TITLE RECOMBINANT EXPRESSION OF THE HAG1 ANTIMICROBIAL PEPTIDE: USE AS FUSION PARTNER FOR THE EXPRESSION OF ALPHA HELICAL ANTIMICROBIAL PEPTIDES
FIELD OF THE INVENTION This invention relates to the field of antimicrobial peptides. More specifically, the invention relates to the recombinant production of antimicrobial peptides using an antimicrobial peptide from the hagfish intestine as a fusion partner. BACKGROUND OF THE INVENTION
This invention relates to the production of linear, cationic, amphiphilic, alpha helical, antimicrobial peptides by recombinant techniques in bacterial host cells by a method in which the peptides are fused to a specific cathelicidin-related peptide derived from the hagfish (U.S. Patent No. 5,734,015). Although short (< 20 amino acid) peptides can be produced in high yields via chemical synthesis (Merrifield, R. B., J. Am. Chem. Soc, 85:2149-2154 (1993)), recombinant production offers the potential for large scale production at a more reasonable cost. However, the expression of very short polypeptide chains can be problematic in microbial systems because small peptides are often proteolyzed by the host cell's protein regeneration systems. The expression of antimicrobial peptides is often even more problematic because the peptides can be toxic to the production host cells, leading to limited production and cell death. Fusion to larger carrier proteins which serve as anionic partners can eliminate toxicity and provide a method of affinity purification (K. Terpe, Appl.Microbiol.Biotechnol., Vol.60, 523-533 (2003)). However, fusion systems can require costly cleavage reagents and affinity columns for purification. In addition, even when the toxic peptide is part of a larger fusion molecule, high concentrations of fusion peptide in a cell can lead to toxic effects.
The production of antimicrobial peptides for use in materials applications would require kilogram to ton quantities per year. If production of recombinant peptides can be achieved at this large scale, such production can potentially be economical. However, limited fermentative expression and downstream processing steps for the production of peptides and proteins from bacteria can often contribute a significant fraction of total production cost. It is desirable that aspects of the recombinant production process be improved and/or optimized in order to make large-scale production of antimicrobial peptides by recombinant means more economically viable.
SUMMARY OF THE INVENTION The present invention provides a process for producing a fusion oligopeptide Met-(Hag1 -[Antimicrobial Peptide]n)m, wherein n and m are integers from 1 to 25. The process comprises the steps of: (a) providing a transformed host cell comprising an isolated nucleic acid fragment under the control of suitable regulatory sequences, the isolated nucleic acid fragment encoding a fusion oligopeptide, the fusion oligopeptide comprising Met, SEQ ID NO:31 and an Antimicrobial Peptide; (b) growing the host cell of (a) under suitable conditions whereby the fusion oligopeptide Met-(Hag1 -[Antimicrobial Peptide]n)m is produced; and (c) recovering the Met-(Hag1 -[Antimicrobial Peptide]n)m.
The Antimicrobial Peptide is selected from the group consisting of cathelicidins, magainins, cecropins, SEQ ID NO:9, SEQ ID NO:33 and analogs thereof. The invention described herein further provides a process for producing an Antimicrobial Peptide. The process comprises the steps of: (a) providing a transformed host cell comprising an isolated nucleic acid fragment under the control of suitable regulatory sequences, the isolated nucleic acid fragment
encoding a fusion oligopeptide, the fusion oligopeptide comprising Met, SEQ ID NO:31 and an Antimicrobial Peptide; (b) growing the host cell of (a) under suitable conditions whereby the fusion oligopeptide Met-(Hag 1 -[Antimicrobial Peptide]n)m is produced; (c) cleaving the fusion oligopeptide Met-(Hag1 -[Antimicrobial Peptide]π)m to produce products comprising the Antimicrobial Peptide and Hag1 ; and (d) recovering the Antimicrobial Peptide from the products.
Hag1 may also be recovered as a cleavage product. The present invention also provides an isolated nucleic acid fragment a) encoding Met-(Hag1 -[Antimicrobial Peptide]n) , wherein n and m are integers from 1 to 25; (b) an isolated nucleic acid fragment that hybridizes with (a) under the following hybridization conditions: 0.1X SSC, 0.1 % SDS at 65°C, and washed with 2X SSC, 0.1% SDS followed by 0.1 X SSC, 0.1 %) SDS; and (c) an isolated nucleic acid fragment that is completely complementary to (a) or (b). The isolated nucleic acid fragment may be synthesized such that the encoded protein contains at least one site for cleavage by a protease or a chemical on the N-terminal end of Hag1 , the C-terminal end of Hag1 , the N-terminal end of the Antimicrobial Peptide, the C-terminal end of the Antimicrobial Peptide, or combinations thereof. The invention also provides chimeric genes comprised of the instant nucleic acid fragments and suitable regulatory sequences, as well as the polypeptides encoded by the sequences and vectors comprising the chimeric genes. Additionally, the invention provides recombinant organisms transformed with the chimeric genes of the instant invention; the chimeric genes may be integrated into the chromosome or plasmid-borne. The invention also provides methods for synthesizing the genes of the instant invention. The invention also provides compositions and methods for use of the fusion oligopeptides described herein.
BRIEF DESCRIPTION OF THE DRAWINGS AND SEQUENCE DESCRIPTIONS Figure 1 is a schematic of the PCR amplified insert fragment for the Hag1 coding region. Figure 2 illustrates the pLEX vector sequence at the cloning sites. Figure 3 illustrates the pLEX expression vector with hagl inserted into the Ndel and BamHI sites. Figure 4 depicts helical wheel projections of the hagl (A) and 16KGLG1 proteins (B). Figure 5 depicts the helical wheel projection of the Met-Hag1- 16KGLG1 protein encoded by pLH109. Figure 6 depicts the helical wheel projection of the Met-Hag1-3G- 16KGLG1 protein encoded by pLH108. Figure 7 is a schematic of the PCR amplified insert fragment for the
16KGLG1 protein coding region. Figure 8 illustrates the pLEX vector sequence at the cloning sites. Figure 9 illustrates the pLEX expression vector with the 16KGLG1 sequence inserted into the Ndel and Xbal sites creating plasmid pLH113. Figure 10 illustrates the insertion of the Hagl coding sequence into the Ndel and BamHI sites of vector pET11C. Figure 11 illustrates the pET11C vector with the Hagl coding sequence inserted into the Ndel and BamHI sites creating plasmid pLH115
The invention can be more fully understood from the following detailed description, the figures, and the accompanying sequence descriptions that form a part of this application and are incorporated by reference herein. The following sequence descriptions and sequences listings attached hereto comply with the rules governing nucleotide and/or amino acid sequence disclosures in patent applications as set forth in 37 C.F.R. §1.821-1.825 ("Requirements for Patent Applications Containing Nucleotide Sequences and/or Amino Acid Sequence Disclosures - The
Sequence Rules") and consistent with World Intellectual Property Organization (WIPO) Standard ST.25 (1998) and the sequence listing requirements of the EPO and PCT (Rules 5.2 and 49.5(a-bis), and Section 208 and Annex C of the Administrative Instructions). The Sequence Descriptions contain the one letter code for nucleotide sequence characters and the three letter codes for amino acids as defined in conformity with the lUPAC-IYUB standards described in Nucleic Acids Research 13:3021-3030 (1985) and in the Biochemical Journal 219 (No.2):345-373 (1984) which are herein incorporated by reference. The symbols and format used for nucleotide and amino acid sequence data comply with the rules set forth in 37 C.F.R.§1.822. SEQ ID NOs:1-4 are the primers 080101-1 , 080101-3, 080101-4, and 100101-5, respectively. SEQ ID NOs:5-6 are the primers 080101-8 and 100101-7, respectively. SEQ ID NOs:7-8 are the sequencing primers 080201-1 and 080201-2, respectively. SEQ ID NO:9 is the 16KGLG1 peptide. SEQ ID NOs:10-15 are primers used to synthesize the Met-Hag1- 16KGLG1 fusion protein. SEQ ID NO:16 is the Met-Hag1-16KGLG1 peptide. SEQ ID NOs:17-18 are primers used to synthesize the Met-Hag1- 16KGLG1 fusion protein. SEQ ID NOs:19-20 are the pLEX forward and pLEX reverse sequencing primers, respectively. SEQ ID NOs:21-25 are primers used to synthesize the Hag1-3G- 16KGLG1 fusion protein. SEQ ID NO:26 is the Met-Hag1-3G-16KGLG1 protein. SEQ ID NO:27 is the protein Met-Hag1. SEQ ID NO:28 is the DNA sequence encoding Met-Hag1. SEQ ID NO:29 is the DNA sequence encoding Met-Hag1- 16KGLG1.
SEQ ID NO:30 is the DNA sequence encoding Met-Hag1-3G- 16KGLG1. SEQ ID Nos:31 and 32 are the amino acid and nucleotide sequence, respectively, for Hagl SEQ ID NO:33 is the amino acid sequence for 3G-16KGLG1. SEQ ID NO:34 is a primer used to synthesize Met-Hag1-3G- 16KGLG1. SEQ ID NO:35 is the amino acid sequence for Hag1-3G-16KGLG1. DETAILED DESCRIPTION OF THE INVENTION The instant invention provides a process for recombinantly producing and purifying antimicrobial peptides (AMPs). The invention described herein provides a process for producing fusion proteins of two or more antimicrobial peptides. The fusion proteins of the invention are not toxic to the expression host, are not subject to proteolysis by the expression host, and do not necessarily require post-expression cleavage to recover the antimicrobial peptides. The stated problem has been solved by identifying a cationic antimicrobial peptide that can be expressed by microorganisms, such as Escherichia coli, and that retains antimicrobial activity against its production host post-expression and purification. The amino acid sequence of the peptide is the non-brominated form of peptide 1 described in U.S. Patent No. 5,734,015; the peptide of the instant invention is referred to herein as Hagl (SEQ ID NO:31). A chemically synthesized version of this peptide was shown herein to have substantial activity against both bacteria and fungi in standard Microbial Inhibitory Concentration (MIC) assays (Table 1). This peptide was not active against the yeast, Candida albicans.
Table 1. Relative activity (1/μM MIC) of chemically synthesized Hagl (SEQ ID NO: 31) against bacterial and fungal species

Furthermore, it is demonstrated that recombinant fusion genes can be synthesized comprising Hagl linked to at least one additional small (< 25 amino acids), cationic, linear, alpha helical AMP, and that the fusion proteins encoded by these genes can be recombinantly expressed by microorganisms. The Hagl peptide and fusion proteins comprised thereof are not secreted and do not cause cell lysis; they do not form inclusion bodies. In addition, they are stable through post fermentative processing and purification. The fusion proteins of the instant invention demonstrate antimicrobial activity that is similar to or greater than that observed for the individual AMPs. In addition, the high pi of the Hagl peptide allows for economical purification of the fusion peptide by cation exchange chromatography. Furthermore, the fusion proteins can be cleaved by chemical or enzymatic means to produce individual peptides. In this way, peptides that normally might not be expressed by a host cell due to problems such as toxicity or proteolysis could be expressed and purified on a large-scale basis in a cost effective manner. In addition, the instant invention provides for improved methods for recovering homogeneous
peptides in large quantities via improved methods of fermentative production and purification. In addition, this invention provides compositions and methods of use for the fusion oligopeptides described herein.
Definitions and abbreviations In this disclosure, a number of terms and abbreviations are used.
The following definitions are provided. "Polymerase chain reaction" is abbreviated PCR. "High performance liquid chromatography" is abbreviated HPLC. "Reverse-phase high performance liquid chromatography" is abbreviated RP-HPLC. "Sodium dodecyl sulfate" is abbreviated SDS. "Sodium dodecyl sulfate-polyacrylamide gel electrophoresis" is abbreviated SDS-PAGE. "Ethylene diamine tetraacetic acid" is abbreviated EDTA. "Bovine serum albumin" is abbreviated BSA. "Deoxyribonucleotide triphosphates" is abbreviated dNTPs. "Time-of-f light" is abbreviated TOF. "Antimicrobial peptide" is abbreviated AMP. "ATCC" refers to the American Type Culture Collection International
Depository located at 10801 University Boulevard, Manassas, VA
20110-2209, U.S.A. The "ATCC No." is the accession number to cultures on deposit with the ATCC. As used herein the following abbreviations will be used to identify specific amino acids: Three-Letter One-Letter
Amino Acid Abbreviation Abbreviation
Alanine Ala A
Arginine Arg R
Asparagine Asn N
Aspartic acid Asp D
Cysteine Cys C
Glutamine Gin Q
Three-Letter One-Letter
Amino Acid Abbreviation Abbreviation
Glutamine acid Glu E
Glycine Gly G
Histidine His H
Leucine Leu L
Lysine Lys K
Methionine Met M
Phenylalanine Phe F
Praline Pro P
Serine Ser S
Threonine Thr T
Tryptophan Trp w
Tyrosine Tyr Y
Valine Val V
The terms "amphiphilic " and "amphipathic" peptides are used interchangeably herein and refer to peptides which have regions or sequences of hydrophilic and hydrophobic amino acid residues. The term "concatemer" herein refers to multiple copies of a given unit as tandem repeats. The multiple copies (multimers) may be separated by intervening sequences that provide, for example, cleavage sites for post-expression peptide recovery. The terms "protein", "oligopeptide" and "polypeptide" are used interchangeably herein. A "fusion protein", "fusion oligopeptide" or "fusion polypeptide" of the present invention is an oligopeptide in which one antimicrobial peptide is fused to one or more additional antimicrobial peptides. At least one of the AMPs is Hagl . The AMP sequences may be separated by one or more stretches of amino acids that function as cleavage sites for the recovery of individual AMPs. The term "back-translate" refers to deducing the nucleotide sequence encoding a given amino acid sequence, taking into account organism-specific codon preferences, from a given amino acid sequence. The term "isolated nucleic acid fragment" or "isolated nucleic acid molecule" refers to a polymer of RNA or DNA that is single- or double- stranded, optionally containing synthetic, non-natural or altered nucleotide bases. An isolated nucleic acid fragment in the form of a polymer of DNA
may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA. A nucleic acid molecule is "hybridizable" to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength. Hybridization and washing conditions are well known and exemplified in Sambrook, J., Fritsch, E.F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989) (hereinafter "Sambrook"), particularly Chapter 11 and Table 11.1 therein (entirely incorporated herein by reference). The conditions of temperature and ionic strength determine the "stringency" of the hybridization. Stringency conditions can be adjusted to screen for moderately similar fragments, such as homologous sequences from distantly related organisms, to highly similar fragments, such as genes that duplicate functional enzymes from closely related organisms. Post-hybridization washes determine stringency conditions. One set of preferred conditions uses a series of washes starting with 6X SSC, 0.5% SDS at room temperature for 15 min, then repeated with 2X SSC, 0.5% SDS at 45°C for 30 min, and then repeated twice with 0.2X SSC, 0.5% SDS at 50°C for 30 min. A more preferred set of stringent conditions uses higher temperatures in which the washes are identical to those above except for the temperature of the final two 30 min washes in 0.2X SSC, 0.5% SDS was increased to 60°C. Another preferred set of highly stringent conditions uses two final washes in 0.1 X SSC, 0.1% SDS at 65°C. Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of Tm for hybrids of nucleic
acids having those sequences. The relative stability (corresponding to higher Tm) of nucleic acid hybridizations decreases in the following order: RNA:RNA, DNA.RNA, DNA:DNA. For hybrids of greater than 100 nucleotides in length, equations for calculating Tm have been derived (see Sambrook et al., supra, 9.50-9.51). For hybridizations with shorter nucleic acids, i.e., oligonucleotides, the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (see Sambrook et al., supra, 11.7-11.8). In one embodiment, the length for a hybridizable nucleic acid is at least about 10 nucleotides. Preferably, a minimum length for a hybridizable nucleic acid is at least about
15 nucleotides; more preferably at least about 20 nucleotides; and most preferably, the length is at least 30 nucleotides. Furthermore, the skilled artisan will recognize that the temperature and wash solution salt concentration may be adjusted as necessary according to factors such as length of the probe. A "substantial portion" of an amino acid or nucleotide sequence is that portion comprising enough of the amino acid sequence of a polypeptide or the nucleotide sequence of a gene to putatively identify that polypeptide or gene, either by manual evaluation of the sequence by one skilled in the art, or by computer-automated sequence comparison and identification using algorithms such as BLAST (Basic Local Alignment Search Tool; Altschul, S. F., et al., (1993) J. Mol. Biol. 215:403-410; see also www.ncbi.nlm.nih.gov/BLAST/). In general, a sequence of ten or more contiguous amino acids or thirty or more nucleotides is necessary in order to putatively identify a polypeptide or nucleic acid sequence as homologous to a known protein or gene. Moreover, with respect to nucleotide sequences, gene specific oligonucleotide probes comprising 20-30 contiguous nucleotides may be used in sequence-dependent methods of gene identification (e.g., Southern hybridization) and isolation (e.g., in situ hybridization of bacterial colonies or bacteriophage plaques). In addition, short oligonucleotides of 12-15 bases may be used as amplification primers in PCR in order to obtain a particular nucleic acid fragment comprising the primers. Accordingly, a "substantial portion" or
"portion" of a nucleotide sequence comprises enough of the sequence to specifically identify and/or isolate a nucleic acid fragment comprising the sequence. The instant specification teaches partial or complete amino acid and nucleotide sequences encoding one or more peptides. The skilled artisan, having the benefit of the sequences as reported herein, may now use all or a substantial portion of the disclosed sequences for purposes known to those skilled in this art. Accordingly, the instant invention comprises the complete sequences as reported in the accompanying Sequence Listing, as well as substantial portions of those sequences as defined above. The term "complementary" is used to describe the relationship between nucleotide bases that are capable of hybridizing to one another. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the instant invention also includes isolated nucleic acid fragments that are complementary to the complete sequences as reported in the accompanying Sequence Listing as well as those substantially similar nucleic acid sequences. The term "percent identity", as known in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. "Identity" and "similarity" can be readily calculated by known methods, including but not limited to those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, NY (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, NY (1993); Computer Analysis of Sequence Data. Part I (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, NJ (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, NY (1991 ). Preferred methods to determine identity are designed to give the
best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations may be performed using the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wl). Multiple alignment of the sequences was performed using the Clustal method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments using the Clustal method were KTUPLE 1 , GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. Suitable nucleic acid fragments (isolated polynucleotides of the present invention) encode polypeptides that are at least about 70% identical, preferably at least about 80% identical region of homology of the amino acid sequences reported herein. Preferred nucleic acid fragments encode amino acid sequences that are about 85% identical to the region of homology of the amino acid sequences reported herein. More preferred nucleic acid fragments encode amino acid sequences that are at least about 90% identical to the region of homology of the amino acid sequences reported herein. Most preferred are nucleic acid fragments that encode amino acid sequences that are at least about 95% identical to the region of homology of the amino acid sequences reported herein. The term "region of homology" refers to the portion of a nucleic acid fragment that is homologous to that encoding an amino acid sequence reported herein. A nucleic acid fragment may encode, for example, an amino acid sequence for Met-Hag1 that is longer or shorter than that reported herein; the percent identity is calculated for the region of the gene that is homologous to that reported herein. "Codon degeneracy" refers to divergence in the genetic code permitting variation of the nucleotide sequence without affecting the amino acid sequence of an encoded polypeptide. Accordingly, the instant invention relates to any nucleic acid fragment that encodes all or a substantial portion of the amino acid sequence encoding polypeptides as set forth in SEQ ID NO:16, SEQ ID NO: 26, or encodes the sequence Met-
(Hag 1 -[Antimicrobial Peptide]n)m- The skilled artisan is well aware of the "codon-bias" exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. Therefore, when synthesizing a gene for improved expression in a host cell, it is desirable to design the gene such that its frequency of codon usage approaches the frequency of preferred codon usage of the host cell. Accordingly, in the instant invention, codon bias for enteric bacteria was utilized as a basis for synthesizing the nucleic acid sequences SEQ ID NO:28, SEQ ID NO: 29 and SEQ ID NO:30 such that optimal expression would be obtained in E. coli. "Synthetic genes" or "fusion genes" can be assembled from oligonucleotide building blocks that are chemically synthesized using procedures known to those skilled in the art. These building blocks are ligated and annealed to form gene segments that are then enzymatically assembled to construct the entire gene. The instant invention describes fusion genes that are created comprising SEQ ID NO:28 encoding the amino acid sequence Met-Hag1 (SEQ ID NO:27) and the nucleotide sequence for at least one additional AMP. "Chemically synthesized", as related to a sequence of DNA, means that the component nucleotides were assembled in vitro. Manual chemical synthesis of DNA may be accomplished using well established procedures, or automated chemical synthesis can be performed using one of a number of commercially available machines. Accordingly, the genes can be tailored for optimal gene expression based on optimization of nucleotide sequence to reflect the codon bias of the host cell. The skilled artisan appreciates the likelihood of successful gene expression if codon usage is biased towards those codons favored by the host. Determination of preferred codons can be based on a survey of genes derived from the host cell where sequence information is available. "Gene" refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence. "Native gene" refers to a gene as found in nature with its own
regulatory sequences. "Chimeric gene" refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. "Endogenous gene" refers to a native gene in its natural location in the genome of an organism. A "foreign" gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes. A "transgene" is a gene that has been introduced into the genome by a transformation procedure. "Coding sequence" refers to a DNA sequence that codes for a specific amino acid sequence. "Suitable regulatory sequences" refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, and stem-loop structures. "Promoter" refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. In general, a coding sequence is located 3' to a promoter sequence. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters that cause a gene to be expressed in most cell types at most times are
commonly referred to as "constitutive promoters". It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths may have identical promoter activity. The "3" non-coding sequences" refer to DNA sequences located downstream of a coding sequence and include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 31 end of the mRNA precursor. "RNA transcript" refers to the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence. When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript or it may be a RNA sequence derived from post-transcriptional processing of the primary transcript and is referred to as the mature RNA. "Messenger RNA (mRNA)" refers to the RNA that is without introns and that can be translated into protein by the cell. "cDNA" refers to a double-stranded DNA that is complementary to and derived from mRNA. "Sense" RNA refers to RNA transcript that includes the mRNA and so can be translated into protein by the cell.
"Antisense RNA" refers to a RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target gene (U.S. Patent No.5,107,065; WO9928508). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5' non-coding sequence, 3' non-coding sequence, or the coding sequence. "Functional RNA" refers to antisense RNA, ribozyme RNA, or other RNA that is not translated yet has an effect on cellular processes. The term "operably linked" refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably linked with a coding sequence when it is capable of affecting the expression of that coding sequence (i.e., that the coding sequence is under the
transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation. The term "expression", as used herein, refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragment of the invention. Expression may also refer to translation of mRNA into a polypeptide. Furthermore, it is well known in the art that antisense suppression and co-suppression of gene expression may be accomplished using nucleic acid fragments representing less than the entire coding region of a gene, and by using nucleic acid fragments that do not share 100% sequence identity with the gene to be suppressed. Moreover, alterations in a nucleic acid fragment which result in the production of a chemically equivalent amino acid at a given site, but do not effect the functional properties of the encoded polypeptide, are well known in the art. Thus, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a functionally equivalent product. Nucleotide changes that result in alteration of the N-terminal and C-terminal portions of the polypeptide molecule would also not be expected to alter the activity of the polypeptide. Each of the proposed modifications is well within the routine skill in the art, as is determination of retention of biological activity of the encoded products. "Mature" protein refers to a post-translationally processed polypeptide; i.e., one from which any pre- or propeptides present in the primary translation product have been removed. "Precursor" protein refers to the primary product of translation of mRNA; i.e., with pre- and propeptides still present. Pre- and propeptides may be but are not limited to intracellular localization signals. The term "signal peptide" refers to an amino terminal polypeptide preceding the secreted mature protein. The signal peptide is cleaved from
and is therefore not present in the mature protein. Signal peptides have the function of directing and translocating secreted proteins across cell membranes. Signal peptide is also referred to as signal protein. "Transformation" refers to the transfer of a nucleic acid fragment into the genome of a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as "transgenic" or "recombinant" or "transformed" organisms. The terms "plasmid", "vector" and "cassette" refer to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell, and usually in the form of circular double- stranded DNA molecules. Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3' untranslated sequence into a cell. "Transformation cassette" refers to a specific vector containing a foreign gene and having elements (in addition to the foreign gene) that facilitate transformation of a particular host cell. "Expression cassette" refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that allow for enhanced expression of that gene in a foreign host. The term "sequence analysis software" refers to any computer algorithm or software program that is useful for the analysis of nucleotide or amino acid sequences. "Sequence analysis software" may be commercially available or independently developed. Typical sequence analysis software will include, but is not limited to: the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wl), BLASTP, BLASTN, BLASTX (Altschul et al., J. Mol. Biol. 215:403-410 (1990)), DNASTAR (DNASTAR, Inc., Madison, Wl), and the FASTA program incorporating the Smith-Waterman algorithm (W. R.
Pearson, Comput. Methods Genome Res., [Proc. Int. Symp.] (1994), Meeting Date 1992, 111-20. Editor(s): Suhai, Sandor. Publisher: Plenum, New York, NY). Within the context of this application it will be understood that where sequence analysis software is used for analysis, the results of the analysis will be based on the "default values" of the program referenced, unless otherwise specified. As used herein "default values" will mean any set of values or parameters that originally load with the software when first initialized. More preferred amino acid fragments are those that are at least about 70%-80% identical to the sequences herein using a BLASTP analysis, where about 80%-90% is preferred.
Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein. Similarly, preferred nucleic acid sequences corresponding to the sequences herein are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred nucleic acid fragments are at least 90%) identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein. For example, preferred nucleic acid sequences encoding SEQ ID NO:16 or SEQ ID NO:26 are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences SEQ ID NO:29 or SEQ ID NO:30, respectively, reported herein. More preferred nucleic acid fragments are at least 90% identical to the nucleic acid sequences encoding SEQ ID NO:16 or SEQ ID NO:26. Most preferred are nucleic acid fragments that are at least 95% identical to the nucleic sequences encoding SEQ ID NO:16 or SEQ ID NO:26. Standard recombinant DNA and molecular cloning techniques used here are well known in the art and are described by Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989); and by Silhavy, T. J., Bennan, M. L. and Enquist, L W.,
Experiments with Gene Fusions. Cold Spring Harbor Laboratory Cold Press Spring Harbor, NY (1984); and by Ausubel, F. M. et al., Current
Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-lnterscience (1987).
Fusion oligopeptides: The fusion oligopeptides of the present invention comprise Met-
(Hag1 -[Antimicrobial Peptide]n)m, wherein n and m are integers from 1 to 25, Met is methionine, Hagl is SEQ ID NO:31 , and the Antimicrobial Peptide is a linear, cationic, amphiphilic, α-helical AMP. Thus, in one embodiment, the instant invention comprises the oligopeptide Met-Hag1- Antimicrobial Peptide; examples of Met-Hag1 -Antimicrobial Peptide include SEQ ID NO: 16 and SEQ ID NO:26. In another embodiment, the instant invention comprises Met-Hag1 -(Antimicrobial Peptide)n, wherein n is an integer from 2 to 25 and (Antimicrobial Peptide)n represents a concatemer of AMP sequences; an example of Met-Hag1 -(Antimicrobial Peptide)n is the fusion "SEQ ID NO:27-SEQ ID NO:33-SEQ ID NO:33-SEQ ID NO:33". The AMP concatemer need not be comprised solely of one AMP; different AMPs may be used as long as they belong to the family of cationic, linear, amphiphilic, α-helical AMPs. In yet another embodiment, the instant invention comprises Met-(Hag1 -Antimicrobial Peptide)m, wherein m is an integer from 2 to 25 and (Hag 1 -Antimicrobial Peptide)m is a concatemer comprised of (Hag 1 -Antimicrobial Peptide); an example of Met-(Hag1 -Antimicrobial Peptide)m is the fusion "Met-([SEQ ID NO:31- SEQ ID NO:33]-[SEQ ID NO:31-SEQ ID N0.33])". In still another embodiment, the instant invention comprises the oligopeptide Met-(Hag1- [Antimicrobial Peptide]n)m, wherein (Hag 1 -[Antimicrobial Peptide]n)m comprises a concatemer of (Hag 1 -[Antimicrobial Peptide]n); an example of Met-(Hag1 -[Antimicrobial Peptide]n)m is the fusion "Met-(Hag1-AMP-AMP- AMP)-(Hag1-AMP-AMP-AMP)-(Hag1-AMP-AMP-AMP)", where AMP refers to an Antimicrobial Peptide. The instant invention also provides an isolated nucleic acid fragment encoding a fusion oligopeptide comprising Met, SEQ ID NO:31 and an Antimicrobial Peptide. The nucleic acid fragment is selected from the group consisting of:
(a) an isolated nucleic acid fragment encoding Met-(Hag1- [Antimicrobial Peptide]n) , wherein n and m are integers from 1 to 25; (b) an isolated nucleic acid fragment that hybridizes with (a) under the following hybridization conditions: 0.1X SSC, 0.1% SDS at 65°C, and washed with 2X SSC, 0.1% SDS followed by 0.1 X SSC, 0.1% SDS; and (c) an isolated nucleic acid fragment that is completely complementary to (a) or (b). The isolated nucleic acid fragment encoding Met-(Hag1-
[Antimicrobial Peptide]n)m may be constructed such that the expressed fusion oligopeptide contains at least one site for cleavage by a protease or a chemical on the N-terminal end of Hagl , the C-terminal end of Hagl , the N-terminal end of the Antimicrobial Peptide, the C-terminal end of the Antimicrobial Peptide, or combinations thereof. "On the N-terminal end" refers to one or more amino acids encoded by a nucleotide sequence that is upstream of the 5' end of the sequence encoded by the Hagl peptide or by the Antimicrobial Peptide; "on the C-terminal end" refers to one or more amino acids encoded by a nucleotide sequence that is downstream of the 3' end of the sequence encoded by the Hagl peptide or by the Antimicrobial Peptide. In another embodiment of the invention, a truncated form of the Hagl peptide may be used. For example, specific sequences within Hagl may be required for targeting the expressed peptide to the membrane; these sequences may be responsible for the reduced toxicity exhibited by Hagl when expressed in E. coli or other Gram negative bacteria. Thus, it may be possible to remove non- necessary portions of the Hagl peptide and still achieve expression of recombinant AMPs using Hagl as a fusion partner.
Antimicrobial peptides: The Antimicrobial Peptides that are particularly useful for the fusion proteins of the instant invention comprise linear, cationic, amphiphilic, alpha helical AMPs. Most preferred are the cathelicidins, magainins,
cecropins, SEQ ID NO:9, SEQ ID NO:33 and analogs thereof. It is preferred that the linear, cationic, amphiphilic, α-helical AMP comprises less than 50 amino acids. It is more preferred that the linear, cationic, amphiphilic, α-helical AMP comprises less than 30 amino acids.
Cleavage Methods: A preferred embodiment of the instant invention is the expression of linear, cationic, amphiphilic, α-helical antimicrobial peptides as fusion proteins with the Hagl peptide. In an additional preferred embodiment, the expressed fusion protein is cleaved to produce the individual antimicrobial peptide components comprising the fusion. In theory, any method for protein cleavage would be applicable herein. Methods that have been successfully used include both enzymatic and chemical cleavage. Enzymatic cleavage methods include thrombin, factor Xa and other endo peptidases, such as trypsin; the fusion genes would have to be synthesized to include cleavage sites for these proteases between the Hagl peptide and the additional AMP or AMPs comprising the fusion protein. Chemical methods include cleavage with cyanogen bromide at methionine residues, dilute acid cleavage at aspartyl-prolyl bonds, and hydroxylamine cleavage at asparagine-glycine bonds at pH 9. Cyanogen bromide, for example, cleaves at methionine residues, and thus to utilize this mechanism of cleavage the fusion protein must have a methionine between the individual antimicrobial peptide components; accordingly, the fusion gene must be generated to include the appropriate nucleotide sequence for methionine between Hagl and other AMP components. Similar strategies must be utilized for other chemical cleavage mechanisms. Strategies for the generation of fusion genes and methods for cleaving fusion proteins are well known in the art, and are described, for example, in Current Protocols in Protein Science (1995), John Wiley & Sons, Unit 5.
Methods for preparing synthetic genes:
In the instant invention PCR (Mullis, et al., U.S. Patent No. 4,683,202) was used to amplify and synthesize the synthetic genes for the expression of Hagl or of the Hagl fusion peptides comprising Hagl and at least one additional AMP. Typically, in PCR-type primer directed amplification techniques, the primers have different sequences and are not complementary to each other. Depending on the desired test conditions, the sequences of the primers should be designed to provide for both efficient and faithful replication of the target nucleic acid. Methods of PCR primer design are common and well known in the art (Thein and Wallace, "The Use of Oligonucleotide as Specific Hybridization Probes in the
Diagnosis of Genetic Disorders", In, Human Genetic Diseases: A Practical Approach, K. E. Davis, Ed., (1986) pp. 33-50 IRL Press, Herndon, VA; Rychlik, W. In, Methods in Molecular Biology, B.A. White, Ed., (1993) Vol. 15, pp. 31-39; PCR Protocols: Current Methods and Applications, Humana Press, Inc., Totowa, NJ; The Polymerase Chain Reaction (1994) Mullis, K.B., Ferre, F., and R. A. Gibbs (editors), Birkhaeuser, Boston). In the instant invention overlapping PCR primers were used to generate genes based on the amino acid sequences of the peptides of interest. "Overlapping PCR primers" are primers which contain common sequences of contiguous nucleotides; the overlapping sequences may be from about 15 to about 18 nucleotides in length; the primers are generally between 30 and 60 bases in length. Methods for using overlapping primers to synthesize genes can be found in PCR Protocols: Current Methods and Applications (Humana Press, Inc., Totowa, NJ). A nucleic acid fragment encoding Met-(Hag1 -[Antimicrobial Peptide]n)m can be prepared by: (a) synthesizing overlapping oligonucleotide primers comprising: (i) one or more portions of the sequence as set forth in SEQ ID NO:28; (ii) one or more portions of the sequence encoding an Antimicrobial Peptide; and (iii) a portion of the sequence spanning the fusion region of the individual components of the
fusion oligopeptide; wherein amplification of the overlapping oligonucleotide primers results in generation of the complete sequence of the nucleic acid fragment; and (b) amplifying the oligonucleotide primers to generate the nucleic acid fragment encoding the fusion oligopeptide. Primers and the PCR technique may also be used for the identification and cloning of homologs of Hagl or of known AMPs from nucleic acid (DNA or RNA) libraries. Synthetic genes can also be prepared by in vitro chemical synthesis using conventional methods as known in the art. Various commercial synthetic apparatuses are available, for example the automated synthesizer from Applied Biosystems (Foster City, CA). By using synthesizers, it would be easily possible to substitute unnatural amino acids, such as D-amino acids, for natural amino acids to enhance the stability or efficacy of the peptide in a manufactured product. Gene sequences encoding antimicrobial peptides can also be cloned from nucleic acid libraries using conventional methods and ligated to the gene sequence encoding Met-Hag1 (SEQ ID NO:27) or Hagl (SEQ ID NO:31).
Microbial Recombinant Expression The genes encoding the fusion oligopeptide Met-(Hag1- [Antimicrobial Peptide]n)m may be introduced into heterologous host cells, particularly in the cells of microbial hosts. Thus the instant invention provides a transformed host cell comprising an isolated nucleic acid fragment under the control of suitable regulatory sequences, the isolated nucleic acid fragment encoding a fusion oligopeptide, the fusion oligopeptide comprising Met, SEQ ID NO:31 and an Antimicrobial Peptide. Host cells preferred for expression of the instant genes and nucleic acid molecules are microbial hosts that can be found within the family of Gram negative bacteria, including enteric bacteria. Host cells also include
Gram negative bacteria that are protease deficient. For example Williams, et al. (U.S. Patent No. 5,589,364) describe a method for fusion of the AMP to the maltose binding protein as a fusion partner and increasing the effective level of production by expressing this protein in a protease deficient host. Because transcription, translation, and the protein biosynthetic apparatus is the same irrespective of the cellular feedstock, functional genes are expressed irrespective of carbon feedstock used to generate cellular biomass. Large scale microbial growth and functional gene expression may utilize a wide range of simple or complex carbohydrates, organic acids or alcohols, and saturated hydrocarbons such as methane. However, the functional genes may be regulated, repressed or depressed by specific growth conditions, which may include the form and amount of nitrogen, phosphorous, sulfur, oxygen, carbon or any trace micronutrient including small inorganic ions. In addition, the regulation of functional genes may be achieved by the presence or absence of specific regulatory molecules that are added to the culture and are not typically considered nutrient or energy sources. Growth rate may also be an important regulatory factor in gene expression. Examples of suitable host strains include, but are not limited to,
Gram negative bacteria. More preferred are the Gram negative, aerobic or facultatively anaerobic rods or cocci, such as members of the genera Escherichia, Pseudomonas, Klebsiella, Salmonella, Caulobacter, Methylomonas, Acetobacter, Achromobacter, Acinetobacter, Aeromonas, Agrobacterium, Alcaligenes, Azotobacter, Burkholderia, Citrobacter,
Comamonas, Enterobacter, Erwinia, Rhizobium, Vibrio and Xanthomonas. Most preferred is E. coli. Microbial expression systems and expression vectors containing regulatory sequences that direct high level expression of foreign proteins are well known to those skilled in the art. Any of these could be used to construct chimeric genes for production of the any of the gene products of the instant sequences. These chimeric genes could then be introduced into appropriate microorganisms via transformation to provide high level
expression of the peptides or proteins. It has been shown, for example, that introduction of the instant chimeric genes as set forth in SEQ ID NO:28, SEQ ID NO:29 or SEQ ID NO:30 under the control of the appropriate promoters into a host cell will result in expression of the peptides or proteins encoded by SEQ ID NO:27, SEQ ID NO: 16 or SEQ ID NO:26, respectively. Similarly, it is expected that introduction of genes encoding fusion proteins comprising the sequence Met-Hag1 fused to one or more linear, cationic, amphiphilic, α-helical antimicrobial peptides into a host cell under the control of the appropriate promoters would result in the expression of fusion proteins having the amino acid sequence Met-(Hag1- [Antimicrobial Peptide]n)m. In the instant invention the pL promoter system pLEX (U.S. Patent No. 4,874,702) was used, and it was found that when the pL promoter was operating and the Hagl peptide or Hagl fusion protein was being expressed, there was no effect on host cell growth or further production. Therefore, it is a further part of this invention that Hagl can be made by any inducible or constitutive promoter expression systems and not appreciably harm growth or accumulation of biomass in E. coli. A further embodiment of this invention is that the expression cassette containing the E. coli promoter and the Hagl protein coding region can be either plasmid borne or chromosomally integrated. A further embodiment would be for multiple copies of the E. coli promoter/Hag 1 coding region to be multimeric structures (tandem repeats) either chromosomally integrated or plasmid borne.
Vectors Vectors or cassettes useful for the transformation of suitable host cells are well known in the art. Typically the vector or cassette contains sequences directing transcription and translation of the relevant gene, a selectable marker, and sequences allowing autonomous replication or chromosomal integration. Suitable vectors comprise a region 5' of the gene which harbors transcriptional initiation controls and a region 3' of the DNA fragment which controls transcriptional termination. It is most
preferred when both control regions are derived from genes homologous to the transformed host cell, although it is to be understood that such control regions need not be derived from the genes native to the specific species chosen as a production host.
Promoters and Termination Control Regions Initiation control regions or promoters, which are useful to drive expression of the instant genes in the desired host cell, are numerous and familiar to those skilled in the art. Virtually any inducible or constitutive promoter capable of driving these genes in Gram negative bacteria, and particularly in £. coli, is suitable for the present invention including, but not limited to: lac, ara, tet, trp, IP\_, IPR, 17, tac, trc, malE (maltose binding protein promoter) and derivatives thereof. In the instant invention, the pL promoter system pLEX (U.S. Patent No. 4,874,702) was used to produce the Hagl peptide in £. coli at up to 1 g/L in fermenter cultures. The pLEX vector contains the pL promoter from phage lambda which is repressed by a temperature sensitive lambda cl repressor. The cl repressor is produced from a chromosomally integrated gene controlled by a tryptophan (trp) promoter. The trp promoter is regulated by a native E. coli trp repressor system. When tryptophan is limited, the trp promoter transcribes the lambda cl repressor that can repress expression of the pL promoter and limit transcription of the Hagl gene sequence. When tryptophan is added to the medium, the trp repressor binds to the trp operator and represses further expression of the cl repressor. When the temperature of the culture is raised to 37°, the remaining cl temperature sensitive repressor molecules denature and fall off of the pL operator sequence allowing transcription of the Hagl coding sequence. The pL promoter combines very high level transcription and is optimized for translation initiation. This two step repression control provides tight regulation of expression allowing the cloning of toxic gene products and controllable high level expression.
Termination control regions may also be derived from various genes native to the preferred hosts. Optionally, a termination site may be unnecessary; however, it is most preferred if included.
Preparation of antibodies: In the instant invention polyclonal antiserum was used to screen for expression of the hagl peptide, as well as to determine localization of the expressed hag 1 -containing peptides or proteins within the E.coli host. Methods for producing antibodies are well known to those skilled in the art. A discussion of strategies for polyclonal antibody production, including preparation of the immunogen, linking of small peptides to a carrier such as keyhole limpet cyanin or bovine serum albumin, selecting an animal and immunization can be found in Current Protocols in Molecular Biology ([1997] John Wiley & Sons, New York, Units 11.12 and 11.14. Methods for producing antibodies, including discussion of strategies for immunization and bleeding can be found in Current Protocols in Immunology ([1999], John Wiley & Sons, New York, Units 1 and 2). Polyclonal antisera or monoclonal antibodies could be used not only to detect and quantify, but also to affinity purify, Hagl , individual Antimicrobial Peptides or fusions thereof.
Industrial Production Where commercial production of Met-(Hag1 -[Antimicrobial Peptide]n)m is desired, a variety of culture methodologies may be applied. For example, large-scale production from a recombinant microbial host may be produced by both batch and continuous culture methodologies. Thus the instant invention provides a process for producing the fusion oligopeptide Met-(Hag1 -[Antimicrobial Peptide]n)m; the process comprises the steps of: (a) providing a transformed host cell comprising an isolated nucleic acid fragment under the control of suitable regulatory sequences, the isolated nucleic acid fragment encoding a fusion oligopeptide, the fusion oligopeptide
comprising Met, SEQ ID NO:31 and an Antimicrobial Peptide; (b) growing the host cell of (a) under suitable conditions whereby the fusion oligopeptide Met-(Hag1 -[Antimicrobial Peptide]n)m is produced; and (c) recovering the Met-(Hag1 -[Antimicrobial Peptide]n)m. The instant invention also provides a process for producing an
Antimicrobial Peptide; the process comprises the steps of: (a) providing a transformed host cell comprising an isolated nucleic acid fragment under the control of suitable regulatory sequences, the isolated nucleic acid fragment encoding a fusion oligopeptide, the fusion oligopeptide comprising Met, SEQ ID NO:31 and an Antimicrobial Peptide; (b) growing the host cell of (a) under suitable conditions whereby the fusion oligopeptide Met-(Hag1 -[Antimicrobial Peptide]n)m is produced; (c) cleaving the fusion oligopeptide Met-(Hag1 -[Antimicrobial Peptide]n)m to produce products comprising the Antimicrobial Peptide and Hagl ; and (d) recovering the Antimicrobial Peptide from the products; and (e) optionally recovering Hagl . A classical batch culturing method is a closed system where the composition of the medium is set at the beginning of the culture and not subjected to artificial alterations during the culturing process. Thus, at the beginning of the culturing process the medium is inoculated with the desired organism or organisms and growth or metabolic activity is permitted to occur adding nothing to the system. Typically, however, a "batch" culture is batch with respect to the addition of carbon source and attempts are often made at controlling factors such as pH and oxygen concentration. In batch systems the metabolite and biomass compositions of the system change constantly up to the time the culture is terminated.
Within batch cultures cells moderate through a static lag phase to a high growth log phase and finally to a stationary phase where growth rate is diminished or halted. If untreated, cells in the stationary phase will eventually die. Cells in log phase are often responsible for the bulk of production of end product or intermediate in some systems. Stationary or post-exponential phase production can be obtained in other systems. A variation on the standard batch system is the Fed-Batch system. Fed-Batch culture processes are also suitable in the present invention and comprise a typical batch system with the exception that the substrate is added in increments as the culture progresses. Fed-Batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the media. Measurement of the actual substrate concentration in Fed-Batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors such as pH, dissolved oxygen and the partial pressure of waste gases such as CO2- Batch and Fed-Batch culturing methods are common and well known in the art and examples may be found in Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition (1989) Sinauer Associates, Inc., Sunderland, MA, or Deshpande, Mukund V., Appl. Biochem. Biotechnol, 36, 227, (1992), herein incorporated by reference. Fermentation media in the present invention must contain suitable carbon substrates. Suitable substrates may include but are not limited to monosaccharides such as glucose and fructose, oligosaccharides such as lactose or sucrose, polysaccharides such as starch or cellulose or mixtures thereof and unpurified mixtures from renewable feedstocks such as cheese whey permeate, cornsteep liquor, sugar beet molasses, and barley malt. The carbon substrates may also comprise, for example, alcohols, organic acids, proteins or hydrolyzed proteins, or amino acids. Additionally the carbon substrate may also be one-carbon substrates such as carbon dioxide or methane for which metabolic conversion into key biochemical intermediates has been demonstrated. In addition to one and two carbon substrates, methylotrophic organisms are also known to utilize
a number of other carbon containing compounds such as methylamine and glucosamine, as well as methanol and a variety of amino acids for metabolic activity. Hence, it is contemplated that the source of carbon utilized in the present invention may encompass a wide variety of carbon containing substrates and will only be limited by the choice of organism. Commercial production of Hagl or Hagl fusion proteins may also be accomplished with a continuous culture. Continuous cultures are open systems where a defined culture medium is added continuously to a bioreactor and an equal amount of conditioned medium is removed simultaneously for processing. Continuous cultures generally maintain the cells at a constant high liquid phase density where cells are primarily in log phase growth. Alternatively, continuous culture may be practiced with immobilized cells where carbon and nutrients are continuously added, and valuable products, by-products or waste products are continuously removed from the cell mass. Cell immobilization may be performed using a wide range of solid supports composed of natural and/or synthetic materials. Continuous or semi-continuous culture allows for the modulation of one factor or any number of factors that affect cell growth or end product concentration. For example, one method will maintain a limiting nutrient such as the carbon source or nitrogen level at a fixed rate and allow all other parameters to moderate. In other systems a number of factors affecting growth can be altered continuously while the cell concentration, measured by medium turbidity, is kept constant. Continuous systems strive to maintain steady state growth conditions and thus the cell loss due to medium being drawn off must be balanced against the cell growth rate in the culture. Methods of modulating nutrients and growth factors for continuous culture processes as well as techniques for maximizing the rate of product formation are well known in the art of industrial microbiology and a variety of methods are detailed by Brock, supra.
Fusion Proteins:
This invention encompasses fusions of small alpha helical cationic AMPs to the Hagl peptide as an N-terminal carrier. Fusion with Hagl provides several advantages for expression and purification of small AMPs. For example, small AMPs are typically cationic with a pi in the range of 10-10.8. Hagl has a pi of 11.83. Fusion of the smaller peptides to Hagl would raise the pi of the fusion and assist in purification by cation exchange. For example, the peptide of SEQ ID NO:9 has a pi of 10.78. When fused with Hagl , the pi of the fusion is 11.86. Raising the pi would mean that purification of the fusion protein would be more easily enabled due to more specific loading and elution of the fusion molecule from chromatography resins. In the instant invention, the production of the fusion peptide Met- Hag1-3G-16KGLG1 (SEQ ID NO:26) was shown to be as efficient as production of Hagl alone using the pLEX system. In addition, the detection and quantification of the fusion proteins was facilitated by a polyvalent anti-Hag 1 antibody preparation. This antiserum was used to detect and quantify the Met-Hag1-3G-16KGLG1 (SEQ ID NO:26) and could be used to detect and quantify any fusion protein containing the Hagl carrier sequence. Therefore, an embodiment of this invention would be the fusion of any other small alpha helical cationic AMP sequence to the Hagl sequence to use as a carrier protein to enhance production in E. coli and subsequent purification. These sequences could include but are not limited to any published linear alpha helical AMPs such as cecropins, cathelicidins, magainins, SEQ ID NO:9, SEQ ID NO:33 or analogs thereof. These Hag1-small AMP fusions could be engineered to have proteolytic cleavage sites between the Hagl carrier and the small AMP sequence thereby allowing purification of the fusion using Hagl standardized methodology followed by cleavage to release the small AMP. Any cleavage mechanism could be used but preferred would be those that utilize non-toxic, low cost reagents such as the acid cleavage system described in Gram (H. Gram, et al., Bio/Technology, Vol.12, 1017-1023 (1994)).
Protein Purification: The fusion oligopeptides of the instant invention can be purified by any of the standard methods practiced in the art to separate proteins based on size, charge, ligand specificity or hydrophobicity. These methods include size exclusion, ion exchange, hydrophobic interaction, reversed phase and affinity chromatography. Affinity chromatography may utilize antibodies, or may, for example, take advantage of metal chelate techniques such as utilizing nickel-containing resin to purify His-tagged proteins. Methods for the purification of recombinantly expressed proteins are described in detail in Guide to Protein Purification (Deutscher (ed.), 1990, Methods in Enzymology, Vol. 182, Academic Press, San Diego, CA) or Current Protocols in Protein Science, supra (Units 6, 8 and 9). The choice of purification method depends not only on the protein properties, but also on the quantity to be purified.
Applications: The instant invention provides a method for cost-effectively producing and purifying linear, α-helical AMPs. The instant invention further provides a method for producing and purifying AMPs that are toxic to host cells or cannot be expressed by host cells due to proteolysis. Oligopeptides produced by the process of the present invention are effective as antimicrobials and can be employed to kill, inhibit the growth of, or prevent the growth of microorganisms such as Gram-positive bacteria, Gram-negative bacteria, viruses, and fungi. The peptides produced by the process of the present invention are effective in antimicrobial compositions for use against disease-causing organisms in humans, animals, aquatic and avian species, and plants. The oligopeptides and compositions thereof can also be used as preservatives or sterilants for articles susceptible to microbial contamination. The oligopeptides of the present invention and compositions thereof can be administered to a target cell or host by direct or indirect application. For example, the peptide may be administered topically, systemically or as a
coating. The peptides of the present invention and compositions thereof may also be bound to or incorporated into substrates to provide antimicrobial substrates to reduce or inhibit microbial contamination of the substrate. The present invention also provides articles comprising the antimicrobial substrates of the invention. Substrates suitable for the present invention include polymers selected from the group consisting of latex, polyvinyl chloride, polyimide, polyesters, polyethylene, polypropylene, polyamides, polyacrylates, polyolefins, polysaccharides, polyurethane, polysulfone, polyethersulfone, polycarbonate, fluoropolymers, cellulosics, synthetic rubber, silk, silicone, and mixtures or blends thereof. Additional polymer substrates are also functionalized polymer substrates comprising the aforementioned polymers and that additionally contain, or may be functionalized to contain, active groups with which peptides may react, and which allow for immobilization of the peptides. Examples of active groups include, but are not limited to: acrylic acid, acetal, hydroxyl, amines, epoxides, carboxylates, anhydrides, isocyanates, thioisocyanates, azides, aldehydes, halides, acyl halides, aryl halides and ketones at 1 to 50% by weight of the polymer. Various methods of protein or peptide immobilization are described in Protein Immobilization (Richard F. Taylor (ed.), Marcel Dekker, New York, 1991). Substrates suitable for the present invention also include ceramics, glass, metal, metal oxides, and composites comprised of ceramics, glass, metals or metal oxides plus polymers as described above. Suitable metals include steel, stainless steel, aluminum, copper, titanium, alloys thereof, and combinations thereof. Additional substrates suitable for the present invention include artificial (or synthetic) marble. Artificial marbles encompass cultured marble, onyx and solid surface materials typically comprising a resin matrix, the resin matrix comprising one or more fillers. Typically, cultured marble is made of a gel coating of unfilled unsaturated polyester on a substrate of a filled unsaturated polyester. The filler may be calcium
carbonate or a similar material. Onyx typically consists of a gel coat of unfilled unsaturated polyester on a substrate of filled unsaturated polyester. The filler in this case is typically alumina trihydrate (ATH). Solid surface materials are typically filled resin materials and, unlike cultured marble or onyx, do not have a gel coat. Corian® material available from E. I. du Pont de Nemours and Company (DuPont), Wilmington, DE, is a solid surface material comprising an acrylic matrix filled with ATH. An additional solid surface DuPont material, known by the brand name Zodiaq®, is described as an engineered stone or artificial granite. Such materials are made from an unsaturated polyester matrix filled with quartz. . The articles of the present invention have antimicrobial peptides of the invention bound to or incorporated into a substrate. The use of antimicrobial peptides for rendering substrates antimicrobial provides many advantages to traditional molecules in that peptides exhibit rapid biocidal activity, broad spectrum activity, reduced environmental toxicity and a reduced likelihood of causing organisms to become resistant. Peptides can be bound to a substrate either physicochemically, or covalently. Physicochemical binding of oligopeptides to the substrate may occur by any one or combinations of the following forces: electrostatic, hydrogen bonding, and Van der Waals. Alternatively, oligopeptides may be bound to the substrate surface by a covalent bond. Additionally, antimicrobial peptides of the present invention can be incorporated into the polymer by mixing with the polymer, for example by dissolving the peptide and the polymer in a common solvent and casting or molding the peptide:polymer mixture into an article. In one embodiment, the antimicrobial peptide is bound to the substrate by coating a substrate polymer with an aqueous or non-aqueous solution of the peptide, wherein the peptide is at concentration ranging from about 0.001 to about 20 weight percent. The peptide is contacted with the substrate polymer, and the peptide and polymer may be shaken at temperatures ranging from about 10°C to about 100°C for a period of time ranging from about 10 min to about 96 hrs. Preferably the peptide
and polymer are shaken at a temperature of from about 25°C to about 80°C for a period of time ranging from about 1 hr to about 24 hrs. In another embodiment, the substrate polymer is primed to generate active groups that will bind to the antimicrobial peptide. Surface modification of the polymer may be achieved by a variety of techniques well known in the art including: oxidation, reduction, hydrolysis, plasma, and irradiation. Substrate polymers containing acid or base hydrolyzable groups such as polyesters, polyamides, and polyurethanes may be treated with acid or base first. Subsequently, the hydrolyzed polymer is brought into contact with an aqueous or non-aqueous solution of from about 0.001 to about 20 weight percent of the antimicrobial peptide. The peptide and the polymer may be shaken at temperatures ranging from about 10°C to about 100°C for a period of time ranging from about 10 min to about 96 hrs. Preferably the peptide and polymer are shaken at a temperature of from about 25°C to about 80°C for a period of time ranging from about 1 hr to about 24 hrs. In another embodiment, a commercial substrate polymer containing 1 - 50%) active groups is brought into contact with an aqueous or non- aqueous solution comprising from about 0.001 to about 20 weight percent of the antimicrobial peptide. After treatment with the antimicrobial peptide, the article may be washed, preferably with deionized water. Optionally, the article may then be dried via methods known in the art. Such methods include ambient air drying, oven drying, and air forced drying. In one preferred embodiment, the article is dried at about 50°C to about 120°C, more preferably at about 50°C to about 100°C, for about 15 min to about 24 hrs. Articles comprising the polymer substrate of the present invention may be in the form of or comprise an extrudate, film, membrance, laminate, knit fabric, woven fabric, nonwoven fabric, fiber, filament, yarn, pellet, coating, or foam. Articles may be prepared by any means known in the art, such as, but not limited to, methods of injection molding, extruding, blow molding, thermoforming, solution casting, film blowing, knitting, weaving, or spinning.
The preferred articles of the present invention provide multiple uses, since many articles benefit from a reduction in microbial growth and a wide variety of substrates are included in the present invention. The following are examples of articles wherein it is desirable to reduce microbial growth in or on the article in the end-use for which the particular article is commonly used. The articles of the invention include packaging for food, personal care (health and hygiene) items, and cosmetics. By "packaging" is meant either an entire package or a component of a package. Examples of packaging components include but are not limited to packaging film, liners, absorbent pads for meat packaging, tray/container assemblies, caps, adhesives, lids, and applicators. The package may be in any form appropriate for the particular application, such as a can, box, bottle, jar, bag, cosmetics package, or closed-ended tube. The packaging may be fashioned by any means known in the art, such as by extrusion, coextrusion, thermoforming, injection molding, lamination, or blow molding. Some specific examples of packaging include, but are not limited to bottles, tips, applicators, and caps for prescription and non-prescription capsules and pills; solutions, creams, lotions, powders, shampoos, conditioners, deodorants, antiperspirants, and suspensions for eye, ear, nose, throat, vaginal, urinary tract, rectal, skin, and hair contact; lip product packaging, and caps. Examples of applicators include lipstick, chapstick, and gloss; packages and applicators for eye cosmetics, such as mascara, eyeliner, shadow, dusting powder, bath powder, blusher, foundation and creams. These applicators are used to apply substances onto the various surfaces of the body and reduction of bacterial growth will be beneficial in such applications. Other forms of packaging components included in the present invention include drink bottle necks, replaceable caps, non-replaceable caps, and dispensing systems; food and beverage delivery systems; baby bottle nipples and caps; and pacifiers. Where a liquid, solution or
suspension is intended to be applied, the package may be fashioned for application in a form for dispensing discrete drops or for spraying of droplets. The invention will also find use in pharmaceutical applications fashioned as inhalers. Examples of end-use applications, other than packaging, in the area of food handling and processing that benefit from antimicrobial functionality and wherein microbial growth is reduced in the particular end- use of the consumer are coatings for components of food handling and processing equipment, such as temporary or permanent food preparation surfaces; conveyer belt assemblies and their components; equipment for mixing, grinding, crushing, rolling, pelletizing, and extruding and components thereof; heat exchangers and their components; and machines for food cutting and slicing and components thereof. Where the surface of such equipment components is metal, the metal could be coated directly, or a coating of a polymer or functionalized polymer could first be applied to the metal surface. Alternatively, a film of such a polymer or functionalized polymer could be coated with an antimicrobial peptide of the invention and then applied to the equipment surface. Additional articles of the invention include foods and seeds. Articles of the present invention can also be used in or as items of apparel, such as a swimsuit, undergarment, shoe component (for example, a woven or nonwoven shoe liner or insert), protective sports pad, child's garment. Articles of the invention also include protective medical garments or barrier materials, such as gowns, masks, gloves, slippers, booties, head coverings or drapes. Articles of the present invention can also be used in or as medical materials, devices, or implants, such as bandages, adhesives, gauze strips, gauze pads, syringe holders, catheters such as central venous catheters and peripheral IV catheters, sutures, urinary catheter ostomy ports, orthopedic fixtures, orthopedic pins, pacemaker leads, defibrillator leads, ear canal shunts, vascular stents, cosmetic implants, ENT implants, staples, implantable pumps, hernia patches, plates, screws, blood bags, external blood pumps, fluid administration systems, heart-lung machines,
dialysis equipment, artificial skin, artificial hearts, ventricular assist devices, hearing aids, vascular grafts, pacemaker components, hip implants, knee implants, and dental implants. In the hygiene area, articles of the present invention include personal hygiene garments such as diapers, incontinence pads, sanitary napkins, sports pads, tampons and their applicators; and health care materials such as antimicrobial wipes, baby wipes, personal cleansing wipes, cosmetic wipes, diapers, medicated wipes or pads (for example, medicated wipes or pads that contain an antibiotic, a medication to treat acne, a medication to treat hemorrhoids, an anti-itch medication, an anti- inflammatory medication, or an antiseptic). Articles of the present invention also include items intended for oral contact, such as a baby bottle nipple, pacifier, orthodontic appliance or elastic bands for same, denture material, cup, drinking glass, toothbrush, or teething toy. Additional child-oriented articles that benefit through comprising the polymer substrate of the present invention include baby bottles, baby books, plastic scissors, toys, diaper pails, and a container to hold cleansing wipes. Household articles of the present invention include telephones and cellular phones; fiberfill, bedding, bed linens, window treatments, carpet, flooring components, foam padding such as mat and rug backings, upholstery components (including foam padding), nonwoven dryer sheets, laundry softener containing sheets, automotive wipes, household cleaning wipes, counter wipes, shower curtains, shower curtain liners, towels, washcloths, dust cloths, mops, table cloths, walls, and counter surfaces. The current invention is also useful in reducing or preventing biofilm growth on the surface of separation membranes (for example, pervaporation, dialysis, reverse osmosis, ultrafiltration, and microfiltration membranes) comprised of polymer substrates of the invention. In order to impart antimicrobial functionality to the products listed, the product can be treated with an antimicrobial peptide of the invention before it is manufactured, or after, or at any time during manufacture of the
product. For example, in making an antimicrobial shower curtain, an antimicrobial peptide of the invention may be bound to or incorporated into the polymer substrate, followed by fashioning a shower curtain from the treated material. Alternatively, treatment of the polymer substrate with an antimicrobial peptide of the invention may be performed after the substrate is made into a shower curtain. It is believed that the antimicrobial properties of the material will not change significantly. Antimicrobial substrates or articles prepared by methods of the invention exhibit antimicrobial functionality, wherein microbes are killed, or microbial growth is reduced or prevented. Antimicrobial activity of the antimcrobial substrate or article can be determined by using any of a number of methods well known in the art, such as the antimicrobial assay described in Example 10 of the present invention. Additional methods for determining antimicrobial activity are discussed in Tenover et al. (eds.), Manual of Clinical Microbiology, 7th Edition, Section VIM, 1999, American Society for Microbiology, Washington, DC. The present invention provides a method for killing, inhibiting, or preventing the growth of at least one microbe, the method comprising contacting the microbe with an effective amount of an antimicrobial fusion oligopeptide Met-(Hag1 -[Antimicrobial Peptide]n)m wherein: (i) n and m are integers from 1 to 25; and (ii) the Antimicrobial Peptide is selected from the group consisting of cathelicidins, magainins, cecropins, the oligopeptide as set forth in SEQ ID NO:9 and the oligopeptide as set forth in SEQ ID NO:33 and analogs thereof. The present invention provides antimicrobial compositions comprising at least one antimicrobial fusion oligopeptide Met-(Hag1- [Antimicrobial Peptide]n)m wherein: (i) n and m are integers from 1 to 25; and (ii) the Antimicrobial Peptide is selected from the group consisting of cathelicidins, magainins, cecropins, the oligopeptide as set forth in SEQ ID NO:9 and the
oligopeptide as set forth in SEQ ID NO:33 and analogs thereof. The antimicrobial fusion oligopeptide comprises from about 0.00001 % to about 20% by weight of the composition. In another embodiment of the invention the antimicrobial fusion oligopeptide comprises from about 0.0001 % to about 10%> by weight of the composition. In still another embodiment of the invention the antimicrobial fusion oligopeptide comprises from about 0.0001%) to about 5% by weight of the composition. The present invention also comprises methods for killing, inhibiting or preventing the growth of at least one microbe, the method comprising administering an effective amount of an antimicrobial composition comprising at least one antimicrobial fusion oligopeptide Met-(Hag1- [Antimicrobial Peptide]π)m wherein: (i) n and m are integers from 1 to 25; and (ii) the Antimicrobial Peptide is selected from the group consisting of cathelicidins, magainins, cecropins, the oligopeptide as set forth in SEQ ID NO:9 and the oligopeptide as set forth in SEQ ID NO:33 and analogs thereof. The present invention also comprises methods for killing, inhibiting or preventing the growth of at least one microbe, the method comprising bringing at least one microbe into contact with a substrate coated with an effective amount of at least one antimicrobial fusion oligopeptide Met- (Hag 1 -[Antimicrobial Peptide]n) wherein: (i) n and m are integers from 1 to 25; and (ii) the Antimicrobial Peptide is selected from the group consisting of cathelicidins, magainins, cecropins, the oligopeptide as set forth in SEQ ID NO:9 and the oligopeptide as set forth in SEQ ID NO:33 and analogs thereof.
EXAMPLES The present invention is further defined in the following Examples. It should be understood that these Examples, while indicating preferred embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Examples 10-14 are prophetic examples.
GENERAL METHODS Procedures for phosphorylations, ligations and transformations are well known in the art. Techniques suitable for use in the following examples may be found in Sambrook, J., Fritsch, E. F. and Maniatis, T.,
Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY (1989). Materials and methods suitable for the maintenance and growth of bacterial cultures are well known in the art. Techniques suitable for use in the following examples may be found as set out in Current Protocols in
Molecular Biology, (F. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G.
Seidman, J.A. Smith, K. Struhl, [editors], Wiley and Sons, Inc, New York,
New York, [2002]). All reagents, restriction enzymes and materials used for the growth and maintenance of bacterial cells were obtained from DIFCO Laboratories (Detroit, Ml), GIBCO/BRL (Gaithersburg, MD), or
Sigma Chemical Company (St. Louis, MO) unless otherwise specified. Materials and methods suitable for gel electrophoresis and Western blotting may be found in Current Protocols in Protein Science. (J.E.
Coligan, et al., [editors], Wiley and Sons, Inc, New York, New York, [2002]). Reagents were obtained from Invitrogen (Carlsbad, CA), Biorad
(Hercules, CA) or Pierce Chemicals (Rockford, IL) unless otherwise indicated.
The meaning of abbreviations is as follows: "hr" means hour(s), "min" or "min." means minute(s), "day" means day(s), "ml" means milliliters, "L" means liters, "μl" means microliters, "mM" means millimolar, "μM" means micromolar, "pmol: means picomol(s), "°" means degrees Centigrade, "RT" means room temperature, "bp" means base pair, "bps" means base pairs, "kDa" means kilodaltons.
Bacterial Strains And Plasmids: The pLEX expression system marketed by Invitrogen is subject to US Patent No. 4,874,702. The sequence for plasmid pLEX is available from Invitrogen. pLEX carries the PL promoter for high-level expression of recombinant protein, lambda ell ribosome binding site and initiation ATG for efficient translation of recombinant protein, the E. coli aspA transcription terminator, an ampicillin resistance marker, the ColE1 origin of replication and a polylinker region for cloning of gene inserts in appropriate juxtaposition to the PL promoter. E. coli strain GI724 has genotype F-, lambda-, laclq, lacPLδ, ampC::Pupcl, mcrA, mcrB, INV(rnnD- rnnE). This strain contains the cl repressor under control of the trp promoter (Mieschendahl, et al., Bio/Technology,4, 802-806, (1986)). E. coli strain ATCC No. 25922 is a wild type strain recommended for standard E. coli static bioassays.
Standard protocols: E. coli static bioassay: E. coli 25922 was grown overnight from a single colony. Log phase
E. coli cells were diluted to 2x105 CFU/ml in Trypticase Soy Broth (TSB; Difco). Experimental samples were added to the first row of a 96 well plate in duplicate and serially diluted with TSB across the plate. Ampicillin was used as the negative growth control at a starting concentration of 1 μg/ml. TSB was used as a positive growth control. Each well then received 0.1 ml of diluted E. coli for a final inoculation of 105 CFU/ml per well. Bioassay plates were incubated for 18 hr at 37°C and then scored for growth or no growth by visual inspection ("cloudiness") of each well. TSB
is composed of 1.7% pancreatic digest of casein, 0.3% papaic digest of soybean meal, 0.5 % NaCI, 0.25% dipotassium phosphate, and 0.25%) dextrose. HPLC analysis: Hagl and the Hagl fusion proteins expressed in E. coli cells were visualized by RP-HPLC as follows. Peptides were separated using an analytical Varian Dynamax Microsorb C4 column (300 Angstrom pore size, 10 micron particle size, 250 mm length X 4.6 mm ID) on a Varian (Walnut Creek, CA) ProStar HPLC system. Solvent A consisted of 95% water, 5% acetonitrile, 0.1% trifluoroacetic acid (TFA) and Solvent B consisted of 95% acetonitrile, 5% water, 0.1% TFA. The gradient was 10% B to 60% B over 25 minutes. The flow rate was 1 ml/min. Peptides were detected using a photodiode array detector at 214 nm; Hagl eluted at 16.9 minutes, corresponding to 44% B.
Western blot analyses: Antibodies to Hagl greatly aided in evaluating and visualizing Hagl production in recombinant E. coli. The Hagl peptide was chemically synthesized leaving a free COOH terminus; rabbit antibodies to the Hagl peptide were produced by Covance (Denver, PA). Hagl was conjugated 1 :1 to Keyhole Limpet Hemocyanin (KLH) for increased immunogenicity.
Immunization Schedule for elite rabbits:
Day 1 KLH-Hag1 500 μg each intradural inoculation into back, multiple sites
Day 20 KLH-Hag1 (250 μg/0.5 ml) each sub-cutaneous into nodal region
Day 40 KLH-Hag1 (250 μg/ml) each subcutaneous
Day 54 1st Bleed Day 68 KLH-Hag1 (250 μg/ml) subcutaneous
Day 78 2nd Bleed 3/28/02
A. Gel electrophoresis
Protein samples were prepared by addition of NuPage SampleBuffer dye (Invitrogen Life Technologies, Carlsbad, CA) (diluted to 1x in the sample), then heated at 70°C for 10 min prior to loading on the gel. Protein samples (10-20 μl) were loaded onto NuPage Bis-Tris 4-12% gradient gels (Invitrogen). Proteins were separated by electrophoresis in MES SDS buffer (50 mM 2-(N-morpholino) ethane sulfonic acid, 50 mM Tris, 3.47 mM SDS, 1 mM EDTA, pH 7.3) at 100 V for 1.5 hr or until the Phenol Red dye front was at the bottom of the gel.
B. Western Blotting Proteins in the gels were transferred to 0.2 micron nitrocellulose membranes at 30 V for 2 hr in NuPage Transfer buffer (25 mM Bicine, 25 mM Bis-Tris, 1 mM EDTA, 50 μM chlorobutanol with 20%o methanol, pH 7.2)
C. Visualization Transferred peptides were checked using 2% PonceauS stain on NC to assure transfer. The blot was blocked with Super Block (Pierce Chemicals; Rockford, IL) + 0.05% Tween 20 overnight at 4° The blot was then incubated with anti-Hagl primary antibody diluted 1 :100 in Super Block + 0.05%) Tween 20 for 1 hr with shaking at RT. The blot was washed thoroughly with Tris Buffered Saline + 0.05% Tween 20 (TBST). Goat anti-Rabbit Secondary antibody conjugated to Horse Radish Peroxidase was diluted 1 :100,000, added to the blot, and incubated for 1 hr with shaking at RT. The blot was washed thoroughly with TBST. The blot was incubated in Super Signal West Pico Rabbit IgG detection chemiluminescent substrate (Pierce Chemicals) (equal volumes of luminol/enhancer and stable peroxide buffer) for 5 min. Digital images generated on a Kodak imager (Model #440CF, Kodak; Rochester, NY) could be used to quantitate the amount of Hagl protein in samples.
Example 1
Cloning of the Haqfishl (Hagl) Peptide Seguence for Expression in E. coli.
The P|_ expression system (Invitrogen uses the P\_ promoter from bacteriophage lambda to drive transcription of the gene of interest. In the absence of tryptophan, the lambda cl repressor is under the control of the trp promoter and prevents transcription of the gene of interest. When tryptophan is added and the temperature raised, the repressor promoter is blocked and the temperature sensitive cl repressor falls off the P\_ operator. The trp promoter/cl repressor gene is located on the bacterial chromosome of E. coli strain GI724.
Synthesis of the gene encoding the Hagl protein sequence: The Hagl protein coding region (Figure 1) was synthesized in a PCR amplification reaction using the primers of SEQ ID NOs:1-4. The primers were diluted to 5 pmol/μl.
PCR amplification: The first round of PCR consisted of 5 pmol each of primers 080101- 1 , 080101-3, 080101-4, and 100101-5 (SEQ ID NOs:1-4), 1X Pfu polymerase buffer (Invitrogen), 0.4 mM dNTPs, and 2 units of Pfu polymerase in a 50 μl reaction. A Perkin Elmer thermocycler GENEAMP PCR System 9700 (Perkin Elmer Applied Biosystems; Branchburg, NJ) was used to incubate the reaction mix as follows: two cycles at 94°, 30 sec; 50° annealing, 1 min; 72°, 2 min; followed by 8 cycles with a 47° annealing temperature. Five μl of PCR product from the first round were removed and used as template for a second round of PCR amplification. This time short end-specific primers were used to amplify the entire gene sequence. Five pmol of each primer 080201-8 (SEQ ID NO:5) and 100101-7 (SEQ ID NO:6), 1.0X Pfu polymerase buffer, 0.4 mM dNTPs, and 2 μl of Pfu polymerase in a 100 μl reaction.
The reaction was incubated for 5 cycles of: 94°, 30 sec; 64°, 1 min; 72°, 2 min; followed by 30 cycles of 94°, 30 sec; 59°, 1 min; 72°, 2 min. Fragment sizes and purity were checked on 4% agarose gels in Tris Borate EDTA buffer (Sambrook).
Restriction digests: The PCR products were checked for size and quantity using 4% agarose gels. The fragments were digested with Ndel and BamHI by mixing 1μg PCR fragment, 1/10 volume 10X React 2 buffer, 33 μl of water and 10 units each of the Ndel and BamHI restriction enzymes. The mix was incubated at 37° for 4 hrs and then precipitated with ethanol for cleanup. The plasmid pLEX was digested with Ndel and BamHI following a similar protocol. After digestion, the plasmid was gel purified from a 1.5% agarose gel and the agarose removed using SpinX columns (Corning Inc.;
Corning, New York).
Ligations: The Hagl coding sequence was designed with flanking sequence that allowed it to be cloned into the Nde I and BamH I sites of the expression vector pLEX as shown in Figure 2. Linearized pLEX plasmid (50 ng) was mixed with 25 ng of insert and 0.5 units of T4 DNA ligase in 1X ligation buffer was added to a final volume of 10 μl. The mixture was incubated at 4° overnight. This ligation resulted in the plasmid depicted in Figure 3.
Transformation: To make cells electro-competent, E. coli G1724 cells were streaked onto Luria Broth (LB) agar plates supplemented with 100 μg/ml ampicillin (LB ampl 00) for single colony isolation, and a single colony was inoculated into 5 ml of LB amp100 broth and incubated at 37° overnight with shaking. Two ml of the overnight culture were used to inoculate 500 ml of LB amp100 in a 2 L flask, and this culture was incubated at 37° with
shaking at 300 rpm until an OD6oo of 0.5-0.6 was reached. Chilled cells were centrifuged to pellet cells, washed 1X in 500 ml ice cold water and centrifuged again. The cell pellet was resuspended in 500 μl of cold water and used for electroporation the same day. Electroporation was performed in 0.2 ml prechilled cuvettes with a Biorad GenePulser electroporation device set to 2.5 kV, 25 uF, and pulse controller to 200 (or 400) ohms. Cells were plated onto LB amp100 plates for selection of the pLEX transformants and grown for 24 hrs at 30°. Isolated resistant colonies were screened for insertion of the Hagl sequence in pLEX by analyses using PCR fragment length and restriction digests.
Sequence analysis: The Hagl encoding DNA fragment was successfully cloned into the pLEX vector for protein expression in E. coli. There were 12/24 isolates with the correct size insert, as determined by PCR analysis. Four of the isolates were chosen for sequence analysis and sequenced by standard methodology. The sequencing primers used were 080201-1 : GGTGACGCTCTTAAAAATTAAGCC (SEQ ID NO:7) and 080201-2: CCCTGTACGATTACTGCAGG (SEQ ID NO:8). One isolate containing plasmid pLH106 had the correct inserted sequence and was used for protein expression studies.
Example 2 Induction of Expression of the Haα1 Protein Using the pLEX System
Hagl was cloned into pLEX for expression in E. coli. Control of expression is manipulated by controlling the P|_ promoter from phage lambda. Repressor cl, driven by the trp promoter, is expressed in the absence of tryptophan and binds the operator region of the P|_ promoter, preventing transcription of Hagl Low temperature (30° C) also facilitates repression by the temperature sensitive repressor cl. When tryptophan is added, it binds the trp promoter operator region, preventing cl
transcription and subsequent translation. Raising the temperature to 37 °C denatures the temperature sensitive cl repressor. Repressor cl falls off the P|_ operator, allowing transcription of Hagl to proceed.
Shake flask studies: Single colonies of E. coli containing pLH106 were put into 5 ml Rich
Medium (RM) and grown overnight at 30 °C and 250 rpm. The formula for RM is: 1X M9 salts, 2.0% Casamino Acids, 1% glycerol, 1 mM MgCI2 and 100 μg/ml ampicillin. An aliquot of the overnight culture (0.5 ml) was added to 6 ml of Induction Medium and grown to OD550 of 0.5. Induction Medium contains little or no tryptophan: 1X M9 salts, 0.2% casamino acids, 0.5%) glucose, 1 mM MgC , 100 μg/ml ampicillin. For induction, tryptophan was added to a final concentration of 100 μg/ml, and the flasks were transferred to a 37 °C shaking incubator. Samples were taken at 0, 0.5, 1 , 2 and 4 hr post induction. Cells were pelleted by centrifugation and frozen at -20 °C until analyzed. The cells expressing Hagl protein continued to grow to about 3X the OD at induction and did not show observable lysis during this time. It was expected that the production of a lytic antimicrobial peptide internal to E. coli might result in lysis of the host cells. However, Hagl peptide did not appear to have that effect. Visualizing production of Hagl peptide was problematic, leading us to examine multiple methods for lysing the cells: lysozyme digestion, sonication, bead beater, and acid hydrolysis. Using HPLC, bioassay or an SDS-PAGE gel stained for total proteins, it was difficult to observe expression of the Hagl peptide under any of these conditions.
Fermentative growth: Since the level of biomass in shake flask studies was so low (OD550 of 0.5), the level of Hagl production was difficult to visualize. Ten liter Braun fermenters (B. Braun Biotech, Inc.; Allentown, PA) were used to grow and induce a higher biomass of Hagl producing cells. E. coli
transformant LH106 was grown overnight in 500 ml RM medium in a 2 L flask at 30 °C with shaking at 250 rpm (from 1.5 ml of a -80 °C stock). 500 ml of this overnight inoculum was placed in a 10 L fermenter containing minimal medium (Table 2) with setpoints (SP) as described in Table 3. The following parameters were controlled throughout the fermentation. Dissolved oxygen was maintained at 25%, or at a previously determined set point, through a cascade control scheme that increases agitation first followed by airflow. Pressure was maintained at 0.5 bar (7.5 psig) throughout the run. The pH was controlled at the desired set point, and temperature was maintained at 30 °C until induction at 37 °C. ODβoo, pH, and glucose were monitored every 2 hours. Glucose was maintained at approximately 1 % by glucose feed. Induction began at mid log phase (OD6oo of 30), with the addition of 100 μg/ml (1 g/10 L) tryptophan and an increase in temperature from 30 °C to 37 °C. Samples (200 ml) were collected at preinduction, 4, 6, 8, 12, 16, 20 and 24 hr post induction. An optimum time for harvesting was found to be from 8-16 hrs post induction. OD600 at stationary phase of this culture was between 60 and 80 units.
Table 2. Fermentation minimal medium
Tryptophan 10 ml 100 mg/ml
a"Modified Balch's Trace Elements" was modified from the original to include the following components (g/L): citric acid*H20, 4.0; MnSO4*H20, 3.0; NaCI, 1.0; FeSO4*7H20, 0.10; ZnSO4*7H20, 0.10; CuSO4*5H20, 0.010; H3BO3, 0.010; and Na2MoO4*2H20, 0.010 (Gerhardt, P., et al. [editors]; 1994, Methods for General and Molecular Bacteriology, p. 158, American Society for Microbiology, Washington, D.C.)
Table 3. Fermentation control setpoints Control Setpoints
Stirrer Speed Initial Value/SP: 390 RPM Low SP: 390 RPM High SP: 1500 RPM Comments:
Aeration
Initial Value/SP: 5 SLPM Low SP: 5 SLPM High SP: 30 SLPM g/L Dry Weight 3 OD550
Comments: Cell Molecular 101 g/gmol Weight * Gas Type: Air Specific 1.0 g/ml Gravity* Feed = 67% glucose (w/w)
Pressure Cell Formula:
Initial Value/SP: 7.5 PSIG C 4 Low SP: 7.5 PSIG H 7 High SP: 7.5 PSIG O 2 Comments: N 1
Temperature Acid: 20% H3PO4 Initial Value/SP: 30°C Base: 40% NH4OH Low SP: 30°C High SP: 37°C Comments: adjust temp prior to tryptophan addition
Initial Value/SP: 6.8 Low SP: 6.8
Table 3 cont.. Fermentation control setpoints Control Setpoints High SP: 6.8 Comments:
Dissolved Oxygen Initial Value/SP: 150 % Low SP: 25 % High SP: 150 % Comments:
Using these parameters, we routinely produced up to 1 g of the Hagl molecule/L of fermentation culture.
Example 3 Purification of the Hagl Molecule Produced by Fermentation
Extraction of Hagl and Hagl Fusion Protein from Recombinant E.coli Cell Paste: To a sample of frozen recombinant cell paste containing either the Hagl protein or Hagl fusion protein, two volumes of guanidine extraction solution (10 mM phosphate buffer, 137 mM sodium chloride, 2.7 mM KCI, 6 M guanidine hydrochloride, 1 mM EDTA, pH 8.5) were added (for example 10 grams of paste and 20 ml of guanidine extraction solution). The extraction solution was mixed continuously for one hour at room temperature. The extract was centrifuged (30 minutes at 12,000 rpm) to remove insoluble cell debris. The clarified guanidine extract was carefully removed from the cell debris pellet and HPLC solvent B was added at 1/3 volume. Sufficient solid phase adsorption material was added to the clarified guanidine extract to bind Hagl or the Hagl fusion proteins, (e.g., 1 gram of DSC 18 (Supelco [Sigma-Aldrich]; St. Louis, MO) was added to 20 ml of clarified guanidine extract). The guanidine/DSC18
suspension was stirred at room temperature for one hour until adsorption of the Hagl or Hagl fusion protein was complete. After adsorption was complete, the solid phase adsorption material was collected by either low speed centrifugation (4,000 rpm for 5 min), sedimentation or filtration. The solid phase adsorption material containing adsorbed Hagl or
Hagl fusion protein was washed twice with 10 volumes of solid phase adsorption wash solution. One gram of solid phase adsorption material was suspended in 10 ml of solid phase adsorption wash buffer and the wash solution was removed by low speed centrifugation, sedimentation or filtration. Hagl or Hagl fusion protein was eluted from the solid phase adsorption material by repeated 10 ml aliquots of a 50/50 (v/v) solution of HPLC solution A and HPLC solution B. Hagl or Hagl fusion protein could be recovered by removal of solvents by lyophilization. Further purification of lyophilized Hagl or Hagl fusion proteins was accomplished by preparative liquid chromatography using protocols similar to those described above for analytical RP-HPLC. Three peaks were identified by RP-HPLC; the material eluting with these peaks was collected and analyzed by Western blotting. The samples collected by RP-HPLC were then prepared for matrix assisted laser desorption/ionization (MALDI) mass spectrometry as follows. 2, 5- Dihydroxybenzoic acid was dissolved in acetone to make a saturated solution. One half μl of the acetone solution was applied to the MALDI target plate and allowed to dry. One half μl of the peptide solution in water was added to the dried matrix. The instrument used for the analysis was a PerSeptive Biosystems Voyager DE STR MALDI mass spectrometer (PerSeptive Biosystems, Inc.; Framingham, MA). Laser energy was selected to be just above the threshold for observation of the peptide signal, and ionization from 50 to 100 laser shots were averaged to produce each mass spectrum. Spectra were obtained in the linear mode. Using MALDI-TOF, it was determined that the three Hagl related species present in fermentation samples are the Hagl sequence plus an added methionine, the Hagl sequence plus methionine plus a formyl group and the Hagl molecule without the formyl or methionine residues. We believe
that these molecules represent inefficient processing and removal of the formyl-methionine residue added during translation initiation. All three species of the Hagl molecule were active against E. coli 25922 (see Table 5).
Example 4 Cloning of lytic peptide sequences as protein fusions on the C terminus of the Hagl protein seguence The antimicrobial peptide Hagl was expressed in E. coli without the aide of a fusion partner. The E. coli cells did not lyse during expression of Hagl internal to the cells, despite the high antibacterial activity of Hagl externally toward E. coli. Microscope studies indicated that Hagl may be translocated to the periplasm. Signal sequence data analysis corroborated this theory. Based on the literature, expression of shorter, less sequence diverse AMPs in E. coli would probably lead to lysis and low concentrations of peptide produced. Hagl may be a good candidate for a fusion to these other peptides, pulling them along into the periplasm and neutralizing the anti-E. coli activity while inside the cell. We might also expect some synergistic effects of peptides when fused to the Hagl protein sequence that would expand the spectrum of activity. In addition, a small additional cationic sequence fused to Hagl would result in a protein retaining the extreme pl of Hagl (pl-11.83) facilitating the use of cation exchange resins in the purification process. The peptide 16KGLG1 (SEQ ID NO:9) (Figure 4B) is a Dupont proprietary sequence (described in cofiled application CL-2305 herein incorporated by reference) with broad antibacterial and antifungal activity (Table 4).
This sequence was chosen for the first fusion trial. The amino acid sequence of the Hag1-16KGLG1 peptide fusion (SEQ ID NO:16) was backtranslated to E. coli preferred codons to give appropriate gene sequences for efficient expression in E. coli. Oligonucleotide sequences were designed to span the Hag1-16KGLG1 coding sequence, with overlaps of at least 15 bps with melting temperatures around 44 °C. The set of oligonucleotides designated by SEQ ID NOs 10 through 15 was used to generate a direct fusion of the nucleotide sequence encoding Hagl with the nucleotide sequence coding for 16KGLG1 This gene would code for the protein represented by SEQ ID NO:16. Initial rounds of PCR were done using these overlapping oligos (SEQ ID NOs: 10-15) to fill in and produce full length fusion sequences. A second round of PCR was done using 5' and 3' flanking primers designated by SEQ ID NOs 17 and 18 to amplify the complete coding sequence using normal PCR parameters. Restriction enzyme sites (Ndel on the 5' end and BamHI on the 3' prime end) were designed on each end of the coding region for directional cloning into the pL expression system (Invitrogen). Conditions and parameters for PCR amplification, restriction digests, ligation, and transformation were as described in Example 1 Isolates positive for this insert were sequenced using forward and reverse primers specific for the pLEX vector sequence (pLEX forward
[SEQ ID NO; 19] and pLEX reverse [SEQ ID NO:20]). The correctly inserted sequence was confirmed for isolate LH109 (containing pLH109), and this isolate was used in shake flask and fermentation production studies as described in Example 2. An alpha helical wheel projection of the oligopeptide Met-Hag1-16KGLG1 (Figure 5) reveals that this direct fusion would result in a skewing of the amphipathic structure of the molecule if a perfect helix is formed. It was possible that this structure might not be as efficient in antibacterial activity as one where the amphipathic structure was kept in register. Therefore, a second cloning was designed to insert three glycines between the Hagl molecule and the 16KGLG1 sequence of SEQ ID NO:16 to generate an isolate containing pLH108 which comprised the sequence Met-Hag1-3G-16KGLG1 (SEQ ID NO:30), thereby generating a perfect amphipathic helix as depicted in Figure 6. A similar PCR amplification scheme was used as described above using the primers designated by SEQ ID NOs 21 through 25 and SEQ ID NO:34. The secondary round of PCR amplification utilized primers designated by SEQ ID NOs 17 and 18. Restriction digests of vector pLEX and the PCR amplified fragment, ligation, transformation and PCR identification of cloned sequences were as described in Example 1.
Single colony isolates of LH108 (containing pLH108) with the correct insert of DNA encoding Met-Hag1-3G-16KGLG1 (SEQ ID NO:26) were used for shake flask and fermentative growth studies to observe expression of the fusion protein.
Example 5 Fusion protein expression in shake flask and 10 L fermenter cultures Isolates containing pLH108 and pLH109 were used in shake flask expression analyses as described in Example 2. As with the pLH106 construct, the induction of the Hagl fusion constructs did not cause lysis of the cells. Growth continued to increase after induction up to about twice the OD6oo at induction. Western blot analysis using the anti-Hagl protein was used to observe the presence of Hagl related proteins in cell
samples. We observed Hagl related proteins of 6.3 Kda (from LH109) and 6.6 Kda (from LH108) as predicted in samples from shake flask inductions after 4 and 21 hrs. However, bioassay of acid hydrolyzed broth samples did not have any antibacterial action on the test strain E. coli 25922. This indicated that the predicted fusion proteins were being produced in E. coli G1724 but that insufficient quantities of peptide were present in the acid hydrolyzed supernatant samples for observation of bioactivity. In order to increase recovery of the fusion proteins, the isolates containing pLH108 and pLH109 were grown in 10 L fermentation vessels with parameters as described in Example 2. The growth curves were very similar to the previous fermentations with Hagl alone suggesting that lysis of cells was not occurring. Samples were assayed over time for the presence of the 6.3 kDa protein (SEQ ID NO:16) encoded by pLH109 and the 6.6 kDa protein encoded by pLH108 (SEQ ID NO:26) using Western blot analysis. Fusion protein production was visible from both fermenter cultures at 2 hrs post induction, reached a maximum at 6 hrs and maintained the same concentration until 21 hrs post induction. Estimates of production rates from quantitation of Western blots indicated 0.8 g to 1.0 g of protein produced per liter of fermenter culture. This was comparable to production of the Hagl protein from the isolate containing pLH106 indicating that the fusion peptides are similarly non-toxic when internal to E. coli. Example 6 Purification and activity spectrum of Hagl fusion peptides The purification protocol described in Example 3 was repeated using cell paste from fermentations of LH108 and LH109 described in Example 5. Due to the similar physical properties of these proteins to the parent Hagl molecule, the protocol of Example 2 served to efficiently isolate both fusion peptides. Again the three isoforms (-met, +met, +met+formyl) of each Hagl fusion peptide were observed as three separable peaks using RP-HPLC and their identities were confirmed by
MALDI-TOF. Isolation of the peaks and purification of the three forms of the fusion from proteins encoded by pLH108 via RP-HPLC allowed us to assay activity of each form (Table 5). The activity of each form of the against E. coli was somewhat reduced compared to the parent recombinant or synthetic Hagl (SEQ ID NO:31). The fusion Met-Hag1- 16KGLG1 did not impart any observable activity against Candida albicans. However, the production and purification of the fusion peptides was as efficient as with Hagl itself demonstrating that the Hagl sequence can be used as a fusion partner with any linear alpha helical AMP for production 10 and purification using E. coli.
Table 5. Relative activity (1/μM MIC) for recombinant forms of Hagl

Constructs designed for the production of linear, alpha helical 15 AMPs using Hagl as the fusion partner can also include proteolytic cleavage sites, and transformants containing these constructs would be expected to have equivalent production rates to those described for the 16KGLG1 fusions in Examples 5 and 6.
Example 7 Cloning of 16KGLG1 directly fused to PL promoter The PL expression system was used as in Example 1. In this example, we cloned the coding sequence for 16KGLG1 (SEQ ID: 9), constructed as depicted in Figure 7, directly downstream of the PL promoter in the pLEX vector (Figures 8 and 9). The nucleotide sequence corresponding to 16KGLG1, depicted in Figure 7, was constructed by PCR using the primers as set forth in SEQ ID NOs 36-39 at 5 pmol/μl. First round PCR reactions were performed as described in Example 1 using SEQ ID NOs 36 and 37 as primers and with the following PCR protocol: 2 cycles, 94 ° for 30 sec; 54° for 1 min; 72° for 1 min; followed by 8 cycles, 94° for 30 sec; 5° for 1 min; 72° for 1 min; followed by extension at 72° for 2 min. For second round PCR, 5 μl of the first round PCR mix was used with 5 pmol each of the primers as set forth in SEQ ID NOs 38 and 39. The PCR cycles were: 5 cycles, 94° for 30 sec; 64° for 1 min; 72° for 1 min; followed by 30 cycles, 94° for 30 sec; 59° for 1 min;72° for 1 min; followed by extension at 72° for 2 mins. Ligations and transformation protocols were as described in Example 1 except the cloning sites were Ndel and Xbal in the vector pLEX with transformation into the £ coli GI724 expression strain. PCR analysis showed that 4 out of 12 isolates were positive for the correct size insert. Sequence analysis confirmed the insert and the strain was designated pLH113. In shake flask analysis of expression, we observed that the growth of pLH113 was similar to the Hagl expressing cells of Example 1 with no apparent lysis of the cells. There was no observable 16KGLG1 peptide observed when shake flask samples were visualized using SDS-PAGE gels. As in Example 1 , 10 L fermentation was done to amplify putative production of 16KGLG1 During the induction period no lysis was observed by optical density or microscopic examination as would be predicted if 16KGLG1 had been produced in substantial concentrations. In addition, no 16KGLG1 peptide was detected by HPLC analyses.
Therefore, we predict that the peptide was either not efficiently translated or was degraded very rapidly.
Example 9 Cloning and expression of the Hagl peptide using the T7 promoter system In order to confirm that Hagl could be produced in observable quantities using other promoter systems and not cause host cell lysis, we cloned the Hagl sequence into the pET11C plasmid for expression using the T7 promoter system. The pET system (Stratagene) is covered by patent 4,952,496. The pET-11C plasmid has the T7 promoter with Lac operator (F. W. Studier, et al., Methods in Enzymology Vol 185, 60-89 (1990)). PET vectors carry the T7 bacteriophage gene 10, along with its 5' leader sequence for high levels of transcription and translation. The gene 10 transcription terminator is used for efficient termination of transcription. The vector also contains a pBR322 origin of replication, an ampicillin resistance gene, and a poly linker region for cloning of gene inserts in appropriate juxtaposition to the T7 promoter. The £ coli strain BL21 (DE3) has the genotype F', ompT, hsdS (rB- mB-), dcm+, tetR, galΔ (DE3), endA. When induced with IPTG, de-repression of the lac UV5 promoter allows over-expression of the T7 RNA polymerase, leading to expression of the target gene. The Hagl protein coding region was synthesized as in Example 1 Restriction digests, ligation and transformation protocols were similar to Example 1 except the Hagl coding region was ligated into the Ndel and BamHI sites of the pET-11 c vector (Figures 10 and 11). The vector was transformed into the BL21 (DE3) £. coli B strain. Sequence analysis of transformants confirmed the correct juxtaposition of the insert fragment to the T7 promoter. The final isolate was designated pLH115. A single colony of pLH115 was grown in LB overnight, and the culture was then restarted in fresh LB and grown to an OD550 of 0.5, followed by induction using 1 mM IPTG. Cells expressing Hagl under the T7 promoter continued to grow through the induction period, with no
apparent lytic effect of Hagl overexpression. Western blot analysis determined that Hagl was produced at about 1.5% of the total protein in the cells.
EXAMPLE 10 Antimicrobial assay The antimicrobial activity of a polymer substrate or article may be evaluated using an Antimicrobial Assay. Test substance (polymer with immobilized peptide) or control substance (polymer alone) (50 mg suspended in 0.6M phosphate buffer (pH 7)) is added to a sterile culture plate well; a dilute suspension of bacteria (1 X 105 cells/mL final concentration in the well) in 0.6 mM phosphate buffer is added to the well for a final volume of 5 mL. The plate is shaken on a platform shaker at room temperature. At specified times (4 hours and 24 hours), an aliquot is removed from the culture plate (0.1 mL, in triplicates), and serial dilutions ranging from 1 to 100 fold are made for enumeration of cells on trypticase soy agar (TSA) plates. The TSA plates are incubated for 20 hr at 37°C, and the number of colony forming units (CFU) per mL is determined.