WO2005032580A1 - Methods and compositions for treating eosinophil mediated gastro-intestinal dysfunction or disease - Google Patents

Abstract

The present invention provides methods and compositions for the effective treatment of gastro-intestinal dysfunction, including chronic and acute inflammatory bowel diseases and the symptoms thereof, through the modulation of eosinophil peroxidase activity. The methods and compositions disclosed include those that modulate eosinophil peroxidase activity by depleting substrate, antagonizing enzyme activity, or attenuating enzyme expression so as to effect treatment of disease conditions or symptoms. Also provided are methods for the identification of additional therapeutically effective compounds for the treatment of gastro-intestinal dysfunction through the modulation of eosinophil peroxidase activity.

Description

METHODS AND COMPOSITIONS FOR TREATING EOSINOPHIL MEDIATED GASTRO-INTESTINAL DYSFUNCTION OR DISEASE

BACKGROUND OF THE INVENTION

FIELD OF THE INVENTION

[0001] The present invention relates to improved methods for treating eosinophil mediated gastro-intestinal dysfunction or disease,

DESCRIPTION OF RELATED ART

[0002] Inflammatory bowel diseases (IBD), Crohn's disease (CD), ulcerative colitis (UC), eosinophilic gastroenterocolitis, and related conditions are chronic, relapsing, remitting gastro-intestinal diseases characterized by chronic inflammation of the intestine (Blumberg et al., Curr. Opin. Immunol. (1999) ll(6):648-56; Strober et al., Annu. Rev.. Immunol. (2002) 20:495-549; Russel MG, Eur. J. Intern. Med. (2000) 11(4): 191-196; Narama et al., Toxicl. Pathol. (1999) 27(3):318-324). Gastro-intestinal inflammation is one of the most common types of inflammatory process which affects humans (for a review see Bamford, FEMS Immunol Med Microbiol 24(2): 161-8 (1999)).

[0003] Clinical and experimental evidence suggests that the pathogenesis of IBD is multifactorial, involving susceptibility genes a,nd environmental factors (Sartor, Am J Gastroenterol. (1997) 92:5S-11S). The interaction of these factors with the immune system leads to^' intestinal inflammation and dysregulated mucosal immunity against commensal bacteria, various microbial products (e.g., LPS) or antigens (Mayer et al. Current concept of IBD: Etiology and pathogenesis. In "Inflammatory Bowel Disease" 5th edition (2000), Kirsner J B, editor, W. B. Sanunders Company, pp 280-296; for a discussion of IBD in children see Walker-Smith, Postgrad Med J (2000) 76(898):469-72).

[0004] UC and CD are associated with intestinal and extraintestinal clinical manifestations including weight loss, diarrhea accompanied by blood or mucus, fever, gastric dysmotility, and shortening of the colon (Fiocchi C, Gastroenterology (1998) 115(l):182-205; Hendrickson et al. Clin, Micorbiol. Rev. (2002) 15(l):79-94). UC is a condition that primarily affects the superficial layer of the colon mucosa and histological analyses reveal ulceration of' the mucosa, blunting and loss of crypts, and an inflammatory infiltrate. The cellular composition of the inflammatory infiltrate into the colon is characterised by increased numbers of CD4+ T lymphocytes, mast cells, neutrophils and eosinophils (Blumberg et al, Curr. Opin. Immunol, (1999) ll(6):648-56; Strober et al, Annu. Rev. Immunol. (2002) 20:495-549). Clinical studies have demonstrated a correlation between

Crohn's disease (CD) has been characterized by type 1 Helper T (Th-1) response, which produce the presence of activated inflammatory cells, morphological changes to the GI tract and the development of GI dysfunction in EGD ^1"3.

[0005] cytokines interleukin IL-2, interferon-gamma, and tumor necrosis factor (TNF) (for a review of anti-TNF alpha therapy in Crohn's disease, see Mikula, Gastroenterol Nurs. (1999) 22(6):245-8; Selby, Vet Microbiol (2000) 77(3-4):505-511).

[0006] Ulcerative colitis (UC) is thought to be regulated by CD4⁺ Type-has been characterized by type 2 Helper T-cell (Th₂) responses through the release of (Th-2) responses, which produce anti-inflammatory cytokines includingsuch as IL-4, IL-5 and IL-10. Indeed, peripheral blood and tissue from patients with IBD contains elevated numbers of activated T-cells and their increased numbers correlate with elevated levels of Th₂-cytokines, the degree of GI inflammation and dysfunction. However, the demarcation between Th-1 and Th-2 response in CD and UC is not absolute and there may be significant overlap in their characteristics.

[0007] There has been increasing interest in the involvement of eosinophils in the pathogenesis of UC (Gleich and Adolphson, Adv. Immunol. (1986) 39(177):177-253; Gleich et al., Ann. Rev. Med. (1993) 44:85-101; Rothenberg M, N. Engl. J. Med. (1998) 338:1592-600). Elevated levels of eosinophils have been observed in colonic biopsy samples from UC patients and increased numbers of this cell have been shown to correlate with morphological changes to the GI tract, disease severity and_. gastrointestinal dysfunction (Jeziorska et al., J. Pathol, (2001) 194(4): 484-92; Saitoh et al., Am J. Gastroenterol. (1999) 94:3513-3520; Sangfelt et al., Am J. Gastroenterol. (2001) 96(4): 1085-90; Carlson et al, Am J. Gastroenterol. (1999) 94(7): 1876-83. Eosinophils are multifunctional leukocytes possessing the capacity to initiate or potentiate inflammatory reactions through the release of a range of inflammatory cytokines, chemokines and lipid mediators (Gleich et al., Adv Immunol 1986;39(177): 177-253. Gleich et al., Annual Review of Medicine 1993;44:85-101. Rothenberg M. N Engl J Med 1998;338:1592-600). Eosinophils may induce GI dysfunction through the release of lipid mediators (PAF and leukotriene C4) and eosinophilic granular proteins (major basic protein [MBP], eosinophil peroxidase [EPO] and eosinophil-associated ribonucleases i.e., eosinophil cationic protein [ECP] and eosinophil-derived neurotoxin [EDN]). Clinical investigations of bowel biopsy specimens from UC patients have shown correlation between the eosinophil numbers in the mucosa, the levels of MBP, EPO, ECP, and EDN in perfusion fluid samples and disease severity (Jeziorska et al., J.. Pathol. (2001) 194(4):484-92; Saitoh et al., Am J. Gastroenterol. (1999) 94:3513-3520; Sangfelt et al, Am J. Gastroenterol. (2001) 96(4): 1085-90; Carlson et al, Am J. Gastroenterol. (1999) 94(7): 1876-83.

[0008] MBP, EPO and ECP have been shown to be toxic to a variety of tissues, including heart, brain, bronchial and intestinal epithelium ⁷. ECP and EDN are ribonucleases and have been shown to possess anti-viral activity and ECP can cause voltage-insensitive, ion-selective toxic pores in the membranes of target cells, possibly facilitating the entry of other cytotoxic molecules ⁶. MBP can alter smooth muscle contraction responses through dysregulating vagal muscarinic M₂ and M₃ receptor function and also promote mast cell and basophil degranulation ⁹. Although the underlying causes of EGD are not yet fully understood, several investigations have demonstrated an association between eosinophil degranulation and disease severity³.

[0009] Several experimental models of UC have been developed in mice to dissect out the key cellular and molecular mechanisms predisposing to disease (Blumberg et al, Curr. Opin. Immunol. (1999) ll(6):648-56; Strober et al, Annu. Rev. Immunol. (2002) 20:495-549; Boismenu and Chen, J. Leukoc Biol. (2000) 67(3):267-78; Narama et al, Toxicl, Pathol. (1999) 27(3):318-324). These models mimic certain pathophysiological features of human UC including weight loss, diarrhea with blood and/or mucus, shortening of the colon, crypt abnormalities, and infiltration of inflammatory cells particularly eosinophils into the GI mucosa (Blumberg et al., Curr. Opin. Immunol. (1999) ll(6):648-56; Strober et al, Annu. Rev. Immunol. (2002) 20:495-549; Boismenu and Chen, J. Leukoc Biol. (2000) 67(3):267-78; Narama et al, Toxicl. Pathol. (1999) 27(3):318-324). Employing these animal models of UC investigators have corroborated clinical studies demonstrating a prominent role for CD4⁺ T cells in the regulation of intestinal inflammation (Blumberg et al. Curr Opin Immunol (1999) 6:648-56). Furthermore, these studies have shown that CD4⁺ T-cells through the release of cytokines (IL-4, IL-5 an IL-13) activate inflammatory pathways inducing eosinophilic inflammation and disease pathology (Papadakis et al. Annu Rev Med (2000) 51:289-98; Blumberg JAMA (2001). However, these investigations have provided conflicting evidence concerning the contribution of eosinophils in the development of GI dysfunction in experimental UC.Experimental mouse model systems have also been developed to dissect out the key cellular and molecular mechanisms leading to IBD (Blumberg et al., Curr. Opin. Immunol. (1999) ll(6):648-56; Strober et al, Annu. Rev. Immunol. (2002) 20:495-549; Boismenu and Chen, J. Leukoc Biol. (2000) 67(3):267-78; Narama et al, Toxicl. Pathol. (1999) 27(3):318-324). These rodent models mimic certain pathophysiological features of human IBD including weight loss, diarrhea with blood, shortening of the colon, crypt abnormalities, and infiltration of inflammatory cells particularly eosinophils. Despite the clear utility of these models, however, these investigations have provided conflicting evidence concerning the contribution of various factors in the development of GI dysfunction.

[0010] Model organism studies have also used transgenic mice containing deletions in a cytokine gene. These mice spontaneously develop inflammatory bowel disease (for a review see MacDonald, Eur J Gastroenterol Hepatol (1997) 9(11): 1051-50). Colitis induced by cytokine DNB, driven by mucosal Thl response, has been reported to be accelerated by rIL-12 and inhibited by administration of anti-IL-12 antibodies (Neurtah et al (2000)). The inflammatory process and the immune response at mucosal sites result in mucosal barrier dysfunction leading to further exposure to enteric bacteria or their products that perpetuate mucosal inflammation (Podolsky Am J Physiol (1999) 277:G495-9). [0011] These animal models of colitis have suggested a prominent role for CD4+ T cells in the regulation of intestinal inflammation (Blumberg et al. Curr Opin Immunol (1999) 6:648-56). Cytokine imbalance, and the production of inflammatory mediators have been hypothesized to play an important role in the pathogenesis of both experimental colitis and IBD (Papadakis et al. Annu Rev Med (2000) 51:289-98; Blumberg JAMA (2001) 285(5):643-647; Nagura et al. Digestion (2001) 63 Suppl Sl:12- 21). In particular, dysregulated CD4+ T cell responses may play a pivotal role in the pathogenesis of experimental colitis (Bhan et al. Immunol Rev (1999) 169:195-207). Indeed, Thl cytokines (e.g., IL-12) are dominant in inflamed mucosa of CD, whereas Th2 cytokines (e.g., IL-4) are relatively common in UC. In this respect,. initrobenzene sulphonic acid-induced colitis (DNB), which is characterized by predominating Thl response in mice (Neurath et al. Int Rev Immunol (2000) 19:51-6) mimics CD, whereas dextran sodium sulphate (DSS) induces acute and chronic colitis with a mixed Thl/Th2- like response, features shared with UC (Dieleman et al. Clin Exp Immunol (1998) 114:385-91).

[0012] Along with the above developments, there has been increasing interest in the involvement of eosinophils in the pathogenesis of a number of disease conditions, generally. Eosinophils are multifunctional leukocytes possessing the capacity to initiate or potentiate inflammatory reaction through the release of a range of inflammatory cytokines, chemokines and lipid mediators (Gleich and Adolphson, Adv. Immunol. (1986) 39(177): 177-253; Gleich et al, Ann. Rev. Med. (1993) 44:85-101; Rothenberg M, N. Engl. J. Med. (1998) 338:1592-600).

[0013] It has been hypothesized that eosinophils may induce GI dysfunction through the release of lipid mediators (PAF and leukotriene C4) and eosinophilic granular cationic proteins: major basic protein (MBP), eosinophil cationic protein (ECP), eosinophil peroxidase (EPO or EPX), eosinophil-associated ribonuclease (EAR) and eosinophil-derived neurotoxin (EDN). Clinical investigations of bowel biopsy specimens from UC patients have shown correlation between the eosinophil numbers in the mucosa, the levels of MBP, EPO, ECP, and EDN in perfusion fluid samples and disease severity (Jeziorska et al, J. Pathol. (2001) 194(4):484-92; Saitoh et al, Am J. Gastroenterol. (1999) 94:3513-3520; Sangfelt et al, Am J. Gastroenterol. (2001) 96(4): 1085-90; Carlson et al, Am J. Gastroenterol. (1999) 94(7): 1876-83.

[0014] Nevertheless, the pathological role of the eosinophil in UC is not understood. Furthermore, it is not clear which, if any, of the eosinophilic proteins are central to the disease state.

[0015] This dearth of knowledge in the etiology of IBD has hindered development of effective therapies, Immunosuppressive and anti-inflammatory agents in high maintenance doses are the principal drugs used in the therapy of chronic inflammatory gastro-intestinal disorders. Anti-inflammatory drugs presently used in treatment of IBD include aminosalycilates and immunosuppressive agents such as corticosteroids, azathioprine, cyclosporine and methotrexate. Corticosteroids remain the mainstay of anti- inflammatory and immunosuppressive therapy for many gastro-intestinal conditions (Hyams, Curr Opin Pediatr (2000) ;12(5):451-5).

[0016] Unfortunately, about 20-25% of the patients with UC fail to respond to intensive and optimal medical therapy and therefore are referred to surgery for total proctocolectomy. In general, patients with CD are less responsive to medical therapy and usually do not respond to surgical treatment. Recently, anti-TNF alpha antibodies were introduced to treat patients with CD with some efficacy, but this approach is ineffective in patients with UC.

[0017] Ahmed et al. (U.S. Pat. Publ. No. 20030087875) disclose the use of hypersulfated disaccharideS in the treatment of late phase reactions and inflammatory response in extra-pulmonary sites such as allergic rhinitis; allergic dermatitis and alergic conjunctivitis, exta-pulmonary diseases where inflammatory response plays a major role, and inflammatory bowel disease. Houck et al. (U.S. Pat. Publ. No. 20030013658) disclose the use of small peptides for the treatment of IBD. [0018] In asthma and other respiratory conditions characterized by inflammation and a prominent role of eosinophilic granular cationic proteins, it has been proposed that administration of pseudohalides may be effective in treating the inflammation associated with those conditions (Slungaard et al. WO 02/41885). As disclosed by Slungaard et al, a pseudohalide is a nonhalide moiety capable of reacting as a substrate with peroxidase in the presence of the co-substrate H₂O₂ to form an oxidant product. It is thought that the pseudohalides may block EPO-mediated oxidative protein modification or damage and scavenging of NO, bronchodilator, and thus attenuate the symptoms of asthma, allergies, and skin diseases in which eosinophils have been implicated.

[0019] The importance of management of gastro-intestinal dysfunction, particularly chronic gastro-intestinal inflammation, can not be underestimated, since the presence of gastro-intestinal inflammation can be an early sign for risk of development of further serious conditions. For example, colorectal cancer represents the major cause for excess morbidity and mortality by malignant disease in ulcerative colitis as well as in Crohn's disease. The risk for ulcerative colitis associated colorectal cancer is increased at least 2- fold compared to the normal population. Colorectal cancer is observed in 5.5-13.5% of all patients with ulcerative colitis and 0.4-0.8% of patients with Crohn's disease. Ulcerative- colitis associated colorectal cancer typically can occur in the entire colon, is often multifocal and of undifferentiated histology. Stage distribution and prognosis of ulcerative colitis associated colorectal cancer appears to be similar to that of sporadic colorectal cancer with an overall survival of about 40% (15-65%) after 5 years with tumor stage at diagnosis being the most important predictive parameter for survival (Pohl et al, Hepatogastroenterology (2000) 47(31):57-70).

[0020] Yet, despite its importance in both the clinical and research setting, there continues to be a significant lack of knowledge of the etiology and basis of IBD and related conditions. Consequently, there continues to be a significant need for effective methods of treating gastro-intestinal dysfunction, particularly chronic gastro-intestinal inflammation such as IBD and its related conditions. The present invention addresses this need. SUMMARY OF THE INVENTION

[0021] The present disclosure is of the key role of eosinophil peroxidase activity in gastro-intestinal dysfunction or disease and of the modulation of eosinophil peroxidase activity as a useful means of therapeutic intervention. Accordingly, the invention provides methods for treating (or relieving the symptoms of) dysfunction in a mammalian gastro-intestinal tract in a subject, the method comprising providing to the subject a therapeutically effective amount of a modulator of eosinophil peroxidase activity such that eosinophil-mediated dysfunction or disease of the gastro-intestinal tract is treated or prevented. A wide variety of modulators useful in methods of modulating eosinophil peroxidase activity are provided so as to achieve treatment or relief of symptoms of gastro-intestinal dysfunction or disease.

[0022] Particular gastro-intestinal dysfunctions that may be treated by the present invention include, but are not limited to inflammatory bowel disease (IBD) of whatever type, etiology, or pathogenesis; or inflammatory bowel disease that is a member selected from the group consisting of ulcerative colitis (UC); collagenous colitis; colitis polyposa; transmural colitis; and Crohn's disease (CD).

[0023] In specific embodiments of the invention, the modulators of eosinophil peroxidase activity act by reducing expression of eosinophil peroxidase, reducing degranulation of eosinophils, antagonizing eosinophil peroxidase activity, or depleting peroxidase substrate.

[0024] In particularly preferred embodiments, a modulator of eosinophil peroxidase activity depletes peroxidase substrate. Particular embodiments that exemplify the broad genus of compounds that may find use in the invention through the ability to deplete peroxidase substrate include dihydroxybenzene (in ortho, meta and para isomeric forms), azide, aminotriazol, dapsone, and mixtures thereof. In an especially preferred embodiment the modulator is the meta isomer of dihydroxybenzene, i.e. resorcinol.

& [0025] In an additionally preferred embodiment, the modulator of eosinophil peroxidase may act by reducing the expression of eosinophil peroxidase, i.e. through the disruption or interference with transcription, translation, and associated cellular activities that lead to the expression of active enzyme. These modulators may be of any suitable chemical structure known to be effective in reducing eosinophil peroxidase expression, including nucleic acids or proteins (such as antibodies) or small molecules.

[0026] In a particular embodiment, the modulator is a nucleic acid. In a particularly preferred embodiment, the nucleic acid is an siRNA molecule. Of course, the method used to achieve an attenuated expression of EPO and thus treatment of the contemplated conditions or symptoms may also include other types of nucleic acids that have been demonstrated to be useful in achieving therapeutic ends. These will include, but are not limited to an antisense RNA molecule, an antisense DNA molecule, a ribozyme, or a double stranded RNA molecule.

[0027] In a particularly preferred embodiment of the invention, the nucleic acid is an siRNA molecule. In additional preferred embodiments, the siRNA molecule comprises a strand that is complementary to at least a contiguous portion of a nucleic acid encoding a mammalian eosinophil peroxidase. In one such embodiment the strand is complementary to at least a portion of SEQ. ID. NO:l. In particular embodiments, the strand is complementary to at least 40, 35, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, or about 18 contiguous base pairs or less of SEQ ID NO:l.

[0028] In one embodiment, the invention comprises an expression vector comprising a sequence for an siRNA molecule having complementarity to a RNA molecule derived from a nucleotide sequence encoding a mammalian eosinophil peroxidase. In a particular embodiment, that nucleotide sequence is SEQ ID NO:l. In yet a further embodiment, an expression vector of the invention comprises a nucleic acid sequence encoding two or more RNA molecules, which can be the same or different.

[0029] In additional embodiments, these nucleic acids may be provided to the subject or particular tissue within a subject through the provision of cells expressing EPO modulating nucleic acids or proteins, such as antibodies. [0030] Cells expressing EPO modulating nucleic acids or proteins may be eukaryotic or prόkaryotic in origin. In one embodiment, the invention features a mammalian cell, for example, a human cell, including an expression vector encoding the nucleic acids of encoding a modulator of EPO activity according to the invention.

[0031] In additional, contemplated embodiments, modulators of eosinophil peroxidase activity that may be used within the methods of the invention are those that antagonize eosinophil peroxidase activity. An exemplary antagonist is provided by an arylhydrazide, though those of skill in the art would appreciate that any such compound having the reactivity of arylhydrazides or azides, if pharmaceutically acceptable, would be useful within the methods of the invention.

[0032] In additional embodiments, the methods of the invention further comprise the step of monitoring eosinophil-mediated inflammation. In yet further additional embodimentsembodiemtns, the methods further comprise the step of monitoring eosinophil peroxidase activity.

[0033] Within the methods of the invention, are contemplated any effective means of introducing modulators of eosinophil activity that may be best adapted to the particular subject's needs, the modulator chosen, and the goal and course of any treatment. In a preferred embodiments, a therapeutically effective amount of a modulator of eosinophil peroxidase activity is provided to the subject by injection, taken orally, or through suppository. In specific embodiments, oral administration includes the provision of neutraceuticals and dietary supplements.

[0034] In yet further, preferred embodiments, the methods of the invention comprise comprise providing to the subject a therapeutically effective amount of a modulator of eosinophil peroxidase activity together with at least one other pharmaceutically active agent such that eosinophil-mediated dysfunction of the gastro-intestinal tract is treated or prevented. In additional such embodiments, the other pharmaceutically active agent is co-administered with the modulator of eosinophil peroxidase activity, or may be administered separately from with the modulator of eosinophil peroxidase activity. Additional such embodiments include those in which the at least one other pharmaceutically active agent is also a modulator of eosinophil peroxidase activity.

[0035] Yet further embodiments of the invention are those that include the use of a composition in the manufacture of a medicament for the treatment of eosinophil- mediated dysfunction of the gastro-intestinal tract, wherein the composition comprises a modulator of eosinophil peroxidase activity, and wherein adminstration of the medicament is effective in preventing or reducing the dysfunction.

[0036] The invention also provides- a method of identifying a candidate substance for the treatment of eosinophil-mediated inflammation of the gastro-intestinal tract comprising the steps of: (i) identifying a modulator of eosinophil peroxidase activity; (ii) providing an animal model of gastro-intestinal dysfunction; (iii) characterizing the gastro-intestinal dysfunction of the animal model; (iv) contacting the animal model with the modulator of eosinophil peroxidase activity; and (v) comparing the gastro-intestinal dysfunction of the animal model in step (iv) with the dysfunction observed when said modulator is not present, wherein an alteration in dysfunction indicates that said candidate modulator is a candidate substance for the treatment of eosinophil-mediated inflammation of the gastro-intestinal tract.

[0037] The invention further provides for a process for aiding the treatment of a disease condition comprising making a medicament for the treatment of dysfunction of a mammalian gastro-intestinal tract, wherein the medicament comprises a modulator of eosinophil peroxidase activity, and selling the medicament to an organization involved in managing or providing health care. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of the invention presented herein.

[0039] FIG. 1 (a). Disease Activity Index (DAI) during the course of 2.5% DSS and control treatment in C57BL/6 WT mice.

[0040] FIG. 1 (b). Colon lengths. Data represent the mean colon length + SEM. Statistical significance of differences (p < 0.05) was determined using Student's unpaired t-test.

[0041] FIG. 1 (c). Photograph representative of section of colon from control (non- treated) C57BL/6 WT mice.

[0042] FIG. 1 (d). Photograph of colon from 2.5% DSS treated C57BL/6 WT mice showing loss of pellet formation indicating diarrhea.

[0043] FIG. 2 (a). Representative photomicrograph of H E-stained section of colon from 2.5% DSS treated C57BL/6 WT mice.

[0044] . FIG. 2 (b). Representative photomicrograph of H/E-stained section of colon from control (non-treated) C57BL/6 WT mice.

[0045] FIG. 2 (c). Representative high magnification photomicrograph of immunohistochemical stained section of colon from 2.5% DSS treated mice using the eosinophil specific anti-MBP antibody, filled arrows depicit MBP-positive eosinophils.

[0046] FIG. 2 (d). Representative high magnification photomicrograph of immunohistochemical stained section of colon from control (non-treated) C57BL/6 WT mice using the eosinophil specific anti-MBP antibody, filled arrows depicit MBP-positive eosinophils. [0047] FIG. 2 (e), Additional representative low magnification photomicrograph of immunohistochemical stained section of colon from 2.5% DSS treated mice using the eosinophil specific anti-MBP antibody, filled arrows depicit MBP-positive eosinophils.

[0048] FIG. 2 (f). Representative high magnification photomicrograph of Massons Trichrome stain sections of colon from 2.5% DSS treated mice, open arrow depicits fibrotic thickening of the muscularis mucosa.

[0049] FIG. 3 (a). DAI during the course of DSS treatment in IL-5^"7", eotaxin^'7" and strained matched C57BL/6 WT mice. Data represent the mean ± SEM of 4-5 random sections per mouse for 4-5 mice per group. Statistical significance of differences (p<0.05) was determined using Student's unpaired T-test. Significant differences (*p<0.05) between groups. *p<0.05 as compared to eotaxin^"''^" control, **p<0.01 as compared to IL- 5^";" control; ^#ρ<0.05 as compared to eotaxin ^" DSS and **ρ<0.05 as compared to^'WT control.

[0050] FIG. 3 (b). Colon lengths of control and DSS-treated IL-5^7", eotaxin^"'^" and WT mice. Data represent the mean + SEM of 4-5 random sections per mouse for 4-5 mice per. group. Statistical significance of differences (p<0.05) was determined using Student's unpaired T-test. Significant differences (*p<0.05) between groups. **p<0.01 as compared to matched control.

[0051] FIG. 3 (c). Eosinophil numbers per high powered field in the colon of control and DSS-treated IL-5^7", eotaxin^{" "} and WT mice. Eosinophils were quantitated by counting 20 similar high-powered fields (HPF) (x32 magnification) for each group. Data represent the mean + SEM of 4-5 random sections per mouse for 4-5 mice per group. Statistical significance of differences (p<0,05) was determined using Student's unpaired T-test. Significant differences (*p<0.05) between groups. ^#p<0.05 as compared to eotaxin^7" DSS and **p<0.01 as compared to matched control.

[0052] FIG. 4. DSS treatment induces eosinophil cytolysis and EPO release, Electron photomicrographs of eosinophils in the colon of control (a) and (b) and 2.5% DSS (c) and (d) treated C57B1/6 WT mice. Arrow depicts loss of eosinophil .plasma membrane and the presence of extracellular protein-laden eosinophilic granules, (e) Colonic lumiήal EPO activity in control and 2.5% DSS treated C57BL/6 WT, IL-5-/- and eotaxin-/- mice. Data represent the mean + SEM of 4-5 perfusion samples per group. Statistical significance of differences (p < 0.05) was determined using Student's unpaired T-test. * p < 0.05 as compared to matched Control, # p < 0,05 as compared to Eotaxinv- 2.5% DSS.

[0053] Figure 5. Critical role for EPO in DSS- induced experimental colitis, (a) Disease Activity Index (DAI) during the course of 2.5% DSS treatment in WT, MBP-' and EPO-'- mice. Eosinophil numbers per high powered field in the colon (b) and Colon lengths (c) of control and 2.5% DSS treated WT, MBP'- and EPO mice. Eosinophils were quantitated by counting 20 similar high-powered fields (HPF) (x32 magnification) for each group. Data represent the mean ^± stand error of mean (SEM) of 4-5 random sections per mouse for 4-5 mice per group, (d) Colonic luminal EPO activity in control and 2.5% DSS treated C57B1/6 WT, MBP-/- and EPO-/- mice. Data represent the mean + SEM of 4-8 perfusion samples per group. Statistical significance of differences (p < 0.05) was determined using Student's unpaired T-test. (a) * p < 0.05 as compared to EPO'- Control, ** p < 0.05 as compared to MBP'- Control; # p < 0.05 as compared to EPO'- 2.5% DSS. (b) * p < 0.05 as compared to WT Control, (d) * p < 0.01 as compared to matched Control; * p < 0.05 as compared to EPO-'- 2.5% DSS.

[0054] FIG. 6. Inhibition of eosinophil peroxidase activity by resorcinol. Dose dependent effect of resorcinol on EPO activity. Data represent the mean ⁱ SEM of 4-5 mice per group. Statistical significance of differences (p<0.05) was determined using Student's unpaired T-test. Significant differences (*p< 0,05) between groups.

[0055] FIG 7 (a). DAI during the course of DSS treatment in vehicle- and 1.25mg/kg resorcinol-treated C57BL/6 WT mice. Data represent the mean ^± SEM of 4-5 mice per group.

[0056] FIG. 7 (b). Colon lengths of control- and DSS-treated C57BL/6 WT mice administered vehicle or 1.25mgkg resorcinol. Data represent the mean + SEM of 4-5 mice per group. Statistical significance of differences (p<0.05) was determined using Student's unpaired T-test. ⁺p<0.05 as compared to vehicle and p<0.05; as compared to 1.25mg/kg resorcinol.

[0057] FIG. 7 (c). Eosinophil numbers/HPF in the colon of control- and DSS-treated C57BL/6 WT mice administered vehicle or l,25mg/kg resorcinol. Data represent the mean + SEM of 4-5 mice per group. Statistical significance of differences (p<0.05) was determined using Student's unpaired T-test. Significant differences (*p< 0.05) between groups. ⁺p<0.01 as compared to vehicle.

[0058] FIG. 7 (d). Colonic luminal EPO activity in control and DSS-treated C57BL/6 WT mice administered i.v. vehicle or 1.25mg/kg resorcinol. Data represent the mean + SEM of 4-8 perfusion samples per group. Statistical significance of differences (p<0.05) was determined using Student's unpaired T-test. Significant differences (*p< 0.05) between groups. *p< 0.001 as compared to vehicle, **p<0.01 as compared to vehicle and ^#p<0.001 as compared to 1.25mg/kg resorcinol.

[0059] FIG. 7 (e). Disease score during the course of DSS-treatment in mice treated with vehicle and 0.25mg/kg resorcinol on Day 6 and 7. Data represents individual disease score per mouse per group. Statistical significance of differences (p<0.05) was determined using Student's unpaired T-test. Significant differences (*p< 0.05) between groups. The disease score for these experiments were derived by the following score: 1 = healthy + normal stool (formed pellets); 2 = macroscopic bleeding (occult anal bleeding) + normal stool (formed pellets); 3= pilar erecti, decreased activity and body mass, macroscopic bleeding (observable anal bleeding) and diarrhoea (semi-formed stools that do not stick to the anus); 4= pilar erecti, dehydration, hunched posture, decreased activity and body mass, excreted perianal mucus, macroscopic bleeding (blood around the anus) and diarrhoea (pasty and semi-formed stools that stick to the anus) and 5= pilar erecti, abdominal distention, shrunken eyes, dehydration, hunched posture, decreased activity and body mass, excreted perianal mucus, gross macroscopic bleeding (blood around the anus or in the cage) and diarrhoea (liquid stools that stick to the anus). DETAILED DESCRIPTION OF THE INVENTION

[0060] The following detailed descriptions of particular embodiments and examples are offered by way of illustration and not by way of limitation. Unless contraindicated or noted otherwise, in these descriptions and throughout this specification, the terms "a" and "an" mean one or more, the term "or" means and/or.

[0061] By "comprising" is meant including, but not limited to, whatever follows the word "comprising". Thus, use of the term "comprising" indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present. By "consisting of" is meant including, and limited to, whatever follows the phrase "consisting of." Thus, the phrase "consisting of" indicates that the listed elements are required or mandatory, and that no other elements may be present. By "consisting essentially of" is meant including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase "consisting essentially of indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present depending upon whether or not they affect the activity or action of the listed elements.

[0062] "Gastro-intestinal inflammation" as used herein refers to inflammation of a mucosal layer of the gastro-intestinal tract, and encompasses acute and chronic inflammatory conditions. Acute inflammation is generally characterized by a short time of onset and infiltration or influx of neutrophils. Chronic inflammation is generally characterized by a relatively longer period of onset and infiltration or influx of mononuclear cells. Chronic inflammation can also typically characterized by periods of spontaneous remission and spontaneous occurrence. "Mucosal layer of the gastrointestinal tract" is meant to include mucosa of the bowel (including the small intestine and large intestine), rectum, stomach (gastric) lining, oral cavity, and the like.

[0063] "Chronic gastro-intestinal inflammation" refers to inflammation of the mucosal of the gastro-intestinal tract that is characterized by a relatively longer period of onset, is long-lasting (e.g., from several days, weeks, months, or years and up to the life of the subject), and is associated with infiltration or influx of mononuclear cells and can be further associated with periods of spontaneous remission and spontaneous occurrence. Thus, subjects with chronic gastro-intestinal inflammation may be expected to require a long period of supervision, observation, or care. "Chronic gastro-intestinal inflammatory conditions" (also referred to as "chronic gastro-intestinal inflammatory diseases") having such chronic inflammation include, but are not necessarily limited to, inflammatory bowel disease (IBD), colitis induced by environmental insults (e.g., gastro-intestinal inflammation (e.g., colitis) caused by or associated with (e.g., as a side effect) a therapeutic regimen, such as administration of chemotherapy, radiation therapy, and the like), colitis in conditions such as chronic granulomatous disease (Schappi et al. Arch Dis Child. February 2001; 84(2):147-151), celiac disease, celiac sprue (a heritable disease in which the intestinal lining is inflamed in response to the ingestion of a protein known as gluten), food allergies, gastritis, infectious gastritis or enterocolitis (e.g., Helicobacter pylori-infected chronic active gastritis) and other forms of gastro-intestinal inflammation caused by an infectious agent, and other like conditions.

[0100] As used herein, "inflammatory bowel disease" or "IBD" refers to any of a variety of diseases characterized by inflammation of all or part of the intestines. Examples of inflammatory bowel disease include, but are not limited to, Crohn's disease and ulcerative colitis. Reference to IBD throughout the specification is often referred to in the specification as exemplary of gastro-intestinal inflammatory conditions, and is not meant to_.be limiting.

[0101] As used herein, "subject" or "individual" or "patient" refers to any subject for whom or which therapy is desired, and generally refers to the recipient of the therapy to be practiced according to the invention. The subject can be any vertebrate, but will preferably be a mammal. If a mammal, the subject will preferably be a human, but may also be a domestic livestock, laboratory subject or pet animal.

[0102] "Treatment" or "treating" as used herein means any therapeutic intervention in a subject, usually a mammalian subject, generally a human subject, including: (i) prevention, that is, causing the symptoms not to develop, e.g., preventing progression to a harmful state; (ii) inhibition, that is, arresting the development or further development of symptoms, e.g., mitigating or completely inhibiting active (ongoing) inflammation so as to decrease inflammation, which decrease can include substantially complete elimination of inflammation; or (iii) relief, that is, causing the regression of symptoms, e.g., causing relief from diarrhea, rectal bleeding and weight loss, reduction in colon weight, reduction in colon lesions, reduction of strictures, reduction of fistulae, or reduction colonic inflammation.

[0103] The term "effective amount" or "therapeutically effective amount" means a dosage sufficient to provide for treatment for the disease state being treated or to otherwise provide the desired effect (e.g., reduction of inflammation or other symptoms ^■ of gastro-intestinal dysfunction). The precise dosage will vary according to a variety of factors such as subject-dependent variables (e.g., age, medical history, etc.), the disease (e.g., the type of gastro-intestinal dysfunction), and the treatment being effected. In the case of treatment of gastro-intestinal inflammation, an "effective amount" is that amount sufficient to substantially improve the likelihood of treating the inflammation or other symptom of a gastro-intestinal inflammatory disease such as, but not limited to, IBD, UC, or CD.

[0104] As used herein, "pharmaceutically acceptable carrier" includes any material which, when combined with an active ingredient of a composition, allows the ingredient to retain biological activity and without causing disruptive reactions with the subject's immune system. Examples include, but are not limited to, any of the standard pharmaceutical carriers such as a phosphate buffered saline solution, water, emulsions such as oil and water emulsion, and various types of wetting agents. Preferred diluents for aerosol or parenteral administration are phosphate buffered saline or normal (0.9%) saline. Compositions comprising such carriers are formulated by well known conventional methods (see, for example, Remington's Pharmaceutical Sciences, Chapter 43, 14th Ed., Mack Publishing Col, Easton Pa. 18042, USA),

[0105] Modulation of eosinophil peroxidase (EPO) activity as used^' herein refers to any change in the measurable or therapeutically effective amount of EPO catalyzed reactions. As is well known to those of skill in the art, (see O'Brien, (2000) Peroxidases, Chemico-Biological Interactions 129: 113-139) eosinophil peroxidase catalyzed reactions include those that follow the the following general scheme of reaction:

[0106] EP^J+Peroxidase + ROOH -> Compound I + ROH

[0107] Compound I + XOH+ H⁺EP³⁺ + HOX -> Compound II + XO*

[0108] Compound II + XOH -> Peroxidase + XO* + H2O

[0109] As is well known to those of skill in the relevant art, eosinophil peroxidase is known by a number of acronyms, including EPO, EP³⁺ and EPX. See O'Brien (2000). These acronyms and aliases, and others that may be coined, are meant to refer to the enzyme and enzyme activity identified herein, whether of human origin, or derived from other mammalian species.

[0110] As used herein, R, as in ROOH, refers to any chemical structure that possesses a hydroperoxide group. As used herein, X, as in X^'O refers to halides or pseudohalides (thiocyanate). As used herein, HOXXO* denotes Hypohalous acids.

[0111] Compound I and Compound II refer to specific redox intermediate reaction products, as disclosed in the above scheme and as known to those of skill in the art. See O'Brien (2000), for example.

[0112] Modulation of EPO activity includes any act that successfully alters the rate of any of the intermediate reactions or the entire reaction scheme for EPO. Such modulation may be achived by various methods, but specifically includes (i) providing an agent that reduces the expression of the EPO protein, (ii) providing an agent that antagonizes the enzyme, or providing an agent that depletes peroxidase substrate. In non- limiting examples depletion of peroxidase substrate includes depletion of available ROOH, antagonizing the enzyme includes administration of compounds that result in inactive peroxidase or the accumulation of any of the reaction intermediates, and reduction of expression of the peroxidase protein includes any reduction in the amount of

IS active, available enzyme that may lead to the disease conditions to which the present invention is directed.

[0113] The present invention discloses that modulation of gastric eosinophil peroxidase (EPO) activity is effective in treating or reducing symptoms of inflammatory conditions of the gastro-intestinal tract, such as that of inflammatory bowel disease (IBD). The invention provides a new and potent therapeutic advantage that is effective across species as may be demonstrated in a variety of animal models of chronic or acute gastro-intestinal dysfunction, which animal models are regarded in the field as accurate and predictive models of disease in humans.

[0114] The modulation of EPO activity in treatment of gastro-intestinal inflammation is shown herein to reduce disease activity, e.g., diarrhea, rectal bleeding and weight loss, to reduce colon weight and colon lesions, as well as to reduce colonic inflammation, as measured by, for example, anti-neutrophil cytoplasmic antibodies (ANCA), colonic myelo-peroxidase activity, eosinophil peroxidase activity or other indicator of gastro-intestinal inflammation. Such indicators can be used to monitor the therapy based upon modulation of EPO activity as described herein. This discovery offers an attractive new treatment strategy for the large number of patients suffering from gastro-intestinal inflammation, particularly chronic gastro-intestinal inflammation, such as those patients suffering from IBD, particularly those patients for whom no satisfactory and effective treatment is currently available,

[0115] Ulcerative colitis (UC) is a chronic, recurrent ulceration in the colon, chiefly of the mucosa and submucosa, which is of unknown cause, and which is manifested clinically by cramping abdominal pain, rectal bleeding, and loose discharges of blood, pus, and mucus with scanty fecal particles. Related diseases of the bowel include collagenous colitis, which is a type of colitis of unknown etiology that is characterized by deposits of collagenous material beneath the epithelium of the colon, and marked by crampy abdominal pain with a conspicuous reduction in fluid and electrolyte absorption that leads to watery diarrhea; colitis polyposa, which is ulcerative colitis associated with the formation of pseudopolyps, i.e., edematous, inflamed islands of mucosa between areas of ulceration; and transmural colitis, which is inflammation of the full thickness of the bowel, rather than mucosal and submucosal disease, usually with the formation of noncaseating granulomas, that clinically resembles ulcerative colitis but in which the ulceration is often longitudinal or deep, the disease is often segmental, stricture formation is common, and fistulas, particularly in the perineum, are a frequent complication.

[0116] Crohn's disease (CD) is a chronic granulomatous inflammatory disease of unknown etiology involving any part of the gastro-intestinal tract, but commonly involving the terminal ileum with scarring and thickening of the bowel wall, frequently leading to intestinal obstruction, and fistula and abscess formation, and having a high rate of recurrence after treatment. Ulcerative colitis, Crohn's disease and the related diseases discussed above are collectively referred to as inflammatory bowel disease (IBD). These diseases are chronic, spontaneously relapsing disorders of unknown cause that are immunologically mediated and whose pathogenesis has been established through the use of animal models and advanced immunological techniques. See Bickston and Caminelli, "Recent developments in the medical therapy of IBD," Curr. Opin. Gastroenterol. 14 6- 10, 1998; and Murthy et al., "Inflammatory bowel disease: A new wave of therapy," Exp. Opin. Ther. Patents 8(7) 785-818, 1998. While the incidence of ulcerative colitis has remained relatively stable, the incidence of Crohn's disease has increased significantly.

[0117] Current therapy for inflammatory bowel disease includes 5-aminosalicylic acid, corticosteroids, and immunomodulators such as azathioprine, 6-mercaptopurine, and methotrexate. These agents have a wide range of adverse side effects and do not modify the disease itself, and there is thus an ongoing need for more effective treatment agents. The compounds of Marfat et al. have been proposed to be able to beneficially treat inflammatory bowel diseases as a result of their ability to inhibit the production of TNF- alpha, because TNF-alpha causes immune cell activation, proliferation, and mediator release in inflammatory bowel disease. See Radford-Smith and Jewell, "Cytokines and inflammatory bowel disease." Baillieres Clin. Gasteroenterol. 10 151-164, 1996. TNF- alpha has also been detected in the stools and intestinal mucosa of patients with inflammatory bowel disease. Further, early clinical studies in Crohn's disease using TNF monoclonal antibodies have shown significant promise. [0118] MODULATING EOSINOPHIL PEROXIDASE (EPO) ACTIVITY

[0119] Depleting Peroxidase Substrate

[0120] EPO activity may be modulated or attenuated by the provision of agents that act to deplete peroxidease substrate. Referring to the reaction scheme as provided above, one such substrate is ROOH. Agents that act to deplete peroxidase substrate, such as ROOH or H₂O₂, and related substrates include those agents that possess the ability to substitute and thereby cleave the ROOH or H₂O₂into H₂O and OOH . Such agents are well known to those of skill in the art and may be selected for the use in the present invention based upon their known toxicology, reactivity, and chemical structure, Such agents include, but are not limited to the following:

[0121] Resorcinol:

[0122] 3-amino-l,2,4-triazole:

[0123] Dapsone:

[0124] Resorcinol (or resorcin) is one of three isomers of dihydroxybenzene. The other isomers are catechol (or catechin, pyrocatechol, pyrocatechuic acid), which is the ortho (1,2) isomer, and hydroquinone (or quinol), which is the para (1,4) isomer.

[0125] Resorcinol, its isomers, and the other compounds disclosed hereinabove are known to possess similar reactivity such that a peroxide substrate of EPO (ROOH in the disclosed reaction scheme) is depleted, Many other compounds are known that have similar reactivities and that may be used in the methods of the invention. As further disclosed herein, administration of these and similarly reactive agents in therapeutically effective amounts results in the treatment of IBD, UC, CD, and related gastro-intestinal dysfunction through the modulation or attenuation of EPO activity by depleting EPO substrate.

[0126] Antagonizing EPO

[0127] EPO activity may be modulated or attenuated by the provision of agents that act to antagonize EPO activity. Referring to the reaction scheme for EPO as providedabove, such agents include but are not limited to alkylhydrazines and may include suitable azides. See, for example, Ator et al (1989) J. Biol. Chem. 264(16):9250-9257.

[0128] Reduction of EPO Expression

[0129] One embodiment of the present invention is to modulate EPO activity and thus its role in gastro-intestinal dysfunction through the reduction or attenuation of EPO expression. As contemplated herein, any means of modulating protein expression that will specifically attenuate EPO expression and thereby result in reduced EPO activity may be employed in the practice of the invention. One particular embodiment of the invention involves use of nucleic acids to modulate EPO activity.

[0130] A nucleic acid may be made by any technique known to one of ordinary skill in the art. Non-limiting examples of synthetic nucleic acid, particularly a synthetic oligo nucleotide, include a nucleic acid made by in vitro chemical synthesis using phosphotriester, phosphite or phosphoramidite chemistry and solid phase techniques such as described in EP 266,032, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al., 1986, and U.S. Patent Serial No. 5,705,629. A non-limiting example of enzymatically produced nucleic acid include one produced by enzymes in amplification reactions such as PCR™ (see for example, U.S. Patent 4,683,202 and U.S. Patent 4,682,195), or the synthesis of oligonucleotides described in U.S. Patent No. 5,645,897. A non-limiting example of a biologically produced nucleic acid includes recombinant nucleic acid production in living cells (see for example, Sambrook et al. 1989).

[0131] A nucleic acid may be purified on polyacrylamide gels, cesium chloride centrifugation gradients, or by any other means known to one of ordinary skill in the art (see for example, Sambrook et al. 1989).

[0132] The term "nucleic acid" will generally refer to at least one molecule or strand of DNA, RNA or a derivative or mimic thereof, comprising at least one nucleobase, such as, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., adenine "A," guanine "G," thymine "T," and cytosine "C") or RNA (e.g. A, G, uracil "U," and C). The term "nucleic acid" encompasses the terms "oligonucleotide" and "polynucleotide." The term "oligonucleotide" refers to at least one molecule of between about 3 and about 100 nucleobases in length. The term "polynucleotide" refers to at least one molecule of greater than about 100 nucleobases in length. These definitions generally refer to at least one single-stranded molecule, but in specific embodiments will also encompass at least one additional strand that is partially, substantially or fully complementary to the at least one single-stranded molecule. Thus, a nucleic acid may encompass at least one double-stranded molecule or at least one triple-stranded molecule that comprises one or more complementary strand(s) or "complement(s)" of a particular sequence comprising a strand of the molecule.

[0133] In certain embodiments, a "gene" refers to a nucleic acid that is transcribed. As used herein, a "gene segment" is a nucleic acid segment of a gene. In certain aspects, the gene includes regulatory sequences involved in transcription, or message production or composition. In particular embodiments, the gene comprises transcribed sequences that encode for a protein, polypeptide or peptide. In other particular aspects, the gene comprises a nucleic acid, or encodes a polypeptide or peptide-coding sequences of a gene that is defective or mutated in a hematopoietic and lympho-hematopoietic disorder. In keeping with the terminology described herein, an "isolated gene" may comprise transcribed nucleic acid(s), regulatory sequences, coding sequences, or the like, isolated substantially away from other such sequences, such as other naturally occurring genes, regulatory sequences, polypeptide or peptide encoding sequences, etc. In this respect, the term "gene" is used for simplicity to refer to a nucleic acid comprising a nucleotide sequence that is transcribed, and the complement thereof. In particular aspects, the transcribed nucleotide sequence comprises at least one functional protein, polypeptide or peptide encodipg unit. As will be understood by those in the art, this functional term "gene" includes both genomic sequences, RNA or cDNA sequences, or smaller engineered nucleic acid segments, including nucleic acid segments of a non-transcribed part of a gene, including but not limited to the non-transcribed promoter or enhancer regions of a gene. Smaller engineered gene nucleic acid segments may express, or may be adapted to express using nucleic acid manipulation technology, proteins, polypeptides, domains, peptides, fusion proteins, mutants or such like. Thus, a "truncated gene" refers to a nucleic acid sequence that is missing a stretch of contiguous nucleic acid residues.

[0134] Various nucleic acid segments may be designed based on a particular nucleic acid sequence, and may be of any length. By assigning numeric values to a sequence, for example, the first residue is 1, the second residue is 2, etc., an algorithm defining all nucleic acid segments can be created: [0135] n to n + y

[0136] where n is an integer from 1 to the last number of the sequence and y is the length of the nucleic acid segment minus one, where n + y does not exceed the last number of the sequence. Thus, for a 10-mer, the nucleic acid segments correspond to bases 1 to 10, 2 to 11, 3 to 12 .,, or so on. For a 15-mer, the nucleic acid segments correspond to bases 1 to 15, 2 to 16, 3 to 17 ... or so on. For a 20-mer, the nucleic segments correspond to bases 1 to 20, 2 to 21, 3 to 22 ... or so on.

[0137] A particularly preferred embodiment involves nucleic acids that act through the phenomenon generally known as RNA interference, or RNAi. As disclosed in numerous publications, and effectively summarized in WO 03/012052, WO 02/44321, and WO 99/32619, administration of double stranded RNA of a sequence specific to a portion of the EPO gene may be used to attenuate EPO expression and thereby EPO activity. Such RNA molecules are generally known as siRNA, for short, inhibitory RNA, though other synonyms are in use and the use of siRNA herein is not meant to exclude other published or accepted synonyms.

[0138] The methods and materials necessary for synthesizing and optimizing such double stranded RNA and its use in obtaining gene specific inhibition of expression are well known to those of skill in the art and are described in, for example, WO 01/75164, U.S. Pat. No. 2002/0137210, WO 01/29058, WO 02/072762, WO 02/059300, WO 02/44321, WO 01/92513, WO 01/68836, U.S. Pat. No. 2002/0173478, U.S. Pat. No. 2002/0160393, U.S. Pat. No. 2002/0162126, U.S. Pat. No. 2002/0137709, U.S. Pat. No. 2002/0132788, U.S. Pat. No. 2002/0086356, and WO 99/32619. See especially WO 03/012052. Double stranded RNA may be derived from enzymatic digestion of larger RNA or through direct chemical synthesis. For example, WO 03/064621 discusses the various means by which the sequence of short, double stranded RNAs may be selected and the molecules themselves obtained for use in practicing RNA interference.

[0139] Administration of the double stranded RNA may be direct, i.e. by providing to the cells of the gastro-intestinal tissues appropriate RNA, or indirect, i.e. by providing to gastro-intestinal tissues a gene construct, or cells containing a gene construct that expresses the interfering RNA. Such constructs may be contained within vectors that are well known to the skilled artisan,

[0140] siRNA molecules that interact with and down-regulate EPO genes may be expressed from transcription units inserted into DNA or RNA vectors. The recombinant vectors can be DNA plasmids or viral vectors. RNA expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphavirus. The recombinant vectors capable of expressing the RNA molecules can be delivered so as to persist in target cells. Alternatively, viral vectors can be used that provide for transient expression of siRNA molecules,

[0141] Such vectors can be repeatedly administered as necessary. Once expressed, the siRNA molecules bind and down-regulate gene function or expression via RNA interference (RNAi). Delivery of siRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from a patient followed by reintroduction into the patient, or by any other means that would allow for introduction into the desired target cell.

[0142] In one embodiment, the invention features an expression vector comprising a nucleic acid sequence encoding at least one siRNA molecule of the invention, in a manner that allows expression of the siRNA molecule. For example, the vector can contain sequence(s) encoding both strands of a siRNA molecule comprising a duplex. The vector can also contain sequence(s) encoding a single nucleic acid molecule that is self complementary and thus forms a siRNA molecule. Non-limiting examples of such expression vectors are described in Paul et al., 2002, Nature Biotechnology, 19, 505; Miyagishi and Taira, 2002, Nature Biotechnology, 19, 497; Lee et al., 2002, Nature Biotechnology, 19, 500; and Novina et al, Nat Med. 2002 Jul;8(7):681-6.

[0143] Injectable Compositions and Pharmaceutical Formulations

[0144] Administration and Dosage [0145] Treatment includes prophylaxis and therapy. Prophylaxis or therapy can be accomplished by a single direct administration at a single time point or multiple time points. Administration can also be delivered to a single or to multiple sites.

[0146] The subject can be any vertebrate, but will preferably be a mammal. Mammals include, but are not necessarily limited to, human, bovine, equine, canine, feline, porcine, and ovine animals. If a mammal, the subject will generally be a human, but may also be a domestic livestock, laboratory subject or pet animal. Modulators of EPO activity are administered to an individual using any available method and route suitable for drug delivery including systemic, mucosal, and localized routes of administration. In general, subjects who receive therapy according to the invention include those who has or are at risk of acute or chronic gastro-intestinal inflammation, particularly those who have or are at risk of chronic gastro-intestinal inflammation, particularly inflammatory bowel disease, especially ulcerative colitis or Crohn's disease. Methods for identification of such subjects with these conditions or at risk of these conditions are well within the skill and knowledge of the ordinarily skilled artisan.

[0147] Routes of Administration

[0148] Conventional and pharmaceutically acceptable routes of administration for treatment of gastro-intestinal inflammation (e.g., chronic gastro-intestinal inflammation such as that of IBD), include, but are not necessarily limited to, intramuscular, subcutaneous, intradermal, transdermal, intravenous, recta (e.g., enema, suppository), oral, intragastric, intranasal and other routes of effective inhalation routes, and other parenteral routes of administration. In general, gastro-intestinal routes of administration are of particular interest in the present invention for treatment of gastro-intestinal inflammation including, but not necessarily limited to oral (including ingestion), intranasal, intragastric, and rectal administration. Routes of administration may be combined, if desired, or adjusted depending upon the modulator of EPO activitymolecule or the desired effect on the immune response. The modulator of EPO activitycomposition can be administered in a single dose or in multiple doses, and may encompass administration of additional doses, to elicit or maintain the desired effect. [0149] Modulators of EPO activity can be administered to a subject using any available conventional methods and routes suitable for delivery of conventional drugs, including systemic or localized routes. Methods and localized routes that further facilitate production of a type-1 or type-1-like response or the anti-gastro-intestinal inflammatory (e.g., anti-IBD) activity of the modulator of EPO activitymolecules, particularly at or near a site of inflammation is of interest in the invention, and may be preferred over systemic routes of administration, both for the immediacy of therapeutic effect and reduction of the incident of in vivo degradation of the administered modulators of EPO activity. In general, routes of administration contemplated by the invention include, but are not necessarily limited to, gastroenteral, enteral, or parenteral routes. Gastroenteral routes of administration include, but are not necessarily limited to, oral and rectal (e.g., using a suppository) delivery.

[0150] Dose

[0151] The dose of modulator administrated to a subject, in the context of the present invention, should be sufficient to effect a beneficial therapeutic response in the subject over time, or to alleviate symptoms. Thus, a modulator is administered to a patient in an amount sufficient to alleviate, reduce, cure or at least partially arrest symptoms or complications from the disease. An amount adequate to accomplish this is defined as a "therapeutically effective amount."

[0152] It should be noted that the therapeutic activity of the modulators of the invention is essentially dose-dependent. Clinically, it may be advisable to administer the modulator of EPO activity in a low dosage, then increase the dosage as needed to achieve the desired therapeutic goal (e.g., increasing amounts of modulator can be administered until a reduction or mitigation in the gastro-intestinal dysfunction or EPO activity is achieved).

[0153] In particular embodiments, such as methods employing resorcinol and like compounds, effective concentrations of modulator may be achieved through appropriate dosage resulting in concentrations ranging from lfM to at least lOnM. In a non-limiting example, resorcinol may be employed in the methods of the invention at a dose of about 1,5 mg/kg body weight and injected intra peritoneally (i.p.).

[0154] In addition, some routes of administration will require higher concentrations than other routes. Those skilled in the art can adjust the dosage and concentration to suit the particular route of delivery.

[0155] The effectiveness of therapy can be monitored by monitoring the reduction of dysfunction or EPO activity in the subject, and, if necessary, dosage adjusted accordingly. Reduction in dysfunction can be monitored by, for example, monitoring reduction of incidence of diarrhea or volume of stool, reduction of rectal bleeding, reduction of weight loss, reduction of size or number of colon lesions, reduction or opening of strictures, reduction or closure of fistulae, and the like. Therapeutic effectiveness can also be measured by for example, a decrease in anti-neutrophil cytoplasmic antibodies (ANCA) in a biological sample, a decrease in colonic myelo- peroxidase activity, reduction of anemia (as detected by, for example, erythrocyte sedimentation rate (ESR), hemoglobin levels, and the like ), decrease in EPO activity, or other conventional indicator of gastro-intestinal inflammation. Many of these methods for assessing therapeutic efficacy can be accomplished through endoscopy or through blood tests. Methods for monitoring gastro-intestinal inflammation are well known in the art and well within the skill and knowledge of the ordinarily skilled artisan.

[0156] Reduction of Risk of Subsequent Disease

[0157] The methods of the invention can also provide for reduced risk of other conditions for which gastro-intestinal inflammation is a risk factor. For example, ulcerative colitis is a risk factor for colonic carcinoma. Thus, treatment of ulcerative colitis (e.g., by reduction of inflammation) according to the methods of the invention also reduces the risk of colonic cancer (e.g., colonic carcinoma, colonic adenoma, and the like). The methods of the invention can thus be applied as prophylactic measure to prevent or reduce the risk of onset of colonic carcinoma, particularly in those patients that are high risk of colon cancer. [0158] Established risk factors for colon cancer in those patients having ulcerative colitis include long duration of the disease, large extent of the disease, low activity of the disease, young age at onset, presence of complicating primary sclerosing cholangitis or stenotic disease and possibly lack of adequate surveillance, inadequate pharmacological therapy, folate deficiency and non-smoking. Crohn's disease is associated with an increased risk of colorectal carcinoma in patients with long-standing disease, strictures and fistulae under the condition that the colon is involved, tumors of the small intestine may occur occasionally, (see, e.g., Pohl, et al. (2000), ibid). Thus treatment using according to the invention can be of particular benefit in these patients

[0159] Formulations

[0160] In general, modulators of EPO activity are prepared in a pharmaceutically acceptable composition. or delivery to a host. Such compositions include compositions suitable for use in nutraceutical formulations, including food compositions. Modulators of EPO activity are optionally provided with a pharmaceutically . acceptable carrier. Exemplary pharmaceutically carriers include sterile aqueous of non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. A composition of modulator may also be lyophilized using means well known in the art, for subsequent reconstitution and use according to the invention. Also of interest are formulations for liposomal delivery, and formulations comprising microencapsulated modulators of EPO activity. Pharmaceutically acceptable carriers include food-grade carriers

[0161] In general, the pharmaceutical- compositions can be prepared in various forms, such as granules, tablets, pills, suppositories, capsules (e.g. adapted for oral delivery), microbeads, microspheres, liposo es, suspensions, salves, lotions and the like. The modulator of EPO activityuseful in the invention can be prepared in a variety of formulations, including conventional pharmaceutically acceptable carriers, and, for example

[0162] Pharmaceutical grade organic or inorganic carriers or diluents suitable for oral and topical use can be used to make up compositions comprising the therapeutically- active compounds. Diluents known to the art include aqueous media, vegetable and animal oils and fats. Stabilizing agents, wetting and emulsifying agents, salts for varying the osmotic pressure or buffers for securing an adequate pH value.

[0163] Nucleic acid modulators of EPO activity can be administered in the absence of agents or compounds that might facilitate uptake by target cells (e.g., as a "naked" polynucleotide, e.g., a polynucleotide that is not encapsulated by a viral particle). Nucleic acid modulators of EPO activity can also be administered with compounds that facilitate uptake of nucleic acids by cells (e.g., by macrophages) or otherwise enhance transport of the modulator to a treatment site for action

[0164] A colloidal dispersion system may be used for targeted delivery of modulators of EPO activity to specific tissue. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

[0165] Liposomes are artificial membrane vesicles which are useful as delivery vehicles in vitro and in vivo. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2-4.0 micrometers can encapsulate a substantial percentage of an aqueous buffer containing large molecules. RNA and DNA can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al, (1981) Trends Biochem. Sci., 6:77). The composition of the liposome is usually a combination of phospholipids, particularly high-phase-transition-temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations. Examples of lipids useful in liposome production include phosphatidyl compounds, such as phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides. Particularly useful are diacylphosphatidylglycerols, where the lipid moiety contains from 14-18 carbon atoms, particularly from 16-18 carbon atoms, and is saturated. Illustrative phospholipids include egg phosphatidylcholine, dipalmitoylphosphatidylcholine and distearoylphosphatidylcholine

[0166] Where desired, targeting of liposomes can be classified based on anatomical and mechanistic factors. Anatomical classification is based on the level of selectivity, for example, organ-specific, cell-specific, and organelle-specific. Mechanistic targeting can be distinguished based upon whether it is passive or active. Passive targeting utilizes the natural tendency of liposomes to distribute to cells of the reticulo-endothelial system (RES) in organs which contain sinusoidal capillaries. Active targeting, on the other hand, involves alteration of the liposome by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein, or by changing the composition or size of the liposome in order to achieve targeting to organs and cell types other than the naturally occurring sites of localization

[0167] The surface of the targeted delivery system may be modified in a variety of ways. In the case of a liposomal targeted delivery system, lipid groups can be incorporated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable association with the liposomal bilayer. Various well known linking groups can be used for joining the lipid chains to the targeting ligand (see, e.g., Yanagawa, et al., (1988) Nuc. Acids Symp. Ser., 19:189; Grabarek, et al., (1990) Anal. Biochem., 185:131; Staros, et al., (1986) Anal. Biochem. 156:220 and Boujrad, et al„ (1993) Proc. Natl. Acad. Sci. USA, 90:5728). Targeted delivery of nucleic acid molecules can also be achieved by conjugation of the nucleic acid to the surface of viral and non- viral recombinant expression vectors, to an antigen or other ligand, to a monoclonal antibody or to any molecule which has the desired binding specificity.

[0168] Nutraceutical [0169] The term "nutraceutical formulation" refers to a food or part of a food that offers medical or health benefits including prevention or treatment of disease. Nutraceutical products range from isolated nutrients, dietary supplements and diets, to genetically engineered designer foods, functional foods, herbal products and processed foods such as cereal, soup and beverages. The term "functional foods," refers to foods that include "any modified food or food ingredients that may provide a health benefit beyond the traditional nutrients it contains." Thus, by definition, pharmaceutical compositions comprising a modulator of EPO activity include nutraceuticals. Also by definition, pharmaceutical compositions comprising a modulator of EPO activity include compositions comprising such a modulator and a food-grade component. Modulators of EPO activity may be added to food products to provide a health benefit.

[0170] Nutraceutical formulations of interest include foods for veterinary or human use, including food bars (e.g. cereal bars, breakfast bars, energy bars, nutritional bars); chewing gums; drinks; fortified drinks; drink supplements (e.g., powders to be added to a drink); tablets; and the like. These foods are enhanced by the inclusion of a modulator of eosinophil activity. For example, in the treatment of an inflammatory bowel disease, the normal diet of a patient may be supplemented by a modulator of EPO activity provided through a nutraceutical formulation taken on a regular basis, e.g., at meal times, before meals, or after meals

[0171] The present invention provides compositions (e.g., nutraceutical compositions) comprising a modulator of EPO activity and a food-grade pharmaceutically acceptable excipient. In many embodiments, nutraceutical compositions include one or more components found in food products. Thus, the instant invention provides a food composition and products comprising a modulator of EPO activity and a food component. Suitable components include, but are not limited to, mono- and disaccharides; carbohydrates; proteins; amino acids; fatty acids; lipids; stabilizers; preservatives; flavoring agents; coloring agents; sweeteners; antioxidants, chelators, and carriers; texturants; nutrients; pH adjusters; emulsifiers; stabilizers; milk base solids; edible fibers; and the like. The food component can be isolated from a natural source, or can be synthesized. All components are food-grade components fit for human consumption.

[0172] Examples of suitable monosaccharides include sorbitol, mannitol, erythrose, threose, ribose, arabinose, xylose, ribulose, glucose, galactose, mannose, fructose, and sorbose. Non-limiting examples of suitable disaccharides include sucrose, maltose, lactitol, maltitol, maltulose, and lactose

[0173] Suitable carbohydrates include oligosaccharides, polysaccharides, or carbohydrate derivatives. As used herein, the term "oligosaccharide" refers to a digestible linear molecule having from 3 to 9 monosaccharide units, wherein the units are covalently connected via glycosidic bonds. As used herein, the term "polysaccharide" refers to a digestible (i.e., capable of metabolism by the human body) macromolecule having greater than 9 monosaccharide units, wherein the units are covalently connected via glycosidic bonds. The polysaccharides may be linear chains or branched. Carbohydrate derivatives, such as a polyhydric alcohol (e.g., glycerol), may also be utilized as a complex carbohydrate herein. As used herein, the term "digestible" in the context of carbohydrates refers to carbohydrate that are capable of metabolism by enzymes produced by the human body. Examples of polysaccharides non-digestible carbohydrates are resistant starches (e.g., raw corn starches) and retrograded amyloses (e.g., high amylose corn starches). Non-limiting examples carbohydrates include raffinoses, stachyoses, maltotrioses, maltotetraoses, glycogens, amyloses, amylopectins, polydextroses, and maltodextrins.

[0174] Suitable fats include, but are not limited to, triglycerides, including short- chain (C₂-C ) and long-chain triglycerides (Ci₆-C₂₂).

[0175] Suitable texturants (also referred to as soluble fibers) include, but are not limited to, pectin (high ester, low ester); carrageenan; alginate (e.g., alginic acid, sodium alginate, potassium alginate, calcium alginate); guar gum; locust bean gum; psyllium; xanthan gum; gum arabic; fructo-oligosaccharides; inulin; agar; and functional blends of two or more of the foregoing. [0176] Suitable emulsifiers include,- but are not limited to, propylene glycol monostearate (PGMS), sodium stearoyl lactylate (SSL), calcium stearoyl lactylate (CSL), monoglycerides, diglycerides, monodiglycerides, polyglycerol esters, lactic acid esters, polysorbate, sucrose esters, diacetyl tartaric acid esters of mono-diglycerides (DATEM), citric acid esters of monoglycerides (CITREM) and combinations thereof.

[0177] Edible fibers include polysaccharides, oligosaccharides, lignin and associated plant substances. Suitable edible fibers include, but are not limited to, sugar beet fiber, apple fiber, pea fiber, wheat fiber, oat fiber, barley fiber, rye fiber, rice fiber, potato fiber, tomato fiber, other plant non-starch polysaccharide fiber, and combinations thereof.

[0178] Suitable flavoring agents include natural and synthetic flavors, "brown flavorings" (e.g., coffee, tea); dairy flavorings; fruit flavors; vanilla flavoring; essences; extracts; oleoresins; juice and drink concentrates; flavor building blocks (e.g., delta lactones, ketones); and the like; and combinations of such flavors. Examples of botanic flavors include, for example, tea (e.g., preferably black and green tea), aloe vera, guarana, ginseng, ginkgo, hawthorn, hibiscus, rose hips, chamomile, peppermint, fennel, ginger, licorice, lotus seed, schizandra, saw palmetto, sarsaparilla, safflower, St. John's Wort, curcuma, cardamom, nutmeg, cassia bark, buchu, cinnamon, jasmine, haw, chrysanthemum, water chestnut, sugar cane, lychee, bamboo shoots, vanilla, coffee, and the like.

[0179] Suitable sweeteners include, but are not limited to, alitame; dextrose; fructose; lactilol; polydextrose; xylitol; xylose; aspartame, saccharine, cyclamates, acesulfame K, L-aspartyl-L-phenylalanine lower alkyl ester sweeteners, L-aspartyl-D- alanine amides; L-aspartyl-D-serine amides; L-aspartyl-hydroxymethyl alkane' amide sweeteners; L-aspartyl-1-hydroxyethylalkane amide sweeteners; and the like.

[0180] Suitable anti-oxidants include, but are not limited to, tocopherols (natural, synthetic); ascorbyl palmitate; gallates; butylated hydroxyanisole (BHA); butylated hydroxytoluene (BHT); tert-butyl hydroquinone (TBHQ); and the like. [0181] Suitable nutrients include vitamins and minerals, including, but not limited to, niacin, thiamin, folic acid, pantothenic acid, biotin, vitamin A, vitamin C, vitamin B,sub.2, vitamin B.sub.3, vitamin B.sub.6, vitamin B.sub.12, vitamin D, vitamin E, vitamin K, iron, zinc, copper, calcium, phosphorous, iodine, chromium, molybdenum, and fluoride.

[0182] Suitable coloring agents include, but are not limited to, FD&C dyes (e.g., yellow #5, blue #2,red #40), FD&C lakes; Riboflavin; P-carotene; natural coloring agents, including, for example, fruit, vegetable, or plant extracts such as grape, black currant, aronia, carrot, beetroot, red cabbage, and hibiscus.

[0183] Exemplary preservatives include sorbate, benzoate, and polyphosphate preservatives.

[0184] Suitable emulsifiers include, but are not limited to, diglycerides; monoglycerides; acetic acid esters of mono- and diglycerides; diacetyl tartaric acid esters o mono- and diglycerides; citric acid esters of mono- and diglycerides; lactic acid esters of mono- and diglycerides; fatty acids; polyglycerαl esters of fatty acids; propylene glycol esters of fatty acids; sorbitan monostearates; sorbitan tristearates; sodium stearoyl lactylates; calcium stearoyl lactylates; and the like

[0185] Suitable agents for pH adjustment include organic as well as inorganic edible acids. The acids can be present in their undissociated form or, alternatively, as their respective salts, for example, potassium or sodium hydrogen phosphate, potassium or sodium dihydrogen phosphate salts. Exemplary acids are edible organic acids which include citric acid, malic acid, fumaric acid, adipic acid, phosphoric acid, gluconic acid, tartaric acid, ascorbic acid, acetic acid, phosphoric acid and mixtures thereof

[0186] Modulators of EPO activity are present in the food product/nutraceutical formulation in an amount of from about 0.01% to about 30% by weight, e.g., from about 0.01% to about 0.1%, from about 0.1% to about 0.5%, from about 0.5% to about 1.0%, from about 1.0% to about 2.0%, from about 2.0% to about 5%, from about 5% to about 7%, from about 7% to about 10%, from about 10% to about 15%, from about 15% to about 20%, from about 20% to about 25%, or from about 25% to about 30% by weight. In some embodiments, the modulator present in the food product is homogenous, e.g.; a single, added modulator in the food product, In other embodiments, the modulators in the food product comprise more than one modulator. In particular instances where nucleic acid modulators are employed, different nucleic acid sequences used in the modulators are considered to be two, different modulators.

[0187] Where the food product is a beverage, the food product generally contains, by volume, more than about 50% water, e.g., from about 50% to about 60%, from about 60% to about 95% water, e.g., from about 60% to about 70%, from about 70% to about 80%, from about 80% to about 90%, or from about 90% to about 95% water.

[0188] Where the food product is a bar, the food product generally contains, by volume, less than about 15% water, e.g., from about 2% to about 5%, from about 5% to about 7%, from about 7%_. to about 10%, from about 10% to about 12%, or from about 12% to about 15% water.

[0189] In some embodiments, the food product is essentially dry, e.g., comprises less than about 5%, water.

[0190] Monosaccharides, disaccharides, and complex carbohydrates, if present, are generally present in an amount of from about 0.1% to about 15%, e.g., from about 0.1% to about 1%, from about 1% to about 5%, from about 5% to about 7%, from about 7% to about 10%, or from about 10% to about 15%, by weight each. Soluble fibers, edible fibers, and emulsifiers, if present, are generally present in an amount of from about 0.1% to about 15%, e.g., from about 0.1% to about 1%, from about 1% to about 5%, from about 5% to about 7%, from about 7% to about 10%, or from about 10% to about 15%, by weight each.

[0191] Other components discussed above, if present, are present in amounts ranging from about 0.001% to about 5% by weight of the composition.

[0192] Additional Agents [0193] Modulators for delivery according to the invention can be formulated with additional agents, which agents may be inert or active agents. For example, preservatives and other additives may also be present such as, for example, antimicrobial agents (e.g., antibacterials, antivirals, antifungals, etc.), antioxidants, chelating agents, and inert gases and the like. In addition, the modulator of EPO activitymay be modified to be conjugated to another molecule of interest,

[0194] Modulators of EPO activitycan be combined with conventional agents used for treatment of gastro-intestinal inflammation, where appropriate. Exemplary agents used in conventional gastro-intestinal inflammation therapy, such as those used in therapy for chronic gastro-intestinal inflammation such as in IBD, include, but are not necessarily limited to, corticosteroids, azathioprine, cyclosporine, and methotrexate, as well as antibodies directed against tumor necrosis factor-alpha (TNF-alpha), or other drug useful in the treatment of chronic gastro-intestinal inflammation. Such additional agents can be administered separately or included in the composition. In modulators of EPO activity can be formulated with other anti-inflammatory agents, with the proviso that such agents do not substantially interfere with the therapeutic efficacy of the modulators employed. Exemplary agents include, but are not necessarily limited to, antacids, H2 blockers, and the like (e.g., famotidine, ranitidine hydrochloride, and the like).

[0195] Timing of Administration

[0196] Modulators of EPO activity can be administered to a subject prior to onset of more severe symptoms (e.g., prior to onset of an acute inflammatory attack), or after onset of acute or chronic symptoms (e.g., after onset of an acute inflammatory attack). As such, the modulators can be administered at any time, and may be administered at any interval. In one embodiment, a modulator is administered about 8 hours, about 12 hours, about 24 hours, about 2 days, about 4 days, about 8 days, about 16 days, about 30 days or 1 month, about 2 months, about 4 months, about 8 months, or about 1 year after initial onset of gastro-intestinal inflammation-associated symptoms or after diagnosis of gastrointestinal inflammation in the subject. As described in more detail below, the invention -also provides for administration of subsequent doses of modulators of EPO activity. [0197] When multiple doses are administered, subsequent doses are administered within about 16 weeks, about 12 weeks, about 8 weeks, about 6 weeks, about 4 weeks, about 2 weeks, about 1 week, about 5 days, about 72 hours, about 48 hours, about 24 hours, about 12 hours, about 8 hours, about 4 hours, or about 2 hours or less of the previous dose. In one embodiment, modulators are administered at intervals ranging from at least every two weeks to every four weeks (e.g., monthly intervals) in order to maintain the maximal desired therapeutic effect (e.g., to provide for maintenance of relief from gastro-intestinal dysfunction).

[0198] Solutions of the nucleic acids as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Patent 5,466,468). In all cases the form must be sterile and must be fluid to the extent that- easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, or vegetable oils, Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin. [0199] For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intraarterial, intramuscular, subcutaneous, intratumoral and intraperitoneal administration. In this connection, sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml^' of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biologies standards.

[0200] Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0201] The compositions disclosed herein may be formulated in a neutral or salt form. Pharmaceutically-acceptable salts, include the acid addition salts and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like.

[0202] Continuous administration also may be applied where appropriate. Delivery via syringe or catherization is preferred. Such continuous perfusion may take place for a period from about 1-2 hours, to about 2-6 hours, to about 6-12 hours, to about 12-24 hours, to about 1-2 days, to about 1-2 wk or longer following the initiation of treatment. Generally, the dose of the therapeutic composition via continuous perfusion will be equivalent to that given by a single or multiple injections, adjusted over a period of time during which the perfusion occurs.

[0203] Treatment regimens may vary as well, and often depend on type of disease and location of diseased tissue, and factors such as the health and the age of the patient. The clinician will be best suited to make such decisions based on the known efficacy and toxicity (if any) of the therapeutic formulations based on the present invention.

[0204] The treatments may include various "unit doses." A unit dose is defined as containing a predetermined-quantity of the therapeutic composition comprising a lentiviral vector of the present invention. The quantity to be administered, and the particular route and formulation, are within the skill of those in the clinical arts. A unit dose need not be administered as a single injection but may comprise continuous infusion over a set period of time. Unit dose of the present invention may conveniently be described in terms of transducing units (T.U.) of lentivector, as defined by tittering the vector on a cell line such as HeLa or 293. Unit doses range from 10³, 10⁴, 10⁵, 10°, 10⁷, 10⁸, 10⁹, 10¹⁰, 10", 10¹², 10¹³ T.U, and higher.

[0205] Brief Description of Relevant Nucleotide Sequences and the Sequence Listings.

[0206] The sequence of eosinophil peroxidase is known and readily available for a variety of mammal species, including humans. See, for example, Sakamaki et al, Molecular cloning and characterization of a chromosomal gene for human eosinophil peroxidase. J. Biol. Chem. 264 (28), 16828-16836 (1989) and Ten et al, Molecular cloning of the human eosinophil peroxidase: Evidence for the existence of a peroxidase multigene family. J. Exp. Med. 169 (5), 1757-1769 (1989). cDNA and genomic sequences are publically available. See, for example, locus NM_000502, 2148 bp mRNA encoding Homo sapiens eosinophil peroxidase (EPX or EPO), accession number NM_000502, SEQ ID NO: 1 provides the nucleotide sequence of human EPO. As is known to those of skill in the art, members of the EPO/EPX family may be readily identified within mammalian species and isolated therefrom via well known techniques. See Sakamaki et al. The evolutionary conservation of the mammalian peroxidase genes. Cytogenet. Genome Res. 98:93-95 (2002).

[0207] SEQ ID NO:2-SEQ ID NO:23 contain primer sequences useful in amplification of cytokine sequences as disclosed herein.

[0208] Without further description, one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods. The following working examples therefore, specifically point out preferred embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims. All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference.

[0209] Examples

[0210] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

[0211] Materials and Methodology Employed in Examples 1 - 5

[0212] Animals

[0213] C57BL/6 wild type (WT), Nio C57BL/6 WT, Nio C57BL/6 eotaxin-/-, C57BL/6 IL-5-/-, MBP-/-, EPO-/- and WT (background: Svl29/ola/Hsd x SV129/SvJ) mice were obtained from specific pathogen-free facilities at the Australian National University (ANU) and housed in approved containment facilities. Mice were treated according to ANU animal welfare guidelines and age- and sex-matched animals were used throughout these studies.

[0214] Induction of Colitis

[0215] Dextran sodium sulphate (DSS) used for the induction of experimental colitis (ICN Biomedical Inc., USA) was supplied as the sodium salt with an average molecular weight of 41kDA with a sulphur substitution of 16.3%. It was used as a supplement in the drinking water of the mice for 8 days as 2.5% (w/v) solution in distilled water.

[0216] Disease Activity Index

[0217] Disease activity index (DAI) was derived from the three major clinical signs (weight loss, diarrhea, and rectal bleeding) (Stevceva et al, Genes and Immunity (2000) 1:213-218). The clinical signs were assessed separately and correlated with the histological score. The final formula for the DAI was evaluated by correlation with the histological score. The formula to derive DAI was: DAI = (body weight loss) + (diarrhoea score) + (rectal bleeding score).

[0218] Body Weight Loss [0219] Body weight loss was calculated as the difference between the expected body weight and the actual body weight on a particular day. The formula for predicted body weight was derived by simple regression using the body weight data for the control group. The following formula was derived: Y = a + kx, where Y = body weight change (loss or gain), k = daily increase in body weight, x = day, a = starting body weight.

[0220] Diarrhea.

[0221] The appearance of diarrhoea was defined as mucus/fecal material adherent to anal fur. The presence or absence of diarrhoea was scored as either 1 or 0, respectively. The presence or absence of diarrhoea was confirmed by examination of the colon following completion of the experiment. (Stevceva et al, Genes and Immunity (2000) 1:213-218). Mice were sacrificed and the colon excised from the animal. Diarrhoea was defined by the absence of fecal pellet formation in the colon and the presence of continuous fluid fecal material in the colon.

[0222] Rectal Bleeding

[0223] The appearance of rectal bleeding was defined as diarrhoea containing visible blood/mucus or gross rectal bleeding and scored as described for diarrhoea.

[0224] Histopathological Examination

[0225] Animals were sacrificed on Day 8 and the colon was excised, The length of the colon was measured using digmatic callipers (Mitutoyo, Kawasaji, Japan). Tissue specimens were then fixed in 4% paraformaldehyde and stained with hematoxylin and eosin (H/E) and Masson's trichrome using standard histological techniques,

[0226] Immunohistochemistry detection and quantification of eosinophils.

[0227] The colon segment of the GI tract was immunostained with antiserum against mouse MBP as previously described (Mishra et al., J. Clin. Invest. (1999) 103(12):1719- 27). Briefly, 5μm sections were quenched with H2O2, blocked with normal goat serum and stained with a rabbit anti-murine eosinophil major basic protein (MBP) anti-serum as described earlier (Mishra et al„ J. Clin. Invest. (1999) 103(12):1719-27). The slides were then washed and incubated with biotinylated goat anti-rabbit antibody and avidin- peroxidase complex (Vectastain ABC Peroxidase Elite kit; Vector Laboratories). The slides were developed by nickel diaminobenzidine, enhanced cobalt chloride to form a black precipitate, and counterstained with nuclear fast red. Quantification of eosinophils was performed by counting the number of immunoreactive cells from 15-25 fields of view (magnification x 40) from at least 4-5 random sections/mouse. Values were expressed as eosinophils per mm2 tissue.

[0228] Reverse Transcriptase-PCR (RT-PCR) analysis.

[0229] Total RNA was isolated from PBLN cells and eosinophils by standard methods with RNAzol B (Biotech Laboratories, Houston, TX, USA). A reverse transcriptase-PCR (RTPCR) procedure was performed as previously described (Wynn et al., J. Immunol. (1993) 151(3): 1430-40) to determine relative quantities of mRNA for various cytokines. The primers for all genes were purchased from GIBCO (GIBCO BRL products, USA). Primer sequences for RANTES, MCP-1, -2, -3, -5, MJ -la, -la, -2, -3a, eotaxin-1, and eotaxin-2 are as indicated in Table 1.

[0230] Table 1. Primer sequences for RANTES, MCP-1, -2, -3, -5, MlP-la, -la, -2, -3a, eotaxin-1, and eotaxin-2. GENE SEO ID NAME PRIMER PRIMER SEQUENCE NO:

RANTES sense CCCTCACCATCATCCTCACT 2

RANTES antisense GGGAAGCGTATACAGGGTCA 3

MCP-1 sense ACCAGCCAACTCTCACTGAAGC 4

MCP-1 antisense CAGAATTGCTTGAGGTGGTTGTG 5

MCP-2 sense AGTGCTTCTTTGCCTGCTGCTGCTCATAG 6

MCP-2 antisense ATGAGAAAACACGCAGCCCAGGCACC 7 MCP-3 sense ACGCTTCTGTGCCTGCTGCTCATAG 8

MCP-3 antisense GTAAAAATGGGGAAAGGGGGAGAAT 9

MCP-5 sense CTATGCCTCCTGCTCATAGC 10

MCP-5 antisense CTTAACCCACTTCTCCTTGG 11

MlP-la sense TAGTCACTTTGCGGCTGATG 12

MlP-la antisense CAGTGTCAACCCAGGGCTAT 13

MlP-la sense CCCACTTCCTGCTGTTTCTC 14

MlP-la antisense GAGGAGGCCTCTCCTGAAGT 15

MIP-2 sense AGTGAACTGCGCTGTCAATG 16

MIP-2 antisense CTTTGGTTCTTCCGTTGAGG 17

MIP-3a sense CGACTGTTGCCTCTCGTACA 18

MIP-3a antisense AGGAGGTTCACAGCCCTTT 19

Eotaxin-1 sense TCCACCATGCAGAGCTCCACAG 20

Eotaxin-1 antisense CCCACATCTCCTTTCATGCCCC 21

Eotaxin-2 sense GCTGCACGTCCTTTATTTCC 22

Eotaxin-2 antisense CCCCTTTAGAAGGCTGGTTT 23

[0231] All primers in Table 1 were designed to span an intron to identify the presence of contaminating genomic DNA. After the appropriate number of PCR cycles, the amplified DNA was analysed by gel electrophoresis. Band intensity of each cytokine and chemokine was measured using NIH Image 1.62 program and the expression level of each mediator was expressed as the band intensity ratio to alpha-actin,

[0232] Eosinophil Peroxidase (EPO) Activity Assay [0233] Animals were sacrificed on Day 8 and the colon was excised and flushed with lml PBS solution. The fecal material was vortexed vigorously for 5 minutes at 4oC and centrifuged at 10,000g for 10 minutes at 4°C. The supernatant was collected and placed in sterile eppendorf and stored at -70°C until analysis. Eosinophil peroxidase (EPO) activity was measured in the supernatant of cell-free colon flushes as previously described (Schneider and Issekutz, J. Immunol, Methods (1996) 198:1-14). This assay is based on the oxidation of o-phenylenediamine (OPD) by EPO in the presence of hydrogen peroxide (H2O2). The substrate solution consisted of 12 mM OPD (Sigma), 0.005% H2O2, 10 mM HEPES and 0.22% CTAB. Substrate solution (75 μl) was added to cell free colon flush supernatant samples (75 μl) in a 96-well microplate and incubated at room temperature for 15 min before stopping the reaction with 50 μl of cold 8N sulfuric acid. Absorbance was measured at 490 nm. Standard EPO activity lOOU/ml was determined as EPO activity produced by 1 x 10β purified eosinophils / μl supernatants.

[0234] Resorcinol. inhibition of eosinophil peroxidase activity

[0235] Resorcinol (Sigma, St. Louis, MI) (concentration range: 10-6 - 10-13 M) was titrated [1:10 serial dilutions] into 2 x 104 purified eosinophil / μl supernatants in a 96- well microplate. Samples were added to the EPO substrate solution and incubated at room temperature for 15 min before stopping the reaction with 50 μl of cold 8N sulfuric acid. Absorbance was measured at 490 nm.Resorcinol treatment in vivo

[0236] Mice were intra peritoneally (i.p.) injected with 200μl of Resorcinol (1.5mg/kg) and subsequently provided with drinking water supplemented with 2.5% (w/v) Dextran sodium sulphate (DSS) for 8 days to induce experimental colitis. On day 8, mice were sacrificed and parameters of experimental colitis . analysed. In some experiments mice were provided with drinking water supplemented with 2.5% (w/v) Dextran sodium sulphate (DSS) for 8 days to induce experimental colitis and on day 6 and 7 i.p. injected with 200 μl of Resorcinol (1.5mg/kg). [0237] EXAMPLE 1: DSS-induced experimental colitis produces eosinophilic inflammation and gastro-intestinal dysfunction.

[0238] Administration of 2.5% DSS to C57BL/6 mice induces an acute inflammation of the colon, sustained weight loss and bloody diarrhoea (Figure 1. A-B), The first characteristics of pathologies are apparent after 6 days exposure to 2.5% DSS and is primarily attributed to weight loss. 6-10 days following exposure, mice develop diarrhoea, rectal bleeding and colon shortening (Figure 1. B(ii) and I). Histological examination of mouse colons at day 10 showed that DSS-treated mice developed extensive ulceration of the epithelial cell layer, massive bowel wall edema, fibrotic thickening of the muscularis mucosa and dense infiltration of the superficial layers of the mucosa with granulocytes and mononuclear cells (Figure 1. C - H).

[0239] Immunohistochemistry using a monoclonal antibody against eosinophil- derived MBP indicated that eosinophils were observed throughout the mucosa and submucosa in DSS-treated mice. In particular, eosinophil numbers were significantly increased in the colon of DSS-treated mice as compared to control-treated mice (Figure 1. J). Masson's trichrome stains of colonic sections to evaluate the presence and distribution of collagen, showed blue staining thickly packed collagen fibres in the mucosa beneath the muscularis mucosa in DSS-treated mice and not in control-treated mice (Figure 1. H). The thick collagen layer present in DSS-treated mice contained large numbers of infiltrating eosinophils (Figure 1. G - H). The histopathology of the colon is similar to that observed in UC patients and indicates that a substantively similar pathological mechanism contributes to tissue damage in both types of inflammation.

[0240] EXAMPLE 2: Eosinophilic inflammation and gastro-intestinal dysfunction in DSS-induced experimental colitis is regulated by eotaxin.

[0241] IL-5 and eotaxin have been shown to be important in the regulation of eosinophil function during inflammatory responses regulating eosinophil recruitment during allergic airways disease and trafficking into the upper gastro-intestinal tract (small bowel) at baseline and also following allergen challenge, respectively (Rothenberg M, N. Engl. J. Med. (1998) 338:1592-600; Rothenberg et al, Adv. Immunol. (2001) 78:291- 328; Foster et al, Trends Mol. Med. (2002) 8:162-167).

[0242] IL-5- and eotaxin-deficient mice were used to examine the contribution of

IL-5 and eotaxin in eosinophil recruitment into the large bowel (colon) during experimental colitis. Administration of 2.5% DSS to IL-5 deficient mice induced experimental colitis including diarrhoea and rectal bleeding and colon shortening (Figure 2. A and B). The degree, of DSS-induced experimental colitis was similar to that observed in Wild Type (WT) mice.

[0243] Histological examination of mouse colons showed extensive tissue ulceration, massive bowel wall oedema, fibrosis of the muscularis mucosa and dense cellular infiltration characterised by eosinophils (Figure 2. C). Quantification of eosinophil numbers revealed a significant increase in eosinophil levels in the colon of DSS-treated IL-5-/- mice as -compared to control-treated IL-5-/- mice (Figure 2. C). The level of eosinophilic infiltration in 2.5% DSS-treated IL-5-/- mice was similar to that of DSS- treated WT mice. DSS-induced experimental colitis in eotaxin-/- mice was significantly attenuated compared to DSS-treated WT or IL-5-/- mice (Figure 2. A). The reduced DAI was attributed to weight loss with the degree of diarrhoea and rectal bleeding and colon shortening reduced as compared to DSS-treated WT and IL-5-/- mice.

[0244] The attenuation of experimental colitis in eotaxin-/- mice was associated with a reduction in the level of eosinophilic infiltration into the colon (Figure 2. A and C). Although, the eosinophil levels in DSS-treated eotaxin-/- mice were significantly higher than that compared to control-treated eotaxin-/- mice, the level of eosinophilic infiltration was reduced by 45% compared to DSS-treated WT and IL-5-/- mice (Figure 2. C).

[0245] EXAMPLE 3: DSS-induced experimental colitis is associated with eosinophil cytolytic degranulation,

[0246] Clinical investigations have provided ultrastructural evidence of eosinophil degranulation in patients with IBD (Dvorak, et al, Annals Surgery (1993) 217:260-271; Chen et al, J. Allergy Clin. Immunol. (1997) 99:683-692; Erjefalt et al, Thorax (2001) 56:341-344). Here, administration of DSS induced extensive eosinophilic degranulation. In control-treated mice, colonic eosinophils were primarily located in the lamina propria and early all the eosinophils possessed features of healthy eosinophils including intact plasma membranes, heterochromatic-segmented nuclei and abundant granules with characteristic electron dense cores and matrixes (Figure 3. A and B). In comparison, eosinophils in DSS-treated mice appeared to be undergoing cytolytie eosinophilic degranulation as evidenced by nuclear chromatolysis, disruption of plasma membrane and the presence of free eosinophilic granules in the extracellular spaces adjacent to these eosinophils (Figure 3. C and D).

[0247] Examination of the level of EPO in the lumen of the colon of 2.5% DSS- and control-treated mice shows that EPO activity in DSS-treated mice was 1000-fold higher than that observed in control treated animals (Figure 3. E). Examination of lumenal EPO levels in control- and DSStreated IL-5-/- and eotaxin-/- mice revealed that in both IL-5-/- and eotaxin-/- mice lumenal EPO levels are elevated in comparison to the control-treated mice (~ 500-fold and ~ 100-fold respectively). However, consistent with the observation of attenuated experimental colitis in eotaxin-/- mice, EPO levels are attenuated when compared to WT and IL-5-/- DSS treated mice (Figure 3. E).

[0248] EXAMPLE 4: Eosinophil peroxidase plays a key role in the pathophysiology of DSS-induced experimental colitis

[0249] MBP-/-, EPO-/- and WT (Svl29/ola/Hsd x SV129/SvJ) mice were challenged with DSS to examine the contribution of EPO and MBP in DSS-mediated experimental colitis. DSS treatment of WT mice induced experimental colitis similar to that previously described for WT C57BL/6 mice. Experimental colitis was associated with increased DAI, diarrhoea, rectal bleeding, eosinophilic inflammation and colon shortening and elevated levels of colon EPO activity. Similarly, DSS treatment induced experimental colitis in MBP-/- mice was comparable to that observed in WT mice (Figure 4. A).

[0250] However, in EPO-/- mice, DSS-induced colitis was significantly attenuated as compared either WT or MBP-/- mice (Figure 4. A). Although a significant reduction in disease activity (rectal bleeding, diarrhoea and colon shortening) and abolition of lumenal EPO levels were observed, eosinophil numbers in these mice were not significantly different to those observed in WT mice (Figure 4. C). These studies demonstrate that the genetic deletion of EPO has no impact on DSS-induced recruitment of eosinophils into the colon. Moreover, these findings show that eosinophil-derived EPO plays a key role in the immunopathogenesis of experimental colitis.

[0251] EXAMPLE 5: Eosinophil peroxidase inhibitor resorcinol attenuates DSS-induced experimental colitis.

[0252] The demonstration that EPO plays a key role in the manifestations observed in experimental colitis, suggests that an inhibitor of EPO activity should attenuate experimental colitis. In testing for suppressive effects on EPO activity of a peroxidase inhibitor, resorcinol, it was found that resorcinol detectably inhibited EPO activity at lf with the 50% inhibitory concentration being 3pM and maximal inhibition at lOnM (Figure 5. A).

[0253] Following the demonstration that resorcinol inhibits EPO activity, the effects of resorcinol on inhibiting EPO activity in vivo were examined. Mice were injected i.p. with resorcinol (or vehicle) and subsequently received 2.5% DSS. Experimental colitis in mice given 2.5% DSS and i.p. injected with resorcinol was significantly attenuated as compared to 2.5% DSS-treated vehicle-injected mice (Figure 5. B). Furthermore, the degree of colon shortening was also reduced in mice given 2.5% DSS and i.p. injected with resorcinol as compared to 2.5% DSS-treated vehicle-injected mice (Figure 5. C). This reduction in pathology occurred despite eosinophil levels in the colon of these mice being comparable to DSS-treated vehicle-injected mice (Figure 5. D and E).

[0254] Lumenal EPO levels in 2.5% DSS-treated resorcinol-injected mice were significantly reduced as compared to 2.5% DSS-treated vehicle-injected mice, further demonstrating the ability of resorcinol to block EPO activity in vivo (Figure 5. E). To examine whether resorcinol could also suppress established experimental colitis, mice received an i.p, injection of vehicle or resorcinol on days 6 and 7 of the 8 day experimental regime. [0255] Experimental colitis in mice receiving 2.5% DSS and administered resorcinol on Days 6 and 7 (but not vehicle alone) was significantly attenuated (Figure 5. F). Symptoms of experimental colitis (rectal bleeding and diarrhoea) but not of weight loss were reduced within 24 hours and were ablated within 48 hours (Day 8) of resorcinol treatment, confirming the key role of eosinophil derived EPO in the pathophysiology of experimental colitis and the ability to treat disease and symptoms through modulation of EPO activity.

[0256] EXAMPLE 6: Reduction of EPO expression attenuates DSS-induced experimental colitis.

[0257] The demonstration that EPO plays a key role in the manifestations observed in experimental colitis, indicates that inhibition of EPO activity and/or synthesis will attenuate experimental colitis. Small interfering RNA's (siRNA's) have been shown to silence gene expression in a sequence-specific manner in mammalian cells in by a process that is known as RNA interference (see, e.g. Dykxhoorn et al., 2003 Nature Reviews Mol. Cell Biol. 4: 457-467).

[0258] To treat gasto-intestinal dysfunction through the modulation of EPO expression, sequence specific target sequences are designed against mammalian (e.g. human or Mus muscularis) EPO through published methods. See, for example, the methods and algorithms indexed and available at

<http://www.ambion,com/techlib/misc/siRNA_finder.html>.

[0259] Non limiting exemplary sequences for use in an siRNA molecule are provided in the following tables.

[0260] Table 2. SiRNA #1 Human EPO

Sense siRNA: GUUACAACCCCAGCGGUCCtt SEQ ID NO: 24 extinction coei MW = 6604.2 nmol per OD260 - 5.16 μg per OD260 = 34.09 sense strand length: 21

Antisense siRNA: GGACCGCUGGGGUUGUAACtt SEQ ID NO: 25 extinction coefficient = 201400 M' ¹ MW = S741.2 nmol per OD260 = 4.97 μg per OD260 = 33.47 antisense strand length: 21

Alignment

Target: 5'- AAGTTACAACCCCAGCGGTCC -3'

Sense siRNA strand: 5'- GUUACAACCCCAGCGGUCCtt -3' Antisense siRNA strand: 3'- ttCAAUGUUGGGGUCGCCAGG -5'

[0261] Table 3. SiRNA #2 Human EPO

Sense siRNA: GUACCGCACCAUCACUGGAtt SEQ ID NO: 26 extinction coefficient = 198900 M^"1cm^': MW a 6628.2 nmol per OD260 ^β 5.03 μg per OD260 = 33.32 sense strand length: 21

Antisense siRNA: UCCAGUGAUGGUGCGGUACtt SEQ ID NO: 27 extinction coefficient ^β 202400 M^"1cm^'' MW = 6702.2 nmol per OD260 = 4.94 μg per OD260 = 33.11 antisense strand length: 21

Alignment

Target: 5'- AAGTACCGCACCATCACTGGA -3'

Sense siRNA strand: Antisense siRNA strand: GUACCGCACCAUCACUGGAtt -3' ttCAUGGCGUGGUAGUGACCU -5 '

[0262] Once target sequences are identified, the oligonucleotide is synthesized or constructed and subcloned into a siRNA expression vector using materials and methods well known to those of skill in the art. For example, an siRNA construct:

RNA Pol ill BA H1 Sense strand Loop Anti-sense strand Terminate Hind III 5' GAτc cN NNNNN NNNN NNNNⁱTτCAAGAGA^ΛNNN NNNNNNNNNNNNN ^J^l^TTTTτl!3QAAA 3^l, 3' GGNNNNNNNNNNNNNNNNNNNTTGTTCTCTNNNNNNNNNNNNNNNNNNNTTTTCCTTTTCGA 5'

wherein N refers to sense and antisense EPO specific siRNA sequence.

The EPO specific sequences are incorporated into 55-60mer oligonucleotides. The oligonucelotides encode the 19 mer hairpin loop sequence specific to EPO mRNA and a polythymidine tract to terminate transcription by RNA Pol III. The 55-60 mer oligonucleotide is ligated into a siRNA expression vector.

An siRNA expression vector is delivered to the subject (i.v,, s.c, intra-anal, orally, etc.) to inhibit EPO expression, translation, EPO activity and thereby treat or ameliorate the sumptoms of colitis.

[0263] All of the compositions or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention, More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims. REFERENCES

[0264] The following references, and references cited hereinabove, to the extent that they provide exemplary procedural or other details- supplementary to those set forth herein, are specifically incorporated herein by reference,

U.S. Patent Application Publication No. 20020086356 U.S. Patent Application Publication No. 20020132788 ^' U.S Patent Application Publication No. 20020137210 U.S. Patent Application Publication No. 20020137709 U.S. Patent Application Publication No. 20020160393 U.S Patent Application Publication No. 20020162126 U.S. Patent Application Publication No. 20020173478 U.S. Patent Application Publication No. 20030013658 U.S. Patent Application Publication No. 20030027845 U.S. Patent Application Publication No. 20030087875 U.S. Patent Application Publication No. 20030130217 U.S. Patent No! 4,682,195 U.S. Patent No. 4,683,202 U.S. Patent No. 5,466,468 U.S. Patent No. 5,645,897 U.S. Patent No. 5,705,629 WO 01/29058 WO 01/68836 O 01/92513

WO 02/059300

WO 02/072762

WO 02/44321

WO 02/44321

WO 03/012052

WO 03/012052

WO 03/064621

WO 99/32619

WO 99/32619

EP 266,032

Ahmed et al. (U.S. Pat. Publ. No. )

Ator et al. (1989) J. Biol. Chem. 264(16):9250-9257.

Bamford, FEMS Immunol Med Microbiol 24(2):161-8 (1999)).

Bhan et al. Immunol Rev (1999) 169:195-207

Bickston and Caminelli, "Recent developments in the medical therapy of IBD," Curr.

Opin. Gastroenterol. 14 6-10, 1998

Blumberg et al, Curr. Opin. Immunol. (1999) ll(6):648-56

Blumberg JAMA (2001) 285(5): 643-647;

Boismenu and Chen, J. Leukoc Biol. (2000) 67(3):267-78;

Boujrad, et al., (1993) Proc. Natl. Acad. Sci. USA, 90:5728)

Carlson et al, Am J. Gastroenterol. (1999) 94(7): 1876-83. Chen et al, J. Allergy Clin. Immunol. (1997) 99:683-692

Chien, Novel Drug Delivery Systems, Ch. 4 (Marcel Dekker, 1992)

Dieleman et al. Clin Exp Immunol (1998) 114:385-91).

Dvorak, et al, Annals Surgery (1993) 217:260-271

Erjefalt et al, Thorax (2001) 56:341-344

Fiocchi C, Gastroenterology (1998) 115(1): 182-205;

Foster et al, Trends Mol. Med. (2002) 8:162-167)

Fraley, et al, (1981) Trends Biochem. Sci., 6:77)

Froehler et al., 1986

Gleich and Adolphson, Adv. Immunol. (1986) 39(177):177-253;

Gleich et al, Ann. Rev. Med. (1993) 44:85-101;

Grabarek, et al., (1990) Anal. Biochem., 185:131

Hendrickson et al Clin. Micorbiol. Rev. (2002) 15(l):79-94

Houck et al. (U.S. Pat. Publ, No. 20030013658

Hyams, Curr Opin Pediatr (2000) ;12(5):451-5).

Jeziorska et al, J. Pathol. (2001) 194(4):484-92;

Lee et al„ 2002, Nature Biotechnology, 19, 500

MacDonald, Eur J Gastroenterol Hepatol (1997) 9(11): 1051-50).

Mayer et al. Current concept of IBD: Etiology and pathogenesis. In "Inflammatory Bowel

Disease" 5th edition (2000), Kirsner J B, editor. W. B. Sanunders Company, pp 280-296;

Walker-Smith, Postgrad Med J (2000) 76(898):469-72).

Mikula, Gastroenterol Nurs, (1999) 22(6):245-8;

Miyagishi and Taira, 2002, Nature Biotechnology, 19, 497 Murthy et al., "Inflammatory bowel disease: A new wave of therapy," Exp. Opin. Ther.

Patents 8(7) 785-818, 1998.

Nagura et al. Digestion (2001) 63 Suppl Sl:12-21).

Narama et al, Toxicl. Pathol. (1999) 27(3):318-324).

Neurath et al. Int Rev Immunol (2000) 19:51-6

Novina et al,, 2002, Nature Medicine, advance online publication doi: 10.1038/mn725.

O'Brien, (2000) Peroxidases, Chemico-Biological Interactions 129: 113-139

Papadakis et al. Annu Rev Med (2000) 51:289-98;

Paul et al., 2002, Nature Biotechnology, 19, 505

Podolsky Am J Physiol (1999) 277:G495-9).

Pohl et al, Hepatogastroenterology (2000) 47(31):57-70).

Radford-Smith and Jewell, "Cytokines and inflammatory bowel disease." Baillieres Clin.

Gasteroenterol. 10 151-164, 1996.

Remington's Pharmaceutical Sciences, Chapter 43, 14th Ed., Mack Publishing Col,

Easton Pa. 18042, USA).

Remington's Pharmaceutical Sciences, 15th Edition, pages 1035-1038 and 1570-1580).

Rothenberg et al, Adv. Immunol. (2001) 78:291-328

Rothenberg M, N, Engl. J. Med. (1998) 338:1592-600

Russel MG, Eur. J. Intern. Med. (2000) 11(4):191-196;

Saitoh et al, Am J. Gastroenterol. (1999) 94:3513-3520;

Sakamaki et al. Cytogenet. Genome Res. 98:93-95 (2002).

Sakamaki,K, et al. J. Biol. Chem. 264 (28), 16828-16836 (1989) Sambrook J. et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor

Press, Plainview, N.Y,

Sangfelt et al, Am J. Gastroenterol. (2001) 96(4): 1085-90;

Sartor, Am J Gastroenterol. (1997) 92:5S-11S)

Schappi et al. Arch Dis Child. February 2001; 84(2):147-151

Selby, Vet Microbiol (2000) 77(3-4):505-511).

Sloan, Ch. 5, "Prodrugs: Topical and Ocular Drug Delivery" (Marcel Dekker, 1992)

Slungaard et al. WO 02/41885

Staros, et al., (1986) Anal. Biochem. 156:220

Strober et al, Annu. Rev. Immunol. (2002) 20:495-549).

Ten, R.M., et al. J. Exp. Med. 169 (5), 1757-1769 (1989)

Yanagawa, et al., (1988) Nuc. Acids Symp. Ser., 19:189 http://www.ambion.com/techlib/misc/siRNA_finder.html; visited 8 October 2003.

Claims

WHAT IS CLAIMED IS:

1. A method for treating or relieving the symptoms of dysfunction or disease in a mammalian gastro-intestinal tract in a subject, the method comprising providing to the subject a therapeutically effective amount of a modulator of eosinophil peroxidase activity such that eosinophil-mediated dysfunction or disease of the gastro-intestinal tract is treated or prevented.

2. The method of claim 1, wherein the dysfunction in the mammalian gastrointestinal tract is inflammatory bowel disease (IBD) of whatever type, etiology, or pathogenesis; or inflammatory bowel disease that is a member selected from the group consisting of ulcerative colitis (UC); collagenous colitis; colitis polyposa; transmural colitis; and Crohn's disease (CD).

3. The method of claim 1, wherein the modulator of eosinophil peroxidase activity reduces expression of eosinophil peroxidase, reduces degranulation of eosinophils, antagonizes eosinophil peroxidase activity, or depletes peroxidase substrate.

4. The method of claim 3, wherein the modulator of eosinophil peroxidase activity depletes peroxidase substrate.

5. The method of claim 4, wherein the modulator is selected from the group consisting of dihydroxybenzenes, azides, aminotriazols, dapsone, and mixtures thereof.

6. The method of claim 5, wherein the modulator of eosinophil peroxidase activity is resorcinol.

7. The method of claim 3, wherein the modulator of eosinophil peroxidase activity reduces expression of eosinophil peroxidase.

8. The method of claim 7, wherein the modulator is selected from the group consisting of a nucleic acid, a protein, and a small molecule.

9. The method of claim 8, wherein the modulator is a nucleic acid.

10. The method of claim 9, wherein the nucleic acid is an antisense RNA molecule, an antisense DNA molecule, a ribozyme, or a double stranded RNA molecule.

11. The method of claim 9, wherein said nucleic acid is an siRNA molecule.

12. The method of claim 11, wherein the siRNA molecule comprises a strand that is complementary to at least a contiguous portion of SEQ ID NO: 1.

13. The method of claim 12, wherein the strand is complementary to at least 18 contiguous base pairs of SEQ ID NO: 1.

14. The method of claim 3, wherein the modulator of eosinophil peroxidase activity antagonizes eosinophil peroxidase activity.

15. The method of claim 14, wherein the modulator is an arylhydrazide.

16. The method of claim 1, further comprising the step of monitoring eosinophil- , mediated inflammation.

17. The method of claim 1, further comprising the step of monitoring eosinophil peroxidase activity.

18. The method of claim 1, wherein the therapeutically effective amount of a modulator of eosinophil peroxidase activity is provided to the subject by injection.

19. ^• The method of claim 1, wherein the therapeutically effective amount of a modulator of eosinophil peroxidase is provided in a formulation to be taken orally.

20. The method of claim 1, wherein the therapeutically effective amount of a modulator of eosinophil peroxidase activity is provided by suppository.

21. A method of treating or relieving the symptoms of dysfunction in a mammalian gastro-intestinal tract of a subject, the method comprising providing to the subject a therapeutically effective amount of a modulator of eosinophil peroxidase activity together with at least one other pharmaceutically active agent such that eosinophil-mediated dysfunction or disease of the gastro-intestinal tract is treated or prevented.

22. The method of claim 21, wherein the other pharmaceutically active agent is co-administered with the modulator of eosinophil peroxidase activity.

23. The method of claim 21, wherein the other pharmaceutically active agent is administered separately from with the modulator of eosinophil peroxidase activity.

24. The method of claim 21, wherein the at least one other pharmaceutically active agent is also a modulator of eosinophil peroxidase activity.

25. The use of a composition in the manufacture of a medicament for the treatment of eosinophil-mediated dysfunction of the gastro-intestinal tract, wherein the composition comprises a modulator of eosinophil peroxidase activity, and wherein adminstration of the medicament is effective in preventing or reducing the dysfunction.

26. A method of identifying a candidate substance for the treatment of eosinophil- mediated inflammation of the gastro-intestinal tract comprising the steps of:

(i) identifying a modulator of eosinophil peroxidase activity; (ii) providing an animal model of gastro-intestinal dysfunction; (iii) characterizing the gastro-intestinal dysfunction of the animal model; (iv) contacting the animal model with the modulator of eosinophil peroxidase activity; and (v) comparing the gastro-intestinal dysfunction of the animal model in step (iv) with the dysfunction observed when said modulator is not present, wherein an alteration in dysfunction indicates that said candidate modulator is a candidate substance for the treatment of eosinophil-mediated inflammation of the gastro-intestinal tract.

27. A process for aiding the treatment of a disease condition comprising making a medicament for the treatment of dysfunction of a mammalian gastro-intestinal tract, wherein the medicament comprises a modulator of eosinophil peroxidase activity, and selling the medicament to an organization involved in managing or providing health care.

28. A composition comprising a therapeutically effective amount of a modulator of eosinophil peroxidase activity.

29. The composition of claim 28, wherein the composition is a neutraceutical.