WO2005030802A2 - Antigenes pour vaccin contre la theileriose (east coast fever) - Google Patents

Antigenes pour vaccin contre la theileriose (east coast fever) Download PDF

Info

Publication number
WO2005030802A2
WO2005030802A2 PCT/US2004/030831 US2004030831W WO2005030802A2 WO 2005030802 A2 WO2005030802 A2 WO 2005030802A2 US 2004030831 W US2004030831 W US 2004030831W WO 2005030802 A2 WO2005030802 A2 WO 2005030802A2
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
polypeptide
cells
parva
animal
Prior art date
Application number
PCT/US2004/030831
Other languages
English (en)
Other versions
WO2005030802A3 (fr
Inventor
Evans Taracha
Malcolm J. Gardner
Vishvanath Nene
Original Assignee
International Livestock Research Institute
The Institute For Genomic Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/US2004/022605 external-priority patent/WO2005007691A2/fr
Application filed by International Livestock Research Institute, The Institute For Genomic Research filed Critical International Livestock Research Institute
Priority to DE602004018347T priority Critical patent/DE602004018347D1/de
Priority to MXPA06003169A priority patent/MXPA06003169A/es
Priority to AP2006003594A priority patent/AP2006003594A0/xx
Priority to CA2539816A priority patent/CA2539816C/fr
Priority to EP04784633A priority patent/EP1670820B1/fr
Publication of WO2005030802A2 publication Critical patent/WO2005030802A2/fr
Publication of WO2005030802A3 publication Critical patent/WO2005030802A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/44—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56905—Protozoa
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • Theilerioses are a group of disease syndromes affecting cattle, sheep, goats and domestic buffalo caused by tick-borne haemo-protozoan parasites in the genus Theileria.
  • the most economically important diseases include East Coast fever (ECF), Mediterranean fever, and malignant theileriosis.
  • ECF caused by Theileria parva (T. parva) affects 30 million cattle in eastern, central and southern Africa.
  • Mediterranean fever caused by T. annulata occurs in North Africa, southern Europe, Near East, Middle East and many parts of Far East Asia with a population of 200 million cattle and buffalo at risk.
  • T. parva causes a lymphoproliferative disorder in which schizont-infected lymphoblasts are responsible for the pathogenesis of the disease.
  • T. lestoquardi and T. sergenti are pathogenic resulting in lymphoproliferative and anaemic syndromes, respectively.
  • acaricides such as the chlortetracyclines (first used as a prophylactic), hydroxynaphthoquinone, menoctone and its two analogues, parvaquone and bupavaquone, and through "infection and treatment" vaccination protocols of animals at risk.
  • Such vaccination protocols are deemed effective in that an animal vaccinated in this manner will not develop ECF disease upon subsequent exposure to infectious T. parva. Due to cost and problems of tick resistance and environmental pollution, control of these diseases through acaricidal destruction of ticks is not sustainable.
  • Vaccination on the other hand, while effective, presents with certain shortcomings associated with the use of live vaccines. Owing to the ease of transmission of T.
  • T. lestoquardi has also been cultivated in vitro and studies have shown that attenuated parasites can be used to immunise animals with a degree of success. Given the unsuccessful attempts to immunise cattle with attenuated T. parva, subsequent efforts have focused on the use of virulent parasites with accompanying chemotherapy.
  • ITM infection and treatment method
  • mice have also been protected against P. yoelii by passive transfer of a monoclonal antibody (Mab) specific for P230 (Majarian et al. 1984. J. Immunol. 132:3131). Mice have also been immunized against (rodent malaria) Plasmodium chabaudi adami challenge, by passive immunization with a monoclonal antibody specific for the homologous 250-kDa molecule of this Plasmodium species (Lew et al. 1989. Proc. Natl. Acad. Sci. USA 86:3768). A 67 kDa glycoprotein (p67) from the surface of the T.
  • parva sporozoite has been isolated (U.S. Patent Number 5273744) and used in a variety of immunization protocols, with little success reported so far, in the development of pratical levels of immune-mediated disease resistance.
  • cattle recovering from a single infection with T. parva sporozoites resist infection upon homologous challenge.
  • Such animals have weak antibody and T cell responses to p67.
  • T. parva antigens that can induce antigen-specific class I MHC-restricted CD8 + cytotoxic T lymphocytes (CTLs).
  • the present invention relates, e.g., to methods for the identification of parasite antigens, such as Theileria parva antigens, that stimulate antigen-specific cytotoxic T lymphocyte (CTL) responses (e.g. for inducing immunoprotection against T. parva in bovine species); and compositions identified by this method (e.g. that can be used to generate a protective response in cattle, to resist the development of ECF disease, when subsequently challenged with infectious T. parva material).
  • CTL cytotoxic T lymphocyte
  • the method includes steps wherein polynucleotide sequences encoding candidate antigens are identified by conventional nucleic sequence alignment and parsing programs that have been fine-tuned using polynucleotide sequence information employing polynucleotide sequences known to encode T. parva antigens that stimulate CTLs in an antigen-specific manner.
  • Candidate antigens and epitopes, and the nucleotide sequences that encode or result in the production of these candidate antigens and/or epitopes, that were identified can be used, e.g., to stimulate CTLs and to successfully immunize cattle against infection with subsequent exposure to T. parva expressing such antigens.
  • the nucleotide sequences are transfected into cells wherein the stimulation of responding lymphocytes to cells transfected by these nucleotides encoding parasite antigen is measured in a high throughput manner, by the release of soluble factors, such as gamma interferon, using either an antibody-elispot assay or a bioassay employing endothelial cells.
  • an isolated polypeptide comprising a sequence represented by one of SEQ ID NO:l through SEQ ID NO:7. Such isolated polypeptides are sometimes referred to herein as "polypeptides of the invention.”
  • an isolated polypeptide of the invention is in detectable amounts in isolates of T. parva; and or comprises a T. parva antigen.
  • Another aspect of the invention is a pharmaceutical composition, which comprises a polypeptide of the invention and a pharmaceutically acceptable carrier or excipient.
  • an immunogenic composition which comprises one or more polypeptides of the invention and, optionally, an adjuvant.
  • the immunogenic composition may stimulate cytotoxic T cells specific to the polypeptide; and/or comprise an epitope that stimulates T. parva- specific cytotoxic T cells.
  • a vaccine which comprises one or more polypeptides of the invention and, optionally, an adjuvant. In an embodiment of the invention, the vaccine protects an animal against T. parva infection.
  • Another aspect of the invention is an isolated polynucleotide comprising:
  • polynucleotides of the invention include a pharmaceutical composition comprising a polynucleotide of the invention and a pharmaceutically acceptable carrier or excipient; a recombinant construct comprising a polynucleotide of the invention, which is operably linked to an expression control sequence; and a vector comprising such a construct.
  • operably linked refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter, or array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence.
  • a vector of the invention may further comprise one or more sequences encoding a selectable marker; and the vector may comprise a plasmid, a bacteriophage, a minichromosome or a eukaryotic virus vector.
  • the selectable marker can be a nucleotide sequence that, when incorporated and expressed, provides resistance to an antibiotic such as geneticin (G418), penicillin, tetracycline, or other types of selectable markers such as methotrexate resistance, expression of a metallothionein gene or a luciferase gene.
  • a host cell e.g., a prokaryotic cell or a eukaryotic cell
  • Another aspect of the invention is a method for producing a polypeptide which stimulates a T.
  • cytotoxic lymphocyte comprising culturing a host cell of the invention under conditions effective for producing a polypeptide encoded by the polynucleotide, and harvesting the polypeptide.
  • an antibody e.g., a polyclonal antibody or a monoclonal antibody
  • the antibody is coupled to a carrier and/or a label.
  • Another aspect of the invention is a method for preparing a polyclonal antibody, comprising immunizing an animal with one or more polypeptides of the invention, or with cells comprising polynucleotides or vectors of the invention.
  • Another aspect of the invention is a method for preparing a monoclonal antibody, comprising (a) immunizing an animal with a polypeptide of the invention; (b) recovering cells from the animal which produce antibody that binds to the polypeptide; (c) preparing a hybridoma with the cells isolated in (b), and (d) recovering a monoclonal antibody from the hybridoma that binds to the polypeptide in (a).
  • Another aspect of the invention is a method for preparing a monoclonal antibody, comprising: (a) immunizing an animal with a host cell comprising a polynucleotide or vector of the invention; (b) recovering cells from the animal which produce antibody that binds to a polypeptide produced by the host cell; (c) preparing hybridomas with the cells isolated in (b), and (d) recovering a monoclonal antibody from the hybridoma that binds to the polypeptide in (b).
  • Another aspect of the invention is a kit for detecting the presence of T. parva in a sample suspected of containing T. parva, or for purifying T. parva from a sample containing T. parva, comprising an antibody of the invention.
  • kits may further comprise means for performing an enzyme-linked or Western blot assay to detect the presence of T. parva; and/or means for binding the antibody to T. parva in the sample, and for releasing the organism from the antibody.
  • Another aspect of the invention is a method for protecting an animal against infection by T. parva, comprising administering to the animal a polypeptide of the invention, under conditions effective for the animal to generate a protective antibody against the polypeptide, or effective for the animal to generate T. /> ⁇ rv ⁇ -antigen-specific CTLs.
  • Another aspect of the invention is a method for protecting an animal against infection by T. parva, comprising administering to the animal a cell comprising a polynucleotide or vector of the invention, under conditions effective for the animal to generate a protective antibody against a polypeptide encoded by the polynucleotide (expressed from the polynucleotide), or effective for the animal to generate T. p ⁇ rv ⁇ -antigen-specific CD4+ helper and CD8+ CTL responses.
  • a "CD8+ CTL response" means that the stimulation of the CD8+CTL can be detected by measuring the release of a factor, such as a soluble factor or other response such as the lysis of antigen-displaying cell.
  • Another aspect of the invention is a method for detecting a pathogenic protozoan infection in a subject, comprising contacting peripheral blood monocytes from the subject with peptide-antigen pulsed cytotoxic T lymphocytes, wherein the cytotoxic T lymphocytes are obtained from an animal to which has been administered a polypeptide of the invention, under conditions effective for the animal to generate T. /rarv ⁇ -antigen-specific CTLs, or effective for the animal to generate T. /r ⁇ rv ⁇ -antigen-specific CD4+ helper and CD8+ cytotoxic T lymphocyte responses.
  • Another aspect of the invention is a method for detecting T. parva in a sample suspected of containing T.
  • Another aspect of the invention is a method for identifying T. parva in a sample suspected of containing T. parva, comprising contacting the sample with an antibody of the invention, under conditions effective, for the antibody to bind specifically to its cognate antigen, and detecting the presence of bound antibody.
  • the detection is carried out by enzyme immunoassay, radioimmunoassay, fluorescence immunoassay, flocculation, particle agglutination, flow microfluorimetry, a competition assay, or in situ chromogenic assay;
  • the antibody is either a monoclonal antibody or a polyclonal antibody;
  • the assay is quantitative; or the assay is high throughput.
  • Another aspect of the invention is a method for the identification of parasite antigens, selected from candidate antigens, that are targets of cytotoxic T lymphocytes or other immune responses, comprising co-culturing immortalized fibroblast cell lines transfected with pooled cDNA harvested from a pathogen, with clones of lines of cytotoxic T cells,, generated in an animal that has been immunized, by infection and treatment with the pathogen and assaying the supernatant from the co-culture for the presence of a soluble factor, such as a cytokine, e.g. a gamma interferon; the pathogen is a protozoan organism (e.g. an organism in the genus Theileria, such as T.
  • a protozoan organism e.g. an organism in the genus Theileria, such as T.
  • T. parva antigen encoding polynucleotides a method for the identification of candidate parasite antigens, that are targets of cytotoxic T lymphocytes or other immune responses, comprising using conventional genome scanning and alignment methods such as "GlimmerM” and "phat” in which sequence information of candidate antigens that cause stimulated of CTLs is used to refine the genome scanning and alignment methods.
  • sequence identity may be optimized by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereus, Sequence Analysis Primer, Stockton Press, 1991 and the references cited therein) and calculating the percent difference between the nucleotides sequences by, for example, the Smith- Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group).
  • An additional embodiment of this invention is a method of using the nucleotide sequences, that have been shown to encode T.
  • parva antigens which stimulate CTLs to identify additional candidate CTL-stimulatory antigens from nucleotide sequence information, such as sequence contigs or whole genome sequence isolate from an organism using techniques such as hybridization under conditions of high stringency, or under other conditions that allow the identification of sequences with 95%-97% homology with known sequence.
  • T. parva is known to cause a lymphoproliferative response in infected animals that resembles a variety of T-cell lymphomas, leukemias and other lymphocytic cancers the presently identified T.
  • parva proteins could have utility in formulating an anticancer composition, e.g., antigenic proteins could have utility in prevention schemes, whereby radioactively labeled-antigens would compete for, intracellular or extracellular binding sites in order to destroy cells undergoing lymphoproliferation.
  • the T. parva antigens of the present invention are also candidates for a method to prevent lymphoproliferation by assisting in the identification and manufacture of small molecules that would manipulate the signaling pathways targeted by parasite proteins.
  • FIG. 1 is a graph that demonstrates IFN-gamma elispot detection of BoLA class I restricted CTL responses to schizont infected cells.
  • Autologous TpM were pre-incubated in elispot plates with monoclonal antibodies specific for BoLA class I, BoLA class II or bovine CD21 (isotype control) before the addition of schizont specific polyclonal CTL.
  • Cells were co-cultured for 20 hours before the plates were developed. IFN-gamma production is presented as mean number of spot forming cells (SFC) ⁇ vell.
  • FIG.2A is a graph that indicates the sensitivity of IFN-gamma elispot to detect CTL recognition of schizont infected cells when the effects of varying the CTL input on responses to TpM titrated in COS-7 cells was addressed;
  • FIG.2B is a graph that indicates the ability of the elispot test to detect responses to very small numbers of TpM, using a CTL input of 10,000/well.
  • FIG.2C shows the effect of titrating TpM in COS-7 cells, when autologous primary SF or iSF were examined and found to have no effect on the background or sensitivity of the elispot assay. IFN-gamma production is presented as mean number of spot forming cells (SFC)/well.
  • SFC spot forming cells
  • FIG. 3 is a graph showing the results generated when selected Tp2 transfected immortalized skin fibroblast cells (iSF) were used to stimulate BW002, BW014 CD8+ polyclonal CTL lines and D409 CTL clone #10.
  • Recognition of selected gene #5 (also known as, Tp2) transfected iSF by BW002 (BW2), BW014 (BW14) CD8+ polyclonal CTL lines and D409 CTL clone #1 was measured by co-culture of transfected cells with CTLs.
  • the iSF were transfected with selected genes, cultured with CTL and recognition assessed by IFN-gamma elispot. Responses are presented as mean numbers of spot forming cells (SFC)/well.
  • FIG. 4 is a graph indicating the lysis of Tp2 transfected autologous (BW002) and allogeneic (BV050) iSF by the schizont specific BW002 polyclonal CD8+ CTL line.
  • Tp5 transfected autologous iSF also served as a negative control.
  • BoLA class I restriction was assessed by pre-incubating Tp2 transfected iSF with an anti-BoLA MHC Class I mAb (class I block). Data are expressed as percent of cells that are lysed.
  • FIG. 5A, FIG. 5B, and FIG. 5C indicate T ⁇ 2 specific CD8+ T cell responses following challenge of immune cattle.
  • ECF immune cattle 5 A (BW002), 5B (BW013), and 5C (BW014), from which schizont specific CTL lines had been generated and shown to recognize Tp2, —were challenged with a lethal dose of T. parva (Muguga) sporozoites. Peripheral blood was collected daily between day 7 - 13 post-challenge, and CD8+ T cells and monocytes purified. Responses to Tp2 peptides containing previously identified CTL epitopes (positive or "+ve") or control peptides were assessed by co- culturing CD8+ T cells and monocytes in the presence of 1 mg/ml peptide and measuring the release of IFN-gamma by Elispot.
  • T. parva Muguga
  • FIG. 6 is a graph showing the mapping of Tp2 CTL epitopes using synthetic peptides. Eighty-four 12mer peptides overlapping by two amino acids encompassing the full length of Tp2 were synthesized and used at a final concentration of lpg/ml for BW002 (BW2) or lug ml for BW013 (BW13), BW014 (BW14) & D409, to pulse autologous iSF.
  • FIG. 7 is a graph that illustrates the identification of Tp2 CTL epitopes using synthetic 9mer peptides. The 6 possible 9mer peptides derived from the epitope containing SEQ ID.
  • FIG. 8 is a graph of data indicating the lysis of Tp2 synthetic peptide pulsed autologous iSF by the schizont specific D409 CTL clone #10.
  • FIG. 9 is a graph that indicates the lysis of Tp2 synthetic peptide pulsed autologous iSF by the schizont specific BW014 polyclonal CD8+ CTL line.
  • FIG. 10 shows the minimal length of the CTL-stimulating epitope Tp2.1, present within the Tp2 polypeptide as established by using sets of overlapping peptides in an Elispot assay.
  • FIG. 11 shows the minimal length of the CTL-stimulating epitope Tp2.2, present within the Tp2 polypeptide as established by using sets of overlapping peptides in an Elispot assay.
  • Autologous immortalized fibroblasts (iSF) or P815 cells, stably expressing the BoLA Class I HD6 (P815-HD6) or JSP-1 (P815-JSP-l) were pulsed with overlapping 9- mer polypeptides represented by SEQ ID. NO: 5 (Tp2 Epitope 2 (Tp2.2)) and 16 (synthesized peptide #75, amino acids residues 97-105 of Tp2), and the 8-mer SEQ ID NO: 21 (amino acid residues 97-104 of Tp2).
  • the peptides shown in the figure, from left to right, are SEQ ID NO: 20, NO: 5 and NO: 16. Pulsed cells were tested for IFN-gamma release using the Elispot assay.
  • FIG. 12 shows the minimal length of the CTL-stimulating epitope Tp2.3, present within the Tp2 polypeptide as established by using sets of overlapping peptides in an Elispot assay.
  • Autologous immortalized fibroblasts (iSF) or P815 cells, stably expressing the BoLA Class I HD6 (P815-HD6) or JSP-1 (P815-JSP-1) were pulsed with overlapping 10-mer polypeptides represented by SEQ ID. NO: 13 (a peptide of Tp2) and 20 (amino acid residues 49-58 of T ⁇ 2), and the 11-mer SEQ ID NO: 6 (Tp2 epitope 3 (Tp2.3)).
  • FIG. 13 shows the minimal length of the CTL-stimulating epitope Tp2.4, present within the Tp2 polypeptide as established by using sets of overlapping peptides in an Elispot assay.
  • Autologous' immortalized fibroblasts (iSF) or P815 cells, stably expressing the BoLA Class I HD6 (P815-HD6) or JSP-1 (P815-JSP-1) were pulsed with overlapping 12-mer polypeptides represented by SEQ ID.
  • FIG. 14 is a graph that indicating the lysis of Tp2 peptide-pulsed autologous iSF by TpM stimulated PBMC.
  • BW002 PBMC were collected 14 days post-challenge and co- cultured for 7 days with autologous TpM.
  • Cells were tested for their ability to lyse Tp2 peptide pulsed autologous iSF using a 51 Chromium release assay. iSF were pulsed overnight with a Tp2 12mer peptide known to contain a CTL epitope (#43; positive (+ve peptide)) or a control Tp2 12mer peptide (#40; control peptide) at a concentration of lug/ml.
  • Autologous and allogeneic (F100) TpM were included as positive and negative controls. Data are expressed at percent of peptide-pulsed cells that were lysed.
  • FIG. 15B represents a photograph of an agarose gel showing the expression of T. parva Tp2 antigen protein. Recombinant protein was isolated by Ni-NTA agarose and run on 12% SDS-PAGE gels. In figure 15A the proteins that are present in the gel are stained with Coomassie blue. In figure 15B an anti-His-tag antibody is used to specifically stain the expressed Tp2-His-labelled protein (immunoblot).
  • FIG. 16 is a photograph of an SDS-PAGE (12.5%) analysis of over-expression of recombinant Tp3 in E. coli.
  • Tp3 containing 5' Bam ⁇ l and 3' Bgl U was PCR amplified and cloned into plasmid vector pQE-16 (Qiagen) from which DFHR fragment was excised using BamH I and Bgl LI.
  • the rcombinant plasmid was transformed into E. coli JM109 and plated.
  • Two colonies (Tp3-1 and Tp3-2) were picked for over- expression as described in the "Example” section.
  • Tp3-1 was expressed in LB broth (Tp3- 1 a) or in 2X YT (Tp3-lb) while Tp3-2 was expressed only in LB broth.
  • FIG. 17 is a photograph of an SDS-PAGE (12.5%) analysis of purified recombinant Tp6. A partial fragment (70%) of Tp6 was PCR amplified and cloned into plasmid vector pQE-16 (Qiagen). The recombinant plasmid was transformed into E. coli JM109. A number of colonies were identified for over-expression.
  • FIG. 18 indicates the level of CTL responses to several Tp antigens, following CP(Canary Pox mediated)/MVA (modified Vaccinia Virus Ankara-vector mediated) immunization protocols.
  • the data indicates the production of T. parva antigen-specific CD8 (CTLs) in animals following immunization protocols with CanaryPox viral vectors, expressing T. parva antigen. Responses are presented as mean numbers of spot forming cells (SFC)/well.
  • FIG. 19 indicates the level of CTL responses to several Tp antigens, following DNA/MVA immunization protocols.
  • the data indicates the production of T. parva antigen-specific CD8 (CTLs) in animals following immunization protocols with modified Vaccinia (Ankara) viral vectors, expressing T. parva antigen. Responses are presented as mean numbers of spot forming cells (SFC)/well.
  • FIG. 20 indicates control data for CP/MVA and DNAMVA immunization protocols, where cattle were given phosphate buffered saline injections rather than Tp antigens. The control experimental data for measuring the development of CTLs following immunization indicates a lack of T parva, antigen-specific CD8+ cells in PBS immunized animals.
  • CD8 + cytotoxic T lymphocytes are responsible for protecting cattle against a lethal challenge with Theileria parva (T. parva), sporozoites (Morrison, Taracha, and McKeever, 1995). These CTLs are directed at schizont-infected cells, which they recognize and lyse. Schizont antigens that are recognized by these CD8 + CTLs are the prime candidates for inclusion into an effective sub-unit vaccine for the prevention of East Coast Fever disease (ECF).
  • ECF East Coast Fever disease
  • the examples herein illustrate the identification of a variety of antigens which are suitable for use in subunit vaccines.
  • the present invention provides polynucleotides, and novel methods for their identification, which encode proteins and peptides that are targets of antigen-specific cytotoxic CD8+ T lymphocytes which have been shown to be protective against ECF infection in adoptive cell transfer experiments. Experimental immunisation of cattle with these antigens or recombinant viral vector cell systems producing these antigens have stimulated the production of antigen-specific T cell responses in the immunized animals.
  • the proteins identified by the novel method can also be used to as antigens to stimulate the production of antibodies. Such antibodies are useful for the detection of the presence of a stimulating antigen, in animals tissues and fluids.
  • T. parva infection of an animal by T. parva is detected by antibodies produced as a result of using peptides encoded by polynucleotide sequences as antigens to stimulate the production of such antibodies.
  • the T. parva nuclear genome consists of 4 chromosomes and is approximately 8.2 Mb in length.
  • the T. parva genome was sequenced using a whole genome shotgun strategy.
  • T. parva genomic DNA (Muguga clone) was sheared and cloned into plasmid vectors. Both ends of randomly selected clones were sequenced.
  • a total of 152,226 sequences with an average read length of 623 nt were obtained, equivalent to 9.48X coverages assuming a genome size of 10 Mb.
  • Assembly of the sequences with "TIGR Assembler" produced a set of preliminary contigs representing 95% of the genome sequence to begin the process of identification of schizont antigens.
  • the preliminary contigs were loaded into an annotation database and subjected to an automated process that searched the T. parva contigs against a nonredundant database of proteins extracted from GenBank (called "nraa”).
  • the search results were used to produce a set of T. parva gene models that encoded proteins similar to those in other organisms.
  • Tp2 SEQ ID NO: 1
  • Tp3 SEQ LD NO: 2
  • Tp6 SEQ ID NO: 3
  • the nucleic acid sequences encoding Tp2, Tp3 and Tp6 are represented by SEQ ID NOs: 25, 26 and 27, respectively.
  • the subject invention also relates to compositions isolated by methods including one or more of these particular steps and the use of these compositions: to stimulate or induce cytotoxic T cells, as diagnostic reagents for the detection of disease or an immune response, in kits or high throughput "chip” methods or assay, for the detection of or expression of, identical or homologous nucleic acids.
  • the antigens identified are useful for immunization of animals for the production of CTLs that recognize T. parva.
  • the present invention identifies a group of polynucleotide sequences that encode T. parva antigens useful for a variety of applications.
  • the nucleic acids of the invention may comprise recombinant nucleic acid.
  • recombinant nucleic acid herein is meant nucleic acid, originally formed in vitro or in a cell in culture, in general, by the manipulation of nucleic acid by endonucleases and or exonucleases and/or polymerases and/or ligases and/or recombinases, to produce a nucleic acid not normally found in nature.
  • nucleic acid in a linear form, or an expression vector formed in vitro by ligating DNA molecules that are not normally joined, are both considered recombinant for the purposes of this invention. It is understood that once a recombinant nucleic acid is made and reintroduced into a host cell or organism, it will replicate non-recombinantly, i.e., using the in vivo cellular machinery of the host cell rather than in vitro manipulations; however, such nucleic acids, once produced recombinantly, although subsequently replicated non-recombinantly, are still considered recombinant for the purposes of the invention.
  • nucleotide sequences may be produced which are based upon the sequences provided herein and corresponding peptides, polypeptides, or proteins. Some of these nucleotide sequences will bear only minimal homology to the sequences disclosed herein; however the subject invention specifically contemplates each and every possible variation of nucleotide sequence that could be made by selecting combinations based on possible codon choices. These combinations are made in accordance with the standard triplet genetic code as applied to the nucleotide sequence of naturally occurring peptide, polypeptide, or protein, and all such variations are to be considered as being specifically disclosed herein.
  • Recombinant nucleotide variants are alternate polynucleotides which encode a particular protein. They may be synthesized, for example, by making use of the. "redundancy" in the genetic code. Various codon substitutions, such as the silent changes which produce specific restriction sites or codon usage-specific mutations, may be introduced to optimize cloning into a plasmid or viral vector or expression in a particular prokaryotic or eukaryotic host system, respectively. It is possible to produce the polynucleotides of the subject invention, or portions thereof, entirely by synthetic chemistry.
  • the nucleic acid sequence can be used alone or joined with a preexisting sequence and inserted into one of the many available DNA vectors and their respective host cells using techniques well known in the art.
  • synthetic chemistry may be used to introduce specific mutations into the nucleotide sequence. Altematively, a portion of sequence in which a mutation is desired can be synthesized and recombined with a portion of an existing genomic or recombinant sequence.
  • Peptides and polypeptides of the invention can also be produced, entirely or in part, by synthetic chemistry, using conventional procedures.
  • Nucleotide sequences encoding a peptide, polypeptide, or protein may be joined to a variety of other nucleotide sequences by means of well established recombinant DNA techniques (Sambrook J. et al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.; or Ausubel F. M. et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York City).
  • Useful sequences include an assortment of cloning vectors such as plasmids, cosmids, lambda phage derivatives, phagemids, and the like.
  • Vectors of interest include vectors for replication, expression, probe generation, sequencing, and the like.
  • vectors of interest may contain an origin of replication functional in at least one organism, convenient restriction endonuclease sensitive sites, and selectable markers for one or more host cell systems.
  • Another aspect of the subject invention is to provide for hybridization probes which are capable of hybridizing with naturally occurring antigen sequences or nucleotide sequences encoding the disclosed peptide, polypeptide, or protein. The stringency of the hybridization conditions will determine whether the probe identifies only the native nucleotide sequence or sequences of closely related molecules. If degenerate nucleotide sequences of the subject invention are used for the detection of related sequences, they should preferably contain at least 50% of the nucleotides of the sequences presented herein.
  • Probes are nucleic acid sequences of variable length, preferably between at least about 10 and as many as about 6,000 nucleotides, depending on use. They are used in the detection of identical, similar, or complementary nucleic acid sequences. Longer length probes are usually obtained from a natural or recombinant source, are highly specific and much slower to hybridize than oligomers. They may be single- or double-stranded and designed to have specificity in PCR, hybridization membrane-based, or ELISA-like technologies. Hybridization probes of the subject invention may be derived from the polynucleotides represented by SEQ ID NO: 25-31, or from surrounding or included genomic sequences comprising untranslated regions such as promoters, enhancers and introns.
  • hybridization probes may be labeled with appropriate reporter molecules.
  • Means for producing specific hybridization probes include oligolabelling, nick translation, end-labeling or PCR amplification using a labeled nucleotide.
  • the cDNA sequence may be cloned into a vector for the production of mRNA probe.
  • Such vectors are known in the art, are commercially available, and may be used to synthesize RNA probes in vitro by addition of an appropriate RNA polymerase such as T7, T3 or SP6 and labeled nucleotides.
  • nucleotide sequences for example, SEQ ED NO: 25-42, 45-48, 51 and 53 can be used to generate probes for mapping the native genomic sequence.
  • the sequence may be mapped to a particular chromosome or to a specific region of the chromosome using well known techniques.
  • chromosomal spreads include in situ hybridization to chromosomal spreads, flow-sorted chromosomal preparations, or artificial chromosome constructions such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), bacterial PI constructions or single chromosome cDNA libraries.
  • YACs yeast artificial chromosomes
  • BACs bacterial artificial chromosomes
  • PI constructions single chromosome cDNA libraries.
  • In situ hybridization of chromosomal preparations and physical mapping techniques such as linkage analysis using established chromosomal markers are invaluable in extending genetic maps in organisms, including intracellular parasites.
  • the nucleotide sequences of the subject invention may also be used to detect differences in the chromosomal location of nucleotide sequences due to translocation, inversion, or recombination.
  • nucleic acids derived therefrom to produce purified peptides include use of the disclosed sequences or recombinant. nucleic acids derived therefrom to produce purified peptides.
  • the nucleotide sequences as disclosed herein may be used to produce an amino acid sequence using well known methods- of recombinant DNA technology. Goeddel (Gene Expression Technology, Methods and Enzymology [1990] Vol 185, Academic Press, Sari Diego, Calif.) is one among many publications which teach expression of an isolated, purified nucleotide sequence.
  • the amino acid or peptide may be expressed in a variety of host cells, either prokaryotic or eukaryotic.
  • Some expression vectors are viral vectors such as Vaccinia-based vectors, avian-pox based vectors, and adeno-associated viral vectors, among others (Dunachie et al. (2003) J Exp Biol 206. 3771-9).
  • Host cells may be from the same species from which the nucleotide sequence was derived, such as fibroblast cells, lymphocytes or the like, or cells or cell lines, such as P815 cells, from a different species.
  • the disclosed sequences or recombinant nucleic acids can be introduced into the host cells by a variety of methods, known to those skilled in the art, such as methods that involve transfection.
  • Transfection is the process whereby the nucleic acid sequences (as well as proteins and oligonucleotides) are introduced by either biochemical or physical processes.
  • Biochemical methods include DEAE-dextran, calcium phosphate, and liposome-mediated transfection methods (such as lipofection).
  • Physical transfection methods include the direct micro-injection of materials, biolistic particle delivery, e.g. a "gene gun” (both methods deliver materials by mechanically perforating the cell membrane), and electroporation. Electroporation exposes target cells to brief, defined electrical pulses to create transient pores that allow nucleic acids and proteins to cross the cell membrane. Still further aspects of the invention use these purified peptides to produce antibodies or other molecules able to bind to the peptides.
  • T. parva antigens can also be used as a diagnostic aid or in methods that measure the presence of T. parva cytotoxic lymphocytes in immunized or infected animals by co-culturing mononuclear cells harvested from an animal suspected to have an infection due to T. parva, with a T.
  • parva antigen-specific cytotoxic T cell under standard culture conditions for mammalian cell cultures.
  • nononuclear cells are incubated in a culture medium containing an indicator that is released upon cell death, such as 5, Cr.
  • an indicator that is released upon cell death such as 5, Cr.
  • the disclosed nucleotide sequences can be used individually, or in panels, in tests or assays to detect levels of peptide, polypeptide, or protein expression.
  • the form of such qualitative or quantitative methods may include northern analysis, dot blot or other membrane based technologies, dip stick, pin or chip technologies, PCR, ELISAs or other multiple sample format technologies.
  • oligonucleotide or “oligomer” is a stretch of nucleotide residues which has a sufficient number of bases to be used in a polymerase chain reaction (PCR). These short sequences are based on (or designed from) genomic or cDNA sequences and are used to amplify, confirm, or reveal the presence of an identical, similar or complementary DNA or RNA in a particular cell or tissue. Oligonucleotides or oligomers comprise portions of a DNA sequence having at least about 10 nucleotides and as many as about 50 nucleotides, preferably about 15 to 30 nucleotides. They can be chemically synthesized and may be used as probes.
  • a "complementary" DNA or RNA is a sequence that is 100% identical to the strand to which it is complementary.
  • the polynucleotides of the subject invention can themselves be used as probes. Additional polynucleotide sequences can be added to the ends of (or internally in) the exemplified polynucleotide sequences so that polynucleotides that are longer than the exemplified polynucleotides can also be used as probes.
  • isolated polynucleotides comprising one or more of the exemplified sequences are within the scope of the subject invention.
  • Polynucleotides that have fewer nucleotides than the exemplified polynucleotides can also be used and are contemplated within the scope of the present invention. For example, for some purposes, it might be useful to use a conserved sequence from an exemplified polynucleotide wherein the conserved sequence comprises a portion of an exemplified sequence. Thus, polynucleotides of the subject invention can be used to find additional, homologous (wholly or partially) genes.
  • Probes of the subject invention may be composed of DNA, RNA, or PNA (peptide nucleic acid). The probe will normally have at least about 10 bases, more usually at least about 17 bases, and may have up to about 100 bases or more.
  • probes can readily be utilized, and such probes can be, for example, several kilobases.in length.
  • the probe sequence is designed to be at least substantially coihplementary to a portion of a gene encoding a protein of interest.
  • the probe need not have perfect complementarity to the sequence to which it hybridizes.
  • the probes may be labeled utilizing techniques that are well known to those - skilled in this art.
  • One approach for the use of the subject invention as probes entails first identifying DNA segments that are homologous with the disclosed nucleotide sequences using, for example, Southern blot analysis of a gene bank.
  • One hybridization procedure useful according to the subject invention typically includes the initial steps of isolating the DNA sample of interest and purifying it chemically. Either lysed cells or total fractionated nucleic acid isolated from cells can be used. Cells can be treated using known techniques to liberate their DNA (and/or RNA). The DNA sample can be cut into pieces with an appropriate restriction enzyme. The pieces can be interest can be isolated through electrophoresis in a gel, usually agarose or acrylamide.
  • the pieces of interest can be transferred to an immobilizing. membrane.
  • the particular hybridization technique is not essential to the subject invention. As improvements are made in hybridization techniques, they can be readily applied.
  • the probe and sample can then be combined in a hybridization buffer solution and held at an appropriate temperature until annealing occurs. Thereafter, the membrane is washed free of extraneous materials, leaving the sample and bound probe molecules typically detected and quantified by autoradiography and/or liquid scintillation counting.
  • the probe molecule and nucleic acid sample hybridize by forming a strong non-covalent bond between the two molecules, it can be reasonably assumed that the probe and sample are essentially identical or very similar.
  • the probe's detectable label provides a means for determining in a known manner whether hybridization has occurred.
  • the particular probe is labeled with any suitable label known to those skilled in the art, including radioactive and non-radioactive labels.
  • Typical radioactive labels include P, S, or the like.
  • Non-radioactive labels include, for example, ligands such as biotin or thyroxine, as well as enzymes such as hydrolases of peroxidases, or the various chemiluminescers such as luciferin, or fluorescent compounds like fluorescein and its derivatives.
  • the probes can be made inherently fluorescent as described in International Application No. WO 93/16094.
  • hybridization is conducted under moderate to high stringency conditions by techniques well known in the art, as described, for example, in Keller, G. H., M. M. Manak (1987) DNA Probes, Stockton Press, New York, N.Y., pp. 169- 170.
  • moderate to high stringency conditions for hybridization refers to conditions that achieve the same, or about the same, degree of specificity of hybridization as the conditions described herein. Examples of moderate to high stringency conditions are provided herein.
  • hybridization of immobilized DNA on Southern blots with 32 P- labeled gene-specific probes is performed using standard methods (Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY, Vol. 1, 2, 3). In general, hybridization and subsequent washes are carried out under moderate to high stringency conditions that allow for detection of target sequences with homology to sequences exemplified herein. Specific hybridization of a variant under stringent conditions means that the complementary strand required for duplex formation is such that a variant can be distinguished. For double-stranded DNA gene probes, hybridization can be carried out overnight at 20-25° C.
  • Tm melting temperature
  • Tm melting temperature
  • polynucleotide sequences of the subject invention include mutations (both single and multiple), deletions, and insertions in the described sequences, and combinations thereof, wherein said mutations, insertions, and deletions permit formation of stable hybrids with a target polynucleotide of interest.
  • Mutations, insertions, and deletions can be produced in a given polynucleotide sequence using standard methods known in the art. Other methods may become known in the future.
  • the mutational, insertional, and deletional variants of the polypeptide sequences of the invention can be used in the same manner as the exemplified polynucleotide sequences so long as the variants have substantial sequence similarity with the original sequence.
  • substantial sequence similarity refers to the extent of nucleotide similarity that is sufficient to enable the variant polynucleotide to function in the same capacity as the original sequence (e.g., to encode a polypeptide of the invention.
  • this similarity is greater than 50%; more preferably, this similarity is greater than 75%; and most preferably, this similarity is greater than 90%.
  • the degree of similarity needed for the variant to function in its intended capacity will depend upon the intended use of the sequence.
  • Mutants, variants, or fragments can include modifications to the peptide backbone, added moieties, derivatized functional groups, and fragments can have sizes in the range from the minimal length of about 11 amino acids up to the full-length of 265 amino acids.
  • Active variants of the polypeptide sequences of the invention are those variants that function in a manner similar to the original polypeptide with respect to stimulating antigen specific CTLs, in stimulating the production of or reacting with an antibody to the original polynucleotide, or in eliciting protective immunity against an antigen of the invention, such as a T. parva antigen. It is well within the skill of a person trained in this art to make m ⁇ tational, insertional, and deletional mutations that are designed to improve the function of the sequence or otherwise provide a methodological advantage.
  • PCR technology Polymerase Chain Reaction (PCR) is a repetitive, enzymatic, primed synthesis of a nucleic acid sequence.
  • PCR is based on the enzymatic amplification of a DNA fragment of interest that is flanked by two oligonucleotide primers that hybridize to opposite strands of the target sequence.
  • the primers are oriented with the 3' ends pointing towards each other.
  • thermostable DNA polymerase such as Taq polymerase, which is isolated from the thermophilic bacterium Thermits aquaticus, the amplification process can be completely automated.
  • Other enzymes that can be used are known to those skilled in the art.
  • polynucleotide sequences of the subject invention can be used as, and/or used in the design of, primers for PCR amplification.
  • a certain degree of mismatch can be tolerated between primer and template. Therefore, mutations, deletions, and insertions (especially additions of nucleotides to the 5' end) of the exemplified polynucleotides can be used in this manner. Mutations, insertions and deletions can be produced in a given primer by methods known to an ordinarily skilled artisan.
  • Full length genes may be cloned utilizing partial nucleotide sequence and various methods known in the art.
  • Polynucleotides. of the subject invention can be defined according to several parameters. One characteristic is the biological activity of the protein products as identified herein.
  • the proteins and genes of the subject invention can be further defined by their amino acid and nucleotide sequences.
  • the sequences of the molecules can be defined in terms of homology to certain exemplified sequences as well as in terms of the ability to hybridize with, or be amplified by, certain exemplified probes and primers. Additional primers and probes can readily be constructed by those skilled in the art such that alternate polynucleotide sequences encoding the same amino acid sequences can be used to identify and/or characterize additional genes.
  • the proteins of the subject invention can also be identified based on their immunoreactivity with certain antibodies.
  • the polynucleotides and proteins of the subject invention include portions, fragments, variants, and mutants of the full-length sequences as well as fusions and chimerics, so long as the encoded protein retains a characteristic biological activity of the proteins identified herein.
  • the terms "variants” or “variations” of genes include nucleotide sequences that encode the same proteins or which encode equivalent proteins having equivalent biological activity.
  • equivalent proteins refers to proteins having the same or essentially the same biological activity as the exemplified proteins.
  • genes may be readily constructed using standard techniques such as site-directed mutagenesis and other methods of making point mutations and by DNA shuffling, for example.
  • gene and protein fragments can be made using commercially available exonucleases, endonucleases, and proteases according to standard procedures.
  • enzymes such as Bal31 can be used to systematically cut off nucleotides from the ends of genes.
  • genes that encode fragments may be obtained using a variety of restriction enzymes. Proteases may be used to directly obtain active fragments of these proteins.
  • molecular techniques for cloning polynucleotides and producing gene constructs of interest are also well known in the art.
  • a "selectable marker” is a gene whose expression allows one to identify cells that have been transformed or transfected with a vector containing the marker gene.
  • Reporter molecules are chemical moieties used for labeling a nucleic or amino acid sequence. They include, but are not limited to, radionuclides, enzymes, fluorescent, chemi-luminescent, or chromogenic agents. Reporter molecules associate with, establish the presence of, and may allow quantification of a particular nucleic or amino acid sequence.
  • a "portion” or “fragment” of a polynucleotide or nucleic acid comprises all or any part of the nucleotide sequence having fewer nucleotides than about 6 kb, preferably fewer than about 1 kb which can be used as a probe.
  • probes may be labeled with reporter molecules using nick translation, Klenow fill-in reaction, PCR or other methods well known in the art. After pretesting to optimize reaction conditions and to eliminate false positives, nucleic acid probes may be used in Southern, northern or in situ hybridizations to determine whether target DNA or RNA is present in a biological sample, cell type, tissue, organ or organism.
  • a "polypeptide” comprises a protein, oligopeptide or peptide fragments thereof.
  • polypeptide, peptide and protein are used interchangeably herein.
  • a "mutant, variant, or modified polypeptide” includes any polypeptide encoded by a nucleotide sequence that has been mutated through insertions, deletions, substitutions, or the like.
  • Chimeric molecules are polynucleotides or polypeptides which are created by combining one or more nucleotide or peptide sequences (or their parts).
  • nucleotide sequences such combined sequences may be introduced into an appropriate vector and expressed to give rise to a chimeric polypeptide which may be expected to be different from the native molecule in one or more of the following characteristics: cellular location, distribution, ligand-binding affinities, interchain affinities, degradation/turnover rate, signaling, etc.
  • Active is that state which is capable of being useful or of carrying out some role. It specifically refers to those forms, fragments, or domains of an amino acid sequence which display a biologic and/or immunogenic activity characteristic of the naturally occurring peptide, polypeptide, or protein.
  • the present invention relates to active fragments of polypeptides (e.g., represented by SEQ ID NO: 1-7).
  • Naturally occurring refers to a polypeptide produced by cells which have not been genetically engineered or which have been genetically engineered to produce the same sequence as that naturally produced.
  • “Derivative” refers to those polypeptides which have been chemically modified by such techniques as ubiquitination, labeling, pegylation (derivatization with polyethylene glycol), and chemical insertion or substitution of amino acids such as omithine which do not normally occur in proteins.
  • “Recombinant polypeptide variant” refers to any polypeptide which differs from naturally occurring peptide, polypeptide, or protein by amino acid insertions, deletions and/or substitutions.
  • Amino acid ' “substitutions” are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
  • Amino acid "insertions” or “deletions” are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids. The variation allowed in a particular amino acid sequence may be experimentally determined by producing the peptide synthetically or by systematically making insertions, deletions, or substitutions of nucleotides in the sequence using recombinant DNA techniques.
  • oligopeptide is a short stretch of amino acid residues and may be expressed from an oligonucleotide. Such sequences comprise a stretch of amino acid residues of at least about 5 amino acids and often about 17 or more amino acids, typically at least about 9 to 13 amino acids, and of sufficient length to display biologic and/or immunogenic activity.
  • a "standard” is a quantitative or qualitative measurement for comparison.
  • an antibody or “specific binding parts” means any antibody molecule of fragment of an antibody molecule that will bind antigen or other ligands such as lectins or other molecules. "Specific binding parts” is meant to include, but not be limited to antibody fragments such as Fab fragments, Fab'(2) fragments, Fc region fragments, Complementarity determining regions (CDRs), Fv fragments, single chain Fv (scFv) fragments, and antigen binding site fragments.
  • an “antigen” is a macromolecule that is recognized by antibodies or immune cells and can trigger an immune response. Usually, an antigen is a protein or a polysaccharide, but it can be any type of molecule, even small molecules if coupled to a large carrier.
  • An "antigen specific" cytotoxic T cell is a T lymphocyte that can recognize and kill another cell that is expressing an antigen, usually in conjunction with a type or class of molecules referred to by those familiar with the art, as Major Histocompatiblity Complex (MHC) Class I molecules. Such Cytotoxic T cells are also referred to as "CD8 +" (CD8 positive) or CTLs, by those familiar with the art.
  • an “epitope” or “antigenic determinant” is a region or section of an antigen that is approximately the minimal length of antigenic sequence that will elicit an immune response, as measured by the development of an antibody response, the development of T antigen- specific T cells, or other measurable immune cell response.
  • an epitope could be a site on an antigen recognized by antibody.
  • a T cell "epitope” is an antigenic determinant recognized and bound by the T-cell receptor. Epitopes recognized by the T-cell receptor are often located in the inner, unexposed side of the antigen, and become accessible to the T-cell receptors after proteolytic processing of the antigen.
  • An “effective” immunization protocol is one in which an animal is protected against infection, at least to a measurable degree, when exposed to the specific infectious agent for which it was immunized.
  • a “boosf'or “booster administration” is an administration of an immunogen or antigen that is given to an animal at a time period, usually weeks or months, after a first administration of the same immunogen, in order to stimulate an antigen specific response.
  • An "effective" condition or state is a those situation in which a biological process may take place. Such a process could be, for example, the state in which an immune response may develop, or a protein could be expressed by a living cell.
  • a “pharmaceutically acceptable carrier” is an agent or carrier, often, but not limited to, a solute or liquid provided for an immunizing agent in order that it can be administered to an animal.
  • a carrier may be water, saline solution, dextrose, glycerols, alcohols, oils, oil-based substances, to which an immunizing agent is added.
  • a pharmaceutically acceptable carrier can also be a solid substrate, such as microbeads that absorb the immunizing agent or a substance that will release the immunizing agent over time, such as a biodegradable implant.
  • a carrier can also be a combination of the above mentioned carriers, ' but is not limited to such substances.
  • An "Elispot Assay” or “elispot assay” is a shorted name for "Enzyme-linked
  • ImmunoSpot Assay which refers to an antibody based method to detect secretion of soluble factors released by cells. Originally developed as a method to detect antibody-secreting B- cells, later the method was adapted to determine T-cell reaction to a specific antigen, often represented as number of activated cells per million. "Effective conditions” for culturing cells or cell lines refers to those culture conditions that allow the cells to respond in a manner than mimics or is the same as the response would be if the cells were responding in vivo. "Harvesting" cells or other materials means to separate and collect those cells from a mixture of from one source for use in another protocol.
  • an “adjuvant” is a substance mixed with an immunizing agent that increases that ability of an animal to respond to the immunizing agent in a manner that the immune response is of a greater degree than if the adjuvant were not present. The immune response is not to the adjuvant, but to the immunizing agent or antigen that is mixed with the adjuvant.
  • a “protective antibody” is an antibody that, when it is expressed in an animal, puts that animal in a state whereby it will not contract a disease caused by the agent to which the antibody binds.
  • an "antigen specific” cell is a cell such as a cytotoxic T cell, that binds only, or substantially primarily, to the specific molecule or antigen for which it expresses receptors, usually as a result of an immune response.
  • An "immunogenic composition” is a molecule or mixture of molecules that, when administered to an animal, will cause the immune system of that animal to become activated and to produce immune molecules or cells.
  • a composition can also be immunogenic in vitro conditions that are such that they mimic or resemble the conditions that occur in vitro in an animal.
  • T cells or other cells of the immune system means that the T cells or other cells of the immune system of an organism, react to a stimulus in a measurable way, such as by the secretion of a molecule or hormone, may become activated and kill or lyse other cells, or by undergoing a change of cell cycle state or the like.
  • a "Bovine MHC class II bioassay” means an assay that measures the presence of a T cell-derived soluble factor, such as interferon (IFN-gamma) release from T cells responding to specific stimulation through the ability of IFN-gamma to induce and up- regulate expression of class II molecules on bovine endothelial cells.
  • IFN-gamma interferon
  • Bovine endothelial cells do not constitutively express class II molecules unless triggered by external signals such as IFN-gamma.
  • a "vaccine” is a composition that, when administered to an animal, causes the immune system of the animal to produce antibody molecules or immune cells, such as antigen-specific T cells, that react with an antigenic substance that is in the composition and render that animal resistant to infection or other pathology that is caused by an organism bearing or producing the antigenic substance.
  • a “pharmaceutical composition” is a material that has a measurable effect on an animal to which it is administered. This effect is of a nature that is normally thought of as being good or desirable for the animal, such as a healing or protective effect.
  • a pharmaceutical composition may be a therapeutic composition, or a composition used for diagnostic purposes.
  • variant DNA sequences are within the scope of the subject invention.
  • reference to "essentially the same" sequence refers to sequences that have amino acid substitutions, deletions, additions, or insertions that do not materially affect biological activity. Fragments retaining the characteristic biological activity are also, included in this definition.
  • the subject invention comprises variant or equivalent proteins (and nucleotide sequences coding for equivalent proteins) having the same or similar biological activity of proteins encoded by the exemplified polynucleotides. Equivalent proteins will have amino acid similarity with an exemplified protein (or peptide).
  • the amino acid identity is typically greater than about 60%. Preferably, the amino acid identity will be greater than 75%. More preferably, the amino acid identity is greater than about 80%, and even more preferably greater than about 90%. Most preferably, amino acid identity is greater than about 95%. (Likewise, the polynucleotides that encode the subject polypeptides will also have corresponding identities in these preferred ranges.) These identities are as determined using standard alignment techniques for determimng amino acid identity. The amino acid identity/similarity/homology will be highest in critical regions of the protein including those regions that account for biological activity or that are involved in the determination of three- dimensional configuration that is ultimately responsible for the biological activity.
  • amino acids may be placed in the following classes: non-polar, uncharged polar, basic, and acidic. Conservative substitutions whereby an amino acid of one class is replaced with another amino acid of the same type fall within the scope of the subject invention so long as the substitution does not materially alter the biological activity of the compound.
  • Nonpolar - Ala Val, Leu, He, Pro, Met, Phe, Trp, uncharged polar Gly, Ser, Thr, Cys, Tyr, Asn, Gin Acidic - Asp, Glu Basic Lys, His
  • non-conservative substitutions can also be made.
  • reference to "isolated” polynucleotides and/or “purified” proteins refers to these molecules when they are not associated with the other molecules with which they would be found in nature. Thus, reference to “isolated” and/or “purified” signifies the involvement of the "hand of man” as described herein.
  • the invention also provides vectors containing the nucleic acid molecules described herein.
  • the term “vector” refers to a vehicle, preferably a nucleic acid molecule, which can transport the nucleic acid molecules.
  • the vector is a nucleic acid molecule, the nucleic acid molecules are covalently linked to the vector nucleic acid.
  • the vector includes a plasmid, single or double stranded phage, a single or double stranded RNA or DNA viral vector, or artificial chromosome, such as a BAC, PAC, YAC, OR MAC.
  • a vector can be maintained in the host cell as an extrachromosomal element where it replicates and produces additional copies of the nucleic acid molecules.
  • the vector may integrate into the host cell genome and produce additional copies of the nucleic acid molecules when the host cell replicates.
  • the invention provides vectors for the maintenance (cloning vectors) or vectors for expression (expression vectors) of the nucleic acid molecules.
  • the vectors can function in prokaryotic or eukaryotic cells or in both (shuttle vectors).
  • Expression vectors contain cis-acting regulatory regions (expression control sequences) that are operably linked in the vector to the nucleic acid molecules such that transcription of the nucleic acid molecules is allowed in a host cell.
  • the nucleic acid molecules can be introduced into the host cell with a separate nucleic acid molecule capable of affecting transcription.
  • the second nucleic acid molecule may provide a trans-acting factor interacting with the cis-regulatory control region to allow transcription of the nucleic acid molecules from the vector.
  • a trans-acting factor may be supplied by the host cell.
  • a trans-acting factor can be produced from the vector itself. It is understood, however, that in some embodiments, transcription and or translation of the nucleic acid molecules can occur in a cell-free system.
  • the regulatory sequence to which the nucleic acid molecules described herein can be operably linked include promoters for directing mRNA transcription.
  • expression vectors may also include regions that modulate transcription, such as repressor binding sites and enhancers. Examples include the SV40 enhancer, the cytomegalovirus immediate early enhancer, polyoma enhancer, adenovirus enhancers, and retrovirus LTR enhancers.
  • expression vectors can also contain sequences necessary for transcription termination and, in the transcribed region a ribosome binding site for translation.
  • Other regulatory control elements for expression include initiation and termination codons as well as polyadenylation signals.
  • vectors can be used to express a nucleic acid molecule.
  • Such vectors include chromosomal, episomal, and virus-derived vectors, for example vectors derived from bacterial plasmids, from bacteriophage, from yeast episomes, from yeast chromosomal elements, including yeast artificial chromosomes, from viruses such as baculoviruses, papovaviruses such as SV40, Vaccinia viruses including the modified vaccinia virus Ankara strain (MVA), adenoviruses, poxvimses including fowlpox virus (FP9) and canary pox, pseudorabies viruses, and retroviruses.
  • MVA modified vaccinia virus Ankara strain
  • adenoviruses poxvimses including fowlpox virus (FP9) and canary pox, pseudorabies viruses, and retroviruses.
  • Vectors may also be derived from combinations of these sources such as those derived from plasmid and bacteriophage genetic elements, e.g. cosmids and phagemids.
  • Appropriate cloning and expression vectors for prokaryotic and eukaryotic hosts are described in Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd. ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1989).
  • the regulatory sequence may provide constitutive expression in one or more host cells (i.e. tissue specific) or may provide for inducible expression in one or more cell types such as by temperature, nutrient additive, or exogenous factor such as a hormone or other ligand.
  • nucleic acid molecules can be inserted into the vector nucleic acid by well-known methodology.
  • the DNA sequence that will ultimately be expressed is joined to an expression vector by cleaving the DNA sequence and the expression vector with one or more restriction enzymes and then ligating the fragments together. Procedures for restriction enzyme digestion and ligation are well known to those of ordinary skill in the art.
  • the vector containing the appropriate nucleic acid molecule can be introduced into an appropriate host cell for propagation or expression using well-known techniques.
  • Bacterial cells include, but are not limited to, E.
  • Eukaryotic cells include, but are not limited to, yeast, insect cells such as Drosophila, animal cells such as COS and CHO cells, fibroblast, skin fibroblast, immortalized skin fibroblast and plant cells. As described herein, it may be desirable to express the peptide as a fusion protein.
  • the invention provides fusion vectors that allow for the production of the peptides.
  • Fusion vectors can increase the expression of a recombinant protein, increase the solubility of the recombinant protein, and aid in the purification of the protein by acting for example as a ligand for affinity purification.
  • a proteolytic cleavage site may be introduced at the junction of the fusion moiety so that the desired peptide can ultimately be separated from the fusion moiety.
  • Proteolytic enzymes include, but are not limited to, factor Xa, thrombin, and enteroenzyme.
  • Typical fusion expression vectors include pGEX (Smith et al., Gene 67:31-40 (1988)), pMAL (New England Biolabs, Beverly, Mass.) and pRi 5 (Pharmacia, Piscataway, N.J.) which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein.
  • GST glutathione S-transferase
  • suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et al, Gene 69:301-315 (1988)) and pET l id (Studier et al, Gene Expression Technology: Methods in Enzymology 185:60- 89 (1990)).
  • Recombinant protein expression can be maximized in host bacteria by providing a genetic background wherein the host cell has an impaired capacity to proteolytically cleave the recombinant protein.
  • the sequence of the nucleic acid molecule of interest can be altered to provide preferential codon usage for a specific host cell, for example E. coli.
  • the nucleic acid molecules can also be expressed by expression vectors that are operative in yeast. Examples of vectors for expression in yeast e.g., S. cerevisiae include pYepSecl (Baldari, et al, EMBO J. 6:229-234 (1987)), pMFa (Kujan et al, Cell 30:933-
  • the nucleic acid molecules can also be expressed in insect cells using, for example, baculovirus expression vectors.
  • Baculovirus vectors available for expression of proteins in cultured insect cells include the pAc series (Smith et al, Mol. Cell Biol. 3:2156-2165 (1983)) and the pVL series (Lucklow et al, Virology 170:31-39 (1989)).
  • the nucleic acid molecules described herein are expressed in mammalian cells using mammalian expression vectors. Examples of mammalian expression vectors include pCDM8 (Seed, B.
  • the invention also encompasses vectors in which the nucleic acid sequences described herein are cloned into the vector in reverse orientation, but operably linked to a regulatory sequence that permits transcription of antisense RNA.
  • an antisense transcript can be produced to all, or to a portion, of the nucleic acid molecule sequences described herein, including both coding and non-coding regions. Expression of this antisense RNA is subject to each of the parameters described above in relation to expression of the sense RNA (regulatory sequences, constitutive or inducible expression, tissue-specific expression).
  • the invention also relates to recombinant host cells containing the vectors described herein.
  • Host cells therefore include prokaryotic cells, lower eukaryotic cells such as yeast, other eukaryotic cells such as insect cells, and higher eukaryotic cells such as mammalian cells.
  • the recombinant host cells are prepared by introducing the vector constructs described herein into the cells by techniques readily available to the person of ordinary skill in the art. These include, but are not limited to, calcium phosphate transfection, DEAE- dextran-mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, lipofection, and other techniques such as those found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual.
  • Host cells can contain more than one vector.
  • different nucleotide sequences can be introduced on different vectors of the same cell.
  • the nucleic acid molecules can be introduced either alone or with other nucleic acid molecules that are not related to the nucleic acid molecules such as those providing trans-acting factors for expression vectors.
  • the vectors can be introduced independently; co-introduced or joined to the nucleic acid molecule vector.
  • bacteriophage and viral vectors these can be introduced into cells as packaged or encapsulated virus by standard procedures for infection and transduction.
  • Viral vectors can be replication-competent or replication-defective. In the case in which viral replication is defective, replication will occur in host cells providing functions that complement the defects.
  • Vectors generally include selectable markers that enable the selection of the subpopulation of cells that contain the recombinant vector constructs. The marker can be contained in the same vector that contains the nucleic acid molecules described herein or may be on a separate vector. Markers include tetracycline or ampicillin-resistance genes for prokaryotic host cells and dihydrofolate reductase or neomycin resistance for eukaryotic host cells. However, any marker that provides selection for a phenotypic trait will be effective.
  • RNA derived from the DNA constructs described herein can be produced in bacteria, yeast, mammalian cells, and other cells under the control of the appropriate regulatory sequences.
  • cell-free transcription and translation systems can also be used to produce these proteins using RNA derived from the DNA constructs described herein.
  • secretion of the peptide is desired, which is difficult to achieve with multi- transmembrane domain containing proteins such as MHC Class I-binding peptides
  • appropriate secretion signals are inco ⁇ orated into the vector.
  • the signal sequence can be endogenous to the peptides or heterologous to these peptides.
  • the expressed protein can be isolated from the host cell by standard disruption procedures, including freeze thaw, sonication, mechanical disruption, use of lysing agents and the like.
  • the peptide can then be recovered and purified by well-known purification methods including ammonium sulfate precipitation, acid extraction, anion or cationic exchange chromatography, phosphocellulose chromatography, hydrophobic-interaction chromatography, affinity chromatography, hydroxylapatite chromatography, lectin chromatography, or high performance liquid chromatography. It is also understood that depending upon the host cell in recombinant production of the peptides described herein, the peptides can have various glycosylation patterns, depending upon the cell, or maybe non-glycosylated as when produced in bacteria. In addition, the peptides may include an initial modified methionine in some cases as a result of a host-mediated process.
  • heterologous gene or polynucleotide there are many methods for introducing a heterologous gene or polynucleotide into a host cell or cells under conditions that allow for stable maintenance and expression of the gene or polynucleotide. These methods are well known to those skilled in the art. Synthetic genes, such as, for example, those genes modified to enhance expression in a heterologous host (such as by preferred codon usage or by the use of adjoining, downstream, or upstream enhancers) that are functionally equivalent to the genes (and which encode equivalent proteins) can also be used to transfect hosts. Methods for the production of synthetic genes are known in the art. Recombinant hosts can be used for the expression or propagation of genes and polynucleotides of the present invention.
  • T. parva nucleic acids can be expressed in a recombinant baculovirus (BV) possessing an optimized promoter and translation initiation region operably linked to the T. parva nucleic acid.
  • BV baculovirus
  • an optimized promoter and translation initiation region are operably linked to the T. parva nucleic acid.
  • insect host cells can be transformed with baculovirus expressing T. parva nucleic acids.
  • Tn5 (Trichoplusiani or High FiveTM) host cells can be transformed with baculovirus expressing T. parva nucleic acids.
  • T. parva "recombinant protein” is a protein made using recombinant techniques, i.e. through the expression of a recombinant nucleic acid as depicted above.
  • a recombinant protein is distinguished from naturally occurring protein by at least one or more characteristics. For example, the protein may be isolated or purified away from some or all of the proteins and compounds with which it is normally associated in its wild type host, and thus may be substantially pure.
  • an isolated protein is unaccompanied by at least some of the material with which it is normally associated in its natural state, preferably constituting at least about 0.5%, more preferably at least about 5% by weight of the total protein in a given sample.
  • a substantially pure protein comprises at least about 75% by weight of the total protein, with at least about 80% being preferred, and at least about 90% being particularly preferred.
  • the definition includes the production of a protein from one organism in a different organism or host cell.
  • the protein may be made at a significantly higher concentration than is normally seen, through the use of an inducible promoter or high expression promoter, such that the protein is made at increased concentration levels.
  • the protein may be in a form not normally found in nature, as in the addition of an epitope tag or amino acid substitutions, insertions and or deletions, as discussed below.
  • T. parva polypeptide variants include T. parva polypeptide variants. These variants fall into one or more of three classes: substitutional, insertional or deletional variants. These variants ordinarily are prepared by site specific mutagenesis of nucleotides in the DNA encoding a T. parva antigen polypeptide, using cassette or PCR mutagenesis, scanning mutagenesis, gene shuffling or other techniques well known in the art, to produce DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture as outlined above.
  • variant T. parva polypeptide fragments having up to about 100-150 residues may be prepared by in vitro synthesis using established techniques.
  • Amino acid sequence variants are characterized by the predetermined nature of the variation, a feature that sets them apart from naturally occurring allelic or interspecies variation of the T. parva antigen polypeptide amino acid sequence. While the site or region for introducing an amino acid sequence variation is predetermined, the mutation per se need not be predetermined. For example, in order to optimize the performance of a mutation at a given site, random mutagenesis may be conducted at the target codon or region and the expressed T. parva antigen polypeptide variants can be screened for the optimal combination of desired activity.
  • T. parva antigen polypeptide variant DNA can be produced by PCR mutagenesis, or other known techniques.
  • Scanning amino acid analysis can also be employed to identify one or more amino acids along a contiguous sequence.
  • preferred scanning amino acids are relatively small, neutral amino acids.
  • Such amino acids include alanine, glycine, serine, and cysteine.
  • Alanine is typically a preferred scanning amino acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the main-chain conformation of the variant [Cunningham and Wells, Science, 244: 1081-1085 (1989), which is expressly incorporated by reference].
  • Alanine is also typically preferred because it is the most common amino acid. Further, it is frequently found in both buried and exposed positions [Creighton, The Proteins, (W.H. Freeman & Co., N.Y.); Chothia, J. Mol. Biol.* 150:1 (1976), which are expressly, inco ⁇ orated by reference]. If alanine substitution does not yield adequate amounts of variant, an isoteric amino acid can be used. Screening of the mutants or variants is done using elispot and/or bioassays of T. parva antigen polypeptide activities and/or properties as described herein.
  • the present invention further provides fragments of the antigen peptides, in addition to proteins and peptides that comprise and consist of such fragments, particularly those comprising the residues identified in SEQ ID NO: 4-7.
  • the fragments to which the invention pertains are not to be construed as encompassing fragments that may be disclosed publicly prior to. the present invention.
  • a fragment comprises at least about 8, 10, 12, 14, 16, or more contiguous amino acid residues from an antigen peptide.
  • Such fragments can be chosen based on the ability to retain one or more of the biological activities of the antigen peptide or could be chosen for the ability to perform a function, e.g. bind a substrate or act as an immunogen.
  • fragments are biologically active fragments, peptides that are, for example, about 8 or more amino acids in length.
  • Such fragments will typically comprise a domain or motif of the antigen peptide, e.g., active site, a transmembrane domain or a substrate-binding domain.
  • possible fragments include, but are not limited to, domain or motif containing fragments, soluble peptide fragments, and fragments containing immunogenic structures. Predicted domains and functional sites are readily identifiable by computer programs well known and readily available to those of skill in the art (e.g.,
  • the software "Glimmer” ver 1.0 and 2.0 (Gene Locator and Inte ⁇ olated Markov Modeler), is used to find genes in DNA, using inte ⁇ olated Markov models (IMMs) to identify the coding regions and distinguish them from noncoding DNA.
  • IMMs inte ⁇ olated Markov models
  • the EVIM approach described in Salzburg et al., 1998, NAR 26:544, and Delcher et al, 1999, NAR 27:4636 use a combination of Markov models from 1st through 8th-order, weighting each model according to its predictive power.
  • Glimmer 1.0 and 2.0 use 3-periodic nonhomogenous Markov models in their IMMs.
  • Glimmer and other software applications that use EMM such as GlimmerM and GlimmerHMM, (Pertea, M., and Salzberg, S.L. Current Protocols in Bioinformatics, 2002.) have been used to find the genes in chromosome 2 of the malaria parasite, P. falciparum.
  • GlimmerM is described in S.L. Salzberg, M. Pertea, A.L. Delcher, M.J. Gardner, and H. Tettelin, "Inte ⁇ olated Markov models for eukaryotic gene finding," Genomics 59 (1999), 24-31.
  • the Glimmer system consists of two main programs.
  • the first of these is the training program, build-imm that takes an input set of sequences and builds and outputs the EMM for them.
  • sequences can be complete genes or just partial orfs.
  • this training data can consist of those genes with strong database hits as well as very long open reading frames that are statistically almost certain to be genes.
  • the second program is glimmer, which uses this EMM to identify putative genes in an entire genome.
  • a Perl program is available that will use Glimmer's predictions as to call the BLAST program and search any locally-installed protein database. "Combiner” (J. E. Allen, M. Pertea, S. L. Salzberg, Genome Research, 14(1), 2004.
  • polypeptides often contain amino acids other than the 20 amino acids commonly referred to as the 20 naturally occurring amino acids. Further, many amino acids, including the terminal amino acids, may be modified by natural processes, such as processing and other post-translational modifications, or by chemical modification techniques well known in the art.
  • the antigen peptides of the present invention also encompass derivatives or analogs in which a substituted amino acid residue is not one encoded by the genetic code, in which a substituent group is included, in which the mature antigen peptide is fused with another compound, such as a compound to increase the half-life of the antigen peptide (for example, polyethylene glycol), or in which the additional amino acids are fused to the mature antigen peptide, such as a leader or secretory sequence or a sequence for purification of the mature antigen peptide or a pro-protein sequence.
  • a substituted amino acid residue is not one encoded by the genetic code, in which a substituent group is included, in which the mature antigen peptide is fused with another compound, such as a compound to increase the half-life of the antigen peptide (for example, polyethylene glycol), or in which the additional amino acids are fused to the mature antigen peptide, such as a leader or secretory sequence or a sequence for purification of the mature anti
  • an amino acid sequence or oligopeptide used for antibody induction does not require biological activity, it must be immunogenic.
  • a peptide, polypeptide, or protein used to induce specific antibodies may have an amino acid sequence consisting of at least five amino acids and preferably at least 10 amino acids. Short stretches of amino acid sequence may be genetically or chemically fused with those of another protein such as keyhole limpet hemocyanin, and the chimeric peptide used for antibody production. Alternatively, the oligopeptide may be of sufficient length to contain an entire domain.
  • Antibodies specific for peptides, polypeptides, or proteins may be produced by inoculation of an appropriate animal with an antigenic fragment of the peptide, polypeptide, or protein.
  • Antibody production includes not only the stimulation of an immune response by injection into animals, but also analogous processes such as the production of synthetic antibodies, the screening of recombinant immunoglobulin libraries for specific-binding molecules (Oriandi R. et al. [1989] PNAS 86:3833-3837, or Huse W. D. et al. [1989] Science 256:1275-1281), or the in vitro stimulation of lymphocyte populations.
  • Current technology (Winter G. and Milstein C. [1991] Nature 349:293-299) provides for a number of highly , specific binding reagents based on the principles of antibody formation. These techniques may be adapted to produce molecules which specifically bind antigen peptides.
  • Antibodies or other appropriate molecules generated against a specific immunogenic peptide fragment or oligopeptide can be used in Western analysis, enzyme-linked immunosorbent assays (ELISA) or similar tests to establish the presence of or to quantitate amounts of peptide, polypeptide, or protein in normal, diseased, or transformed cells, tissues, organs, or organisms as well as liquid suspensions containing said peptide, polypeptide, or protein.
  • the invention also provides for antibodies that selectively bind to one of the peptides of the present invention, a protein comprising such a peptide, as well as variants and fragments thereof.
  • an antibody selectively binds a target peptide when it binds the target peptide and does not significantly bind to unrelated proteins.
  • an antibody is still considered to selectively bind a peptide even if. it also binds to other proteins that are not substantially homologous with the target peptide so long as such proteins share homology with a fragment or domain of the peptide target of the antibody. In this case, it would be understood that antibody binding to the peptide is still selective despite some degree of cross- reactivity.
  • an antibody is defined in terms consistent with that recognized within the art: they are multi-subunit proteins produced by a mammalian organism in response to an antigen challenge.
  • the antibodies of the present invention include polyclonal antibodies and monoclonal antibodies, as well as fragments of such antibodies, including, but not limited to, Fab or F(ab') 2 , and Fv fragments.
  • Antibodies are preferably prepared from regions or discrete fragments of the antigen proteins.
  • Antibodies can be prepared from any region of the peptide as described herein. However, preferred regions will include those involved in function/activity and/or antigen/binding partner interaction.
  • An antigenic fragment will typically comprise at least 8 contiguous amino acid residues.
  • the antigenic peptide can comprise, however, at least 10, 12, 14, 16 or more amino acid residues.
  • Such fragments can be selected on a physical property, such as fragments correspond to regions that are located on the surface of the protein, e.g., hydrophilic regions or can be selected based on sequence uniqueness. Detection on an antibody or peptide of the present invention can be facilitated by coupling (i.e., physically linking) the antibody or peptide to a detectable substance.
  • detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials.
  • suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase;
  • suitable prosthetic group complexes include streptavidin biotin and avidin/biotin;
  • suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin;
  • an example of a luminescent material includes luminol;
  • bioluminescent materials include luciferase, luciferin, and aequorin, and
  • suitable radioactive material include 125 I, 131 1, 35 S or 3 H.
  • the antibodies can be used to isolate one of the proteins of the present invention by standard techniques, such as affinity chromatography or immunoprecipitation.
  • the antibodies can facilitate the purification of the natural protein from cells and recombinantly produced protein expressed in host cells.
  • such antibodies are useful to detect the presence of one of the proteins of the present invention in cells or tissues to determine the pattern of expression of the protein among various tissues in an organism and over the course of schizont development.
  • Such antibodies can be used to detect protein in situ, in vitro, or in a cell lysate or supernatant in order to evaluate the abundance and pattern of expression.
  • such antibodies can be used to assess abnormal tissue distribution or abnormal expression during development or progression of a protozoan infection.
  • Antibody detection of circulating fragments of the full length protein can be used to identify turnover. Further, the antibodies can be used to assess expression in disease states such as in active stages of the disease or in lymphocytes harvested from infected animals. Experimental data has shown expression of T. parva antigens, using antibodies directed against such antigens, in bovine lymphocytes, infected with T. parva. If a disease is characterized by a specific mutation in the protein, antibodies specific for this mutant protein can be used to assay for the presence of the specific mutant protein.
  • the diagnostic uses can be applied, not only in genetic testing, but also in monitoring a treatment modality. Accordingly, where treatment is ultimately aimed at preventing or controlling infection, antibodies directed against the. protein or relevant fragments can be used to monitor therapeutic efficacy.
  • the antibodies are also useful for inhibiting protein function, for example, blocking the binding of the antigenic peptide to a binding partner such as a substrate. These uses can also be applied in a therapeutic context in which treatment involves inhibiting the protein's function.
  • An antibody can be used, for example, to block binding, thus modulating (agonizing or antagonizing) the peptides activity.
  • Antibodies can be prepared against specific fragments containing sites required for function or against intact protein that is associated with a cell or cell membrane. See SEQ ID NO: 1-7 for structural information relating to the proteins of the present invention.
  • the invention also encompasses kits for using antibodies to detect the presence of a protein in a biological sample.
  • the kit can comprise antibodies such as a labeled or labelable antibody and a compound or agent for detecting protein in a biological sample; means for determining the amount of protein in the sample; means for comparing the amount of protein in the sample with a standard; and instructions for use.
  • Such a kit can be supplied to detect a single protein or epitope or can be configured to detect one of a multitude of epitopes, such as in an antibody detection array. Arrays are described in detail below for nucleic acid arrays and similar methods have been developed for antibody arrays.
  • the proteins of the present invention can be used in assays related to the functional information provided in the Figures; for example, to stimulate CD8+ cytotoxic T cell lines, to raise antibodies or to elicit another immune response; as a reagent (including the labeled reagent) in assays designed to quantitatively determine levels of the protein (or its binding partner or ligand) in biological fluids; and as markers for tissues in which the corresponding protein is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in a disease state).
  • the protein binds or potentially binds to another protein or ligand (such as, for example, in an enzyme-effector protein interaction or enzyme-ligand interaction)
  • the protein can be used to identify the binding partner/ligand so as to develop a system to identify inhibitors of the binding interaction. Any or all of these uses are capable of being developed into reagent grade or kit format for commercialization as commercial products. Methods for performing the uses listed above are well known to those skilled in the art. References disclosing such methods include "Molecular Cloning: A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory Press, Sambrook, J., E. F. Fritsch and T.
  • peptides of the present invention are based primarily on the source of the protein as well as the class/action of the protein.
  • antigens isolated from T. parva and their protozoan orthologs serve as targets for identifying agents for use in mammalian therapeutic applications, e.g. an animal drug, particularly in modulating a biological or pathological response in a cell, tissue, or protozoan that expresses an immunogenic antigen.
  • lymphoblastosis is a condition that describes the multiplication or the proliferation of lymphocytes. Often lymphoblastosis occurs when certain lineages of lymphocytes, such as those in the T-cell mediated immunological pathways, are stimulated by an antigen. At other times, lymphoblastosis can be the result of pathological processes such as viral or other pathogenic infection or as a result of tumorgenesis.
  • assays of the invention such as assays to detect a pathogen, e.g., by detecting the presence and/or expression of a polypeptide of the invention in the pathogen, it is sometimes desirable to immobilize either the antigen protein, or fragment, or its target molecule to facilitate separation of complexes from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay.
  • Techniques for immobilizing proteins on matrices can be used in assays of the invention.
  • a fusion protein can be provided which adds a domain that allows the protein to be bound to a matrix.
  • glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtitre plates, which are then combined with the cell lysates (e.g., 35 S-labeled) and the candidate compound, and the mixture incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads are washed to remove any unbound label, and the matrix immobilized and radiolabel determined directly, or in the supernatant after the complexes are dissociated.
  • glutathione sepharose beads Sigma Chemical, St. Louis, Mo.
  • glutathione derivatized microtitre plates which are then combined with the cell lysates (e.g., 35 S-labeled) and the candidate compound, and the mixture incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation
  • the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the level of antigen-binding protein found in the bead fraction quantitated from the gel using standard electrophoretic techniques.
  • the polypeptide or its target molecule can be immobilized utilizing conjugation of biotin and streptavidin using techniques well known in the art.
  • antibodies reactive with the protein but which do not interfere with binding of the protein to its target molecule can be derivatized to the wells of the plate, and the protein trapped in the wells by antibody conjugation. Preparations of an antigen-binding protein and a candidate compound are incubated in the antigen protein- presenting wells and the amount of complex trapped in the well can be quantitated.
  • Methods for detecting such complexes include immunodetection of complexes using antibodies reactive with the antigen protein target molecule, or which are reactive with antigen protein and compete with the target molecule, as well as enzyme-linked assays which rely on detecting an enzymatic activity associated with the presence of the target molecule.
  • the antigen proteins of the present invention are also useful to provide a target for diagnosing a disease or a disease mediated by the peptide. Accordingly, the invention provides methods for detecting the presence, or levels of, the protein (or encoding mRNA) in a cell, tissue, or organism. Experimental data has shown expression in T. p ⁇ rv ⁇ -infected bovine lymphocytes.
  • the method involves contacting a biological sample with a compound capable of interacting with the antigen protein such that the interaction can be detected.
  • a biological sample can be provided in a single detection format or a multi-detection format such as an antibody chip array.
  • One agent for detecting a protein in a sample is an antibody capable of selectively binding to protein.
  • a biological sample includes tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject.
  • Another aspect of the invention is a kit for purifying T. parva from a sample containing T. parva, comprising an antibody of the invention.
  • the kit may further comprise means for performing an enzyme-linked or Western blot assay to detect the presence of T. parva; and/or means for binding the antibody to T.
  • the peptides of the present invention also provide targets for diagnosing active parasite activity or disease, in an animal having a variant peptide, particularly activities and conditions that are known for other members of the family of proteins to which the present one belongs.
  • the peptide can be isolated from a biological sample and assayed for the presence of a genetic mutation that results in aberrant peptide. This includes amino acid substitution, deletion, insertion, rearrangement, (as the result of aberrant splicing events), and inappropriate post-translational modification.
  • Analytic methods include altered electrophoretic mobility, altered tryptic peptide digest, altered enzyme activity in cell-based or cell-free assay, alteration in substrate or antibody-binding pattern, altered isoelectric point, direct amino acid sequencing, and any other of the known assay techniques useful for detecting mutations in a protein.
  • Such an assay can be provided in a single detection format or a multi-detection format such as an antibody chip array.
  • In vitro techniques for detection of peptide include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations and immunofluorescence using a detection reagent, such as an antibody or protein binding agent, as well as the methods that represent embodiments of the present invention.
  • the peptide can be detected in vivo in a subject by introducing into the subject a labeled anti-peptide antibody or other types of detection agent.
  • the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.
  • Such methods can be used to detect the allelic variant of a peptide expressed in an infected subject and methods which detect fragments of a peptide in a sample.
  • the diagnostic uses can be applied, not only in genetic testing, but also in monitoring a treatment modality. Accordingly, where treatment is ultimately aimed at preventing or controlling infection, antibodies directed against the protein or relevant fragments can be used to monitor therapeutic efficacy.
  • kits for using antibodies to detect the presence of a protein in a biological sample can comprise antibodies such as a labeled or labelable antibody and a compound or agent for detecting protein in a biological sample; means for determining the amount of protein in the sample; means for comparing the amount of protein in the sample with a standard; and instructions for use.
  • a kit can be supplied to detect a single protein or epitope or can be configured to detect one of a multitude of epitopes, such as in an antibody detection array. Arrays are described in detail below for nucleic acid arrays and similar methods have been developed for antibody arrays.
  • the present invention further provides isolated nucleic acid molecules that encode a
  • T. parva antigen peptide or protein of the present invention (cDNA, transcript and genomic sequence).
  • Such nucleic acid molecules will consist of, consist essentially of, or comprise a nucleotide sequence that encodes one of the enzyme peptides of the present invention, an allelic variant thereof, or an ortholog or paralog thereof.
  • an "isolated" nucleic acid molecule is one that is separated from other nucleic acid present in the natural source of the nucleic acid.
  • an "isolated" nucleic acid is free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived.
  • flanking nucleotide sequences for example up to about 5KB, 4KB, 3KB, 2KB, or 1KB or less, particularly contiguous peptide encoding sequences and peptide encoding sequences within the same gene but separated by introns in the genomic sequence.
  • flanking nucleotide sequences for example up to about 5KB, 4KB, 3KB, 2KB, or 1KB or less, particularly contiguous peptide encoding sequences and peptide encoding sequences within the same gene but separated by introns in the genomic sequence.
  • flanking nucleotide sequences for example up to about 5KB, 4KB, 3KB, 2KB, or 1KB or less, particularly contiguous peptide encoding sequences and peptide encoding sequences within the same gene but separated by introns in the genomic sequence.
  • an "isolated" nucleic acid molecule such as a transcript/cDNA molecule
  • the nucleic acid molecule can be fused to- other coding or regulatory sequences and still be considered isolated.
  • recombinant DNA molecules contained in a vector are considered isolated.
  • Further examples of isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution.
  • Isolated RNA molecules include in vivo or in vitro RNA transcripts of the isolated DNA molecules of the present invention.
  • Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically.
  • the nucleic acid may be double stranded, single stranded, or contain portions of both double stranded or single stranded sequence.
  • the depiction of a single strand also defines the sequence of the other strand ("Crick"); thus the sequences depicted in the figures also include the complement of the sequence.
  • 100% sequence identity between the RNA and the target gene is not required to practice the present invention.
  • the invention has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymo ⁇ hism, or evolutionary divergence.
  • RNAi molecules of the subject invention are not limited to those that are targeted to the full-length polynucleotide or gene. Gene product can be inhibited with an RNAi molecule that is targeted to a portion or fragment of the exemplified polynucleotides; high homology (90-95%) or greater identity is also preferred, but not necessarily essential, for such applications. Accordingly, the present invention provides nucleic acid molecules that consist of, consist essentially of, or comprise, the nucleotide sequence shown in SEQ ED NO: 25-31 or any nucleic acid molecule that encodes a protein encoded by SEQ ED NO: 25-31.
  • Consisting essentially of when used in the context of biopolymers, refers to a sequence which is intermediate between the number of residues (amino acids or, in the present case, nucleotides) encompassed by the term “consisting of and the longer length encompassed by the term “comprising.” Residues in addition to the residues encompassed by “consisting of language do not affect the basic and novel characteristics (e.g., in the case of a polynucleotide, the ability to encode a functional peptide, or to bind specifically to a nucleic acid of interest) of the molecule encompassed by the "consisting of language.
  • the invention further provides nucleic acid molecules that encode fragments of the peptides of the present invention as well as nucleic acid molecules that encode obvious variants of the enzyme proteins of the present invention that are described above.
  • nucleic acid molecules may be naturally occurring, such as allelic variants (same locus), paralogs (different locus), and orthologs (different organism), or may be constructed by recombinant DNA methods or by chemical synthesis.
  • non-naturally occurring variants may be made by mutagenesis techniques, including those applied to nucleic acid molecules, cells, or organisms. Accordingly, as discussed above, the variants can contain nucleotide substitutions, deletions, inversions and insertions. Variation can occur in either or both the coding and non-coding regions.
  • the variations can produce conservative and non- conservative amino acid substitutions.
  • the present invention further provides epitope fragments of the antigen proteins and the nucleic acid molecules encoding the antigens, provided in the description of epitope- mapping experiments described below.
  • An epitope coding region comprises a contiguous nucleotide sequence greater than 12 or more nucleotides. Further, a fragment could at least 30, 40, 50, 100, 250 or 500 nucleotides in length. The length of the fragment will be based on its intended use. For example, the fragment can encode epitope bearing regions of the peptide, or can be useful as DNA probes and primers. Such fragments can be isolated using the known nucleotide sequence to synthesize an oligonucleotide probe.
  • a labeled probe can then be used to screen a cDNA library, genomic DNA library, or mRNA to isolate nucleic acid corresponding to the coding region. Further, primers can be used in PCR reactions to clone specific regions of gene.
  • a probe/primer typically comprises substantially a purified oligonucleotide or oligonucleotide pair. The oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 12, 20, 25, 40, 50 or niore consecutive nucleotides. Orthologs, homologs, and allelic variants can be identified using methods well known in the art.
  • these variants comprise a nucleotide sequence encoding a peptide that is typically 60-70%, 70-80%, 80-90%, and more typically at least about 90-95% or more homologous to the nucleotide sequence shown in the Figure sheets or a fragment of this sequence.
  • nucleic acid molecules can readily be identified as being able to hybridize under moderate to stringent conditions, to the nucleotide sequence shown in the Figure sheets or a fragment of the sequence.
  • Allelic variants can readily be determined by genetic locus of the encoding gene.
  • the gene encoding the novel enzyme of the present invention is located on a genome component that has been mapped to the T.
  • the nucleic acid molecules of the present invention are useful as probes, primers, chemical intermediates, and in biological assays.
  • the nucleic acid molecules are useful as a hybridization probe for messenger RNA, transcript/cDNA and genomic DNA to isolate full- length cDNA and genomic clones encoding the peptide described in SEQ ID NO:4-7 and to isolate cDNA and genomic clones that correspond to variants (alleles, orthologs, etc.) producing the same or related peptides shown in SEQ ED NO: 1-7.
  • the probe can correspond to any sequence along the entire length of the nucleic acid molecules provided in the SEQ ED information.
  • nucleic acid molecules are also useful as primers for PCR to amplify any given region of a nucleic acid molecule and are useful to synthesize antisense molecules of desired length and sequence.
  • the nucleic acid molecules are also useful for constructing recombinant vectors. Such vectors include expression vectors that express a portion of, or all of, the peptide sequences.
  • Vectors also include insertion vectors, used to integrate into another nucleic acid molecule sequence, such as into the cellular genome, to alter in situ expression of a gene and/or gene product.
  • an endogenous coding sequence can be replaced via homologous recombination with all or part of the coding region containing one or more specifically introduced mutations.
  • the nucleic acid molecules are also useful for expressing antigenic portions of the proteins.
  • the nucleic acid molecules are also useful as probes for determining the chromosomal positions of the nucleic acid molecules by means of in situ hybridization methods.
  • the genes encoding the novel antigens of the present invention are located on a genome component that has been mapped to T. parva chromosomes 1 (Tp2).
  • the nucleic acid molecules are also useful in making vectors containing the gene regulatory regions of the nucleic acid molecules of the present invention.
  • the nucleic acid molecules are also useful for designing antigens corresponding to all, or a part, of the mRNA produced from the nucleic acid molecules described herein.
  • the nucleic acid molecules are also useful for making vectors that express part, or all, of the peptides.
  • the nucleic acid molecules are also useful for constructing host cells expressing a part, or all, of the nucleic acid molecules and peptides.
  • the nucleic acid molecules are also useful as hybridization probes for determining the presence, level, form and distribution of nucleic acid expression.
  • probes could be used to detect the presence of, or to determine levels of, a specific nucleic acid molecule in cells, tissues, and in organisms.
  • the nucleic acid whose level is determined can be DNA or RNA.
  • probes corresponding to the peptides described herein can be used to assess expression and/or gene copy number in a given cell, tissue, or organism. These uses are relevant for diagnosis of disorders involving an increase or decrease in antigen protein expression relative to normal results.
  • In vitro techniques for detection of mRNA include Northern hybridizations and in situ hybridizations.
  • In vitro techniques for detecting DNA include Southern hybridizations and in situ hybridization. Probes can be used as a part of a diagnostic test kit for identifying cells or tissues that express an T.
  • kits for detecting the presence of an antigen nucleic acid in a biological sample can comprise reagents such as a labeled or labelable nucleic acid or agent capable of detecting antigen nucleic acid in a biological sample; means for determining the amount of antigen nucleic acid in the sample; and means for comparing the amount of antigen nucleic acid in the sample with a standard.
  • the compound or agent can be packaged in a suitable container.
  • the kit can further comprise instructions for using the kit to detect antigen protein mRNA or DNA.
  • the present invention further provides nucleic acid detection kits, such as arrays or microarrays of nucleic acid molecules that are based on the sequence information provided in SEQ ED NO: 25-31.
  • arrays or “Microarrays” refers to an array of distinct polynucleotides or oligonucleotides synthesized on a substrate, such as paper, nylon or other type of membrane, filter, chip, glass slide, or any other suitable solid support.
  • the microarray is prepared and used according to the methods described in U.S. Pat. No.
  • the microarray or detection kit is preferably composed of a large number of unique, single-stranded nucleic acid sequences, usually either synthetic antisense oligonucleotides or fragments of cDNAs, fixed to a solid support.
  • the oligonucleotides are preferably about 6-60 nucleotides in length, more preferably 15-30 nucleotides in length, and most preferably about 20-25 nucleotides in length. For a certain type of microarray or detection kit, it may be preferable to use oligonucleotides that are only 7-20 nucleotides in length.
  • the microarray or detection kit may contain oligonucleotides that cover the known 5', or 3', sequence, sequential oligonucleotides which cover the full length sequence; or unique oligonucleotides selected from particular areas, along the length of the sequence.
  • Polynucleotides used in the microarray or detection kit may be oligonucleotides that are specific to a gene or genes of interest.
  • the gene(s) of interest or an ORF identified in the present invention
  • Typical algorithms will then identify oligomers of defined length that are unique to the gene, have a GC content within a range suitable for hybridization, and lack predicted secondary structure that may interfere with hybridization.
  • pairs of oligonucleotides on a microarray or detection kit.
  • the "pairs" will be identical, except for one nucleotide that preferably is located in the center of the sequence.
  • the second oligonucleotide in the pair serves as a control.
  • the number of oligonucleotide pairs may range from two to one million.
  • the oligomers are synthesized at designated areas on a substrate using a light-directed chemical process.
  • the substrate may be paper, nylon or other type of membrane, filter, chip, glass slide or any other suitable solid support.
  • an oligonucleotide may be synthesized on the surface of the substrate by using a chemical coupling procedure and an ink jet application apparatus, as described in PCT application W095/251116 (Baldeschweiler et al.) which is inco ⁇ orated herein in its entirety by reference.
  • a "gridded" array analogous to a dot (or slot) blot may be used to arrange and link cDNA fragments or oligonucleotides to the surface of a substrate using a vacuum system, thermal, UV, mechanical or chemical bonding procedures.
  • An array such as those described above, may be produced by hand or by using available devices (slot blot or dot blot apparatus), materials (any suitable solid support), and machines (including robotic instruments), and may contain 8, 24, 96, 384, 1536, 6144 or more oligonucleotides, or any other number between two and one million which lends itself to the efficient use of commercially available instrumentation.
  • the RNA or DNA from a biological sample is made into hybridization probes.
  • the mRNA is isolated, and cDNA is produced and used as a template to make antisense RNA (aRNA).
  • the aRNA is amplified in the presence of fluorescent nucleotides, and labeled probes are incubated with the microarray or detection kit so that the probe sequences hybridize to complementary oligonucleotides of the microarray or detection kit. Incubation conditions are adjusted so that hybridization occurs with precise complementary matches or with various degrees of less complementarity. After removal of nonhybridized probes, a scanner is used to determine the levels and patterns of fluorescence. The scanned images are examined to determine degree of complementarity and the relative abundance of each oligonucleotide sequence on the microarray or detection kit.
  • the biological samples may be obtained from any bodily fluids (such as blood, urine, saliva, phlegm, gastric juices, etc.), cultured cells, biopsies, or other tissue preparations.
  • a detection system may be used to measure the absence, presence, and amount of hybridization for all of the distinct sequences simultaneously. This data may be used for large-scale correlation studies on the sequences, expression patterns, mutations, variants, or polymo ⁇ hisms among samples.
  • the present invention provides methods to identify the presence or expression of the antigen proteins/peptides of the present invention. In detail, such methods comprise incubating a test sample with one or more nucleic acid molecules and assaying for binding of the nucleic acid molecule with components within the test sample.
  • Such assays comprise incubating a test sample with one or more nucleic acid molecules and assaying for binding of the nucleic acid molecule with components within the test sample.
  • arrays comprising many genes, at least one of which is a gene of the present invention and or alleles of the enzyme gene of the present invention.
  • the figures and associated information below provide information on epitope sequence and micro- variation in strains of T. parva that have been found in the gene encoding the antigen of the present invention.
  • Conditions for incubating a nucleic acid molecule with a test sample vary. Incubation conditions depend on the format employed in the assay, the detection methods employed, and the type and nature of the nucleic acid molecule used in the assay. One skilled in the art will recognize that any one of the commonly available hybridization, amplification or array assay formats can readily be adapted to employ the novel fragments of the T. parva genome disclosed herein.
  • test samples of the present invention include cells, protein or membrane extracts of cells.
  • kits which contain the necessary reagents to carry out the assays of the present invention.
  • the invention provides a compartmentalized kit to receive, in close confinement, one or more containers which comprises: (a) a first container comprising one of the nucleic acid molecules that can bind to a fragment of the T.
  • a compartmentalized kit includes any kit in which reagents are contained in separate containers.
  • Such containers include small glass containers, plastic containers, strips of plastic, glass or paper, or arraying material such as silica.
  • Such containers allows one to efficiently transfer reagents from one compartment to another compartment such that the samples and reagents are not cross-contaminated, and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another.
  • Such containers will include a container which will accept the test sample, a container which contains the nucleic acid probe, containers which contain wash reagents (such as phosphate buffered saline, Tris-buffers, etc.), and containers which contain the reagents used to detect the bound probe.
  • wash reagents such as phosphate buffered saline, Tris-buffers, etc.
  • containers which contain the reagents used to detect the bound probe are known in the art, particularly expression arrays.
  • the T. parva antigens of the present invention can induce, in vivo, antigen-specific CD8+ cytotoxic T cells for prophylactic immunization of cattle for the prevention of East Coast Fever disease.
  • CTLs specific to the following metazoan parasites may also be induced by compositions identified in accordance with the methods of the present invention: Plasmodium falciparum (which causes malaria), Schistosoma mansoni (which causes schistosomiasis), and Trypanosoma cruzi (which causes Chagas' disease), Giardia lamblia, Entoemeba histolytica, Cryptospiridium spp., Leishmania spp., Brugia spp., Wuchereria spp., Onchocerca spp., Strongyloides spp., Coccidia, Haemanchus spp., Ostertagia spp., Trichomonas spp., Dirofilaria spp., Toxocara spp., Naegleria spp., Pneumocystis carinii, Ascaris spp., other Trypanosoma spp., other Schis
  • nucleic acid may refer to either DNA or RNA, or molecules which contain both deoxy- and ribonucleotides.
  • the nucleic acids include genomic DNA, cDNA, and oligonucleotides including sense and anti-sense nucleic acids.
  • Such nucleic acids may also contain modifications in the ribose-phosphate backbone to increase stability and half life of such molecules in physiological environments.
  • Theileria parva nuclear genome consists of 4 chromosomes and is approximately 8.2 Mb in length. Tp2, Tp3, and Tp6 loci are located on Chromosome 1.
  • the T. parva genome was sequenced using a conventional whole genome shotgun strategy. T. parva genomic DNA (Muguga clone) was sheared and cloned into plasmid vectors. Both ends of randomly selected clones were sequenced. A total of 152,226 sequences with an average read length of 623 nt were obtained, equivalent to 9.48X coverages assuming a genome size of 10 Mb.
  • Assembly of the sequences with "TIGR Assembler” produced a set of preliminary contigs represent 95% of the genome sequence.
  • the preliminary contigs were loaded into an annotation database and subjected to an automated process that searched the T. parva contigs against a nonredundant database of proteins extracted from GenBank (called nraa).
  • the search results were used to produce a set of T. parva gene models that encoded proteins similar to those in other organisms.
  • This set of gene models was used to train the gene finding programs "GlimmerM” and "phat”, which were subsequently run against all . of the preliminary contigs to produce gene models for the entire preliminary genome sequence.
  • the proteins encoded by the predicted T were used to train the gene finding programs "GlimmerM” and "phat”, which were subsequently run against all .
  • parva genes were subjected to a variety of analyses such as database searched (“blastp”), predictions of signal peptides and signal anchors (“SignalP 2.0”), and transmembrane domains (“TMHMM”). The results were reviewed and a set of ⁇ 55 genes encoding candidate antigens were selected for screening for immunogenicity. These gene sequences were screened and this led to the identification of antigens known as Tp2, Tp3, and Tp6.
  • RNA Extraction One million of T. parva (Muguga strain)-infected cells were washed withlml of Phosphate Buffered Saline (PBS) and were centrifuged at 15,000 ⁇ m for 10 seconds. After removing the supernatant, the cells were resuspended in 1ml of RNAzol® by pipetting. Then lOOul of chloroform were added and mixed briefly by vortex. The tube was spun at t 15,000 ⁇ m for 15min at 4°C and 400 ⁇ l of the upper aqueous phase were transferred to a new EppendorfTM tube.
  • PBS Phosphate Buffered Saline
  • the flow-through was discarded and the column replaced to the emptied collection tube.
  • the column was washed with 750ul of wash buffer PE and spun for lminute.
  • the flow-through was discarded and spun again for 1 minute to dry.
  • the column was transferred to a 1.5ml EppendorfTM tube containing 5ul of 3M Sodium Acetate and then 50 ⁇ l of buffer EB was pipetted into the column and left to stand for 1 minute before being spun for another minute.
  • the eluted DNA was precipitated by addition of 150ul of ethanol, mixed well and incubated at -20°C for 20minutes.
  • the tube was then spun in a microfuge at 15,000 ⁇ m for 15min at 4°C.
  • the supernatant was aspirated then the residual pellet was washed with 300ul of 70% ethanol.
  • the tube was spun again in a cooled microfuge at 15,000 ⁇ m for lOmin at 4°C.
  • the supernatant was aspirated again and the pellet dried.
  • the DNA was resuspended in 8ul of water and l ⁇ l run on a gel for quality and quantity assessment.
  • Ligation After determination the concentration of the fragments, an adjustment was made such that a ligation mix was set up at a molar ratio of 1:10 (vector: insert); — (pTargeT vector (Promega, 20ng/ul) lul; fragment l-7ul (depending upon the concentration of the fragments); lOx ligation buffer lul; T4 DNA ligase lul; water to make up final vol. to lOul). After incubation at 4°C overnight, ligase was inactivated by incubation of the tube at 70°C for 30 minutes and then ethanol precipitated. Pellets were reconstituted in lO ⁇ l of water.
  • JM109 strain of E.coli electro-competent cells were used for transformation with the ligated samples.
  • Preparation for electroporation was done by cooling the BIO-RAD® 0.2cm E.coli Pulser® Cuvette on ice, thawing the competent cells on ice, setting the electroporator equipment at 2.5KV, 200Omega and 25 ⁇ F.
  • Five ⁇ l of the ligation mixture was added to 50 ⁇ l of the competent cells, and then quickly transferred into cold cuvettes on ice, tapping firmly onto tissue paper to ensure that all cells went to the bottom without leaving any spaces.
  • the cuvette was wiped dry and pulsed till the PLS signal and an alarm signified successful pulsing.
  • Pulsed cells were resuspended in 1ml of 2xYT medium immediately and then transferred into a Falcon 2059 tube and incubated for 1 hour at 37°C with shaking. When the incubation finished, the cells were plated on 2xYT plates containing 60ug/ml Xgal, O.lmM IPTG, and 50ug/ml Ampicillin at a various dilutions. The plates were incubated at 37oC for overnight.
  • V-bottom 96 microtiter plates were used for screening of the colonies.
  • the PCR master mix was prepared such that each well has a total of 25 ⁇ l of [lx PCR buffer mix 23.75 ⁇ l; gene specific-forward primer 0.5 ⁇ l; vector specific-reverse primer 0.5 ⁇ l; Taq polymerase 0.25 ⁇ l].
  • gene-specific primers (EFl, Table3) were used.
  • the vector-specific reverse primer was SEQ ED NO: 44, (5'GAGCGGATAACATCACACAGG3').
  • a colony was touched, then touched the master plate with the same tip at a place that is numbered (for identification pu ⁇ ose) and finally placed in the corresponding well, leaving it there until all the wells were completed.
  • a pipette the well contents were mixed then the tip was discarded and then followed with a drop of mineral oil in each well.
  • the plate was placed in a MJ Research minicycler and run using the following cycles. 95°C 5 minutes; 94°C20 seconds; 55°C 20 seconds; 72°C 30 seconds; then to step two 34 more times; 72oC 5 minutes; and finally at 10°C for a holding time.
  • the plate was removed and 5ul of 6X loading dye was added to each well.
  • the products were run on a 2% agarose gel.
  • the positive clones on the master plates were identified and a sample taken for a 25ml overnight culture.
  • a HiSpeed midi tip was equilibrated by adding 4ml of buffer QBT and allowing the column to empty by gravity flow. The cap was removed from the outlet nozzle and the plunger gently inserted to filter through into the equilibrated HiSpeed tip. The cleared lysate was allowed to enter the resin by gravity flow then washed with 20ml buffer QC. DNA was eluted with 5ml buffer QF into a clean Falcon tube, followed by 3.5ml of 100% Iso-propanol and mixed well. This was then spun at 3500 ⁇ m for 30minutes at 4°C, the supernatant discarded, the residual pellet resuspended in 1.5ml 70% ethanol and then transferred into a labeled 2ml EppendorfTM tube.
  • the tube was spun at 15000 ⁇ m for lOminutes at 4°C, aspirated and dried then reconstituted in 50 ⁇ l water.
  • a l ⁇ l sample was run on an agarose gel for quantification and another lO ⁇ l were submitted for' sequencing and in vitro assay (Elispot and bioassay).
  • the 11 cattle used in this invention were pure bred B ⁇ s indicus (Boran) pure bred Bos taurus (Friesian) or crossbreeds. Details of the animals are shown in Table 4. Sero- negative cattle, as measured by the presence of serum antibodies to T. parva, were immunized by 'infection and treatment' against the Muguga.stock of T. parva by simultaneous inoculation of sporozoites and long-acting oxytetracycline at 20mg/kg BW (Radley et al (1975) Vet Rec 96, 525-7). Cryopreserved sporozoites (Stabilate # 4133) were thawed and diluted 1/20 as previously described.
  • PBMC peripheral blood monocytes
  • Infected cell lines were maintained in TpM medium (RPMI-1640 supplemented with 10% Fetaclone II (Hyclone, UK; tested for BVDV& Mycoplamsa spp.), lOOiU/ml Penicillin, lOOmg/ml Streptomycin, 50mg/ml Gentamycin, 5xlO "5 M 2-mercaptoethanol and 2mM L-Glutamine) and passagedl/5 three times a week.
  • PBMC parva specific Bulk CTL Cultures Venous blood from immunized animals was collected from .4 weeks post- immunization.
  • PBMC were prepared as described previously (Goddeeris & Morrison, 1988). PBMC were adjusted to 4x10 6 /ml in CTL medium (RPMI-1640 without HEPES supplemented with 10% FBS (HyClone; tested for BVDV & mycoplamsa spp.), L-glutamine, 2-mercaptoethanol and antibiotics as described above) and 1 ml/well added to 24 well plates (Costar, Corning, NY, USA). PBMC were co-cultured with irradiated (50Gy) autologous T.
  • parva infected cells TpM
  • TpM parva infected cells
  • Viable cells were harvested as described above, adjusted to 2 xl0 6 /well and stimulated with 4 xl0 5 /well irradiated TpM and 2 xl0 6 /well irradiated autologous PBMC as filler cells.
  • Viable cells were harvested from TpM stimulated lines 7 days post-stimulation (effector cells) and resuspended in cytotoxicity medium at 2xl0 7 /ml. Two-fold doubling dilutions of effector cells were distributed in duplicate (lOO ⁇ l/well) to 96-well half area (A 2) flat-bottom culture plates (Costar, Coming, NY, USA) resulting in a range of effector cell concentrations of 4xl0 6 to 2.5xl0 5 well. Target cells were added to each well containing effector cells (50 ⁇ l/well) resulting in target cell ratios ranging from 80:1 to 5:1.
  • Evidence for MHC class I restricted lysis was assessed by the capacity of monoclonal antibodies recognizing bovine MHC class I to inhibit lysis.
  • Cells were prepared for the cytotoxicity assay as described above except that target cells were resuspended at double the density (2x10 6 /ml) and 25 ⁇ l added first to the plate. 25 ⁇ l of either cytotoxicity medium or monoclonal antibody (mAb; 1L-A88 diluted 1/15 in cytotoxicity medium was added to target cells and incubated for 30min at room temperature. Serial dilutions of effector cells were then added as described above.
  • T cells were isolated either by positive selection using flow cytometry (FACStar Plus, BD Biosciences, San Jose, CA, USA) or negative selection using Dynabeads (Dynal Biotech, Bromborough, UK). Positive selection: Cells were adjusted to 2xl0 7 /ml in sterile monoclonal antibody
  • IL-A105 (specific for bovine CD8) diluted.1/100 and incubated for 30 minutes at 4°C.
  • Cells were washed twice in cold culture medium and resuspended at 2xl0 7 /ml in sterile goat anti- mouse polyvalent immunoglobulins conjugated to FITC (Sigma). Cells were washed twice in cold medium before being run through a FACStar plus cell-sorter and CD8 + FITC + cells collected.
  • Negative selection Cells were adjusted to 2xl0 7 /ml in sterile mAbs EL-A12 (specific for bovine CD4) and GB21A (specific for bovine gamma-delta-TCR) diluted 1/100 and incubated for 30 minutes at 4 C.
  • CD8+ T cells enriched by either of the methods described above were adjusted to 30, 10, and 3 cell/ml and distributed into 96-well, round bottom culture plates containing 2 x 10 4 irradiated autologous TpM, 5 x 10 3 irradiated autologous PBMC and 5U/ml recombinant human EL-2 (HuIL-2; Sigma, Poole, UK) in a final volume of 200 ⁇ l/well. Plates were incubated at 37°C in humidified incubator containing 5% CO 2 in air. Wells showing significant cell growth were selected for analysis of lysis of autologous TpM in an ( ⁇ u ln) Indium oxine release assay.
  • ⁇ n In release assay was performed as described above for 51 Cr release assay except that targets cells were labeled by addition of 5 ⁇ Ci In/l x 10 6 cells and incubation for 15 minutes at 37°C. Cells were washed five times with cytotoxicity medium and resuspended at 1x10 5 /ml and added 50 ⁇ l/well to 96-well V-bottom 96 well plates. lOO ⁇ l cells from wells showing significant growth were transferred to 96-well V-bottom culture plates (Greiner) and centrifuged (180xg) for 5 min. Cells were resuspended lOO ⁇ l/well in cytotoxicity medium and transferred to wells containing labeled target cells.
  • bovine skin fibroblasts A skin biopsy was taken aseptically from the ears of cattle and placed in a 50ml falcon tube containing Elsevier's solution. In the laboratory laminar flow hood, the biopsy was placed into sterile petri dishes (Sterilin) containing 1ml of 0.25% Trypsin-EDTA. Using a sterile scalpel blade, the sample was cut into small pieces and placed into a 50 ml falcon tube containing Trypsin-EDTA. The preparation was placed in a shaking incubator for 1-1.5 hr at
  • SF skin fibroblasts
  • 25-cm tissue culture flasks (Costar).
  • Cells were maintained in complete DMEM containing 10% FBS, 200 IU/ml penicillin, 100 ⁇ g/ml streptomycin and 2 mM L-glutamine and passaged every 3 days at a ratio of 1:3.
  • Cells were expanded in 75-cm 2 tissue culture flasks (Costar) until confluent yielding 3-4* 10 6 cells/flask.
  • a liquid nitrogen cell bank was prepared with 2*10 6 cells/freezing vial in 10% DMSO in FBS.
  • Bovine testicular vein or pulmonary artery EC lines were established as described by Byrom and Yunker (1990) Cytotechnology 4, 285-90) with the modifications of Mwangi et al (1998) Vet Parasitol. 79, 1-17). Briefly, the vein was placed in wash buffer consisting of Ca 2+ - and Mg 2+ -free PBS supplemented with 400 IU/ml penicillin, 400 ⁇ g/ml streptomycin and 5 ⁇ g ml fungizone.
  • the vessel was then slit longitudinally, washed twice before being cut into 1-cm 2 pieces and then placed lumen side down on a drop of collagenase (1 mg/ml) and incubated for 1 h at 37°C.
  • the cell suspension was centrifuged for 5 min at 200*g and resuspended in 24 ml 2x complete DMEM (Gibco-BRL, Paisley, UK) supplemented with 20% heat-inactivated fetal bovine serum (FBS) (Hyclone, Logan, UT), 400 IU/ml penicillin, 300 ⁇ g/ml streptomycin, 5 mg/ml fungizone, 300 ⁇ g/ml endothelial growth supplement (Sigma, St Louis, MO) and 2 mM L-glutamine.
  • FBS heat-inactivated fetal bovine serum
  • Cells were maintained in complete DMEM containing 10% FBS, 200 IU/ml penicillin, 100 ⁇ g/ml streptomycin, 2.5 mg/ml fungizone, 2 mM L-glutamine and passaged every 3 days at a ratio of 1:3.
  • Cells were expanded in 75-cm 2 tissue culture flasks (Costar) until confluent yielding between 3*10 6 and 4*10 6 cells per flask.
  • a liquid nitrogen cell bank was prepared with 2*10 6 cells per freezing vial. Cells were raised from nitrogen into 75-cm 2 flasks and used between the fourth and tenth passages.
  • the DNA mix was prepared by mixing 5 ⁇ l DNA with 495 ⁇ l of DMEM with antibiotics but no serum.
  • a working dilution of Fugene 6 transfection reagent (Roche) was prepared by mixing 15 ⁇ l of Fugene with 485 ⁇ l of DMEM. Mixing was done using the 2ml sterile non-pyrogenic, DNAse and RNase free cryopreservation tubes.
  • the diluted Fugene was added to the diluted DNA drop wise with constant tapping at the end of the tube.
  • the Fugene- DNA complex was allowed to form at room temperature for 30 min.
  • Cells were cultured in 6- well plates (Costar) at a density of 2 x 10 5 cells per well and grown to confluence overnight at 37 C, 5% CO 2 in a humidified incubator.
  • COS-7 cells and immortalized skin fibroblasts with schizont cDNA library were maintained in T75 and T150 TC flasks with DMEM supplemented with 10% FCS, 2mM L-glutamine and antibiotics (TC medium) as described above. Cells are split 1 :4 every 3 days. The day prior to transfection, cells were harvested by the removal of medium, washing in PBS and incubation in 0.25% Trypsin-EDTA for 5 min at 37°C. Once cells had detached TC medium was added and cells removed. Cells were washed by centrifugation at 1200 ⁇ for lOmin and resuspended in TC medium.
  • DNA was prepared for either single transfections of SF or double transfections (co- transfection of schizont cDNA and BoLA class I cDNA) of COS cells. 6 ⁇ l of schizont cDNA and 6 ⁇ l of BoLA class I cDNA (for co-transfection) at 50ng/ ⁇ l in dH 2 O were added to 150 ⁇ l unsupplemented DMEM in wells of a 96-well round-bottom plate.
  • FuGENE 6 transfection reagent was pre-warmed to 37°C. 0.9 ⁇ l or 0.45 ⁇ l FuGENE 6 was added to each well for double and single transfections respectively. The well contents mixed by shaking on a Dynatech Varishaker for 1 min and incubated at RT for 20 min. The medium from the 96 well plates containing adherent COS cells and SF was removed and each transfection complex added to triplicate wells (50 ⁇ l/well). The cells were then incubated for 4 hours at 37°C in a CO 2 (5%) humidified incubator. The transfection complex was removed and replaced with 200 ⁇ l/well DMEM supplemented as described above and incubate for 24 or 48 hours at 37°C in a CO 2 (5%) humidified incubator.
  • the cells were centrifuged at 1200 ⁇ m for 3 min; supernatant removed and resuspended SO ⁇ l/well in CTL medium Schizont specific CTL, generated and maintained as described above, were harvested 7-14 days post-stimulation, transferred to polycarbonate tubes, pelleted at 1200 ⁇ m for lOmin and resuspended at 2xl0 5 /ml in CTL medium supplemented with 5U/ml HuIL-2 (Sigma). Elispot plates (Millipore Co ⁇ oration, Bedford, MA, USA) were coated 50 ⁇ l well with 2 ⁇ g/ml of murine anti-bovine LFN-gamma mAb (CC302; Serotec, UK) and incubated overnight at 4°C.
  • irradiated TpM are serially diluted in COS cells or SF with each at a density of 4xl0 5 /ml. and populations containing 32, 16, 8, 4, 2, 1% TpM are added 50 ⁇ l/well to wells containing CTL. Plates were incubated in a humidified incubator at 37°C for 20 hours. After incubation, the contents of wells were removed and.
  • PBS-T PBS supplemented with Tween 20
  • Bioassay for CTL activation based on rapid induction of class II MHC expression by constitutively negative bovine endothelial cells Endothelial cells were detached from confluent 75-cm 2 tissue culture flasks by treatment with trypsi ⁇ /EDTA as described. 2.5x10 4 cells were seeded into each well of a 48- well plate in 1 ml of complete DMEM and incubated overnight. Cell-free test supematants derived from either co-culture of T.
  • Endothelial cells ere labeled on ice for 30 mini with 100 ul of an antibody cocktail comprising equal volumes of bovine class II MHC-specific monoclonal antibodies (mAbs) JI 1, RI, and IL-A21 (each at a 1/500 dilution of ascitic fluid). After 3 washed in FACS medium, 100 ul of FITC-conjugated goat anti-mouse Ig (Sigma) diluted 1/200 in FACS medium were added.
  • mAbs bovine class II MHC-specific monoclonal antibodies
  • Test supematants were collected from 96-well flat-bottomed microtitre plates (Costar) 48 hours after restimulation of resting T cell lines (2 l0 4 per well) with 4 l0 5 COS-7 cells co-transfected with the KN104 gene and test gene(s) or confluent autologous SF transfected with the test gene(s) in a final volume of 200 ⁇ l for 24 h. These tests were set-up at least in duplicates. Where indicated, class I MHC was blocked using a specific antibody (IL- A88) to check for MHC class I restriction of the CTL lines. Additional negative control supematants were derived from co-culture of CTL with untransfected immortalized SF or COS-7 cells. Positive control supematants were obtained from co-culture of CTL with varying proportions of irradiated autologous TpM.
  • TpM did not constitutively express TpM and no EFN-gamma spots could be attributed to the TpM (Data not shown).
  • TpM were titrated in COS-7 or iSF and co-cultured with CTL in EFN- gamma elispot plates (FIG. 2A, FIG 2B and FIG. 2C).
  • the stimulator population was fixed at an input of 40,000/well, with only the proportions of TpM and COS-7/SF varying.
  • FIG 2C shows the results of co-culturing F100 CD8+ polyclonal CTL line with TpM diluted in COS-7 cells, autologous primary SF and iSF. Neither primary nor iSF significantly affected the background levels or the sensitivity of the elispot assay.
  • Tp2 Following the screening of selected genes with BW002, BW013, and BW014 CD8+ CTL and D409 CTL clone #10.
  • Tp2 was identified through the screening of selected gene transfected autologous iSF with CTL from BW002 (BW2), BW014 (BW14) and D409 ( Figure 3).
  • Selected gene #5 was specifically recognized by all CTL and was named Tp2.
  • Tp2 transfected iSF were also specifically lysed by CTL as assessed by 51 Chromium release assays ( Figure 4). MHC restriction of Tp2 recognition was assessed by the introduction of blocking anti-BoLA class I mAbs. Anti-class I mAb resulted in the inhibition of lysis.
  • CTL target T. parva schizont antigens The identification of CTL target schizont antigen Tp2 was performed using the assay that employs immortalized skin fibroblast (iSF) cell lines. The effect of reduced DNA input upon subsequent recognition of target antigen transfected COS-7 cells and iSF were compared using Tpl and Tp2. The results, show recognition of target antigen transfected COS-7 or BW014 when only lng/well if target antigen DNA is used to transfect. The response increased with the concentration of target DNA peaking at peaking at 50ng/well. This result validated the use of test genes or cDNA pools at lOOng/well for transfection of both COS-7 and iSF.
  • iSF immortalized skin fibroblast
  • CD8+ T cells were sorted indirectly using a monoclonal antibody specific for bovine CD8 (IL-A105) followed by incubation with goat anti-mouse IgG microbeads (Miltenyi Biotec).
  • CD 14 monocytes were sorted directly by incubation with CD 14 microbeads (Miltenyi Biotec).
  • PBMC and CD8+ T cells were added to wells (2.5xl05/well) of coated/blocked Elispot plates and stimulated with autologous TpM (2.5x104/well) or Tp2 peptides (1 mg/ml final concentration). Purified monocytes were additionally added (2.5x104/well) to wells containing peptide and CD8+ T cells.
  • FIG. 5A, FIG. 5B, and FIG. 5C illustrate Tp2 specific CD8 + T cell responses following challenge of immune cattle.
  • Three ECF immune cattle (BW002, BW013, BW014), from which schizont specific CTL lines had been generated and shown to recognize Tp2, were challenged with a lethal dose of T. parva > (Muguga) sporozoites.
  • Peripheral blood was collected daily between day 7 - 13 post- challenge, and CD8+ T cells and monocytes purified.
  • Responses to Tp2 peptides containing previously identified CTL epitopes or control peptides were assessed by co-culturing CD8+ T cells and monocytes in the presence of 1 Og/ml peptide and measuring the release of IFN- gamma elispot.
  • Responses to autologous TpM were included as a positive control.
  • FIG. 6 shows the results of screening the Tp2 PepSet with BW002, BW013, BW014 CD8+ polyclonal CTL lines and D409 CTL clone#10.
  • the BW002 polyclonal line responded to a single peptide #43; (SEQ ED NO:8 CSHEELKKLGML) when the peptides were used at a concentration of lpg/ml.
  • BW0013 CTL responded significantly to two pairs of overlapping peptides; peptides #53 and 54 (SEQ ID NO: 9 (FKSSHGMGKVGKRY) and peptides #78 and 79 (SEQ ED NO: 11 FAQSLVCVLMKCRG).
  • BW014 CTL also responded to peptides #78 and 79 suggesting a common epitope. This. was not perhaps su ⁇ rising since BW013 and BW014 shared a sire.
  • the w7 restricted D409 CTL clone responded to peptides #77 and 78, SEQ ED NO: 12 (KCFAQSLVCVLMKC), suggesting an overlapping epitope.
  • SEQ ED NO: 12 SEQ ED NO: 12
  • all possible 9, 10 and 1 lmers covering SEQ ED NO: 9 FKSSHGMGKVGKRY
  • SEQ ED NO: 11 FKSSHGMGKVGKRY
  • FQSLVCVLMKCRG SEQ ED NO: 11
  • Tp2 epitope 4 Tp2.4
  • SEQ ED NO: 7 SHEELKKLGML
  • Tp2 epitope 3 Tp2.3
  • SEQ ED NO: 6, SEQ ED NO: 6,
  • Peptide libraries (Cleaved PepSets; Mimotopes, Clayton, Australia) were generated for the Tp2- HD6 restricted CTL epitope.
  • the PepSet libraries contained every 12mer, l lmer, lOmer and 9mer offset by 2 amino acids from the protein sequences.
  • the peptides were prepared by truncations of thel2mers at the N-terminus and were supplied lyophilized with each tube containing a nominal 12mer and the 9, 10, 1 lmer truncations with the same C terminus.
  • Peptides were dissolved in 400ml 50% (v/v) DNA synthesis grade acetonitrile/water (Applied Biosystems, Warrington, UK). To aid the dissolution, tubes were held in a sonicator water bath for 2 x 10 min. Peptides were aliquoted into labeled cryopreservation tubes (Greiner) and stored at — 20oC. For screening with CTL, peptides were prepared at lOmg/ml in complete RPMI-1640 and 10ml added to triplicate wells of an Elispot plate, coated, washed and blocked as described above.
  • FIG. 5A, FIG. 5B, and FIG. 5C show the TpM and Tp2 specific CD8+ T cell responses of BW002, BW014 and BW013.
  • CD8+ T cells responded specifically to the Tp2 peptides containing the previously identified CTL epitopes.
  • the responses increased rapidly exceeding the response to TpM and were. sustained over the period of observation (day 13 post-infection).
  • the frequency of Tp2 epitope responding CD8+ cells peaked around 1 :500 for both BW002 (FIG. 5A) and BWOl'4 (FIG. 5B), the Tp2 specific response of BW013 was significantly weaker (FIG. 5C).
  • the kinetics of this response is comparable to that previously described for schizont specific CTL in efferent lymph following challenge of immune cattle with T. parva sporozoites.
  • TpM were titrated in COS-7 or iSF and co-cultured with CTL in EFN- gamma elispot plates.
  • the stimulator population was fixed at an input of 40,000/well, with only the proportions of TpM and COS-7/SF varying. This cell input was adopted since it was thought to mirror the numbers of APC that would be co-cultured with CTL after transient transfection.
  • the elispot assay worked well with little background noise and met the sensitivity requirements when TpM were titrated in COS-7 cells but it was important to determine that the assay performed as well when the TpM were titrated in autologous SF. Neither primary nor iSF significantly affected the background levels or the sensitivity of the elispot assay.
  • the efficiencies of COS-7 and iSF transfection in 96 well TC plates was assessed using GFP as a reporter gene.
  • Nucleotide and deduced amino acid sequences and putative identity of the 5 candidate antigens Following confirmation of the candidates as CTL target antigens, the individual cDNA were sequenced and confirmed to be' of T. parva origin by. interrogating the T. parva genome sequence database. BLAST searches (Altschul et al 1990) of DNA and protein databases were performed and homologues of some of the antigens identified. SignalP (Nielsen et al (1997) Int J Neural Syst. 8, 581-99) and Tmpred (http://www.ch.embnet.org/software/TMPRED_form.html) analyses were conducted to predict the presence of a signal peptide and transmembrane domain. SEQ ED NO: 25-31 indicate the DNA and SEQ ED NO: 1-7, the deduced protein sequences of the five candidate antigens.
  • Tp2, Tp3, and Tp6 protein from recombinant DNA plasmids
  • the reading frames of T. parva candidate antigen genes were amplified by PCR using Taq polymerase (Promega, Madison, WI USA 53711) from the original full-length genes in their respective plasmids in pcDNA3. Both the forward and reverse primers contained restriction enzyme sites (Table 6). The product of the amplification of Tp2 was .8 Kb in size, as measured by PAGE electrohoresis.
  • SEQ ID NO: 45 SEQ ID NO: 46: (pTargeT) CGCGGATCCGCCACCATGAAATTAAATACTATC CGCCTCGAGGGATTTTTTATTATCGTCTGGAC Tp6 SEQ ID ' NO: 47: SEQ ID NO: 48: (pTargeT) CGCGCTAGCGCCGCCACCATGGCTCAGATTCCT GCGCTCGAGTTTATCAGTTGAGAGTAAGAGAG
  • the plasmids were transformed into E. coli strain DH5 (Life Technologies, Carlsbad, CA 92008, USA). All the plasmids were sequenced to ensure that they harbored no substitutions compared to the original genes. Purified plasmids were then used to transform competent BL21 DE3 bacterial cells. Single BL21 DE3 bacterial colonies bearing the recombinant plasmids were isolated and cultured in 2XYT (formula) at 37°C to an OD 6 oo of 0.6, and protein expression induced by addition of EPTG to a final concentration of ImM, and further cultured for 4 h. The cells were harvested by centrifugation at 4000 g for 20 min.
  • Recombinant proteins were isolated by either the native or denaturing nickel-nitrilotriacetic (Ni-NTA) agarose according to the manufacturer's protocol (Qiagen, 28159 Avenue Stanford, Valencia, CA91355), dialyzed against PBS and stored at -20 °C. Purified proteins were checked by checked on 12% SDS- PAGE gels (Laemmli, 1970) and western blot. Protein concentration was determined by the BCA Protein Assay reagent (PIERCE, Rockford, IL 61105, USA). Bacterial cells or purified proteins were applied to a 12% SDS-PAGE gel under denaturing conditions (Laemmli, 1970).
  • Ni-NTA nickel-nitrilotriacetic
  • Figure 15A indicates total protein from an aliquot of lysate and Figure 15B shows the presence of the Tp2-His-tag product as stained by the His- tag-labeled antibody.
  • Expression of Tp3 (16) and Tp6 (FIG 17) has been demonstrated using SDS-PAGE gel electrophoresis of protein from cultures of transfected E. coli.
  • Vaccination strategy Cattle trials were performed to assess the vaccine potential of identified CTL target antigens utilizing a recombinant canary pox virus (patented by Merial Ltd) and modified Vaccinia Virus Ankara (MVA) as an antigen delivery method.
  • FIG. 18 indicates the level of CTL responses to several Tp antigens, following CP (Canary Pox mediated)/MVA (modified Vaccinia Virus Ankara-vector mediated) immunization protocols.
  • the data indicates the production of T. parva antigen-specific CD8 (CTLs) in animals following immunization protocols with Canary Pox viral vectors, expressing T. parva antigen.
  • CTLs T. parva antigen-specific CD8
  • the response to Tp2 shows an increase in the number of spot forming cells (SFC)/well, over that shown in FIG. 20 (representing the phosphate buffered saline (PBS) control), for Day 7.
  • FIG. 19 the level of CTL responses to Tp2 antigen, following DNA/MVA immunization protocols is plotted.
  • the data indicates the production of T. parva antigen-specific CD8 (CTLs) in animals following immunization protocols with modified Vaccinia (Ankara) viral vectors, expressing T. parva antigen.
  • CTLs T. parva antigen- specific CD8
  • Ankara modified Vaccinia
  • FIG. 20 (representing the phosphate buffered saline (PBS) control), for Day 7 and Day 28.
  • the data in FIG. 20 represent control data for CP/MVA (FIG. 18) and DNA/MVA (FIG. 19) immunization protocols, where cattle were given phosphate buffered saline injections rather than Tp antigens.
  • the control experimental data for measuring the development of CTLs following immunization indicates a lack of T parva, antigen-specific CD8+ cells in PBS immunized animals. These trials tested the Tp2 antigen and involved use of 16 cattle in order to evaluate antigen-specific CTL responses and relate these to the outcome to challenge.
  • Animals were inoculated intramuscularly with 1 ml of vaccine (lxlO 8 pfu of virus) and boosted similarly after 4 weeks. Additional immunization trials to test cattle Following a further 4 weeks, cattle are subjected to an LD ⁇ o challenge with T.par a sporozoites by administering subcutaneously 1 ml of diluted stabilated infective material four weeks after immunization with the T. parva antigens, using Canary Pox and MVA vectors, and the DNA/MVA system. Animals are monitored parasitologically and clinically over a period of 2-3 weeks to determine whether the vaccine has protected. It is expected that the vaccines are protective. Additional immunological assays are performed following immunization and challenge.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Virology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention se rapporte à des compositions d'ADN, de protéines et de peptides p. ex. et à des procédés permettant d'identifier des antigènes intracellulaires de pathogènes qui stimulent les lymphocytes cytotoxiques animaux d'une manière spécifique des antigènes. Ces antigènes constituent des candidats de premier ordre pour la mise au point de vaccins servant à la prévention des maladies pathogènes intracellulaires telles que la theilériose (East Coast Fever).
PCT/US2004/030831 2003-09-22 2004-09-21 Antigenes pour vaccin contre la theileriose (east coast fever) WO2005030802A2 (fr)

Priority Applications (5)

Application Number Priority Date Filing Date Title
DE602004018347T DE602004018347D1 (de) 2003-09-22 2004-09-21 Antigene für einen east coast fever-impfstoff
MXPA06003169A MXPA06003169A (es) 2003-09-22 2004-09-21 Antigenos para una vacuna para la fiebre de la costa este.
AP2006003594A AP2006003594A0 (en) 2003-09-22 2004-09-21 Antigens for an east coast fever vaccine.
CA2539816A CA2539816C (fr) 2003-09-22 2004-09-21 Antigenes pour vaccin contre la theileriose (east coast fever)
EP04784633A EP1670820B1 (fr) 2003-09-22 2004-09-21 Antigenes pour vaccin contre la theileriose (east coast fever)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US50442803P 2003-09-22 2003-09-22
US60/504,428 2003-09-22
PCT/US2004/022605 WO2005007691A2 (fr) 2003-07-14 2004-07-14 Vaccin contre la theileriose bovine basee sur des antigenes schizont specifiques a ctl
USPCT/US04/022605 2004-07-14

Publications (2)

Publication Number Publication Date
WO2005030802A2 true WO2005030802A2 (fr) 2005-04-07
WO2005030802A3 WO2005030802A3 (fr) 2005-09-09

Family

ID=39930751

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/030831 WO2005030802A2 (fr) 2003-09-22 2004-09-21 Antigenes pour vaccin contre la theileriose (east coast fever)

Country Status (5)

Country Link
AP (1) AP2006003594A0 (fr)
CA (1) CA2539816C (fr)
MX (1) MXPA06003169A (fr)
WO (1) WO2005030802A2 (fr)
ZA (1) ZA200603167B (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5273744A (en) * 1989-06-14 1993-12-28 International Laboratory For Research On Animal Diseases Vaccines for the protection of animals against theileria infection

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5273744A (en) * 1989-06-14 1993-12-28 International Laboratory For Research On Animal Diseases Vaccines for the protection of animals against theileria infection

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL [Online] 2 January 2003 (2003-01-02), "EST627151 TpMugugaSh01 Theileria parva cDNA clone TPFAC45, mRNA sequence." XP002330787 retrieved from EBI accession no. EM_PRO:BQ543524 Database accession no. BQ543524 *
DATABASE EMBL [Online] 2 January 2003 (2003-01-02), "EST627152 TpMugugaSh01 Theileria parva cDNA clone TPFAC45, mRNA sequence." XP002330788 retrieved from EBI accession no. EM_PRO:BQ543525 Database accession no. BQ543525 *
DATABASE EMBL [Online] 2 January 2003 (2003-01-02), "EST627619 TpMugugaSh01 Theileria parva cDNA clone TPFAF71, mRNA sequence." XP002330785 retrieved from EBI accession no. EM_PRO:BQ543992 Database accession no. BQ543992 *
DATABASE EMBL [Online] 2 January 2003 (2003-01-02), "EST627620 TpMugugaSh01 Theileria parva cDNA clone TPFAF71, mRNA sequence." XP002330786 retrieved from EBI accession no. EM_PRO:BQ543993 Database accession no. BQ543993 *
DATABASE EMBL [Online] 2 January 2003 (2003-01-02), "EST628751 TpMugugaSh01 Theileria parva cDNA clone TPFAN22, mRNA sequence." XP002318733 retrieved from EBI accession no. EM_EST:BQ545112 Database accession no. BQ545112 *
GERHARDS JOACHIM ET AL: "Sequence and expression of a 90-kilodalton heat-shock protein family member of Theileria parva" MOLECULAR AND BIOCHEMICAL PARASITOLOGY, vol. 68, no. 2, 1994, pages 235-246, XP002310752 ISSN: 0166-6851 *
MCKEEVER DECLAN J ET AL: "Novel vaccines against Theileria parva: Prospects for sustainability" INTERNATIONAL JOURNAL FOR PARASITOLOGY, vol. 28, no. 5, May 1998 (1998-05), pages 693-706, XP002310753 ISSN: 0020-7519 *
MORRISON W IVAN ET AL: "Theileriosis: Progress towards vaccine development through understanding immune responses to the parasite" VETERINARY PARASITOLOGY, vol. 57, no. 1-3, 1995, pages 177-187, XP002310754 ISSN: 0304-4017 cited in the application *

Also Published As

Publication number Publication date
CA2539816A1 (fr) 2005-04-07
AP2006003594A0 (en) 2006-04-30
WO2005030802A3 (fr) 2005-09-09
ZA200603167B (en) 2008-03-26
MXPA06003169A (es) 2007-02-19
CA2539816C (fr) 2012-01-03

Similar Documents

Publication Publication Date Title
Dickerson et al. Ichthyophthirius multifiliis: a model of cutaneous infection and immunity in fishes
Ouaissi et al. The Trypanosoma cruzi Tc52-released protein induces human dendritic cell maturation, signals via Toll-like receptor 2, and confers protection against lethal infection
US7166291B2 (en) Allergenic proteins and peptides from dog dander and uses therefor
KR100358271B1 (ko) 보호성면역반응및il-12생산의자극과증강을위한화합물및방법
EP0567512A1 (fr) Proteine ph-20 de surface de cellule spermatique et son utilisation dans un vaccin contraceptif
EP1869073B1 (fr) Polypeptides de leishmania major, polynucleotides codant ces polypeptides, et leur applications a des fins vaccinales, therapeutiques ou diagnostiques
SA110310855B1 (ar) استخدام مصدر l3 و/ أو l5 كلقاح أو كوسيلة تشخيصية لمرض طفيلي
WO2014160985A2 (fr) Vaccins comprenant des polypeptides de leishmania pour le traitement et le diagnostic de la leishmaniose
EP1670820B1 (fr) Antigenes pour vaccin contre la theileriose (east coast fever)
O'Dea et al. Processing of the Plasmodium chabaudi chabaudi AS merozoite surface protein 1 in vivo and in vitro
CA2539816C (fr) Antigenes pour vaccin contre la theileriose (east coast fever)
US20040171821A1 (en) Anti-arthropod vector vaccines method of selecting and uses thereof
EP1668029B1 (fr) Vaccin contre la theileriose bovine basee sur des antigenes schizont specifiques a ctl
KR100250944B1 (ko) 톡소플라스마 곤디(toxoplasma gondii)의 단백질 항원의 클로닝 및 발현
Morrison et al. Immunobiology of Infections with Theileria parva in Cattle
US20210338791A1 (en) Immunogenic composition for paratuberculosis
James Application of exoantigens of Babesia and Plasmodium in vaccine development
MXPA06001765A (en) East cost fever vaccine based on ctl-specific schizont antigens
US20030104003A1 (en) Novel surface protein of the malaria parasite plasmodium falciparum
Smith¹ et al. Serological Recognition of Toxoplasma gondii Cyst Antigens JE Smith¹, G. McNeil², YW Zhang³, S. Dutton4, G. Biswas-Hughes¹, and P. Appleford¹
AU735498B2 (en) Parasite antigens
CA2331833A1 (fr) Antigenes de parasite
EP1343524A1 (fr) Vaccin a base d'un facteur de penetration cellulaire provenant d'un parasite apicomplexa
DAFÜR et al. VACCINAL, THERAPEUTICAL AND DIAGNOSTIC APPLICATIONS THEREOF
CA2503932A1 (fr) Polypeptides de leishmania major et polynucleotides encodant lesdits polypeptides, et applications vaccinales, therapeutiques et diagnostiques connexes

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: PA/a/2006/003169

Country of ref document: MX

Ref document number: 2539816

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2004784633

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2006/03167

Country of ref document: ZA

Ref document number: 200603167

Country of ref document: ZA

WWE Wipo information: entry into national phase

Ref document number: AP/P/2006/003594

Country of ref document: AP

WWP Wipo information: published in national office

Ref document number: 2004784633

Country of ref document: EP