WO2005023987A2 - Cell-based assays for determining drug action - Google Patents

Cell-based assays for determining drug action Download PDF

Info

Publication number
WO2005023987A2
WO2005023987A2 PCT/US2004/028970 US2004028970W WO2005023987A2 WO 2005023987 A2 WO2005023987 A2 WO 2005023987A2 US 2004028970 W US2004028970 W US 2004028970W WO 2005023987 A2 WO2005023987 A2 WO 2005023987A2
Authority
WO
WIPO (PCT)
Prior art keywords
cells
cell
biomap
systems
agent
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2004/028970
Other languages
English (en)
French (fr)
Other versions
WO2005023987A3 (en
Inventor
Ellen L. Berg
Jennifer Melrose
Eric J. Kunkel
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bioseek LLC
Original Assignee
Bioseek LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bioseek LLC filed Critical Bioseek LLC
Priority to CA002576406A priority Critical patent/CA2576406A1/en
Priority to AU2004271183A priority patent/AU2004271183A1/en
Priority to JP2006526218A priority patent/JP2007503841A/ja
Priority to US10/570,081 priority patent/US20070072246A1/en
Priority to EP04788596A priority patent/EP1668361A4/en
Publication of WO2005023987A2 publication Critical patent/WO2005023987A2/en
Publication of WO2005023987A3 publication Critical patent/WO2005023987A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5041Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects involving analysis of members of signalling pathways
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5023Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on expression patterns
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B25/00ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression
    • G16B25/10Gene or protein expression profiling; Expression-ratio estimation or normalisation
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B40/00ICT specially adapted for biostatistics; ICT specially adapted for bioinformatics-related machine learning or data mining, e.g. knowledge discovery or pattern finding
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B40/00ICT specially adapted for biostatistics; ICT specially adapted for bioinformatics-related machine learning or data mining, e.g. knowledge discovery or pattern finding
    • G16B40/30Unsupervised data analysis
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B5/00ICT specially adapted for modelling or simulations in systems biology, e.g. gene-regulatory networks, protein interaction networks or metabolic networks
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B25/00ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression

Definitions

  • the present invention relates generally to the analysis of gene and drug function, the identification of biological pathways, and more particularly to methods for identifying and characterizing drugs by mechanism of action, defining signal transduction pathway architecture, finding relationships between signaling components, and identifying drug targets and drugs that affect those targets.
  • the invention therefore relates to the fields of biology, molecular biology, chemistry, medicinal chemistry, pharmacology, and medicine.
  • Useful assays for measuring biological activities give robust and reproducible changes in a measurable parameter in the presence of a test article.
  • such assays are often either biochemical assays, such as kinase or enzyme assays, or cell-based assays designed to measure the activity of a specific target or pathway.
  • cell-based assays include gene reporter assays, NFKB translocation assays, and the like.
  • Features that distinguish typical cell based assays in drug discovery include an assay design that emphasizes the activity of a single specific target or pathway; use of a single cell type, typically a cell line; and the measurement of a single robust readout, e.g. a calcium signal, or the like.
  • compositions and methods are provided for the classification of biologically active agents according to their effect on human biology, through the use of complex, primary human cell-based disease models in scalable assay formats.
  • the systems of the invention utilize the simultaneous activation of multiple signaling pathways to generate and identify patterns of expression (or "profiles") of physiologically important cell surface and secreted molecules on primary cells in one or more complex environments, including environments simulating inflammation.
  • the assay system is robust, reproducible, responsive to and discriminatory of the activities of a large number of agents, including biological factors, compounds, and genes.
  • biologically active agents induce characteristic response profiles in systems comprising primary human cells in complex, biologically-relevant environments, which profiles can be captured by measuring a relatively small number of physiologically significant protein readouts. Such readout parameters are selected for their information content and relevance to the physiological process of interest.
  • combinations of multiple cell types are utilized, e.g. combinations of different primary cell types, primary cell types in combination with cell lines, etc.
  • Systems encompassing multiple cell types not only respond to perturbations of each cell type's intracellular signaling networks, but also to inhibition of pathways of communication between cells. Thus, systems comprising multiple cell types can provide additional coverage of biological function space.
  • readout information is combined in multisystem analysis. The profiles obtained from multiple systems are combined in order to provide enhanced resolution for agent classification.
  • the clustering results were used in a non-biased fashion to determine the order of presentation of compounds (a) and (b).
  • Raw correlation values are in Table 1.
  • FIG. 3 A complex PBMC and endothelial cell co-culture system expands the coverage of biological activities relevant to inflammation.
  • PBMC were incubated with endothelial cells and treated with SAg to activate T cell receptor-dependent responses,
  • (a) Heat map of mean log parameter expression ratios from 3 independent experiments (n 3 replicates per experiment) showing the increase (green), decrease (red) or lack of change (black) of individual parameter levels. Color saturation reflects the magnitude of the drug effect (see scale, bottom),
  • the dendrogram at the right shows the results of hierarchical clustering of the mean profile data (log expression ratio averaged for replicate experiments). This tree was used to determine the order of presentation of compounds in (a) and (b). Raw correlation values are in Table 2.
  • FIG. 4 Multi-system analysis increases detection and discrimination of compounds.
  • FIG. 5 Drug classification by homology of function across multiple complex systems. 48 compounds were subjected to homology of function classification using the concatenated profiles from three systems (3C, SAg, and LPS).
  • (a) Heat map of mean log parameter expression ratios from three experiments (n 3 replicates in each experiment), showing the increase (green), decrease (red) or lack of change (black) of individual parameters in each system,
  • FIG. 6 is a series of graphs depicting profiles for representative compounds (the p38 MAPK inhibitor PD169316, the CKII/NF- ⁇ B inhibitor apigenin, the HMG-CoA inhibitor atorvastatin, the steroid dexamethasone, the NF-AT inhibitor cyclosporin, the phosphodiesterase 4 inhibitor R(-)rolipram, the MEK inhibitor UO126, and the c-Raf and p38 inhibitor ZM336372) in all three systems examined (3C, SAg, LPS) at multiple doses (0.03, 0.1 , 0.3, 1.0, 3.0, 10.0 ⁇ M). The highest active, but non-toxic, dose was used in all figures. Similar dose responses and toxicity studies were done on each drug examined.
  • FIG. 7 BioMAP parameters characterizing TH1 or TH2 cells after one or two polarizations.
  • CD4+ peripheral blood T cells isolated by negative selection were polarized for two rounds under TH1 or TH2 conditions.
  • a panel of markers (abscissa) of TH1 or TH2 differentiation were used to characterize the resulting T cell populations and determine the best parameters for identifying differences between TH1 and TH2 cells after each polarization.
  • FIG. 8 Effects of drugs on TH1 and TH2 polarization.
  • CD4+ peripheral blood T cells isolated by negative selection were polarized for two rounds under TH1 or TH2 conditions.
  • drugs or solvent controls were added to the culture every other day (days 1 , 3, and 5).
  • a panel of markers (abscissa of each plot) was used to characterize the TH1 or TH2 state of the CD4+ population after the second polarization.
  • Data has been normalized to the percentage of cells expressing the given marker under media only conditions (short dashed line). Circled data points represent normalized ratios falling outside the 95% confidence interval for the solvent control data (long dashed line).
  • TH1 marker changes below 1 or TH2 marker changes above 1 for the TH1 polarization condition signify a shift in the population towards the TH2 state.
  • TH1 markers above 1 or TH2 markers below 1 for the TH2 polarization condition signify a shift of the population towards the TH1 state.
  • anti-IL-12 greatly impairs the ability of cells to polarize toward the TH1 state, but has little effect on the polarization toward the TH2 state since it is already present in the culture for TH2 polarization. Data is representative of two experiments.
  • FIG. 9 Effects of drugs LPS-stimulated monocyte cytokine secretion.
  • CD14+ monocytes were enriched by adherence to 24-well plastic tissue culture dishes for 1 hr and unbound cells were removed.
  • Monocytes were stimulated with 1 ⁇ g/ml LPS for 5 hr in the presence of 2 ⁇ M monensin (a secretion inhibitor).
  • Drugs or solvent control (DMSO) at the indicated concentrations were added 15 minutes before LPS stimulation and were present for the entire 5 hr.
  • Annexin V staining indicates apoptotic cells.
  • Intracellular cytokines were detected by fixing and permeabilizing the cells after scraping them off of the culture dish. Data is presented as the percentage of cells staining positive for a particular parameter. Data is representative of three experiments performed on different days.
  • Applications of the methods of the invention may include large scale gene function screening and target validation, integration of biology and pathophysiology into target validation and drug development, improving the efficiency of drug development programs; and large scale characterization and analysis of environment- and cell differentiation-dependent biological responses.
  • a "system" of the invention comprises one or more cell types, factors, and a test agent for classification analysis.
  • a system will further comprise samples of cells and factors, lacking the test agent, which samples serve as a control.
  • the system may also comprise samples of cells and factors, in the presence of a known agent, which samples also serve as a control. Samples within the system may comprise different combinations of the factors. Each said sample may be present in replicate, so as to control for biological variation.
  • the cellular response is measured by the evaluation of parameters. The change in parameters resulting from the presence of an agent is compared with controls and/or datasets obtained from other agents, particularly where such agents include those with known biological activities.
  • the target of that effect and the mechanism of action can likewise be determined.
  • the function of the compounds can be compared, the pathways affected identified and side effects predicted.
  • the results can be entered into a data processor to provide a biomap dataset.
  • the biomap will include the parameter readouts from one or more systems.
  • the biomap is prepared from values obtained by measuring parameters or markers of the cells in the presence and absence of different agents in a system, as well as comparing the presence of the agent of interest and at least one other state, usually the control state, which may include the state without agent or with a different agent.
  • the parameters include cellular products or epitopes thereof, as well as functional states, whose levels vary in the presence of the factors.
  • the results are normalized against a standard, usually a "control value or state,” to provide a normalized data set.
  • Values obtained from test conditions can be normalized by subtracting the control values from the test values, and dividing the corrected test value by the corrected stimulated control value. Other methods of normalization can also be used; and the logarithm or other derivative of measured values or ratio of test to stimulated or other control values may be used. Data is normalized to control data on the same cell type under control conditions, but a biomap may comprise normalized data from one, two or multiple cell types and assay conditions.
  • the biomap will comprise values of the levels of at least two different parameters from samples in the system, and may comprise values from at least about 3, at least about 4, and not more than about 20 parameters.
  • the results provided herein demonstrate that small numbers of parameters (pauciparameter analysis) can be highly informative, where the number of parameters may be less than about 10, and more than about 3, usually more than about 5.
  • the biomap may also include the parameter values for multiple systems, where a first biomap, a second biomap, a third biomap, etc. are compared. Compilations of biomaps are developed that provide the values for a sufficient number of alternative systems to allow comparison of values. This proves to be a particularly powerful approach to increase discrimination and classification of diverse biological activities.
  • Mathematical systems can be used to compare biomaps, and to provide quantitative measures of similarities and differences between them.
  • the biomaps in the database can be analyzed by pattern recognition algorithms or clustering methods (e.g. hierarchical or k-means clustering, etc.) that use statistical analysis (correlation coefficients, etc.) to quantify relatedness of biomaps. These methods can be modified (by weighting, employing classification strategies, etc.) to optimize the ability of a biomap to discriminate different functional effects.
  • Profile data e.g. averaged, normalized, log normalized, etc. may be ordered in a correlation plot by coupling multidimensional scaling and pivoting to move high correlations toward the diagonal.
  • Statistical analyses allow objective evaluation of the significance of all pairwise correlations between agent activities. Multidimensional scaling may be used to visualize the relationships between agents.
  • At least one factor is present in the system, usually at least two factors, more usually at least three factors, and the system may comprise at least four factors or more. Numerous factors are known that induce pathways in cells that are responsive to the factor. For the most part, factors bind to cell surface receptors, although other receptors may be involved, such as receptors at the nuclear membrane. In addition, where a factor is able to penetrate the surface membrane, through passive or active transport or through endocytosis, the factor may bind to components of the membrane, cytosol or an organelle, e.g. nucleus.
  • the factors selected in a combination are related to a physiological state of interest, e.g. pro-inflammatory response; anti-inflammatory response; angiogenesis; developmental pathways of interest; and the like.
  • these factors can include cytokines, chemokines, and other factors, e.g. growth factors, such factors include interleukins; GM-CSF, G-CSF, M-CSF, TGF, FGF, EGF, TNF- ⁇ , GH, corticotropin, melanotropin, ACTH, etc., extracellular matrix components, surface membrane proteins, such as integrins and adhesins, and other components that are expressed by the targeted cells or their surrounding milieu in vivo.
  • Combinations of interest include the set of factors associated with endothelial cells, e.g. EGF, FGF, VEGF, insulin, etc., cytokines, such as the interleukins, including IL-1 IL-3, IL- 4, IL-8 and IL-13; interferons, including IFN- ⁇ , IFN- ⁇ , IFN- ⁇ ; chemokines; TNF- ⁇ , TGF ⁇ , proangiogenic and anti-angiogenic factors, etc.
  • EGF endothelial cells
  • FGF e.g. EGF, FGF, VEGF, insulin, etc.
  • cytokines such as the interleukins, including IL-1 IL-3, IL- 4, IL-8 and IL-13
  • interferons including IFN- ⁇ , IFN- ⁇ , IFN- ⁇
  • chemokines including TNF- ⁇ , TGF ⁇ , proangiogenic and anti-angiogenic factors, etc.
  • a chronic Th2 assay combination can be defined by the culture of responsive cells with TNF- ⁇ and/or IL-1 and IL-4 for 24 hours. Inflammation in chronic Th2 environments, such as asthma, is characterized by the presence of TNF- ⁇ , IL-1 and IL-4, but not IFN- ⁇ .
  • T cell cultures may include combinations of anti-CD3 + IL-2 +/- IL-4 +/- IFN- ⁇ +/- IL-12 +/- anti-IL-4 or anti-IFN- ⁇ ).
  • the disease environment in psoriasis includes IL-12, IFN- ⁇ and TNF- ⁇ .
  • the disease environment in Crohn's disease includes IL-1 , TNF- ⁇ , IL-6, IL-8, IL-12, IL-18, and IFN- ⁇ .
  • the disease environment in rheumatoid arthritis includes TNF- ⁇ , IL1 , IL-6, IL-10, IL-15, MIP.1 , MCP-1 , and TGF ⁇ .
  • the disease environment in asthma includes IL-1 ⁇ , IL-4, IL-5, IL-6 and GM-CSF.
  • Macrophages are responsive to IL-4 and other IL factors, M- CSF, and GM-CSF.
  • Cancer cells may be used in a system to investigate immune responsiveness, neoplastic proliferation, angiogenesis; and the like, where factors of interest include chemokines; angiogenic factors; cytokines, such as IL-10; steroids, e.g. estrogen, progesterone; testosterone; anti-Her-2/neu; epidermal growth factor; FGF; IGF-I; etc.
  • Hematopoiesis environments may include flt-2; stem cell factor; IL-6; IL-3; IL-7; LIF; etc.
  • Systems for investigating pro- and anti-inflammatory systems may also include acidantigens as a stimulus of the T cell receptor complex, or lipopolysaccharide (LPS) as a stimulator of toll receptor signaling (LPS system).
  • Factors of interest include IL-1 ⁇ ; IL-1 ⁇ ; IL- 2; IL3; IL-4; IL-5; IL-6; IL-7; IL-8; IL-9; IL-10; IL-11 ; IL-12; IL-13; IL-18; M-CSF; G-CSF; GM- CSF; MCP-1 ; MIG; IFN- ⁇ ; IFN- ⁇ ; IFN- ⁇ ; TGF ⁇ ; histamine; PHA, anti-CD3; anti-CD28, ConA; anti-IL-1 , anti-IL-2, anti-TNF- ⁇ , anti-IFN- ⁇ , anti-IL-12; anti-IL-4; anti-TGF ⁇ ; etc.
  • the assay system comprises one or more primary cells.
  • primary cell refers to those cells present in the initial cell cultures established from a tissue, and refers to cells derived from subsequent passages, usually less than about 10 passages, and preferably less than about 5 passages.
  • Adherent cells in primary cultures usually grow until they cover the culture dish surface, i.e. they show contact inhibition.
  • Primary cells cannot normally be grown in culture indefinitely.
  • Those cell lines that proliferate indefinitely in culture may be referred to as “immortal” or “immortalized cell lines”, and for the purposes of the present invention are distinct from primary cells.
  • Some immortalized cell lines are tumorigenic, and may be referred to as "transformed" cell lines. Although such permanent cell lines have been particularly useful for many types of experiments, they are less preferred for the methods of the present invention.
  • cell types find use in the systems of the present invention. Included, without limitation, are cells involved in inflammatory responses. Such cells may include endothelial cells, e.g. primary microvasculature, HUVEC, aortic endothelial cells, etc.; blood mononuclear cells or a subset of cells derived therefrom, e.g. T cells, B cells, natural killer cells, monocytes, macrophages, etc.; blood polymorphonuclear cells or a subset of cells derived therefrom, e.g.
  • endothelial cells e.g. primary microvasculature, HUVEC, aortic endothelial cells, etc.
  • blood mononuclear cells or a subset of cells derived therefrom e.g. T cells, B cells, natural killer cells, monocytes, macrophages, etc.
  • blood polymorphonuclear cells or a subset of cells derived therefrom e.g.
  • T cells can be selected for Th1/Th2 polarization; CD4+; CD8+; cells in the B cell lineage may be divided into plasma cells, B cells, pre-B cells; etc.
  • the assay system may comprise two or more cell types, which may be primary cells, cell lines, or combinations thereof.
  • Systems encompassing multiple cell types not only respond to perturbations of each cell type's intracellular signaling networks, but also to inhibition of pathways of communication between cells. Thus, systems comprising multiple cell types can provide additional coverage of biological function space.
  • Combinations of interest include, without limitation, endothelial cells and leukocytes; leukocytes and antigen presenting cells; cancer cells and endothelial cells; cancer cells, antigen presenting cells and leukocytes; mesenchymal stem cells or hematopoietic stem cells and stromal cells; thymocytes and thymic epithelial cells and/or cortical dendritic cells; neural stem cells and endothelial cells; and the like.
  • polynucleotides are added to one or more of the cells in a panel in order to alter the genetic composition of the cell.
  • the output parameters are monitored to determine whether there is a change in phenotype affecting particular pathways.
  • genetic sequences are identified that encode or affect expression of proteins in pathways of interest, particularly pathways associated with aberrant physiological states.
  • Assay combinations are provided that simulate physiological cell states of interest, particularly physiological ceil states in vivo, usually using the same type of cells or combinations of cells. These cell cultures are created by the addition of a sufficient number of different factors to provoke a response that simulates cellular physiology of the state of interest and to allow for the status of cells in culture to be determined in relation to a change in an environment.
  • the state of interest will normally involve a plurality of pathways where the pathways regulate a plurality of parameters or markers identifying a phenotype associated with the state of interest.
  • the phenotype can be generated by including a plurality of factors that induce pathways affecting the production of the phenotype by the up or down regulation of formation of the parameters as detectable products or may be based on the nature of the cell, e.g. neoplastic primary cells, cell lines, etc., where the factors enhance the response of the cells in vitro to more closely approximate the response of interest.
  • the factors are naturally occurring compounds, e.g. known compounds that have surface membrane receptors and induce a cellular signal that results in a modified phenotype, or synthetic compounds that mimic the naturally occurring factors.
  • the factors will act intracellularly by passing through the cell surface membrane and entering the cytosol with binding to components in the cytosol, nucleus or other organelle.
  • the nature and number of parameters measured generally reflects the response of a plurality of pathways.
  • the subject approach provides for robust results having enhanced predictability in relation to the physiological state of interest.
  • the results may be compared to the basal condition and/or the condition in the presence of one or more of the factors, particularly in comparison to all of the factors used in the presence and absence of agent.
  • the effects of different environments are conveniently provided in biomaps, where the results can be mathematically compared.
  • the genetic agents are added to cells, which are placed in a medium where one or more factors may be present to provide a desired environment, namely an environment of interest, such as a physiological environment involved with an aberrant, e.g. diseased, state. Parameters associated with the pathways related to the physiological state are monitored. Where the parameters show a pattern indicating the up or down regulation of a pathway, the genetic agent is deduced to encode or affect the expression of a member of the pathway. In this way one can determine the role a gene plays in the physiological state of interest, as well as define targets for therapeutic application.
  • an environment of interest such as a physiological environment involved with an aberrant, e.g. diseased, state.
  • Parameters associated with the pathways related to the physiological state are monitored. Where the parameters show a pattern indicating the up or down regulation of a pathway, the genetic agent is deduced to encode or affect the expression of a member of the pathway. In this way one can determine the role a gene plays in the physiological state of interest, as well as define targets for therapeutic application
  • the simulation will usually include at least three different regulated features (parameters) shared with in vivo cell counterparts in normal or diseased states.
  • the simulation may include a cell culture system that allows discrimination of modifications in at least three different signaling pathways or cell functions operative in vivo under conditions of interest.
  • the results can be entered into a data processor to provide a biomap dataset.
  • Algorithms are used for the comparison and analysis of biomaps obtained under different conditions. The effect of factors and agents is read out by determining changes in multiple parameters in the biomap.
  • the biomap will include the results from assay combinations with the agent(s), and may also include one or more of the control state, the simulated state, and the results from other assay combinations using other agents or performed under other conditions.
  • the results may be presented visually in a graph of a biomap, and can include numbers, graphs, color representations, etc.
  • Parameters are quantifiable components of cells, particularly components that can be accurately measured, desirably in a high throughput system.
  • a parameter can be any cell component or cell product including cell surface determinant, receptor, protein or conformational or posttranslational modification thereof, lipid, carbohydrate, organic or inorganic molecule, nucleic acid, e.g. mRNA, DNA, etc. or a portion derived from such a cell component or combinations thereof.
  • Preferred parameters are informative, that is they have a robust modulation in response to one or more individual factors or agents of the system; and additionally may have potential or known relevance to the system, e.g. inflammation, cancer biology, etc.
  • the set of parameters selected is sufficiently large to allow distinction between agents, while sufficiently selective to fulfill computational requirements.
  • a parameter may be defined by a specific monoclonal antibody or a ligand or receptor binding determinant.
  • Parameters may include the presence of cell surface molecules such as CD antigens (CD1-CD247), cell adhesion molecules including ⁇ 4 ⁇ 7 and other integrins, selectin ligands, such as CLA and Sialyl Lewis x, and extracellular matrix components.
  • Parameters may also include the presence of secreted products such as lymphokines, including IL-2, IL-4, IL-6, growth factors, etc.
  • T cells these parameters may include IL-1 R, IL-2R, IL4R, IL-12R ⁇ , CD45RO, CD49E, tissue selective adhesion molecules, homing receptors, chemokine receptors, CD26, CD27, CD30 and other activation antigens. Additional parameters that are modulated during activation include MHC class II; functional activation of integrins due to clustering and/or conformational changes; T cell proliferation and cytokine production, including chemokine production. Of particular importance is the regulation of patterns of cytokine production, the best-characterized example being the production of IL-4 by Th2 cells, and interferon- ⁇ by Th1 T cells.
  • parameters include ICAM-1 , E-selectin, IL-8, HLA-DR, VCAM1 , GRO- ⁇ , ENA-78, etc.
  • MIG CLCX9
  • IP-10 Eotaxin- 1 ; Eotaxin-3; MCP-1 ; RANTES; Tare; CD31 ; alphavbeta3; P-selectin (CD62P); CD34; CD14 CD40; CD38; CD55; CD69; CXCR2; CD95; fibronectin; HLA-ABC; GROalpha; MCP-4; TAPA- 1 ; integrin alphaVbeta ⁇ ; E-Cadherin; CD44; von Willebrand factor; CD3; CD25; CD141 CD142; CD143; CD151 ; MCP-1 ; cutaneous lymphocyte antigen (CLA); CXCR3; CCR3; TNF ⁇ ; IFN- ⁇ ; IL-2; IL-4; IL-1 alpha; M-CSF; integrin alpha4beta7; integrin alphaEbeta7; L-selectin EGF-R;
  • CLA cutaneous lymphocyte antigen (C
  • integrin ⁇ 6 ⁇ integrin ⁇ 6 ⁇
  • integrin ⁇ v laminin 5; urokinase-type plasminogen activator receptor (uPAR); TNFR-I; lactate dehydrogenase (LDH); mitochondrial cytochrome c; APO2.7 epitope; active caspase-3; Ki-67; and PCNA.
  • uPAR urokinase-type plasminogen activator receptor
  • LDH lactate dehydrogenase
  • mitochondrial cytochrome c APO2.7 epitope
  • active caspase-3 active caspase-3
  • Ki-67 and PCNA.
  • Agents of interest include drugs and genes, which induce characteristic signature profiles.
  • drugs and genes which induce characteristic signature profiles.
  • Those of skill in the art will appreciate that, while the invention is illustrated with a number of important genes and drugs relating to inflammation and its control, the invention can be applied to any gene or drug.
  • the completion of the human genome has made available the full complement of human genes and, in combination with modern approaches to chemical diversity, has opened up unparalleled opportunities for advances in biology and medicine.
  • Candidate agents of interest are biologically active agents that encompass numerous chemical classes, primarily organic molecules, which may include organometallic molecules, inorganic molecules, genetic sequences, etc.
  • An important aspect of the invention is to evaluate candidate drugs, select therapeutic antibodies and protein-based therapeutics, with preferred biological response functions.
  • Candidate agents comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, frequently at least two of the functional chemical groups.
  • the candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
  • Candidate agents are also found among biomolecules, including peptides, polynucleotides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.
  • pharmacologically active drugs include chemotherapeutic agents, anti-inflammatory agents, hormones or hormone antagonists, ion channel modifiers, and neuroactive agents.
  • chemotherapeutic agents include chemotherapeutic agents, anti-inflammatory agents, hormones or hormone antagonists, ion channel modifiers, and neuroactive agents.
  • exemplary of pharmaceutical agents suitable for this invention are those described in, "The Pharmacological Basis of Therapeutics," Goodman and Gilman, McGraw-Hill, New York, New York, (1996), Ninth edition, under the sections: Drugs Acting at Synaptic and Neuroeffector Junctional Sites; Drugs Acting on the Central Nervous System; Autacoids: Drug Therapy of Inflammation; Water, Salts and Ions; Drugs Affecting Renal Function and Electrolyte Metabolism; Cardiovascular Drugs; Drugs Affecting Gastrointestinal Function; Drugs Affecting Uterine Motility; Chemotherapy of Parasitic Infections; Chemotherapy of Microbial Diseases
  • Agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds, including biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.
  • the term "genetic agent” refers to polynucleotides and analogs thereof, which agents are tested in the screening assays of the invention by addition of the genetic agent to a cell.
  • the introduction of the genetic agent results in an alteration of the total genetic composition of the cell.
  • Genetic agents such as DNA can result in an experimentally introduced change in the genome of a cell, generally through the integration of the sequence into a chromosome. Genetic changes can also be transient, where the exogenous sequence is not integrated but is maintained as an episomal agents.
  • Genetic agents, such as antisense oligonucleotides can also affect the expression of proteins without changing the cell's genotype, by interfering with the transcription or translation of mRNA. The effect of a genetic agent is to increase or decrease expression of one or more gene products in the cell.
  • Introduction of an expression vector encoding a polypeptide can be used to express the encoded product in cells lacking the sequence, or to over-express the product.
  • Various promoters can be used that are constitutive or subject to external regulation, where in the latter situation, one can turn on or off the transcription of a gene.
  • These coding sequences may include full-length cDNA or genomic clones, fragments derived therefrom, or chimeras that combine a naturally occurring sequence with functional or structural domains of other coding sequences.
  • the introduced sequence may encode an anti-sense sequence; be an anti-sense oligonucleotide; encode a dominant negative mutation, or dominant or constitutively active mutations of native sequences; altered regulatory sequences, etc.
  • sequences derived from the host cell species include, for example, genetic sequences of pathogens, for example coding regions of viral, bacterial and protozoan genes, particularly where the genes affect the function of human or other host cells. Sequences from other species may also be introduced, where there may or may not be a corresponding homologous sequence.
  • a large number of public resources are available as a source of genetic sequences, e.g. for human, other mammalian, and human pathogen sequences.
  • a substantial portion of the human genome is sequenced, and can be accessed through public databases such as Genbank. Resources include the uni-gene set, as well as genomic sequences. For example, see Dunham et al. (1999) Nature 402, 489-495; or Deloukas et al. (1998) Science 282, 744- 746.
  • cDNA clones corresponding to many human gene sequences are available from the IMAGE consortium.
  • the international IMAGE Consortium laboratories develop and array cDNA clones for worldwide use.
  • the clones are commercially available, for example from Genome Systems, Inc., St. Louis, MO. Methods for cloning sequences by PCR based on DNA sequence information are also known in the art.
  • Cytokines, antibodies, and reagents Recombinant human IFN- ⁇ , TNF- ⁇ , and IL-1 ⁇ were from R&D Systems (Minneapolis, Minnesota).
  • Unconjugated mouse antibodies against human VCAM-1 (mlgGi), CD31 (mlgGi), HLA-DR (mlgG 2a ), CD3 (mlgGi), CD40 (mlgGi), CD69 (mlgGi), MIG (mlgGi), MCP- 1 (mlgGi), CD14 (mlgGi), IL-1 ⁇ (mlgGi), and CD38 (mlgGi) were obtained from BD Biosciences (San Jose, California). Unconjugated mouse antibodies against IL-8 (mlgGi) and M-CSF (mlgGi) were obtained from R&D Systems. Polyclonal goat antibodies against TNF- ⁇ , IFN- ⁇ , and IL-1 ⁇ and control goat IgG were obtained from R&D Systems.
  • Recombinant human IL-1ra, and IL-10 were from R&D Systems.
  • Ro-20-1274, R(-)rolipram, DRB, PP2, and PP1 were from BIOMOL (Plymouth Meeting, Pennsylvania).
  • Mycophenolic acid, WHI-P131 , ZM39923, wortmannin, SC-560, NS-398, LM1685, AG490, AG126, SC68376, and SB239063 were from Calbiochem.
  • ZM336372, radicicol, 17-AAG, SP600125, lovastatin, LY294002, FR122047, DUP697, and geldanamycin were from Tocris (Ellisville, MO).
  • PBMC Peripheral blood mononuclear cells
  • Cell-based ELISAs were carried out essentially as described by Melrose et al. (1998) J Immunol 161 :2457-64. Briefly, microtiter plates containing treated and stimulated HUVEC (or HUVEC/PBMC) were blocked, and then incubated with primary antibodies or isotype control antibodies (0.01-0.5 ⁇ g/ml) for 1 hr.
  • siRNA transfection Early passage ( ⁇ 5) exponentially growing HUVEC cells were harvested, washed once with PBS, and resuspended at 2x10 6 cells in 100 ⁇ l Nucelofection solution (Human Umbilical Vein Endothelial Cell Nucleofector Kit, AMAXA, Koeln, Germany).
  • Nucelofection solution Human Umbilical Vein Endothelial Cell Nucleofector Kit, AMAXA, Koeln, Germany.
  • TNFR1 siRNA SEQ ID NO:1 AAGTGCCACAAAGGAACCTAC; 15 ⁇ l of a 20 ⁇ M solution; Dharmacon, Lafayette, Colorado was added to the cell suspension, transferred into an electroporation cuvette, and electroporated using the U-1 setting.
  • Example 7 illustrates the application of the present invention to the screening of compounds for altering immune and/or inflammatory conditions that involve endothelial cells. Endothelial cells were cultured as described in Example 1.
  • a complex, cytokine-stimulated endothelial cell inflammation system discriminates inhibitors of multiple signaling pathways.
  • Endothelial cells modulate inflammatory responses by regulating leukocyte traffic through their expression of adhesion receptors and chemokines.
  • endothelial cells are exposed to multiple proinflammatory cytokines including IL-1 ⁇ , TNF- ⁇ , and IFN- ⁇ . Therefore, primary human endothelial cells (EC) were stimulated with this combination of three pro-inflammatory cytokines (3C system) to simultaneously activate critical pathways and pathway interactions relevant to chronic inflammatory processes. Readouts were selected for their robust modulation in response to one or more individual cytokines or cytokine combinations or to specific drug effects (see below), and for their potential or known relevance to inflammatory biology.
  • VCAM-1 VCAM-1 , ICAM-1 and E-selectin (vascular adhesion molecules for leukocytes), MHC class II (antigen presentation), MIG/CXCL9, MCP-1/CCL2 and IL-8/CXCL8 (chemokines that mediate selective leukocyte recruitment from the blood), and CD31 (leukocyte transmigration).
  • Proteins or bioactive molecules were measured (instead of expressed genes) because 1) unlike genes, biologically active proteins are the proximate mediators of physiologic and pathophysiologic processes; and 2) these species are readily measured in scalable high throughput assay formats.
  • Drugs were included during the 24 hr cytokine activation period, and readout parameters were measured by ELISA. Relative changes of readout parameter expression levels in response to drug treatment in each system are presented.
  • the 3C system responds to inhibitors of multiple different pathways and mechanisms including an antibody inhibitor of TNF- ⁇ , and the drugs apigenin (a casein kinase II inhibitor that blocks NF- ⁇ B function), PD169316 (a p38 MAPK inhibitor), and PD098059 (a MEK inhibitor).
  • apigenin a casein kinase II inhibitor that blocks NF- ⁇ B function
  • PD169316 a p38 MAPK inhibitor
  • PD098059 a MEK inhibitor
  • NDGA nordihydroguaiaretic acid
  • Inhibitors of immune cytokines not added to the system for example, or immune modulators specific for leukocyte signaling pathways (e.g. T cell receptor signaling), had little or no effect (at levels not yielding toxicity) on the multiply stimulated endothelial cell system.
  • immune modulators specific for leukocyte signaling pathways e.g. T cell receptor signaling
  • PBMC peripheral blood mononuclear cells
  • PBMC peripheral blood mononuclear cells
  • LPS lipopolysaccharide
  • Parameters selected include CD3 (T cell marker), CD14 (a monocyte marker), CD38, and CD69 (early activation markers), CD40 (a TNFR family member important for lymphocyte co-stimulation), E-selectin and VCAM-1 (endothelial adhesion molecules), tissue factor (TF, CD142; a initiator of coagulation), IL-1 ⁇ and M-CSF (cytokines), and IL-8, MCP-1 , and MIG (chemokines that control leukocyte recruitment).
  • CD3 T cell marker
  • CD14 a monocyte marker
  • CD38 head-activation markers
  • CD40 a TNFR family member important for lymphocyte co-stimulation
  • E-selectin and VCAM-1 endothelial adhesion molecules
  • tissue factor TF, CD142; a initiator of coagulation
  • IL-1 ⁇ and M-CSF cytokines
  • IL-8 chemokines that control leukocyte recruitment
  • the complex SAg system responds robustly and reproducibly to a number of compounds that are inactive or only weakly active in the endothelial inflammation system (Fig. 3).
  • FK-506 and cyclosporin A inhibitors of calcineurin-mediated T cell receptor signaling, are potent inhibitors of the SAg system response (Fig. 3a; notice decrease (red) in multiple leukocyte and endothelial parameters).
  • Fig. 3b show strong homology of function
  • IL-10 the phosphodiesterase 4 inhibitors Ro-20-1274 and rolipram
  • the immunosuppressant rapamycin the JAK inhibitors WHI-P131 and ZM39923, HMG-CoA reductase inhibitors, corticosteroids, and the src-family kinase inhibitors PP1 and PP2 (Fig. 3a and 3b).
  • Most compounds active in the endothelial inflammation system (Fig. 2) retain activity in the more complex multicellular system (e.g. the p38 inhibitors PD169316 and SB220025 and anti-TNF- ⁇ ; see also Fig. 4). Again, the order of compounds in Fig.
  • FIG. 4 An additional approach to encompass a broad range of biology into response profiles is to combine data from multiple complex systems assayed in parallel. This proves to be a particularly powerful approach to increase discrimination and classification of diverse biological activities (Fig. 4).
  • Fig. 4a We chose 48 compounds from ⁇ 20 functional classes (Fig. 4a) and evaluated them in three complex systems: the 3C system (see Figs. 1 and 2), the SAg system (see Fig. 3), and the LPS system (see Fig. 5a).
  • the order of compound presentation in Fig. 4 was determined by hierarchical clustering of profiles (Fig. 4b) or combinations of profiles (Fig. 4c) and differs depending on the combinations of systems used.
  • HMG-CoA inhibitors In the combined 3C and SAg system, HMG-CoA inhibitors, calcineurin inhibitors, src-family inhibitors, steroids, phosphodiesterase 4 inhibitors, and Cox inhibitors all form discrete clusters, while p38, hsp-90 and PI3K inhibitor clusters (from the 3C system) are maintained.
  • LPS system profiles in series with the 3C and SAg systems Fig. 4c, right panel
  • FIG. 4 illustrates the power of multi-system profiling to classify compounds by homology of function
  • this method may obscure significant similarities between compounds that are on different branches of the tree. Therefore, we applied additional statistical analyses (see Methods) to the compound profiles in all three systems to allow objective evaluation of the significance of all pairwise correlations between compound activities (Fig. 5).
  • Profile data from all three systems were first concatenated into 25 parameter profiles (Fig. 5a), and were compared to each other by pairwise Pearson correlation (Fig. 5b; the intensity of blue indicates the degree of positive correlation).
  • Multidimensional scaling was used to visualize the relationships between compounds (Fig 5c): in this graph, distance between compounds is scaled to reflect their degree of similarity and lines are used to connect drugs whose multi-system profiles show statistically significant similarity.
  • AA861 was a rationally designed inhibitor selected for enhanced 5-lipoxygenase activity and fewer side-effects 15 .
  • NDGA shows homology of function to the CKII inhibitor apigenin in the 3C system due to the ability of both compounds to inhibit NF- ⁇ B-dependent signaling (Fig. 2), multi-system analysis allows them to be discriminated.
  • DRB another CKII inhibitor, shows significant homology of function to apigenin, although these two compounds did not cluster together in the 3C system alone (see Fig. 2).
  • non-steroidal fungal estrogen receptor agonists zearalenone and ⁇ -zearalenol both clustered with a large group of p38 MAPK inhibitors, an effect potentially related to the reported ability of estrogen to modulate p38 signaling.
  • BioMaps generated from assay panels containing cells with genetic constructs that selectively target or modulate specific cellular pathways (e.g. NFAT, calcineurin, NFDB, MAP kinase, and the like), or cells that contain known genetic mutations, e.g. Jurkat cell lines that lack Lck, CD45, or the like (see Yamasaki, 1997, J. Biol. Chem. 272:14787).
  • specific cellular pathways e.g. NFAT, calcineurin, NFDB, MAP kinase, and the like
  • cells that contain known genetic mutations e.g. Jurkat cell lines that lack Lck, CD45, or the like (see Yamasaki, 1997, J. Biol. Chem. 272:14787).
  • the ability to inhibit cellular responses to proinflammatory cytokines is a common feature of many anti-inflammatory compounds, and serves as the basis of anti-inflammatory cell-based screens in drug discovery.
  • many anti-inflammatory compounds including corticosteroids, immunosuppressants, proteosome inhibitors, various kinase inhibitors, and others have been shown to inhibit endothelial cell responses induced by IL-1 ⁇ or TNF- ⁇ .
  • Such assays detect but do not effectively discriminate or classify compounds with different mechanisms of action.
  • the methods of the present invention provide more discrimination between compounds with different mechanisms of action, through a set of human cell-based model systems that incorporate increased levels of complexity with relevance to inflammatory disease biology. Such systems are useful for the rapid identification of effective new therapeutics. In testing the performance of these systems with known pharmacologic agents, it was discovered that the responses measured in these complex systems were surprisingly robust and reproducible, and could be employed for efficient classification of compounds according to their functional activities.
  • This Example illustrates how the methods of the present invention can be used to identify or characterize regulators of T cell mediated inflammation and immunity, such as regulators of the TH1/TH2 polarization process.
  • a set of assay combinations that reproduces aspects of the differentiation and polarization response of adult T cells is provided.
  • FIG. 9 Human peripheral blood CD4+ T cells are used in this illustrative embodiment of the invention. Other cells that can be used include adult peripheral blood CD8+ T cells, isolated populations of CD4+ or CD8+ T cells, and CD4+ or CD8+ memory or naive T cells. Peripheral blood mononuclear cells are isolated from blood by Ficoll-hypaque density gradient centrifugation as described (see Ponath, 1996, JEM 183:2437). CD4+ T cells are then isolated by negative selection using MACS beads as described (see Kim, 2001 , JCI 708:1331).
  • Cells are then cultured for 4-6 days at 0.5x10 6 cells/ml in complete RPMI (RPMI- 1640 + 50 microg/50 U penicillin/streptomycin + 10% FCS + 50 microM beta-mercaptoethanol + 1 mM sodium pyruvate + 2 mM L-glutamine) in plates pre-coated 12 hr with 1-5 microg/ml anti-CD3 (Pharmingen).
  • RPMI RPMI- 1640 + 50 microg/50 U penicillin/streptomycin + 10% FCS + 50 microM beta-mercaptoethanol + 1 mM sodium pyruvate + 2 mM L-glutamine
  • To these cultured T cells is added 1 microg/ml anti-CD28 antibody (Pharmingen) for co-stimulation and 5 ng/ml IL-2 for growth.
  • reagents that can be substituted for co-stimulation include, but are not limited to, anti-CD49d, anti-CD2, or CD40-lg at effective concentrations.
  • cytokines important for the differentiation of T cells are added in particular combinations along with antibodies against other cytokines to induce differentiation and polarization.
  • Useful combinations include 4 ng/ml IL-12, 10 ng/ml IFN- gamma, and 3 microg/ml anti-IL-4 to mimic TH1 differentiation; and 10 ng/ml IL-4, 3 microg/ml anti-IL-12, 3 microg/ml anti-IFN-gamma to mimic TH2 polarization conditions.
  • 10 ng/ml of IL-13, IL-6, or IL-9 may be added to the TH2 conditions, and 10 ng/ml IL-23 or IL-27 may be added to the TH1 conditions.
  • Other polarization conditions include Tr1 polarization (10 ng/ml IL-10 and 4 ng/ml IFN-alpha 2b ) or the neutral polarization (5 ng/ml IL-2 only). After 6 days, the same population of T cells may be re-stimulated in the same manner for another 6 days for further polarization.
  • T cells in the cultures are analyzed by flow cytometry for surface markers and intracellular cytokines.
  • Anti-CD3 and anti-CD4 antibodies are used to identify the CD4+ T cells.
  • BioMaps are generated for the parameters IFN-gamma, TNF-alpha, IL-2, IL-4, IL- 13, LT-alpha, CCR4, CCR5, CXCR3, IL-4Ralpha, CD11c, CD134, CD150, CD137, CD69, B7- H1 , B7-H2, and CD200.
  • TH1 and TH2 lymphocytes can be distinguished after both 6 and 12 days. See, for example, Figure 8.
  • a database of BioMaps is generated from a panel of assay combinations that include the two polarization conditions (e.g. TH1 and TH2) and anti-inflammatory drug compounds.
  • These compounds can include inhibitors of T cell activation and/or T cell proliferation such as the calcineurin inhibitors, FK-506 and cyclosporin A, and the proliferation inhibitors rapamycin, mycophenolic acid, and methotrexate.
  • Other immuno-modulatory drugs e.g. dexamethasone
  • antibodies e.g. anti-IL-12
  • Such compounds include those described in The Pharmacologic Basis of Therapeutics.
  • BioMAP parameters are useful in characterizing TH1 or TH2 cells after one or two polarizations.
  • a panel of markers (abscissa) of TH1 or TH2 differentiation were used to characterize the resulting T cell populations and determine the best parameters for identifying differences between TH1 and TH2 cells after each polarization.
  • Figure 8 demonstrates the effects of drugs on TH1 and TH2 polarization.
  • CD4+ peripheral blood T cells isolated by negative selection were polarized for two rounds under TH1 or TH2 conditions.
  • drugs or solvent controls were added to the culture every other day (days 1 , 3, and 5).
  • a panel of markers (abscissa of each plot) was used to characterize the TH1 or TH2 state of the CD4+ population after the second polarization. It may be noted that anti-IL-12 greatly impairs the ability of cells to polarize toward the TH1 state, but has little effect on the polarization toward the TH2 state since it is already present in the culture for TH2 polarization.
  • the BioMAPS with the known agents are compared with those for candidate test agents. This allows the recognition of the pathway(s) the candidate agent acts on, by comparing the changes in the level of the specific markers for known drugs affecting known pathways and the changes observed with the candidate agent.
  • the database can also include reference BioMaps generated from assay panels containing cells with added genetic over- expression or knockdown constructs (e.g. constitutively active STATSa*; Figure 8) that selectively target or modulate specific cellular pathways (e.g. JAK/STAT, NF-AT, calcineurin, NF-kappaB, MAP kinase, and the like).
  • Human peripheral blood monocytes are used. Other cells that can be used in place human peripheral blood monocytes include bone-marrow derived monocytes, monocytes isolated by elutriation or negative magnetic bead isolation, and the monocyte cell lines THP-1 or U937. About 10x10 6 peripheral blood mononuclear cells/ml are cultured in RPMI containing 10% fetal bovine serum for 1 hour. Non-adherent lymphocytes are removed by gentle washing.
  • IL-1 (1 ng/ml
  • TNF-alpha 100 ng/ml
  • LPS 200 ng/ml
  • one or more of IFN-gam a (10 ng/ml), GM-CSF (10 ng/ml), IL-4 (20 ng/ml), IL-13 (30 ng/ml), IL-10 (10 ng/ml), osteopontin (10 ng/ml), thrombin (10 U/ml), CD40L, oxidized LDL (100 ug/ml), or minimally modified LDL are added to the initial three factors or may replace one of the three factors (see Brown, 2000, J. Clin. Endocrinol. Metab. 85:336; Ashkar, 2000, Science 287:860; de Boer, 1999, J. Pathol. 88:174; and Hopkins, 1990, J. Clin. Invest.
  • BioMaps are generated.
  • Illustrative parameters include Annexin V, TNF-alpha, IL-1 -beta, IL-6, IL-8, MIP-1 -alpha, Mac- 1 (CD11b/CD18), IL-12, and MCP-1 (see Devaux, 1997, Eur. Heart J. 78:470; Kessler, 1998, Diabetes Metab. 24:327; Becker, 2000, Z. Kardiol. 89:160; Kaplanski, 1997, J. Immunol. 758:5435; and Li, 2000, supra).
  • markers of interest that can be included in the BioMAP are CD14, PAI-1 , urokinase-type plasminogen activator receptor (uPAR, CD87), IL-10, IL-18, tissue factor, fibrinogen-binding activity, MIG, TARC, MDC, RANTES, CD80, CD86, CD40 and CD36 (see Paramo, 1985, Br. Med. J. 297:573; Fukuhara, 2000, Hypertension 35:353; Noda- Heiny, 1995, Arterioscler. Thromb. Vase. Biol. 75:37; de Prost, 1995, J. Cardiovasc. Pharmacol., 25 Suppl2:S114; van de Stolpe, 1996, Thromb.
  • a database of BioMaps is generated from a panel of assay combinations that include known anti-atherogenic agents, including but not limited to statins, test compounds are screened, and a BioMap generated that shows the changes in the markers with the different test compounds.
  • the BioMaps of the known agents are used to compare to candidate test agents. This allows the recognition of the pathway(s) on which the candidate drug act, as determined by comparing the changes in the level of the specific markers for known drugs affecting known pathways and the changes observed with the candidate test compound.
  • the database reference BioMaps can include those generated from assay panels containing cells with genetic constructs that selectively target or modulate specific cellular pathways (e.g. NFKB, MAP kinase, and the like), or cells that contain known genetic mutations (e.g. CD36- deficiency, see Yanai, 2000, Am. J. Med. Genet. 93:299, and the like).
  • specific cellular pathways e.g. NFKB, MAP kinase, and the like
  • CD36- deficiency see Yanai, 2000, Am. J. Med. Genet. 93:299, and the like.
  • BioMap analysis can be used to characterize the effects of drugs on LPS-stimulated monocyte cytokine secretion.
  • CD14+ monocytes were enriched by adherence to 24-well plastic tissue culture dishes for 1 hr and unbound cells were removed.
  • Monocytes were stimulated with 1 ⁇ g/ml LPS for 5 hr in the presence of 2 ⁇ M monensin (a secretion inhibitor).
  • Drugs or solvent control (DMSO) at the indicated concentrations were added 15 minutes before LPS stimulation and were present for the entire 5 hr.
  • Annexin V staining indicates apoptotic cells. Intracellular cytokines were detected by fixing and permeabilizing the cells after scraping them off of the culture dish.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medical Informatics (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Chemical & Material Sciences (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Theoretical Computer Science (AREA)
  • Evolutionary Biology (AREA)
  • Data Mining & Analysis (AREA)
  • Food Science & Technology (AREA)
  • Microbiology (AREA)
  • Genetics & Genomics (AREA)
  • Databases & Information Systems (AREA)
  • Pathology (AREA)
  • Computer Vision & Pattern Recognition (AREA)
  • Toxicology (AREA)
  • Software Systems (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Cell Biology (AREA)
  • Public Health (AREA)
  • Artificial Intelligence (AREA)
  • Bioethics (AREA)
  • Epidemiology (AREA)
  • Evolutionary Computation (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Physiology (AREA)
PCT/US2004/028970 2003-09-03 2004-09-02 Cell-based assays for determining drug action Ceased WO2005023987A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
CA002576406A CA2576406A1 (en) 2003-09-03 2004-09-02 Cell-based assays for determining drug action
AU2004271183A AU2004271183A1 (en) 2003-09-03 2004-09-02 Cell-based assays for determining drug action
JP2006526218A JP2007503841A (ja) 2003-09-03 2004-09-02 薬剤作用を決定するための細胞ベースのアッセイ法
US10/570,081 US20070072246A1 (en) 2003-09-03 2004-09-02 Cell-based assays for determining drug action
EP04788596A EP1668361A4 (en) 2003-09-03 2004-09-02 CELL TESTS FOR DETERMINING THE EFFECT OF A MEDICINAL PRODUCT

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US50018003P 2003-09-03 2003-09-03
US60/500,180 2003-09-03

Publications (2)

Publication Number Publication Date
WO2005023987A2 true WO2005023987A2 (en) 2005-03-17
WO2005023987A3 WO2005023987A3 (en) 2005-12-08

Family

ID=34272923

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/028970 Ceased WO2005023987A2 (en) 2003-09-03 2004-09-02 Cell-based assays for determining drug action

Country Status (6)

Country Link
US (1) US20070072246A1 (enExample)
EP (1) EP1668361A4 (enExample)
JP (1) JP2007503841A (enExample)
AU (1) AU2004271183A1 (enExample)
CA (1) CA2576406A1 (enExample)
WO (1) WO2005023987A2 (enExample)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1825263A4 (en) * 2004-11-30 2008-09-17 Cell Networx Llc CELL SIGNALING TESTS, REAGENTS AND PHRASES BASED ON THE METABOLISM TRANSMISSION
EP1872293A4 (en) * 2005-03-28 2010-01-06 Bioseek Inc PROFILING BIOLOGICAL DATA FOR CARDIOVASCULAR DISEASES AND CARDIOVASCULAR INFLAMMATION
US8019551B2 (en) 2004-02-27 2011-09-13 Bioseek Llc Biological dataset profiling of asthma and atopy
US8114615B2 (en) 2006-05-17 2012-02-14 Cernostics, Inc. Method for automated tissue analysis
US8697387B2 (en) 2006-06-02 2014-04-15 DiscoverRx Corporation Methods for identifying agents and their use for the prevention of restenosis
WO2016106160A1 (en) * 2014-12-22 2016-06-30 Enumeral Biomedical Holdings, Inc. Methods for screening therapeutic compounds
US10018631B2 (en) 2011-03-17 2018-07-10 Cernostics, Inc. Systems and compositions for diagnosing Barrett's esophagus and methods of using the same

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004094992A2 (en) * 2003-04-23 2004-11-04 Bioseek, Inc. Methods for analysis of biological dataset profiles
WO2008018905A2 (en) * 2006-01-17 2008-02-14 Cellumen, Inc. Method for predicting biological systems responses
US20100009352A1 (en) * 2006-05-24 2010-01-14 Gough Albert H Method for Modeling a Disease
US20100112602A1 (en) * 2006-11-10 2010-05-06 Taylor Lansing D Protein-Protein Interaction Biosensors and Methods of Use Thereof
US20100093613A1 (en) * 2007-03-09 2010-04-15 Kunkel Eric J Methods for identifying agents and their use for the prevention or stabilization of fibrosis
WO2008121896A2 (en) 2007-03-30 2008-10-09 Bioseek, Inc. Methods for classification of toxic agents and counteragents
US8536135B2 (en) * 2008-03-19 2013-09-17 Ontherix, Inc. Adaptive biochemical signatures
CA2718969A1 (en) * 2008-03-19 2009-09-24 Ontherix, Inc. Adaptive biochemical signatures
WO2016168565A1 (en) * 2015-04-16 2016-10-20 President And Fellows Of Harvard College Methods for treatment of chronic obstructive pulmonary disease and/or therapy monitoring
CN112466403B (zh) * 2020-12-31 2022-06-14 广州基迪奥生物科技有限公司 一种细胞通讯分析方法及系统

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU4007401A (en) * 2000-03-06 2001-09-17 Bioseek Inc Function homology screening
US6763307B2 (en) * 2000-03-06 2004-07-13 Bioseek, Inc. Patient classification
US7266458B2 (en) * 2000-03-06 2007-09-04 Bioseek, Inc. BioMAP analysis
AU2002365904A1 (en) * 2001-07-10 2003-09-04 Gene Logic, Inc. Cardiotoxin molecular toxicology modeling
US7623969B2 (en) * 2002-01-31 2009-11-24 The Institute For Systems Biology Gene discovery for the system assignment of gene function
WO2003068054A2 (en) * 2002-02-13 2003-08-21 The Government Of The United States Of America As Represented By The Secretary, Department Of Health Services Identification of ovarian cancer tumor markers and therapeutic targets
EP1620722A4 (en) * 2003-04-23 2008-01-30 Bioseek Inc METHODS FOR CHARACTERIZING SIGNALING PATHWAYS AND COMPOUNDS INTERACTING THEREWITH
WO2004094992A2 (en) * 2003-04-23 2004-11-04 Bioseek, Inc. Methods for analysis of biological dataset profiles

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of EP1668361A4 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8019551B2 (en) 2004-02-27 2011-09-13 Bioseek Llc Biological dataset profiling of asthma and atopy
EP1825263A4 (en) * 2004-11-30 2008-09-17 Cell Networx Llc CELL SIGNALING TESTS, REAGENTS AND PHRASES BASED ON THE METABOLISM TRANSMISSION
EP1872293A4 (en) * 2005-03-28 2010-01-06 Bioseek Inc PROFILING BIOLOGICAL DATA FOR CARDIOVASCULAR DISEASES AND CARDIOVASCULAR INFLAMMATION
US9734282B2 (en) 2005-03-28 2017-08-15 Discoverx Corporation Biological dataset profiling of cardiovascular disease and cardiovascular inflammation
US8114615B2 (en) 2006-05-17 2012-02-14 Cernostics, Inc. Method for automated tissue analysis
US8597899B2 (en) 2006-05-17 2013-12-03 Cernostics, Inc. Method for automated tissue analysis
US8697387B2 (en) 2006-06-02 2014-04-15 DiscoverRx Corporation Methods for identifying agents and their use for the prevention of restenosis
US10018631B2 (en) 2011-03-17 2018-07-10 Cernostics, Inc. Systems and compositions for diagnosing Barrett's esophagus and methods of using the same
WO2016106160A1 (en) * 2014-12-22 2016-06-30 Enumeral Biomedical Holdings, Inc. Methods for screening therapeutic compounds

Also Published As

Publication number Publication date
EP1668361A2 (en) 2006-06-14
CA2576406A1 (en) 2005-03-17
WO2005023987A3 (en) 2005-12-08
EP1668361A4 (en) 2008-01-23
JP2007503841A (ja) 2007-03-01
AU2004271183A1 (en) 2005-03-17
US20070072246A1 (en) 2007-03-29

Similar Documents

Publication Publication Date Title
US8467970B2 (en) Function homology screening
US20070072246A1 (en) Cell-based assays for determining drug action
EP1436617B1 (en) Patient classification
Junkin et al. High-content quantification of single-cell immune dynamics
Janes et al. The response of human epithelial cells to TNF involves an inducible autocrine cascade
Irish et al. Single cell profiling of potentiated phospho-protein networks in cancer cells
AU2001240074A2 (en) Function homology screening
AU2001240074A1 (en) Function homology screening
Berg et al. Characterization of compound mechanisms and secondary activities by BioMAP analysis
Zhou et al. SARS-CoV-2 infection induces psoriatic arthritis flares and enthesis resident plasmacytoid dendritic cell type-1 interferon inhibition by JAK antagonism offer novel spondyloarthritis pathogenesis insights
Dwivedi et al. A Multiscale Model of Interleukin‐6–Mediated Immune Regulation in Crohn's Disease and Its Application in Drug Discovery and Development
Correa et al. Discovery and characterization of 2-aminobenzimidazole derivatives as selective NOD1 inhibitors
Klinke et al. Quantifying crosstalk among interferon-γ, interleukin-12, and tumor necrosis factor signaling pathways within a TH1 cell model
Damm-Ganamet et al. A prospective virtual screening study: Enriching hit rates and designing focus libraries to find inhibitors of PI3Kδ and PI3Kγ
US20070135997A1 (en) Methods for analysis of biological dataset profiles
Stumpfe et al. Targeting multifunctional proteins by virtual screening: structurally diverse cytohesin inhibitors with differentiated biological functions
Al Shahrani et al. High-throughput screening and in vitro evaluation of CSB-0914; a novel small molecule NF-κB inhibitor attenuating inflammatory responses through NF-κB, Nrf2 and HO-1 cross-talk
US8019551B2 (en) Biological dataset profiling of asthma and atopy
Collinge et al. Human lymphocyte activation assay: an in vitro method for predictive immunotoxicity testing
von Boehmer T-cell development:: What does Notch do for T cells?
Cosgrove et al. Simulating CXCR5 Dynamics in Complex Tissue Microenvironments
AU2002341654A1 (en) Patient classification
Woska Jr et al. Overview of Approaches to the Identification of Inhibitors of Cytokine Action
Baker T Cell Receptor Cross-Reactivity Directed by Antigen Dependent Tuning of Peptide-MHC Molecular Flexibility

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2006526218

Country of ref document: JP

Ref document number: 2004271183

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2004788596

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2004271183

Country of ref document: AU

Date of ref document: 20040902

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2004271183

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2004788596

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2007072246

Country of ref document: US

Ref document number: 10570081

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2576406

Country of ref document: CA

WWP Wipo information: published in national office

Ref document number: 10570081

Country of ref document: US