence of one or more concentrations a compound having known affinity for the metastin recognising receptor. Binding assays can be performed using whole cells that express metastin recognising receptor (either endogenously or heterologously), membranes prepared from such cells, or purified metastin recognising receptor.

Gene Expression

In another embodiment, test compounds that increase or decrease metastin recognising receptor gene expression are identified. A metastin recognising receptor polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the metastin recognising receptor polynucleotide is determined. The level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound. The test compound can then be identified as a modulator of expression based on this comparison. For example, when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression. Alternatively, when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.

The level of metastin recognising receptor mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used. The presence of polypeptide products of a metastin recognising receptor polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry. Alternatively, polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incoφoration of labeled amino acids into a metastin recognising receptor polypeptide.

Such screening can be carried out either in a cell-free assay system or in an intact cell. Any cell that expresses a metastm recognising receptor polynucleotide can be used in a cell-based assay system. The metastin recognising receptor polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.

Pharmaceutical Compositions

The invention also provides pharmaceutical compositions that can be administered to a patient to achieve a therapeutic effect. Pharmaceutical compositions of the . invention can comprise, for example, a metastin recognising receptor polypeptide, metastin recognising receptor polynucleotide, ribozymes or antisense oligonucleotides, antibodies which specifically bind to a metastin recognising receptor polypeptide, or mimetics, activators, or inhibitors of a metastin recognising receptor polypeptide activity. The compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to,, saline, buffered saline, dextrose, and water. The compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.

In addition to the active ingredients, these pharmaceutical compositions can contain suitable pharmaceutically-acceptable carriers comprising excipients and auxiliaries that facilitate processing of the active compounds into preparations which can be used pharmaceutically. Pharmaceutical compositions of the invention can be administered by any . number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrafhecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means. Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.

Pharmaceutical preparations for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen. If desired, disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate. Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.

Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol. Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.

Pharmaceutical formulations suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline. Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the active compounds can be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Non-lipid polycationic amino polymers also can be used for delivery. Optionally, the suspension also can contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. For topical or nasal administration, penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

The pharmaceutical compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes. The pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms. In other cases, the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.

Further details on techniques for formulation and administration can be found in the latest edition of REMINGTON'S PHARMACEUTICAL SCIENCES (Maack Publishing Co., Easton, Pa.). After pharmaceutical compositions have been prepared, they can be placed in an appropriate cofrtainer and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.

Therapeutic Indications and Methods Modulating human metastin recognising receptor provides effective controls of urinary disorders such as urinary incontinence, overactive bladder, benign prostatic hypeφlasia and lower urinary tract syndromes.

^■ Determination of a Therapeutically Effective Dose

The determination of a therapeutically effective dose is well within the capability of those skilled in the art. A therapeutically effective dose refers to that amount of active ingredient which increases or decreases metastin recognising receptor, activity relative to the metastin recognising receptor activity which occurs in the absence of the therapeutically effective dose.

For any compound, the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.

Therapeutic efficacy and toxicity, e.g., ED₅₀ (the dose therapeutically effective in 50% of the population) and LD₅₀ (the dose lethal to 50% of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD₅₀/ED₅₀.

Pharmaceutical compositions that exhibit large therapeutic indices are preferred. The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use. The dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED₅₀ with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.

The exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect. Factors that can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.

Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration. Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.

If the reagent is a single-chain antibody, polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well-established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome-mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun," and DEAE- or calcium phosphate-mediated transfection.

Effective in vivo dosages of an antibody are in the range of about 5 μg to about 50 μg/kg, about 50 μg to about 5 mg/kg, about 100 μg to about 500 μg/kg of patient body weight, and about 200 to about 250 μg/kg of patient body weight. For administration of polynucleotides encoding single- chain antibodies, effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 μg to about 2 mg, about 5 μg to about 500 μg, and about 20 μg to about .100 μg of DNA.

If the expression product is mRNA, the reagent is preferably an antisense oligonucleotide or a ribozyme. Polynucleotides that express antisense Oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.

Preferably, a reagent reduces expression of a metastin recognising receptor gene or the activity of a metastin recognising receptor polypeptide by at- least aboμt 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent. The effectiveness of the mechanism chosen to decrease the level of expression of a metastin recognising receptor gene or the activity of a metastin recognising receptor polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to metastm recognising receptor- specific mRNA, quantitative RT-PCR, immunologic detection of a metastin recognising receptor polypeptide, or measurement of metastin recognising receptor activity. In any of the embodiments described above, any of the pharmaceutical compositions 'of the invention can be administered in combination with other appropriate therapeutic agents. Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles. The combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.

Any of the. therapeutic methods described above can be applied to any subject in

need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.

Diagnostic Methods

Human metastin recognising receptor also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences that encode the polypeptide. For example, differences can be determined between the cDNA or genomic sequence encoding metastin recognising receptor in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent of the disease.

Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method. . In addition, cloned DNA segments can be employed as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequencing primer can be used with a double-stranded PGR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.

Genetic testing based on DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al, Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cfeavage method (e.g., Cotton et al, Proc. Natl. Acad. Sci. USA 85, 4397-4401, 1985). Thus, the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA. In addition to direct methods such as gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.

Altered levels of metastin recognising receptor also can be detected in various tissues. Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays.

All patents and patent applications cited in this disclosure are expressly incoφorated herein by reference. The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples, which are provided for puφoses of illustration only and are not intended to limit the scope of the invention.

EXAMPLE 1

Establishment of stable transfectants expressing recombinant metastin recognizing polypeptides

Human GPR54 cDNA (SEQ ID NO: 1) and human G_αl6 cDNA (Accession No: 63904) were fused and inserted in pcDNA3.1 expression vector (Invitrogen). A stable CHO transformant expressing mitchondrial aequorin was transfected with this construct by Lipofectamiήe method (Invitrogen). Human GPR54-expressing CHO clones were selected in the presence of G418 (lmg/ml; GIBCO). Cells were cultured in 45 % Dulbecco's modified Eagle Medium, 45 % F12 (DMEM/F12) and 10 % fetal calf serum at 37 °C in 5% C0₂/95% air and 100 % humidified condition. Stable transfectants expressing other recombinant metastin recognising receptors are similary generated.

Other stable transfectants expressing Mrgs can be generated ina similar manner.

EXAMPLE 2

Identification of test compounds that bind to metastin recognising receptor polypeptides

Stable transformants expressing recombinant metastin recognising receptor polypeptides are put in wells of 96-well microtiter plates (2x10⁵ cells/80 ul/well) in a binding assay buffer, such as 20 mM Tris-HCl (pH 8.0), 5 mM MgCl₂, 1 mM EDTA, 0.1% BSA and lx protease inhibitor cocktail (Roche Applied Bioscience). Metastin recognising receptor polypeptides comprise the amino acid sequence shown in SEQ ID NO: 2, 4 or 6. The test compounds dissolved in dimethylsulfoxide are diluted by the assay buffer and aliquots are added to each well (10 ul/well). [¹²⁵I]-metastin(45-54) (Amersham, Buckinghamshire, UK) dilited with the same buffer is added to each well (10 ul/well, 0.1-10 nM final concentration). After shaking for 5 min, the plates are incubated at room temperature for 1 hr. Mixture is transferred to Multiscreen™-FB filters (Millipore) precoated with 0.5% polyethylenimine and washed 3 times with cold assay buffer. After complete drying, Microscinti-PS (Packard, Downers Grove, EL) is added (30 ul/well) and remaining radioactivity is measured by Topcount (Packard). For the detection of total and non-specific binding, assay buffer and non-labelled metastin(45-54) (final concentration: 10 uM) is added is stead of a test compound, respectively. A test compound that decrease the remaining radio activity in a well by at least 15% relative to radio activity a well in which a test compound is not incubated is identified as a compound which binds to a metastin recognising receptor polypeptide.

EXAMPLE 3

Identification of a test compound which decreases metastin recognising receptor gene expression

A test compound is administered to a culture of human cells transfected with a metastin recognising receptor expression construct and incubated at 37°C for 10 to 45 minutes. A culture of the same type of cells that have not been transfected is incubated for the same time without the test compound to provide a negative control.

RNA is isolated from the two cultures as described in Chirgwin et al. (Biochem. 18, 5294-99, 1979). Northern blots are prepared using 20 to 30 μg total RNA and hybridized with a ³²P-labeled metastin recognising receptor-specific probe at 65 ° C in Express-hyb (CLONTECH). The probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO 1, 3 or 5. A test compound that decreases the metastin recognising receptor-specific signal relative to the signal obtained in the absence of the test compound is identified as an modulator that inhibits metastin recognising receptor signaling or gene expression.

EXAMPLE 4

Expression analysis of mRNA coding KiSSl and GPR54

The expression of KiSSl and GPR54 in rat spinal cord, DRG and bladder was determined by reverse transcription-polymerase chain reaction (RT-PCR).

Total RNA from the tissues was used for the PCR experiment. RNA was extracted from the rat tissues by acid guanidinium thiocyanate-phenol-chloroform method (Chomczynski and Sacchi,

1987). Genomic DNA was removed from total RNA preparations by treatment with DNase I (Stratagene, La Jolla, CA) in the presence of RNase inhibitor (Takara Shuzo, Otsu, Japan) 'and 10 mM dithiothreitol. RNA was then extracted with phenol/chloroform. An aliquot of purified RNA (5 ug) was reverse-transcribed using 300 units of Superscript II reverse transcriptase (GibcoBRL, Scotland, U.K.). in a 20 ul reaction mixture containing 10 mM dithiothreitol, 20 nM dNTPs, 117 units of RNase inhibitor, and one of the anchor primers at 2.5 uM of random hexamer primers and oligo dT primers.

Specific primers were designed based on the sequence of rat KiSSl and GPR54 as follows:

rKiss(-17-7): 5'-GATCTGCCTCTTCCAGAATGATC-3' (SEQ ID NO:7); ^"

rKiss(456-431): 5'-CTAGAAGCTCCCTGCCTTGGCCTC-3' (SEQ ID NO:8);

rKiss(l 15-140): 5'-GGACCCCAGGAACTCGTTAATGCC-3' (SEQ ID NO:9);

rKiss(376-352): 5'- AAGGAGTTCCAGTTGTAGGCTGAC-3' (SEQ ID NO: 10);

rKissR(169-193): 5'-CTAGTCGGGAACTCACTGGTCATC-3' (SEQ ID NO: 11);

rKissR(946-923): 5'-AATTGCTGTAGGACATGCAGTGAG-3' (SEQ ID NO: 12);

rKissR(336-360): 5*-CTTCATGTGCAAATTCGTCAACTAC-3' (SEQ ID NO:13); and

rKissR(640-618): 5'- AGGTATAGGGCCAGCAGGTTGTAG -3' (SEQ ID NO: 14).

PCR experiments were performed on 10 ng of reverse transcribed RNA from each sample. For control, we measured the expression of GAPDH. The assay reaction mixture was as follows : lx final KOD dash PCR mix (TOYOBO, Osaka, Japan) ; 200 nM forward primer ; 200 nM reverse primer ; 10 ng cDNA ; and water to 10 μl. After denaturation at 95 °C for 2 min, following steps were carried out 40 times: denaturation 10 seconds at 95 °C, annealing, 30 seconds at 60 °C, extension at 72 °C. PCR reaction was performed on an Thermal cycler 9700 (Applied Biosystems, Foster City, CA). First, PCR was performed using a primer set, rKiss(-17-7) and rKiss(456-431) or rKissR(169-193) and rKissR(946-923)_; Second, PCR products of 1^st PCR was diluted 20 times, and then amplified with a primer set, rKiss(l 15-140) and rKiss(376-352) or rKissR(336-360) and rKissR(640-618).

PCR product was electrophoresed on 1.0% agarose gels with size marker. Tris-acetate (TAE) was used as electrophoresis buffer. Agarose gel was stained with ethidium bromide in TAE buffer (0.5 ug/ml) for 20 min. After washing with water, DNA was detected by ultraviolet. Expression of GAPDH, a house keeping gene, was deteced in all tissues at similar 'extent. Expression of KiSSl was also detected in all tissues, but that of GPR54 was observed only in spinal cord and brain (positive control) (Fig. 1).

EXAMPLE 5 Bladder contraction induced by metastin(45-54) peptide (intrathecal administration)

Female Sprague-Dawley rats was anesthetized by intraperitoneal administration of urethane 1.2g/kg. The atlanto-occipital membrane was exposed through a dorsal incision and a small hole was made in the dura. A polyethylene catheter filled with saline was inserted into the subarachnoid space and advanced caudally until the tip reached the level of L6-S1 spinal cord. A suture in the superficial dorsal muscle layer fixed the catheter. The abdomen was opened through a midline incision, and both ureters were ligated and cut to prevent influx of extra urine into the bladder. A ballon-tipped polyethylene catheter was implanted into the bladder through the bladder dome and secured in place by a silk ligature, and abdomen was closed. The catheter was connected to a transducer to monitor intravesical pressure by PowerLab system. Saline was infused into the balloon until spontaneous bladder contraction was observed, and then it was drained until bladder contraction has stopped completely. Capsaicin (10 ug/kg) was administered through a polyethylene cannula inserted into the femoral vein. About 15 min after capsaicin loading twice, saline or metastin(45-54) at the doses of 1, 3 or 10 nmol/head in a volume of 20 μl/head was administered intrathecally. Intrathecal administration of saline did not induce contraction. At the doses of 3 and 10 nmol/head metastin induced a bladder contraction, but not 1 nmol/head metastin (Fig. 2). IVP stands for ^■ Intravesical pressure and cap stands for capsaicin 10 microgram kg i.v. in Fig. 2.

EXAMPLE 6

Bladder contraction induced by metastin(45-54) peptide (intraveous injection) Female Sprague-Dawley rats was anesthetized by intraperitoneal administration of urethane 1.2g/kg. The abdomen was opened through a midlme incision, and both ureters were ligated and cut to prevent influx of extra urine into the bladder. A ballon-tipped polyethylene catheter is implanted into the bladder through the bladder dome and secured in place by a silk ligature, and abdomen was closed. The catheter was connected to a transducer to monitor intravesical pressure by PowerLab system. Saline was infused into the balloon until spontaneous bladder contraction was observed and drained until bladder contraction has stopped completely. Capsaicin (10 μg/kg) was administered through a polyethylene cannula inserted into the femoral vein. About 15 min after capsaicin loading twice, saline or metastin(45-54) at the doses of 3, 30 or 300 nmol/kg was administered intravenously. Bladder contraction induced by metastin(45-54) was determined, and it was expressed as percentage when it compared with capsaicin-induced contraction amplitude.

Intravenous administration of metastin(45-54) induced a bladder contraction. The contraction amplitude was increased by metastin(45-54) in a dose dependent manner (Fig. 3). Pretreatment of rats with a ganglion blocker, hexamethonium (10 mg/kg, intraveous injection), greatly suppressed metastin(45-54)-induced bladder contraction (Fig. 4). These data indicate that the metastin(45-54) elicits bladder contraction via the activation of metastin recogniging receptors in spinal cord, but not via the direct activation of bladder.

EXAMPLE 7

Cystometry in rats

Micturition parameters from cystometry are utilized to evaluate the drug candidates for micturition disorders. Sprague-Dawley rats are anesthetized by intraperitoneal administration of urethane at 1.2g/kg. The abdomen is opened through a midline incision, and a polyethylene catheter is implanted into the bladder through the dome. In parallel, the inguinal region is incised, and a polyethylene catheter filled with 2 IU/ml of heparin in saline is inserted into a common iliac artery. The bladder catheter is connected via T-tube to a pressure transducer and a microinjection pump. Saline is infused at room temperature into the bladder at a rate of 2.4 ml/hr. Intravesical pressure^' is recorded continuously on a chart pen recorder. At least three reproducible micturition cycles are recorded before a test compound administration and used as baseline values. The saline infusion is stopped before administrating compounds. A testing compound dissolved in an appropriate vehicle is intraveously or intraarterialy injected. Relative increases in the time to 1^st voiding (bladder capacity), residual volume, voiding intervals, voiding pressure, and other cystometry parameters are analyzed from the cystometry data in comparison with the normal micturition patterns. The testing compounds-mediated inhibition of the parameters is evaluated using Student's t-test. A probability level less than 5% is accepted as significant difference.

EXAMPLE 8

Bladder outlet obstruction model

For the assessment of the drugs affecting on LUTS following the bladder outlet obstruction model is useful. To obtain a partial obstruction of the urethra, Wistar rats are anesthetized with ketamine, intraperitoneally. The abdomen is opened through a midline incision and the bladder and the proximal urethra are exposed. A constant degree of urethral obstruction is produced by tying a ligature around the urethra and a catheter with an outer diameter of 1 mm. The abdominal'well is closed and the animals allowed to recover. After 1-6 weeks, the rats are anesthetized with ketamine and the ligature around the urethra was carefully removed, to normalize the outlet resistance and enable repetitive micturition. A polyethylene catheter is implanted in the bladder through the dome, and exteriorized at the scapular level. Animals are then allowed to recover for at least 48 hours. Cytometric investigation is performed without anesthesia two days after bladder catheter implantation in control and obstructed animals. The bladder catheter was connected via a T-tube to a strain gauge and a microinjection pump. The conscious rats were held under partial restraint in a restraining device. ^• Warmed saline was infused into the bladder at a rate of 3 ml/hr for control.and obstructed animals. The rate of infusion was increased from 3 to 10 ml/hr to obtain similar interval times between micturitions in obstructed and control rats. Overactivity of the

^■ obstructed bladders is assessed by measuring the cystometric parameters such as basal pressure, peak micturition pressure, threshold pressure, micturition interval, amplitude and frequency of spontaneous activity and micturition slope. [Lluel P, Duquenne C, Martin D; Experimental bladder instability following bladder outlet obstruction in the female rat. J. Urol. 160:2253-2257, 1998].

Claims

1. A method of screening for agents which decrease the activity of human metastin recognising receptor, comprising the steps of: i) contacting a test compound with any human metastin' recognising receptor polypeptide; and ii) detecting binding of the test compound to the human metastin recognising receptor polypeptide, wherein a test compound which binds to the polypeptide is identified as a potential therapeutic agent for decreasing the activity of a human metastin recognising receptor and for treating urological disorders.

2. A method of screening for agents which regulate the activity of a human metastin recognising receptor, comprising the steps of: i) contacting a test compound with a human metastin recognising receptor polypeptide and ii) detecting a human metastin recognising receptor activity of the polypeptide, wherein a test compound which decreases the human metastin recognising receptor activity of the polypeptide is identified as a potential therapeutic agent for decreasing the activity of the human metastin recognising receptor and useful to treat urological disorders.

3. A method of screening for agents which decrease the activity of a human metastin recognising receptor, comprising the steps of: i) contacting a test compound with human^' metastin recognising receptor polynucleotide; and ii) detecting binding of the test compound to the polynucleotide, wherein a test compound which binds to the polynucleotide is identified as a potential therapeutic agent for decreasing the activity of the human metastin recognising receptor and useful to treat urological disorders.

4. A method of reducing the activity of human metastin recognising receptor, comprising the step of: contacting a cell with a reagent which specifically binds to human metastin recognising receptor polynucleotide or a human metastin recognising receptor polypeptide, whereby the activity of human metastin recognising receptor is reduced and a urological disorder is ameliolated.

5. A reagent that modulates the activity of a human metastin recognising receptor polypeptide or polynucleotide, wherein said reagent is identified by the method of any of the claims 1 to 4 and useful to treat urological disorders.

6. A reagent that modulates the activity of a human metastin recognising receptor' polypeptide or polynucleotide, wherein said reagent is useful to treat urological disorders.

7. A pharmaceutical composition for the treatment of urological disorders, comprising: the reagent of claim 5 or 6, and a pharmaceutically acceptable carrier.

8. Use of the reagent of claim 5 or 6 in the preparation of a medicament for modulating the activity of human metastm recognising receptor in a urological disorder.

9. Use of claim 8, wherein the urological disorder is at least one selected from the group consisting of detrusor overactivity (overactive bladder), urinary incontinence, neurogenic detrusor oeractivity (detrusor hyperflexia), idiopathic detrusor overactivity (detrusor instability), benign prostatic hypeφlasia, and lower urinary tract symptoms.