WO2005017198A2

WO2005017198A2 - Surface display expression system

Info

Publication number: WO2005017198A2
Application number: PCT/EP2004/009265
Authority: WO
Inventors: Wim De Coen; Yves Guisez; Marleen Maras; Johan Robbens
Original assignee: Aic
Priority date: 2003-08-18
Filing date: 2004-08-18
Publication date: 2005-02-24
Also published as: WO2005017198A3

Abstract

The present invention provides a biological surface display expression system for the on-line detection of stress-inducing or toxic compounds. The system relies on the expression of a chimeric gene under the control of a progressively-inducible promoter in a host cell. The system may also rely on the expression of a chimeric gene comprising a hotspot sequence under the control of a progressively-inducible promoter in a host cell. In another aspect, the present invention also relates to a method, using said biological reporter system for identifying and characterizing stress-inducing compounds. In a further aspect, the present invention relates to diagnostic kits for performing any of the methods according to the present invention.

Description

Surface display expression system

FIELD OF THE INVENTION

This invention relates to the field of genetic engineering, molecular biology, toxicology and pharmacology. In a first aspect, the present invention provides a biological surface display expression system for detecting stress-inducing compounds. In addition, the present invention also relates to methods for identifying and characterizing stress-inducing compounds and diagnostic kits for performing such methods.

BACKGROUND OF THE INVENTION

Assessing the potential adverse effects of environmental pollutants on man and biota is one of the crucial elements of the environmental risk assessment process. Since the 1950s an increasing number of chemicals have been produced and released into the environment by several types of industries. Various examples are known where products have been synthesized and used for decades because of their interesting physico-chemical properties, e.g. heat resistance, chemical stability, whereas afterwards it became clear that the same compounds were problematic for various habitats and ecosystems. Examples of such compounds are organo-chlorine chemicals, e.g. DDT, organo-bromine, e.g. flame retardants or organo-fluor compounds, e.g. CFC. Though many industries have become more aware of possible environmental impacts, generally persistent chemicals keep accumulating in water, soil and air, and threaten the global health of various ecosystems. Next to exposure through water and food, additional exposure of humans occurs through atmospheric distribution of pollutants originating from industrial activities such as incinerators and transport activities.

The major problem for new as well as for existing chemicals is the poor knowledge of the impact and effects of these chemicals on health and environment. Very few of these chemicals have been comprehensively tested for acute or chronic toxicity. This is the case, not only for individual chemicals, but also for chemical mixtures, irrespective of their use e.g. in production or in products, or of their distribution in waste or in wasted material. As a result of the intensive use of chemicals in our daily life, humans and biota are exposed during a full life cycle to a mixture of pollutants, usually at low concentrations. Also in the registration process of drugs for human or animal use, a major issue is the determination of the toxicity of the drugs. Toxicological testing of a drug prior to commercial production is required. The potential toxicity of new drugs is monitored and generally a large battery of toxicity, carcinogenicity, mutagenicity and reproduction/fertility tests in at least two species of live animals is required. However, besides cost, animal testing also presents disadvantages in terms of time, animal suffering and accuracy. Furthermore, animal testing has come under criticism by animal rights activists and the general public because of the severe suffering inflicted on the animals. Moreover, recent evidence calls into question the accuracy of animal testing. For example, variables, such as animal diet, may impair the predictability of animal tests in determining carcinogenic properties. It is therefore apparent that there is an urgent need for a quick, inexpensive and reliable alternative to toxicity testing in animals.

In several known methods for testing toxicity of compounds or drugs, living representative indicator organisms are used as biological monitors. The simplest and most convenient of these systems utilize unicellular microorganisms, since they are most easily maintained and manipulated. For instance, bacterial assays have been developed. Such assays are colorimetric, luminescent or fluorescent assays comprising the expression of reporter genes encoding an assayable product, for instance a luminescent protein, under the control of inducible stress-responsive promoters in bacteria. For instance, Sagi et al. 2003 (Sensors and Actuators B, Elsevier sequoia SA; Lausanne vol 90, no1-3; p 2-8) refer to the application of genetically modified bacterial strains, engineered to generate a quantifiable signal in response to pre-determined sets of environmental conditions. Inducible promoters fused to reporter genes, are used to evaluate environmental conditions. Practically, the bacteria are transformed with gene constructs comprising gene fusions between reporter genes (GFP, Lux) and inducible promoters, either SOS (e.g. recA) or heat shock promoters (e.g. grpE). However, in such assays, detection of the reporter gene product is time consuming and labor- intensive, since the bacterial cells need to undergo manipulation in order to detect the signals. Also, the signals generated by the stress-inducing compounds can be distorted by interfering compounds present in the environmental matrix or the extract thereof. The interfering compounds can interfere directly during signal measurement. In the prior art, the display of a reporter protein on the surface of a host cell has been reported. For instance, Shi et al. 2001 (Enzyme and microbial technology, 28 (1 ), p25-34) relates to the expression of GFP on the external cell surface of E. coli, by using a construction of a tripartite fusion protein, consisting of an OmpA domain and the mature GFP sequence, fused downstream of the first nine N-terminal amino acids of the mature outer membrane lipoproteine Lpp. The Lpp-OmpA-GFP fusion protein is put under the control of an inducible promoter, in particular a lac promoter. The constructed vector was introduced in E. coli, and GFP was targeted to the outer membrane of E. coli. However, the reported method is not suitable for detecting stress-inducing (toxic) compounds. More in particular, the lac promoter is giving a yes/no answer with a slow response time, which is useful in certain applications but totally irrelevant in a toxicological environment, where a fast and sensitive response to toxic compounds has to be measured. Moreover, using the reported system, the amount and effects of toxic compounds can not be determined. In fact, a lac promoter hardly allows any dosage effect and measurements can only be considered as qualitative.

Cellular reporter systems that have been used in prior art have mainly been based on fluorescence or luminescence. However, in an environmental context, this way of measuring gene expression or stress is very fragile as it is easily disturbed by turbidity of samples, colours of extracts or dyes, or by the spectral characteristics of the chemical to be tested. A good example of the relevance of this problem is provided by the Microtox assay (Microtox^® Rapid Toxicity Testing System; Azure Environmental), a popular cellular screening assay in environmental monitoring. This assay is based on the use of the marine luminescent bacterium Vibrio fischeri strain NRRL B-11177, to measure toxicity from environmental samples. When properly grown, luminescent bacteria produce light as a by-product of their cellular respiration. Cell respiration is fundamental to cellular metabolism and all associated life processes. Bacterial bioluminescence is tied directly to cell respiration, and any inhibition of cellular activity (toxicity) results in a decreased rate of respiration and a corresponding decrease in the rate of luminescence. The more toxic the sample, the greater the percent light loss from the test suspension of luminescent bacteria. However, use of these assays under certain sampling conditions is problematic, especially when samples are highly turbid and coloured. Turbidity of the sample causes problems in the assay readout. Furthermore, coloured samples may cause non-specific reductions in light level when analyzed which cannot be distinguished from those caused by toxicants. These limitations clearly illustrate the need for developing improved sensitive but yet robust measuring system that allow environmental screening at all conditions, including the screening of turbid and coloured samples.

Another problem associated with cellular reporter systems known in the prior art is that such systems generally enable the detection of environmental pollutants and toxic compounds, but do not provide sufficient information on the mode of action of the detected compounds.

In view of the above, there is a great need in the art for improved and easier methods for assessing the impact of environmental pollutants on ecological systems and to study the toxicological hazard of chemicals, wastes, pollutants, or drugs, which overcome the drawbacks of the above-described methods. There also remains a great need for improved methods which do not only permit to detect environmental pollutants and toxic compounds, but which also enable to elucidate the specific mode of action of such polluting compounds.

Therefore, it is a general object of the present invention to provide a sensitive biological test system employing an easy detection mechanism for identifying and characterizing various stress-inducing (toxic) compounds. In particular, it is an object of the present invention to provide methods and diagnostic kits enabling rapid and simple identification and characterization of stress-inducing (toxic) compounds or drugs. It is also an object of the invention to provide a sensitive biological test system, methods and kits employing an easy detection mechanism for detecting, identifying and elucidating the mode of action of specific stress-inducing (toxic) compounds or drugs.

Yet another object of the present invention consists of providing a test system and a method for characterizing the effects of an environmental matrix or an extract thereof on cells. The present invention also aims to provide a test system and a method for characterizing the interaction of different co-cultured host cell types either in the presence or the absence of (stress-inducing) compounds. The invention aims to provide a method that allows circumventing the commonly encountered problems with testing environmental samples or extracts such as e.g. color and turbidity. SUMMARY

The present invention provides a highly sensitive biological reporter system for detecting and characterizing toxicity levels of compounds. The invention relates to a biological reporter system displayed at the surface of a host cell.

In a first aspect the present invention relates to a chimeric gene encoding an assayable product and expressible in a host cell when preceded by an inducible promoter, said chimeric gene comprising - a targeting DNA sequence encoding a polypeptide capable of targeting said assayable product to the host cell membrane - a DNA segment encoding a transmembrane amino acid sequence capable of anchoring and exposing said assayable product in said host cell membrane towards the external surface, and - a DNA sequence encoding an assayable product, wherein said inducible promoter is a progressively-inducible promoter. The term "progressively-inducible promoter", as used herein refers to an inducible promoter which shows an induction level that is gradually increasing after induction. This term does not include promoters which show a maximal induction level at a single time-point, i.e. at the moment of induction. The progressively-inducible promoter fulfils at least one, and preferably two or three of the following parameters: being toxicologically-inducible; and/or showing a time-dependent progressive induction pattern; and/or showing a dose-dependent progressive induction pattern. In addition, such promoter is further preferably rapidly induced and shows a limited constitutive background activity.

In a preferred embodiment the progressively-inducible promoter is a toxicologically-inducible promoter that shows a time-dependent progressive induction pattern. In another preferred embodiment the progressively-inducible promoter is a toxicologically-inducible promoter that shows a dose-dependent progressive induction pattern. In yet another preferred embodiment the progressively-inducible promoter is a promoter that shows a time-dependent and a dose dependent progressive induction pattern. In yet another preferred embodiment the progressively-inducible promoter is a toxicologically-inducible promoter that shows a time- dependent and dose-dependent progressive induction pattern.

The terms "toxicologically-inducible promoter" and "stress-inducible promoter" are used herein as synonyms and both refer to a promoter of a gene that is activated in a cell when a specific stress-inducing or toxic compound is present. The terms "stress-inducing compound" or "toxic compound" are also used herein as synonym and both refer to a compound that disturbs the homeostasis of a cell and that causes cell damage. This term refers to any substance or environmental change that results in an alteration of normal cellular metabolism, gene expression, translation, or posttranslational modifications in a cell or population of cells, whereby this change results in cell damage. Toxic compounds may include, but are not limited to, chemicals, antibiotics, environmental pollutants, heavy metals, as well as agents producing oxidative damage, DNA damage or anaerobiosis.

With "dose-dependent progressive" induction pattern it is meant that the promoter generates a proportional response of transcription over a high dynamic range of concentrations of toxic compounds that are tested. The promoter shows an induction level that is a function of the concentration of toxic compound and that is gradually increasing with increasing concentrations of toxic compound. Preferably, the present promoter is able to shows a progressive increase in induction in function of concentration of toxic compounds over a concentration gradient that spans at least one order of magnitude and preferably at least two, at least three, at least four and preferably at least five orders of magnitude.

The term "time-dependent progressive" induction pattern refers to the fact that the promoter does not reach its maximal induction level at a single time-point, i.e. when induced, but that the promoter shows a gradual increase of its induction level in function of exposure time up to a maximal induction level.

The term "rapidly induced" refers to the ability to provide a detectable transcription signal within at least 6 hours after induction, and preferably within at least 4 hours after induction, and preferably within at least 2 hours after induction, and more preferably within at least 1.5 hour after induction and most preferably within at least 1 hour after induction. The term "a limited constitutive background activity" refers to a constitutive promoter activity that is as low as possible. Preferably an inducible promoter according to the invention promotes gene expression under non-induced conditions at a level that is lower than 10%, and preferably lower than 8%, and more preferably lower than 5%, and even more preferred lower than 2.5 %, and most preferred lower than 1 % of the maximal expression level promoted by the promoter under maximal toxic stress conditions.

Depending upon the host cell system utilized, a number of suitable promoters may be used. A preferred example of a suitable progressively-inducible promoter use in accordance with the present invention includes an arabinose promoter. A preferred example of a suitable toxicologically-induced promoter for use in accordance with the present invention includes a recA promoter.

The biological reporter system according to the invention is displayed at the surface of the detector-organism, being prokaryotic or eukaryotic, preferably a mammalian cell. The DNA sequence, which encodes an assayable product, is preceded by a segment of a transmembrane sequence for anchoring and exposing said assayable product in the cell membrane of a host cell towards the extracellular medium. The DNA segment encoding a transmembrane amino acid sequence is preceded by a targeting DNA sequence for targeting said assayable product to said host cell membrane. As a result, the assayable product of the reporter gene will be targeted on the cell surface of the host cell and suitably anchored in the host cell membrane, in order to allow a correct exposure of the reporter gene product to the extracellular space. Advantageously, the stress-inducible reporter system according to the invention allows on-line and immediate detection of the molecular response of the reporter protein without prior lysis or additional manipulation of the cell population.

Furthermore, the use of an inducible promoter as defined herein for controlling the expression of above-described chimeric gene provides several important advantages. It enables to identify and detect toxic compounds in a sample. It further allows performing toxicological assays having both a quantitative and qualitative character. These two characteristics are the main characteristics for a desirable toxicological characterisation of a molecule. In a second aspect, the present invention relates to a chimeric gene encoding an assayable product and expressible in a host cell, wherein said chimeric gene further comprises an artificial DNA sequence, said artificial sequence providing a defective transcription or translation of said chimeric gene. A major advantage of the biological reporter system according to the invention involves the possibility to detect chemicals with a specific mode of action, such as mutagens. In a particularly preferred embodiment, the invention relates to a chimeric gene, which further comprises an artificial DNA sequence, being created between the promoter and the targeting sequence of the reporter gene, which provides a defective transcription or translation of said chimeric gene. In particular the artificial gene comprises a mutational hotspot sequence. As used herein, the term "mutational hotspot sequence" refers to a sequence where mutations occur at a greater frequency than seen in the genome as a whole. By cloning specific mutational hotspot sequences downstream a stress-inducible promoter and in front of a reporter gene, according to the invention, the induction of the reporter gene for surface display becomes dependent on the presence of mutagens in the sample to be analyzed. The action of a mutagen is needed to restore proper translation of the reporter gene cloned behind the hotspot sequence. Thus, the artificial gene can reveal the presence or the absence of a specific mutagen in a solution.

In accordance to the present invention, several categories of mutagens can be distinguished in function of their mechanisms. By cloning specific mutational hotspot sequences, the present invention enables to reveal the mode of action of a detected mutagen. Since different hotspot sequences are only susceptible to enhanced mutagenesis by specific categories of mutagens, successful mutation of these sequences reveals what kind of mutagen is present in the sample to be analyzed and also gives an indication about the mode of action of the mutagen tested. Successful mutagenesis of the hotspot sequence can be observed immediately after expression of the reporter protein.

The present invention further relates to recombinant vectors carrying a chimeric gene according to the present invention, and to a host cell transformed with such vector.

In yet another aspect, the present invention relates to methods for identifying and characterizing a stress-inducing compound in a sample (e.g. environmental pollutants), for identifying and characterizing the toxicity of a drug, for identifying and characterizing an antitoxin to a stress-inducing compound or drug or for identifying and characterizing a stress- inducing compound or drug having a decreased toxicity.

In a further aspect, the present invention also relates to a test system and methods for identifying and characterizing the effects of an environmental matrix or an extract thereof on host cells. In addition, the present invention also provides a test system and methods for identifying and characterizing interactions between different co-cultured host cell types either in the presence or the absence of (stress-inducing) compounds.

According to a preferred embodiment, the methods according to the present invention comprise direct and/or indirect detection of the assayable product displayed at the surface of the host cell. Direct detection methods may comprise colorimetric, fluorimetric, luminescence or flow cytometric detection techniques. Indirect detection methods are preferably based on immunolabelling such as flow cytometric techniques, immunoassays, Western blots etc... In another aspect, also bacteriophage-based detection methods may be used for detection of the assayable product displayed at the surface of the host cell. In addition, any other or additional physico-chemical measurement technique may be used for detection of the assayable product displayed at the surface of a host cell, such as but not limited to e.g. measurement techniques based on protein-protein-interactions, ligand-protein and receptor- ligand interactions, electrode-based interaction, etc..

The present invention also provides diagnostic kits for performing the methods according to the present invention.

The methods and kits according to the invention are particularly suitable for the identification and evaluation of stress-inducing compounds in general, and of mutagens in particular, which are present in the environment. The methods and kits are also particularly suitable for identifying the toxicity of drugs, and for use in drug design. Other advantages and applications of the present invention will become clear form the following detailed description and accompanying examples. DETAILED DESCRIPTION

The present invention relates to a novel technology, methods and diagnostic kits for detecting and characterizing stress responses in cells caused by stress-inducing compounds or drugs, and to identify and characterize compounds or drugs having a stress-inducing activity. The present invention further relates to a reporter system, methods and diagnostic kits for detecting and determining the mode of action of stress-inducing compounds or drugs. The present invention also relates to a novel technology, methods and diagnostic kits particularly suitable for identifying and characterizing interactions of different cell cultures when co- cultured, either in the presence or the absence of (stress-inducing) compounds.

A particular class of stress-inducing compounds includes the genotoxic chemicals or mutagens. "Genotoxic chemicals" or "mutagens", as used herein refer to substances or agents that causes DNA damage in a cell. Such damage can potentially lead to the formation of a malignant tumor, but DNA damage does not lead inevitably to the creation of cancerous cells. In case of genotoxic events, alteration of DNA can take place through a variety of mechanisms, which are known to be chemical-specific. Several categories can be made according to the mechanisms: nucleotides can be alkylated, oxidated, deaminated or hydroxylated. Bulky products can be covalently added to nucleotides to destabilize DNA- basepairing or base analogs can be incorporated. Other mutagens intercalate between the DNA strands and provoke insertion- or deletion mutations.

As used herein, the term "drugs" refers to pharmaceutical compositions or medicaments.

In a first embodiment, the present invention relates to a chimeric gene encoding an assayable product and expressible in a host cell when preceded by a inducible promoter, said chimeric gene comprising - a targeting DNA sequence, encoding a polypeptide capable of targeting said assayable product to the host cell membrane, - a DNA segment encoding a transmembrane amino acid sequence capable of anchoring and exposing said assayable product in said host cell membrane towards the external surface, and - a DNA sequence encoding an assayable product, wherein said inducible promoter is a progressively-inducible promoter. For the purposes of expressing a cloned DNA construct of the present invention, progressively-inducible promoters are used in the present invention that fulfil at least one, and preferably two or three of the following parameters: a) being toxicologically-inducible; b) showing a time-dependent progressive induction pattern; c) showing a dose-dependent progressive induction pattern. In addition such promoters also preferably are d) rapidly induced and e) show a limited constitutive background activity. These parameters are defined in more detail in the "summary" section.

In order to be useful for toxicology testing, the progressively-inducible promoters used according to the present invention preferably are informative on the type of toxicological damage that is occurring in the cell. Toxicological informative means that mechanisms of the toxicological mode of action in a cell can be elucidated, such as 1 ) information on which type of molecule (lipid, protein, nucleic acid, carbohydrate, vitamin, hormone... or combinations hereof) or pathway that is affected by the chemical; 2) information on a repair mechanism that is initiated or induced inside the cell; 3) information on the type of elimination, excretion or biotransformation pathway that is affected or a combination of these 3 steps. The type of promoter that is used for such purpose depends on the types of molecules or types of damage that are investigated. Good examples of such toxicologically-inducible promoters for stress-related phenomena are given in WO 94/13831 , which is incorporated herein by reference.

Other promoter parameters to which a progressively-inducible promoter in accordance with the present invention need to fit include showing a time-dependent progressive induction pattern and/or showing a dose-dependent progressive induction pattern. To become toxicologically useful a promoter is required that shows a gradual (progressive) increase in induction and does not reach his maximal induction level in a small concentration gradient but at least over one order of magnitudes. As a reporter protein is exposed at the surface of the cell, induction of such heterologous protein on the cell surface needs to be built up gradually. Massive expression at the cell membrane will ultimately damage the cell's outer barrier and will destroy the cell. Therefore an progressively inducible, highly controllable promoter with a high dynamic range of response is required: an inducible promoter that is able to increase protein expression as a function of these two variables (time and concentration) is particularly useful as it permits to provide results and information of dose-response relationships at various time intervals, information which is highly required in toxicological experimentation. In order to obtain such information, it is not sufficient to fuse any inducible promoter to a chimeric gene according to the invention, since not all inducible promoters show a gradual (progressive) induction pattern. An example hereof is for instance the lac promoter. Promoters related to toxicological events are suitable in accordance with the present invention, since they control the expression of genes involved in protection mechanisms of a cell and preservation mechanisms of its vital functions depending on the level of damage or impact that is occurring.

Rapid detection of a toxic impact is another important prerequisite for toxicological screening as it is desired to generate toxicological information in the shortest time frame possible. Therefore, promoters are desired for driving a chimeric gene according to the invention, that show a rapid induction after a short time frame. In particular, it was demonstrated herein that using toxicologically-inducible promoters coupled to a membrane expressible protein, in accordance with the invention, a sufficient signal could be measured after less than 6 hours, and in particular after less than 4 hours, and even better after less than 2 hours. Such rapid response time is desired, since screening assays are usually performed in a semi high- throughput environment wherein toxicity of a sample or compound is preferably evaluated in the shortest possible time frame.

A progressively-inducible promoter used in accordance with the present invention preferably further shows a limited constitutive background activity. Promoter leakage is another important and unwanted aspect of promoters. In a toxicological context leakage is unacceptable, considering the mentioned required dynamic dosage effect, but more important here is the necessity to detect all possible toxic effect, however without drawing wrong conclusions from 'false positives'. Preferably, a toxicologically-inducible promoter used in accordance with the present invention shows a limited constitutive background activity. In particular such promoter promotes gene expression under non-induced conditions at a level that is lower than 10%, and preferably lower than 5%, of the maximal expression level promoted by the promoter under maximal toxic stress conditions. The structure of the chimeric gene according to the invention is as follows. In a preferred embodiment, the targeting DNA sequence precedes said transmembrane sequence, which in its turn precedes a DNA sequence encoding an assayable product.

The biological reporter system according to this embodiment of the invention is based on the following approach: a promoter of a progressive stress-inducible nature linked to a toxicologically relevant phenomenon is linked to a gene, i.e. a "reporter gene", which produces a measurable product. This reporter gene has been inserted into a cell, which responds to stress by making the reporter gene product. To complete the monitor system, the reporter gene has been genetically designed for rapidly and easily providing an assayable reporter gene product activity at the surface of a host cell. Display and attachment at the surface of the detector-organism enables on line and easy detection of a reporter gene product without additional lysis or manipulation of the host cell. Readout of the results can be carried out rapidly and simply with the intact organism, without the necessity of disruption of the cell or extraction of the polypeptide or enzyme to be measured. The assay can be performed easily in the laboratory or in the field, by personnel with minimal training.

In another embodiment, the invention relates to a chimeric gene, which is expressible in a prokaryotic host cell selected from the group comprising G+ bacteria and G- bacteria. In another embodiment, the invention relates to a chimeric gene, which is expressible in an eukaryotic host cell preferably selected from the group comprising yeast or mammalian cells.

An important element in the chimeric gene fusion according to the invention comprises a targeting DNA sequence. Such "targeting DNA sequence" is intended to indicate a sequence encoding a polypeptide capable of targeting the fusion polypeptide, encoded by the chimeric gene, to the host cell membrane. It will be clear from the present invention that the term "host cell membrane" may refer to different cell structures depending on the type of host cell applied according to the invention. In an example, this term refers to the inner membrane of G^" bacteria or to the cell membrane of G⁺ bacteria.

In prokaryotic cells, targeting sequences are well known and have been identified in several membrane proteins and periplasmic proteins, including in the E. coli lipoprotein (Lpp). Generally, as is the case for Lpp, the protein domains serving as localization signals are relatively short. The E. coli Lpp targeting sequence includes the signal sequence and a part of the outer membrane protein amino acid sequence, in particular the first 9 amino acids of the mature protein. These amino acids are found at the amino terminus of Lpp. Other secreted proteins from which targeting sequences may be derived include TraT, OsmB, KlpB and lacZ. Lipoprotein 1 from Pseudomonas aeruginosa or the PA1 and PCN proteins from Haemophilus influenza as well as the 17 kDa lipoprotein from Rickettsia rickettsij and the H.8 protein from Neisseria gonorrhea and the like may be used.

Yet another important element in the chimeric gene fusion according to the invention comprises a DNA sequence encoding a transmembrane amino acid sequence. Such "transmembrane amino acid sequence" is intended to denote an amino acid sequence capable of transporting a polypeptide through the membrane of a host cell and to assure an efficient membrane anchoring and correct exposure of the polypeptide to the external surface of the host cell. Transmembrane proteins serve a different function from that of targeting sequences and generally include amino acid sequences longer than the polypeptide sequences effective in targeting proteins to the host cell membrane. DNA sequences encoding a transmembrane amino acid sequence are well known and have been identified in several prokaryotic organisms, including G+ bacteria and G- bacteria.

In another embodiment of the present invention, the DNA sequence encoding an assayable product is a reporter gene. This DNA sequence is positioned downstream from the DNA segment encoding the transmembrane sequence. The term "reporter gene" as used herein, refers to nucleic acid sequences encoding assayable proteins. The choice of reporter genes to be used is essentially limitless, as long as a DNA sequence encoding the assayable product has been characterized; and the product of the gene can be detected. Sufficient characterization includes knowledge of the entire coding sequence and availability of a cDNA molecule. For example, the assayable product is, chloramphenicol acetyl transferase (encoded by the cat gene), galactose kinase (encoded by the galK gene), ?-glucosidase (encoded by the gus gene), glutathione transferase or luciferase (encoded by the lux gene), LamB protein (encoded by the lamB gene) or green fluorescent protein (encoded by the GFP gene). Most preferably, the GFP gene is employed, and even more preferably a mutated version of the GFP gene, GFPmut2 is used. In addition, it will be clear that any other gene encoding an assayable protein, including newly identified genes, may be used in accordance with the present invention.

In a preferred embodiment, a toxicologically-inducible promoter is used to control the expression of above-described chimeric gene. As defined above, a "toxicologically-inducible promoter" as used herein refers to the promoter of a gene responsive to a stress condition such as but not limited to heat stress, redox stress, DNA stress, protein stress, energy stress, osmotic stress, pH stress or membrane stress. The term "stress promoter induction" refers to conditions, which either increase or decrease the level of expression of assayable gene product.

The term "heat stress", as used throughout this application, refers to conditions, which disrupt cellular metabolism in a cell, and may be induced by heat stress inducing factors such as heat, cold or oxygen deprivation.

The term "redox stress", as used throughout this application, refers to conditions which vary from the normal reduction/oxidation potential ("redox") state of the cell. Redox stress includes increased levels of superoxides, increased levels of peroxides, both hydrogen peroxide and organic peroxides, decreased levels of glutathione and any other conditions which alter the redox potential of the cell, such as exposure to strong reducing agents.

The term "DNA stress", as used herein, refers to alterations to deoxyribonucleic acid or to precursor nucleotides. For example, DNA stress includes, but is not limited to, DNA strand breaks, DNA strand crosslinking, ionizing stress, exposure to DNA intercalating agents, both increased and decreased superhelicity, oxidative DNA damage, DNA alkylation, oxidation of nucleotide triphosphates and alkylation of nucleotide triphosphates. The term also includes inhibition of DNA synthesis and replication.

"Protein stress", as used throughout the application, refers to alterations to proteins or individual amino acids, as well as perturbations of intracellular transport of proteins. The term includes, but is not limited to, denaturation of proteins, misfolding of proteins, chelation of protein cofactors, cross-linking of proteins, both oxygen dependent and -independent oxidation of inter- and intra-chain bonds, such as disulfide bonds, alkylation of proteins, oxidation of individual amino acids and protein damage caused by exposure to heavy metals, such as cadmium.

The term "energy stress" encompass conditions which affect ATP levels in the cell. Examples of energy stress are forced anaerobic metabolism in the presence of oxygen, perturbations of electron transport and exposure to uncoupling agents.

The term "osmotic stress", as used throughout this application, refers to conditions, which cause perturbations in the maintenance of the internal osmolarity of a cell at a relatively invariant level in face of fluctuations in the osmolarity of the environment.

The term "pH stress", as used herein, refers to conditions, which cause perturbations in intracellular pH, i.e., which decrease intracellular pH below about 6.0 or increase intracellular pH above about 7.5. pH stress may be caused, for example, by exposure of the cell to ionophores or other cell membrane damaging components, or exposure to weak organic hydrophobic acids, such as phenolic acid. The term also includes cell membrane damage and deleterious changes in electromotive potential.

The term "membrane stress", as used throughout this application, refers to conditions which perturbations in the organisms' membrane(s).

In addition to those types of stress described above, it is clear that promoter of genes of which the expression is altered upon other type of stress conditions can be used as stress- inducible promoters.

Suitable stress-inducible promoters for use in prokaryotic cells may thus include but are not limited to promoters of genes responsive to heat stress, redox stress, DNA stress, protein stress, energy, osmotic stress or pH stress.

In eukaryotic cells, whereas every gene is controlled by a unique promoter, genes which respond to identical stresses may contain a common response element within their promoters. Accordingly, the same response element is responsible for inducing expression of a family of genes upon exposure to a certain stress. In order to operatively link such a response element to a heterologous gene, it must first be ligated to a minimal promoter. A minimal promoter is one that constitutively causes a basal expression of a gene operatively linked thereto. These minimal promoters are well known in the art. This minimal promoter/response element construct is then operatively linked to the heterologous gene by well-known recombinant DNA methods. It is thus to be understood that suitable stress- inducible promoters for use in eukaryotic cells may comprise promoters of genes responsive to heat stress, redox stress, DNA stress, protein stress, energy, osmotic stress or pH stress, as well as stress responsive elements operably linked to a minimal promoter in order that the resulting construct functions like a progressively-induced stress promoter.

It should be noted that although all eukaryotic cells contain numerous stress-inducible promoters within their genomes, some of those promoters may or may not be activated upon exposure to the proper stress. This is especially true in higher eukaryotic cells, such as mammals. Promoters isolated from those cell lines that do respond to almost all of the appropriate stresses are preferred for use in this invention.

In addition to those promoters described above, new toxicologically-inducible promoters that may be discovered and characterized may also be employed in the methods and kits of this invention.

In another embodiment the invention provides a chimeric gene encoding an assayable product and expressible in a host cell when preceded by an inducible promoter, said chimeric gene comprising: - a targeting DNA sequence, encoding a polypeptide capable of targeting said assayable product to the host cell membrane a DNA sequence encoding a transmembrane amino acid sequence capable of anchoring and exposing said assayable product in said host cell membrane towards the external surface and - a DNA sequence encoding an assayable product wherein said chimeric gene further comprises an artificial DNA sequence, said artificial sequence providing a defective transcription or translation of said chimeric gene. According to this embodiment of the present invention, the chimeric gene comprises an artificial DNA sequence and is preceded by an inducible promoter. Inducible promoters used in the present invention must be operatively linked to the chimeric gene. The term "operative linkage" refers to the positioning of the promoter relative to the chimeric gene encoding the assayable product such that transcription of the gene is regulated by the promoter. Such positioning is well known in the art and involves positioning the promoter upstream (5¹) of the gene so that no transcription termination signals are present between the promoter and the gene. A promoter sequence Operatively linked' to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the promoter sequence.

Examples of suitable inducible promoters for use according to the present invention in prokaryotic cells are well known in the art and may comprise, but are not limited to promoters such as those described in EP 651 ,825, which is incorporated herein by reference.

Examples of suitable inducible promoters or response elements for use in eukaryotic cells according to the present invention are well known in the art and may comprise, but are not limited to promoters or response elements such as those described in WO 94/17208, which is incorporated herein by reference.

In this particular embodiment, the invention relates to a chimeric gene, which further comprises an artificial DNA sequence. As used herein, the term "artificial DNA sequence" or "artificial gene" refers to a DNA sequence or gene that provides a defective transcription or translation of the chimeric gene. Such chimeric gene is preceded by a functional inducible promoter. Preferably, the artificial gene is created between the promoter and the DNA sequence encoding an assayable product. More preferably, the artificial DNA sequence precedes the targeting DNA sequence of the chimeric gene. The artificial gene can be used as a tool to reveal the mechanism by which a mutagen acts. Therefore, in this gene, the start codon is followed by a mutational hotspot sequence or is in the mutational hotspot sequence.

As used herein, a "mutational hotspot sequence" refers to a gene sequence, which has certain DNA base sequences that are highly susceptible for mutation, induced by e.g. carcinogenic chemicals or compounds. Certain mutational sites, i.e. DNA base sequences, have a particular preference for certain types of mutations. Since different hotspot sequences are only susceptible to enhanced mutagenesis by specific categories of mutagens, successful mutation of these sequences reveals what kind of mutagen is present in the sample to be analyzed and also gives an indication about the mode of action of the mutagen tested. Successful mutagenesis of the hotspot sequence can be observed immediately by detecting expression of the reporter protein.

The mutational hotspot sequence may be susceptible to a stress-inducing compound inducing a point mutation, a frame shift mutation, a nucleotide transition, a nucleotide transversion. Examples of hotspot sequences are provided in Example 1.

A "point mutation" is defined as a change or substitution in a single nitrogenous base such that the DNA retains the same number of nucleotides but has a slightly different sequence.

A "frame shift mutation" relates to a mutation resulting in a change in the number of nucleotides. Frame shift mutations may involve addition (insertion) or deletion of one or more nucleotide at a single point. Particularly, a frame shift mutation may involve the loss or gain of some number of nucleotides, e.g, one or more codons. An example of a hotspot sequence susceptible to frame shift mutation comprises the sequence "GCGCGCGC".

A "nucleotide transition mutation" is defined as a replacement of a purine (A or G) by the other purine (G or A). On the opposite DNA strand the original complementary pyrimidine (T or C) is replaced by the other pyrimidine (C or T). An example of a hotspot sequence susceptible to nucleotide transition mutation comprises the sequence "TGGCAA", found in the bacteriophage T4.

A "nucleotide transversion mutation" is defined as a replacement of one purine (A or G) by a pyrimidine (C or T). On the opposite DNA strand the original complementary pyrimidine (T or C) is replaced by a purine (G or A). Transversion mutations derive their name from the fact that purines (and pyrimidines) are switched across the DNA helix. An example of a hotspot sequence susceptible to nucleotide transversion mutation comprises an imperfect inverted repeat of nucleotides 118 to 165 of the thyA gene of E coli. The sequence comprises "GATGGATTCCCGCTGGTGACAACTAAACGTTGCCACCTGCGTTCCATCATC" (SEQ ID NO:1 ).

The term "assayable product" as used herein refers to a product, e.g. protein, that is displayed at the surface of a host cell and that can be detected by any type detection method, including direct and/or indirect detection methods. The assayable gene product can be measured both qualitatively and quantitatively by means of any type of detection method including but not limited to any physico-chemical measurement technique such as fluorescence, absorbance, conductivity, magnetic resonance, measurement techniques based on protein-protein, ligand-protein and receptor-protein interactions, electrode-based interaction, etc; any immunolabelling technique in its broadest context, any bacteriophage- based detection technique or any other specific detection technique.

In a preferred embodiment, the surface display allows assessment by using immunolabelling techniques. The term "immunolabelling technique" as used herein is meant to refer to various detection methods that use immunoglobulins to detect specific epitopes. Such immunolabelling technique may comprise but are not limited to ELISA, immunostaining, immunohistochemistry, enzyme immunoassays, Western Blotting, Flow Cytometry, Nephelometry, immunosensors, etc...

In another preferred embodiment, the surface display allows assessment by using bacteriophage-based detection techniques. The term "bacteriophage-based detection techniques" as used herein is meant to refer to various detection methods that use the infection mechanism of a bacteriophage for infecting bacterial cells.

In a further embodiment, the invention relates to a recombinant vector carrying a chimeric gene according to any of the embodiments of the invention.

In another further embodiment, the invention relates to a host cell transformed with a vector according to the invention. A recombinant vector carrying a chimeric gene according to any of embodiments of the invention can be introduced into a host cell using standard recombinant DNA techniques that are well known in the art. In a preferred embodiment, the present invention relates to a prokaryotic host cell transformed with a vector according to the invention. The term "transformation" refers to the acquisition of new genes in a cell after the incorporation of nucleic acid. Said host cell may be a prokaryotic cell selected from the group comprising G+ bacteria and G- bacteria. Any of a wide variety of gram-negative bacteria may be useful in practicing the invention. Such gram- negative bacteria may include E. coli, Salmonella, Klebsiella, Erwinia, and the like. Any of a wide variety of gram-positive bacteria may equally be useful in practicing the invention. Such gram-positive bacteria may include Staphylococcus sp., Bacillus sp., and the like.

In another embodiment, the present invention relates to an eukaryotic host cell, and preferably yeast or mammalian cells, transfected with a vector according to the invention. The term "transfection" refers to the uptake, incorporation, and expression of recombinant DNA by eukaryotic cells. Preferably, mammalian cells from liver, heart, lung, kidney, brain, or other organs can be used. Preferred mammalian cells are HepG2 cells, HeLa cells, WIL-2 cells or C3A cells. Most preferred are HepG2 cells. Yeasts including Saccharomyces may be useful in practicing the present invention.

The present invention further relates to methods and diagnostic kits for identifying and characterizing stress-inducing compounds. Such methods and kits comprise at least one host cell which has been transformed with the above-described recombinant vector. Identification and characterization of stress-inducing compounds is achieved by detecting the assayable product displayed at the surface of such host cell.

In one embodiment, the present invention relates to a method for identifying and characterizing a stress-inducing compound in a sample comprising the steps of: - separately culturing one or more of the above-described host cells, - incubating said one or more cultures of said host cells with said sample, and - detecting an assayable product displayed at the surface of said host cell in each of said cultures.

In another preferred embodiment, the present invention further relates to a method for detecting and determining the mode of action of a stress-inducing compound in a sample comprising the steps of: - separately culturing one or more of the above-described host cells, in particular host cells carrying a chimeric gene having an artificial DNA sequence; - incubating said one or more cultures of said host cells with said sample, - detecting an assayable product displayed at the surface of said host cell in each of said cultures, and - determining the mode of action of said stress-inducing compound.

The above described method is for instance particularly suitable for monitoring samples for the presence of stress-inducing compounds in general or of genotoxic or mutagenic compounds in particular. As mentioned above, several categories of stress-inducing compounds can be distinguished using a system according to the invention. Potential uses include monitoring of air, soil, water and food quality, agrochemical and drug design, manufacturing and fermentation process control, process monitoring and toxicity screening. These applications may benefit many industries including chemical, beverage, food and flavor, cosmetics, agricultural, environmental, regulatory and health care industries. In a preferred embodiment, the present invention relates to a method assay wherein the sample to be analyzed is selected from the group comprising an aqueous solution, water, soil, sediment, sludge, food, beverage or pesticides.

For use in the methods and diagnostic kits it is preferable that each employed host cell harbors only one particular stress promoter-chimeric gene fusion. In this manner, if a compound induces expression of the assayable gene product in any particular host, the specific type and mode of action caused by the stress-inducing or mutagen compound can unambiguously be identified. Also, in order to compare the toxicity level induced by different stress-inducing compounds, it is desirable that the copy number of each stress promoter- chimeric gene fusion utilized in the methods and kits of this invention is equal.

The method according to this invention comprises the first step of separately culturing each of the individual hosts, according to methods well known in the art. For instance, bacterial host cells are grown so that they are in log or stationary phase. Growth may be in minimal media, with or without antibiotics, such as depending on the strain of bacteria used. Growth of the hosts is followed by measuring cell density via absorbance of the culture at 600 nm (OD₆₀o)- Following this initial growth, a sample wherein a stress-inducing compound, or in particular a mutagen, may be present, is added to one portion of each culture. The other portion of each culture is not exposed to the solution or extract, and is used as both a control to measure the effect of the compound on the overall growth of the cells and for a baseline measurement of assayable gene product. The OD₆₀o of the cultures just prior to exposure to the compound is recorded. All of the cultures, both control and exposed, are then allowed to incubate at normal growth temperature for a period of time ranging from 5 minutes to 24 hours. More preferably, exposure to the stress-inducing or test compound is for about 30 minutes to 4 hours. After this additional incubation, both the exposed and control cultures are used to determine comparative growth by measuring OD₆₀₀.

As will be clear from the invention, mutagenized cells can have a growth advantage over non- mutagenized cells in particular cases wherein an essential gene is mutagenized in said cells. When studying stress-inducing compounds in general, it is crucial to understand the mechanism by which they affect man and biota.

In another embodiment, the present invention relates to a method for identifying and characterizing the toxicity of a stress-inducing compound or drug comprising the steps of: - separately culturing one or more of the above-described host cells, - incubating said one or more cultures of said cells with said stress-inducing compound or drug at one or more concentrations, - detecting an assayable product displayed at the surface of said host cell in each of said cultures.

In particular, the present invention provides a method for determining and characterizing the toxicity of a stress-inducing compound or drug in terms of the type of stress it causes within the cell. Such methods are particularly suitable for determining stress-inducing effects of drugs. In the frame of registration procedures of drugs for human or animal use, such studies are particularly relevant.

Although in some cases individual compounds may not be toxic, sometimes combinations of non-toxic compounds may be toxic. Therefore, it should be understood that the kits and methods of this invention can also be utilized to determine the potential toxicity of combinations of known and unknown compounds in an identical manner to that described above.

The invention provides a method for identifying an antitoxin to a compound determined to induce stress by the methods of this invention. The present invention relates to a method for identifying and characterizing an antitoxin to a stress-inducing compound or drug comprising the steps of: - determining the type of stress caused by said stress-inducing compound or drug by a method according to the present invention, - identifying a known stress-inducing compound which causes similar stress as the stress caused by said stress-inducing compound or drug, and - identifying an antitoxin to said known stress-inducing compound, said antitoxin being also suitable to act as an antitoxin for said stress-inducing compound or drug.

Once a stress promoter induction/suppression profile can be generated for a known or unknown stress-inducing compound or drug, that profile is compared to profiles of known substances in a database. A substance having a similar stress promoter induction/suppression profile as the known or unknown compound is identified. Such identified substance may have an antidote, also referred herein as an antitoxin, i.e. a substance or agent that reduces or represses its toxic activity. Such antitoxin may also be reducing or repressing the activity of the stress-inducing compound or drug.

In order to test the efficacy of an identified antitoxin against the stress-inducing compound or drug, the stress promoter assay is repeated using only those hosts containing stress promoters, which were induced or suppressed by the stress-inducing compound or drug. Each of those hosts is pre-incubated with varying concentrations of the proposed antitoxin prior to the addition of an inducing/ suppressing concentration of the stress-inducing compound or drug. If pre-incubation with the proposed antitoxin decreases or obliterates the effect of the stress-inducing compound or drug, such an antitoxin will likely be effective.

This invention also provides a method of improving active drug design. The present invention relates to a method for identifying and characterizing a stress-inducing compound or drug having a decreased toxicity comprising the steps of: - separately culturing one or more of the above-described host cells, - modifying or eliminating a portion of said stress-inducing compound or drug, for obtaining a modified stress-inducing compound or drug - incubating said one or more cultures of said cells with said modified stress-inducing compound or drug, and - detecting an assayable product displayed at the surface of said host cell in each of said cultures.

The term "portion of a stress-inducing compound or drug" refers to functional group of such compound or drug that is likely to cause cellular damage such as an alteration of normal cellular metabolism, gene expression, translation, or posttranslational modifications in a bacterial cell or population of cells.

According to this embodiment, a new drug is first tested with any of the described kits and methods and its toxicity is determined. The information provided by such methods and kits indicates the cellular mechanism of the drug's toxicity. The particular cellular damage indicated may then be appropriately modified or eliminated depending upon the role that portion or functional group plays in the drug's activity. The resulting modified drug is then retested with the kits and methods of this invention to determine if its toxicity has been sufficiently reduced or eliminated. Drugs improved and modified by this method are also within the scope of this invention

In a preferred embodiment, a stress-inducing compound or drug can be identified and characterized in the methods according to the invention by direct and/or indirect detection of the assayable product displayed at the surface of the host cell. The assayable gene product can be measured both qualitatively and quantitatively.

In one embodiment, the stress-induced surface display allows direct qualitative or quantitative assessment, in case of a colored, fluorescent or luminescent protein.

In another embodiment, the diagnostic kits and methods of this invention also provide the possibility of indirect assessments in particular by using immunolabelling techniques. The term "immunolabelling technique" as used herein is meant to refer to various detection methods that use immunoglobulins to detect specific epitopes. Such immunolabelling technique may comprise but are not limited to ELISA, immunostaining, immunohistochemistry, enzyme immunoassays, Western Blotting, Flow Cytometry, Nephelometry, immunosensors.

A frequent problem encountered in existing cellular bio-assays of environmental samples is that signals generated by stress-inducing compounds can be distorted by interfering compounds present in the environmental matrix or the extract thereof. The interfering compounds can interfere directly during signal measurement. When turbid samples are tested it becomes difficult to measure the emitted light, color or fluorescence directly from the exposed cells. Due to optical interference from the samples with the optical characteristics of the samples correct readings cannot be obtained. Also when samples are colored due to the presence of natural substances it becomes impossible to measure their effects/toxicity directly with the existing cellular assays. To overcome these problems often extracts are made from environmental matrices, e.g. using conventional chemical methods such as soxlet extraction, after which these extracts are dried and redissolved in a smaller volume of solvent. This final solvent containing the extracted contaminants are then exposed to the cells. Such extracts are often colored, certainly in the case of soils, sediment and sludge, which makes it again very difficult to get a correct interpretation of the effects/toxicity of these samples. Moreover due to extracting contaminants from environmental matrices (often using very drastic conditions), one completely affects the availability of contaminants and hence the real toxicity of the sample. Often one can only assess the worst-case effect of contaminants by using extracting methods. It is clear that for a correct impact assessment such procedures are not favorable.

The newly developed surface display expression system overcomes these problems. By measuring the cellular stress of the exposed cells not directly by measuring a color, fluorescence or light, but by indirect immunolabelling techniques it becomes possible to distinguish the test cells even within highly turbid samples. Even more, cells can be directly added to the matrix and can be distinguished from the matrix after testing due to the highly specific immunological techniques. After a certain exposure period, the soil, water or other matrix can be filtered or centrifuged after which the cells can be fixed on a solid support (e.g. filter, multiwell, etc..) after which they can be detected with the specific immunoglobulin that is specifically targeting the surface exposed protein. As such, there is also minimal interference from endogenous cells, which can be present in environmental samples. This makes it possible to apply the assays for direct contact testing of various environmental matrices (e.g. soils, sediments, sludge) as well as for direct testing of filters and other supports used to extract environmental samples.

Therefore, in a further preferred embodiment, the present invention relates to a method for detecting a stress-inducing compound or drug in a sample comprising the steps of - separately culturing one or more host cells according to the present invention, incubating said one or more cultures of said cells with said sample, - separating said one or more cultures from said sample, - fixing said one or more cultures on a suitable support, and - adding a suitable immunoglobulin which targets the surface exposed protein to said fixed one or more cultures, and - detecting interaction between said immunoglobulin and said surface exposed protein.

In another aspect, the test systems including surface display according to the invention allow (host) cell types that have been transfected to be mixed with other cell types and to perform quantitative assessments on cellular interactions between these host cell types as well as on the impact of the surrounding matrixes on these host cells.

In the context of toxicology for example it is relevant to co-culture several different host cell types. This is done for example to evaluate the effects of metabolites produced by one cell population on another cell population. In such co-culturing experiments it is a common practice in the art to culture two or more cell types in a same reaction vessel. In such experiments, different several host cell types, e.g. source cells and target cells, are co- cultured in a same reaction vessel but spatially separated by means of one or more semi- permeable membranes. After addition and incubation of a sample, e.g. the environmental sample, for a given period of time to the co-culture, a mixture of pollutants, e.g. hydrophilic compounds such as poly aromatic hydrocarbons, PCBs..., is metabolized by a first layer of cells, and metabolized products can be released into the cell culturing medium. These metabolized products then have to cross the artificial semi-permeable membrane in order to exert effects on a target cell population. By keeping cell populations separate, one is then allowed to measure a toxicological endpoint of choice into the target cells. Using a test system according to the present invention, an easier method can be provided for studying and characterizing cellular interactions between these host cell types or the impact of surrounding matrixes on different host cells types. Using a test system according to the present invention it becomes possible to mix various host cell types, each expressing a different reporter gene product into one reaction vessel, without having to use semi- permeable membranes.

Co-culturing or co-exposing cellular surface altered cells is for instance applicable in ecological studies where e.g. interactions among bacterial cell populations and their surrounding matrix can be characterized. This is done for example when one wants to follow the function and location of a specific group of bacteria in biofilms, in sludge and in rhizospheres. By using surface display bacteria it becomes possible to trace back, localize and identify the specific group of cells and evaluate their physiological status.

In an embodiment, the present invention relates to a method for identifying and characterizing the effects of an environmental matrix or an extract thereof on host cells. Such method comprises the steps of: - culturing a host cell according to the present invention in an environmental matrix or an extract thereof; and - detecting an assayable product displayed at the surface of said host cell in said culture.

In another embodiment, the present invention relates to a method for identifying and characterizing interactions between different host cell types comprising the steps of; - co-culturing two or more host cells according to the present invention wherein said host cells express different assayable products; and - detecting assayable products displayed at the surface of said host cells in said co-culture.

In yet another embodiment, the present invention relates to a method for identifying and characterizing interactions between different host cell types in the presence of one or more stress-inducing compounds or drugs comprising the steps of; - co-culturing two or more host cells according to the present invention wherein said host cells express different assayable products; incubating said co-culture of said cells with one or more stress-inducing compounds or drugs at one or more concentrations, - detecting assayable products displayed at the surface of said host cells in said co-culture.

In a further embodiment, the invention also provides diagnostic kits for performing any of the methods according to the invention. Such kits comprise at least one host cell according to the invention.

In a preferred embodiment, a stress-inducing compound or drug can be identified and characterized in the diagnostic kits according to the invention by direct and/or indirect detection of the assayable product displayed at the surface of the host cell. The assayable gene product can be measured both qualitatively and quantitatively. In one embodiment, the stress-induced surface display allows direct qualitative or quantitative assessment, in case of a colored, fluorescent or luminescent protein. In another embodiment, the diagnostic kits and methods of this invention also provide the possibility of indirect assessments in particular by using immunolabelling techniques or flow cytometry.

The methods and kits according to the invention are particularly suitable for the identification and evaluation of stress-inducing compounds, which are present in the environment (air, soil, sediments, sludge, water, etc.).

In order that the invention described herein may be fully understood, the following examples are set forth. It should be understood that these examples are for illustrative purposes only and are not to be construed as limiting this invention in any manner.

EXAMPLES Example 1 Examples of hot spot sequences

Different types of hotspot sequences have been reported in literature and can be used in accordance with the present invention. A few examples hereof usable in prokaryotic systems are provided below. However, it is clear that many other hotspot sequences may be used in accordance with the present invention.

A basic set up of a chimeric gene without hotspot sequence is for instance the following: ATG nnn nnn nnn nnn nTA AGG AGG ATT JAA ATA ATG nnn nnn (SEQ ID NO:2) 1 2 3 4 wherein n refers to any nucleotide being A, T, G or C, wherein 1 is the start codon of a first cistron (e.g. the artificial gene); 2 is the shine dalgarno sequence, 3 is an in frame stop codon and 4 is the start codon of a second cistron (e.g. a targeting sequence according to the present invention).

Hotspot sequences, which may be used in accordance with the present invention, may include, but are not limited to hotspot sequences whereby no stop codon is provided at the end of the sequence, unless it is created by specific mutations in the hotspot sequence. A schematic representation of a chimeric gene having such hotspot sequence is the following:

ATG nnn nnn nnn nnn nTA AGG AGG nnnnnn ATA ATG nnn nnn (SEQ ID NO:3)

1 2 5 4 wherein n refers to any nucleotide being A, T G or C, 1 is the start codon of a first cistron (e.g. the artificial gene); 2 is the shine dalgarno sequence, 5 is a hotspot sequence replacing a stop codon and 4 is the start codon of a second cistron (e.g. a targeting sequence according to the present invention).

Another hotspot sequence, which may be used in accordance with the present invention, is a sequence that is not in frame with the stop codon of the artificial gene, unless the reading frame is restored by specific mutations, insertions and/or deletions, in the hotspot sequence.

A schematic representation of a chimeric gene having such hotspot sequence is the following:

ATG nnn nnnnnnn nn nTA AGG AGG ATT JAA ATA ATG nnn nnn (SEQ ID NO:4)

1 5 2 3 4 wherein n refers to any nucleotide being A, T G or C , wherein 1 is the start codon of a first cistron (e.g. the artificial gene); 2 is the shine dalgarno sequence, 3 is an in frame stop codon, 4 is the start codon of a second cistron (e.g. a targeting sequence according to the present invention) and 5 is a coding sequence of a hotspot sequence not in frame with the stop codon 3. Another hotspot sequence is a sequence that comprises a stop codon in frame with the first start codon of the chimeric gene. Such hotspot sequence does not enable efficient transcription and translation of the chimeric gene unless the stop codon of the hotspot sequence is eliminated by mutation. A schematic representation of a chimeric gene having such hotspot sequence is the following: ATG nnn nnnnnnn TGA nnn nTA AGG AGG ATT JAA ATA ATG nnn (SEQ ID NO:5) 1 5 6 2 3 4 wherein n refers to any nucleotide being A, T G or C, wherein 1 is the start codon of a first cistron (e.g. the artificial gene); 2 is the shine dalgarno sequence, 3 is an in frame stop codon, 4 is the start codon of a second cistron (e.g. a targeting sequence according to the present invention), 5 is a hotspot sequence that comprises a stop codon 6 in frame with the first start codon 1 of the chimeric gene.

Another hotspot-sequence consists of the following sequence:

TCT>AGyAGGGTATTAATAATGAGCGCGCGCAAAGAGGAGGAATAAACAGGAGGAATTAAC

CATG (SEQ ID NO: 8) wherein TCTAGA corresponds to a Xbal site; AGAGGG corresponds to a Ribosomal Binding

Site; ATG corresponds to a start codon of a first cistron; GCGCGCGC corresponds to a mutational hotspot; TAA corresponds to a stopcodon of the first gene; AGGAGG corresponds to a ribosomal binding site of the GFP gene and ATG corresponds to the startcodon of the

GFP gene.

This SEQ ID NO: 8 sequence will be used as control if no mutagen is used. Induction and transcription of this sequence will result in the first short gene of which the stopcodon is situated in front of the ribosomal binding site of the second gene, and as such no 'translational initiation effect' can be expected from this construct.

The sequence GCGCGCGC is a hotspot for several mutagens that cause a 2-nucleotide frameshift (GC is deleted). In such event SEQ ID NO: 8 becomes SEQ ID NO: 9:

TCTΛGΛGGGTATTAATAATGAGCGCGCAAAGAGGAGGAATAAACAGGAGGAATTAACCA TG (SEQ ID NO: 9)

In this case the first TAA codon is not used as a stopcodon, but the TAA just in front of the second ATG that is in frame is used as a stopcodon. That stopcodon is behind the ribosomal binding site of the second gene. The observed effect of the mutation will be a higher expression of the second gene. As such this mutational mechanism can be studied for mutagens causing frameshifts.

Polycyclic planar mutagens with reactive side groups that permit the formation of DNA adducts are well known for their high frequency of hotspot mutation which consists of a 2- base deletion (-CG or -GC) within the sequence GCGCGCGC. Known examples of such mutagens are 4-aminobiphenyl, 4-nitroquinoline-oxide (4NQ), 2-nitrosofluorene and hycanthone. 4-nitroquinoline-N-oxide was used in the present example.

The chimeric gene comprised the signal sequence, the first 9 amino acids of the mature E. coli Lpp lipoprotein and the sequence encoding the amino acids 46 to 159 of the E. coli membrane protein OmpA. The reporter gene comprises a mutated version of Aequorea victoria green fluorescent protein, gfpmut2. The artificial hot spot sequence having SEQ ID NO:8, as indicated above, was fused in front of the targeting DNA sequence in the chimeric gene. A plasmid containing this chimeric gene under control of the E. coli arabinose promoter (pFChs) was transformed to E. coli MC1061.

A saturated culture was diluted 100 times, different concentrations of 4-NQ (4-nitroquinoline- oxide) 2.5μg/ml, 1μg/ml and 0.25μg/ml (dissolved previously in a 100 times concentrated stock in DMSO), were added. For the negative control only DMSO was added. Cells were further grown for 12 hours at 37°C. Cells were diluted three fold, and grown for another two hours at 37°C. Arabinose was added at a low concentration of 0.0002% because the increase in fluorescence by of the hotspot-sequence was expected to be most prominent at this low concentration. Cells were further grown at 25°C for another 4 hours after which fluorescence was measured with a spectromax fluorimeter. Values of a representative experiment are shown in table 1. Table 1

With a concentration of 0.0002 % arabinose the fluorescence is 0.149 in the construct without hotspot. In case a hotspot is present the fluorescence is increasing with increasing concentration of the mutagen, i.e. the effect of the hotspot.

In another example, a hotspot-sequence consists of the following sequence: tctagagqqtattaataATGaqcgcqcgcaaagaggaggaaaaaacaggaggaattaaccATG (SEQ ID NO: 10) The different features of this sequence are similar as explained above. In this sequence no in frame stopcodon is present for the first cistron. Only in case of a GC frameshift the TAA behind the ribosomal binding site and in front of ATG is in frame and only then an effect of the sequence is visible. In case of a GC frameshift the sequence is tctagaqqqtattaataATGaqcgcgcaaagaggaggaaaaaacagqaqgaattaaccATG (SEQ ID NO: 11)

Polycyclic planar mutagens with reactive side groups that permit the formation of DNA adducts are well known for their high frequency of hotspot-mutation which constist of a 2- base deletion (-CG or -GC) within the sequence GCGCGCGC. Known examples of such mutagens are 4-aminobiphenyl, 4-nitroquinoline-oxide (4NQ), 2-nitrosofluorene and hycanthone. 4-nitroquinoline-N-oxide was used in the present example.

The used cells are similar as those described above, except for the used artificial hot spot sequence having SEQ ID NO:10, as indicated above, which was fused in front of the targeting DNA sequence in the chimeric gene.

A saturated culture was diluted 100 times, different concentrations of 4-NQ (4-nitroquinoline- oxide) 2.5μg/ml, 1 μg/ml and 0.25μg/ml (dissolved previously in a 100 times concentrated stock in DMSO) were added. Cells were further grown for 12 hours at 37°C. Cells were diluted three times, and grown for another two hours at 37°C. Arabinose was added at a low concentration of 0.0002% because the increase in fluorescence by the hotspot-sequence was expected to be most prominent at this low concentration. Cells were further grown at 25°C for another 4 hours after which fluorescence was measured with a spectromax fluorimeter. Values of a representative experiment are shown in table 2.

Table 2

Example 2 Chimeric genes according to the present invention

In the present example, several chimeric genes according to the present invention are illustrated.

In a first example, the chimeric gene comprises the signal sequence, the first 9 amino acids of the mature E. coli Lpp lipoprotein (Genbank accession No V00302) and the sequence encoding the amino acids 46 to 159 of the £. coli membrane protein OmpA. The reporter gene comprises a mutated version of Aequorea victoria green fluorescent protein, gfpmut2 (Cormack et al., Gene, 173:33-38 1996). A plasmid containing this chimeric gene under control of the Escherichia coli Arabinose promoter was transformed to E. coli MC1061 resulting in E. coli strain SD1. In a second example, the chimeric gene is similar as described above. A plasmid containing this chimeric gene under control of the Escherichia coli recA promoter (Genbank accession No. V00328; Sancar et al., 1980) was transformed to E. coli JM109 resulting in E. coli strain SD2.

In a third example, the chimeric gene is similar as described above. A plasmid containing this chimeric gene under control of mutated versions of the Escherichia coli recA promoter according to Weisemann and Weinstock (1985) was transformed to E. coli JM109 resulting in E. coli strains SD3 and SD4. The mutated versions of the promoter (different mutations at different sites of the recA promotor) provide reduced basal expression levels with a factor 10, but preserve the induction ratio and hence allow more reliable observations (analyses) of non-induced versus induced expression of the reporter protein.

In a fourth example, the chimeric gene comprises a hotspot sequence, a targeting DNA sequence, a DNA sequence encoding a transmembrane amino acid sequence and a reporter gene sequence. The chimeric gene comprises a hotspot sequence which allows introduction of a stop codon upon exposure to the mutagen N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), the signal sequence and the first 9 amino acids of the mature E. coli Lpp lipoprotein (Genbank accession No V00302), the sequence encoding the amino acids 46 to 159 of the E. coli membrane protein OmpA and a mutated version of Aequorea victoria green fluorescent protein, gfpmut2. A plasmid containing this chimeric gene under control of the Escherichia coli Arabinose promoter was transformed to E. coli MC1061 resulting in E. coli strain SD5.

Table 3 Provides a schematic overview of the above-described examples of chimeric genes and their promoters introduced in E. coli

Example 3 Analysis of expression and surface display of a GFP module E.coli strain SD1 was inoculated in Luria-Bertani (LB) medium, containing 0.2 % glucose supplemented with ampicillin to a final concentration of 100μg/ml and grown during 16 hours at 37°C, while shaking at 250 rpm until bacteria reached the stationary phase of the growth curve. Bacteria were then diluted (-5-fold) and grown further (120 min).

Induction was achieved by adding arabinose at increasing concentrations with doses ranging from 0.0000002 % to 0.02 % arabinose) and the optical density at 600 nm and fluorescence at 515 nm were measured again immediately to record post-dose-readings.. Induction of an arabinose promoter was followed by temperature shift to 25°C and growth was followed by recording fluorescence values at 515 nm at timely intervals (10 minutes). The recorded O.D. values and fluorescence values were used to calculate 'fold induction¹ values.

Fixation of E. coli cells with surface displayed GFP to the bottom of wells of microtiter plates was carried out as follows. Microtiter plates were washed twice with PBS. Plates were coated with 1/1000 dilution in PBS of GFP highly purified antibody (Company Abeam) - 50 μl per well for 2h at 37°C (or overnight at 4°C). Plates washed three times with water and three times with PBS/2%BSA (150μl). The unoccupied sites were blocked by incubating the plate with PBS/2% BSA for 1 hour at 37°C.

Binding of E. coli on the attached GFP antibodies was carried out as follows. E. coli cells were induced with different concentration of arabinose A=0%; B= 0.02%, C= 0.0002%, D=0.000002%. The induced E. coli cells (400μl) were centrifuged and obtained pellets were washed with PBS/1 %BSA. Cells were finally re-suspended in 100 μl PBS/1 %BSA and incubated with the coated microtiterplate for 2 h at 37°C. Binding of bacteria by interaction of GFP and anti-GFP polyclonal antibodies was allowed during 2 hours at 37°C. Non-bound cells were removed and fluorescence was measured. Results of one representative experiment is given below in Table 4. The results of this example indicate that more GFP is obtained on the membrane in function of an increasing amount of inducer, and that these bacteria can be adequately bound on the microtiterplate, leading to the corresponding fluorescence. Table 4

This example illustrates that the chimeric gene construct according to the invention can be effectively used to display a reporter gene product at the surface of a host cell in a rapid and easy way in a gradual (progressive) manner over concentrations of a molecule that span several orders of magnitude (at least one) (i.e. from 0.02% to 0.000002%).

Example 4 Flow cytometry to analyse expression and surface display of GFP upon induction E.coli strain SD1 was inoculated in Luria-Bertani (LB) medium, containing 0.2 % glucose supplemented with ampicillin to a final concentration of 100μg/ml and grown during 16 hours at 37°C, while shaking at 250 rpm until bacteria reached the stationary phase of the growth curve. Bacteria were then diluted (-5-fold) and grown further (120 min). Induction of the chimeric gene was achieved by adding arabinose at concentrations of 0% (control strain) and 0.02% (induced strain).

The bacterial cells were injected into the flow cytometer BD LSRII (BD Biosciences) equipped with a 20mW air cooled argon ion laser (Laser Type Coherent Sapphire). Fluorescence in the range 500-560 was detected by a fluorescence detector set at a photomultiplier tube. The mean fluorescence for the 10000 registered events was 27 (arbitrary units) for the control strain versus 202 for the induced strain, showing a clear increase in fluorescence upon induction with an inducer. Intermediate inducer concentration showed intermediate mean fluorescence values. This clearly demonstrated the usefulness of flow cytometry for detection of induced £ coli strain, and as such stress-induced GFP.

Besides fluorescence, Forward Scatter (FSC) and Sideward Scatter (SSC) were also useful tool to detect expressed GFP. This was demonstrated in this experiment wherein the Mean FSC and Mean SSC of the control was 522 and 688 respectively, versus 832 and 1146 for the induced strain. Intermediate inducer concentration showed intermediate mean values for FSC and SSC.

This example illustrates that the chimeric gene construct according to the invention can be effectively detected by the use of flow cytometry. Both fluorescence and Forward/Side scatter plots are adequate tools to detect an increased expression of the chimeric gene. Example 5 Analysis of stress-responsive promoters using surface displayed GFP E. coli strains SD2 were inoculated in LB medium and grown during 16 hours while shaking at 250 rpm until bacteria reached the stationary phase of the growth curve. Bacteria were then diluted (5-fold) and grown further (120 min). The stress inducing compound nalidixic acid was added in a concentration ranging from 0 to 100μg/ml and the bacteria were shifted to 25°C. The optical density at 600nm and the fluorescence at 515nm was measured after 2 hours. The fluorescence values demonstrated a clear correlation with the added inducer concentration as indicated in the table 5

Table 5

Fluorescence is increasing with increasing concentration of Nalidixic acid. The cell density at the highest inducer concentration is decreasing due to lethality effects. This example illustrates that a chimeric gene construct according to the invention can be effectively used to display a reporter gene product at the surface of a host cell in a rapid and easy way in a gradual (progressive) manner over concentrations of a molecule (nalidixic acid) that span several orders of magnitude (at least one) (i.e. from 0 to 10Oμg/ml).

Example 6 Analysis of expression and surface display of an outer membrane protein LamB

LamB is an outer membrane protein of £. coli, and has a role in the uptake of maltose sugars. LamB is also the receptor of bacteriophage Lambda. In the present example, a chimeric gene comprising the lamB reporter gene was constructed. The target sequence in this construct is the lamB signal sequence, the transmembrane sequences are the naturally occurring transmembrane sequences. Detection of the outer membrane protein LamB was performed using a phage Lambda infection detection technique. The detection of LamB is not restricted to this method only; in this context, LamB serves as a demonstrative example of the variety of reporter proteins that can be applied in accordance with the present invention. It will be clear from the present invention that such Lambda infection detection technique may be used for detecting the surface exposure of any kind of reporter gene product of which the expression is driven by any kind of inducible promoter in accordance with the invention.

The lamB gene was amplified by PCR from genomic DNA from the £. coli strain MC1061 with the primers pLmδBECr: having sequence cacaggtgatgtgaaaaaagaattccaatgactcaggagatag (SEQ ID NO: 6) and pLmb3EcH having sequence gacaacctgttttatgccggatgcgcgtaaaaagcttatccggcccagg (SEQ ID NO:7). The gene was cloned in a plasmid pBDEP, which contains the arabinose inducible Ara- promoter, but no Ribosomal Binding Site. The gene was cloned as an EcoRI/Hind3 fragment, resulting in the plasmid pBDEPIamB. The bacterial strain £. coli pop6510 has a lamB null mutation, so that no LamB protein is expressed on the outer membrane. Induction of expression of the chimeric gene could be done by addition of arabinose (as an example of inducer) in the £. coli pop6510 strain (Bouges-Bocquet, J. Cell Biochem. 24, 217 (1984). The presence of the surface displayed LamB protein could be easily monitored by a phage

Lambda infection detection technique.

In this example, pop6510 [pBDEP] (=negative control without lamB) and pop6510[pBDEPIamB] were grown overnight in LB at 37°C. The overnight culture was diluted 1/100 and after 2.5 hours the inducer (i.e. arabinose at 0.02%) was added. After 2 hours the presence or absence of the outer membrane protein LamB was measured by phage Lambda infection. Only when LamB is correctly exposed on the outer membrane, lambda infection occurs. The phage titre was measure by plaque counting according to a well known protocol in the state of the art. Results hereof are given in table 6. Table 6

*pfu plaque forming units This example illustrates that a chimeric gene construct according to the invention can be effectively used to display a reporter gene product at the surface of a host cell in a rapid and easy way. In this example another reporter protein, different from a GFP reporter protein is used. This example illustrates that the type of reporter gene used in a chimeric gene according to the invention is not limited and that any type of reporter gene may be successfully applied according to the present invention.

Example 7 Analysis of expression and surface display of GFP module Membrane exposed GFP may be measured by fluorescence, as illustrated for instance in examples 3, 5 and 7. The present example illustrates the detection and measurement of membrane exposed GFP using immunological techniques. In a first approach, dose dependent determination of membrane exposed GFP was demonstrated using an immunological approach based on a precipitating enzymatic end product substrate. In a second approach dose dependent determination of membrane exposed GFP was demonstrated using an immunological approach based on a soluble enzymatic end product that allows measurement by absorption at 405nm.

In this example, the chimeric gene comprised the signal sequence, the first 9 amino acids of the mature £. coli Lpp lipoprotein and the sequence encoding the amino acids 46 to 159 of the £. coli membrane protein OmpA. The reporter gene comprises a mutated version of Aequorea victoria green fluorescent protein, gfpmut2. A plasmid (pFC) containing this chimeric gene under control of the £. coli arabinose promoter was transformed to £. coli MC1061. E. coli cells MC1061 with or without plasmid were grown overnight at 37°C. The culture was diluted 1/3 and grown for another 2 hours at 37°C. Arabinose was added at different concentrations and the cells were shifted at 25°C. After 1 hour fluorescence was measured. Results are shown in table 7.

Table 7

In a first approach, these cells were centrifuged and washed in PBS buffer. The washed cells were resuspended in PBS + 2%BSA. 10⁶ cells (concentrated in 2μl) were dotted on a PBS- wetted nitrocellulose filter. Highly purified rabbit-GFP antibody (Abeam AB6556-25) was added in a 1/2500 dilution, corresponding with a final concentration of antibody of 0.2μg/ml. The nitrocellulose blot was incubated for 2 hours at room temperature. The nitrocellulose blot was washed twice with PBS+ 2% BSA. Secondary anti-rabbit antibody alkaline phosphatase coupled (Sigma A3687) was added in dilution of 1/10000. The nitrocellulose blot was further incubated for 2 hours at room temperature. The blot was washed with PBS and with Tris buffer (0.1 M Tris, 0.5mM MgCI₂ pH 9.5). The blot was incubated with Tris buffer + NBT/BCIP (final concentration 30 and 15 mg/ml respectively). After 20 minutes the reaction was stopped. Blue dots became visible on the nitrocellulose blot (not shown), and the colour intensities were completely corresponding with the fluorescence values.

In a second approach, another immunological detection technique was used for detecting membrane surface display of the GFP reporter protein. This second technique is based on the use of p-nitrophenyl phosphate (Sigma N9389) which was added as substrate. P- nitrophenol remains soluble, allowing measurement by spectrometric absorption at 405nm. Control and induced cells (amount: 10⁶ cells) were washed and resuspended in 30μl PBS- 2%BSA in 500μl eppendorf tubes. Highly purified rabbit GFP antibody (Abeam 6556-25) was added in 1/2500 dilution corresponding with a final concentration of 0.2 μg/ml). Incubation was done for 2 hours at room temperature. Cells were washed twice with PBS-2%BSA, after which anti-rabbit secondary antibody coupled with alkaline phosphatase was added in 1/10000 dilution. Cells were incubated for 2hours at room temperature. Cells were washed with PBS and with in Diethanolamine buffer (1 M DEA, 0.5mM MgCI₂ pH 9.5) 100μl Diethanolamine + phosphate substrate (final concentration 1 mg/ml p-nitrophenyl-phosphate, Sigma) were added to the cells. Upon enzymatic reaction the formed end product (p- nitrophenol) could be detected by adsorption at 405nm. A kinetic measurement was done on the different cells. Both the kinetic curve - for which the steepness of the curve gives an idea about the activity of the enzyme - and the absorption values at different time points were determined. In table 8 the absorbance after 30 minutes is shown as representative example. Table 8

Both the kinetic curves (as illustrated by the steepness values given in the table) and the absorbance values at 405nm corresponded to the fluorescence measurements.

Both approaches illustrate the possibility to use immunologic detection techniques for detecting membrane surface display of a reporter protein in an expression cassette according to the present invention. These examples also illustrate that a chimeric gene construct according to the invention can be effectively used to display a reporter gene product at the surface of a host cell in a rapid and easy way in a gradual (progressive) manner over concentrations of a molecule that span several orders of magnitude (at least one).

Example 8 Detection of toxic compounds in soil samples using a system according to the present invention.

This example demonstrates the ease of measuring contaminated environmental matrices e.g. soil samples. In the prior art, assays such as the Ames assay are used. However such assays only allow to test soil samples after chemical extraction of the sample in organic solvents, hereby altering the real availability of contaminants and ultimately incorrectly assessing the risk of pollution (Monarca et al, 2002; Environ. Res 88:64 (2002)). The present invention provides an alternative approach for analysing contaminated soil samples.

E. coli strains SD1 and SD2 were used in this example. In SD1 strains, this chimeric gene was put under control of the Escherichia coli Arabinose promoter and is inducible by arabinose. In SD2 strains, the chimeric gene was put under control of the Escherichia coli recA promoter and is inducible by mutagens like e.g. nalidixic acid.

About 2 gram of soil sample was taken from a natural uncontaminated area. The samples were dried overnight at 65°C. The dried sample was resuspended in water and distributed in different eppendorf tubes, each containing about 100μg of soil. The resuspended samples were spiked with 10 μl of different concentrations of arabinose (from 0 to 0.02%) or nalidixic acid (0; 10; 50; 100ug/ml). Spiking was done on the (in water) resuspended soil samples to have an equal distribution of the inducer on the soil. The spiked samples were dried overnight at 40°C to have a sample that is representative for a soil sample.

£. coli cells containing the GFP expression cassette behind the ara-promoter (SD1 cells) or behind the recA-promoter (SD2 cells) were grown overnight and diluted 1/3. Cultures were further grown for 2 hours at 37°C, after which the different soil samples were added and the bacteria were further grown at 25°C. After 2hours, the different samples were centrifuged at low speed (500rpm) allowing the soil to be pelleted while the £. coli cells were still present in the soluble phase. GFP Fluorescence of the bacteria was measured. For the different samples a negative control -£. coli with 'empty' plasmid- was always treated in a same way. Results of fluorescence measurements are given in the table 9.

Table 9

The fluorescence measured at 100 μg/ml of nalidixic acid was lower compared to the fluorescence measured at 75 μg/ml, probably because of lethal effects of this high nalidixic acid concentration. This example illustrates that a chimeric gene construct according to the invention can be effectively used to display a reporter gene product at the surface of a host cell in a rapid and easy way in a gradual (progressive) manner over concentrations of a molecule (arabinose / nlidixic acid) that span several orders of magnitude (at least one). Similar dose-response relationships were obtained using western blotting techniques, demonstrating that this assay is robust towards the most commonly interfering confounding factors in cellular environmental screenings (turbidity and coloured samples). This example further demonstrates the suitability of the present reporter system for detecting toxic compounds in contaminated soil samples. Compared to a standard Microtox (solid phase assay), no additional manipulation of the turbid soil sample is needed, but a simple immune based detection method allows instant toxicity screening of soil samples. These favourable results can be extrapolated to other environmental matrices.

Example 9 Detection of DNA mutations after exposure of E. coli to stress-inducing compounds

E. coli strain SD5 was used in this example. The chimeric gene comprised the following hotspot-sequence: tctagaqqqtattaataATGtatcqattaaataaccaqqaqaaacaqccatq (SEQ ID NO: 12) The different features of this sequence are similar as explained in example 1. In this sequence a stopcodon will be generated because of a GC-AT mutation. In case of a mutation an effect of the sequence is visible. Acag: GC-AT shifts are caused by EMS with a higher frequency in case an A is preceding. In this case, a C-T mutation will result in a TAG stopcodon, and then the effect of the bicistronic system will be detectable. EMS (Ethylmethane sulfonate) is an alkylating mutagen. MNNG and EMS causes a GC to AT transition. However, in case of MNNG, the surrounding sequence is of importance for such transition: 5' Purine-G3' is a mutational hotspot; 5'Pyrimidine-G3' is a mutational coldspot. EMS does not have this specific activity, which indicates that EMS has a different mechanism of alkylation mutagenesis.

The cells used in this example are similar as those described in example 1 , except for the used artificial hot spot sequence having SEQ ID NO:9, as indicated above, which was fused in front of the targeting DNA sequence in the chimeric gene.

A saturated culture was diluted 100 times, different concentrations of EMS (Ethyl Methyl sulfoxide) 3.5μl; 1μl and 0.35μl (of the stock solution of 1.167g/ml) were added. Cells were further grown for 12 hours at 37°C. Cells were diluted three times, and grown for another two hours at 37°C. Arabinose was added at a concentration of 0.0002%. Cells were further grown at 25°C for another 4 hours after which fluorescence was measured with a spectromax fluorimeter. Values of a representative experiment are shown in table 10.

Table 10

With a concentration of 0.0002 % arabinose the fluorescence is 0.149 in the construct without hotspot. In case a hotspot is present the fluorescence is increasing with increasing concentration of the mutagen- i.e. the effect of the hotspot.

These examples illustrate that a chimeric gene construct according to the invention can be used to display a reporter gene product at the surface of a host cell in a rapid and easy way. A reporter gene product can be targeted and visualized on the host cell surface upon the recognition by the chimeric gene construct of a stress-inducing or mutagen compound. It was demonstrated that a clear dosage effect can be observed using a reporter system according to the invention. It was able to detect a reporter signal within a short time frame. Various detection techniques may be applied for detecting the reporter gene product, including but not limited to physico-chemical measurement techniques such as fluorescence, absorbance, conductivity, magnetic resonance, protein-protein, protein-ligand, receptor-ligand, etc.. immunological techniques or phage infection techniques or any other specific measuring technique.

Claims

1. A chimeric gene encoding an assayable product and expressible in a host cell when preceded by an inducible promoter, said chimeric gene comprising: - a targeting DNA sequence, encoding a polypeptide capable of targeting said assayable product to the host cell membrane, - a DNA sequence encoding a transmembrane amino acid sequence capable of anchoring and exposing said assayable product in said host cell membrane towards the external surface, and - a DNA sequence encoding an assayable product, wherein said inducible promoter is a progressively-inducible promoter that fulfils at least one, and preferably two or three of the following parameters: - being toxicologically-inducible; and/or - showing a time-dependent progressive induction pattern; and/or - showing a dose-dependent progressive induction pattern.

2. A chimeric gene according to claim 1 , wherein said chimeric gene further comprises an artificial DNA sequence, said artificial sequence providing a defective transcription or translation of said chimeric gene.

3. A chimeric gene according to claim 1 or 2, wherein said targeting DNA sequence precedes said transmembrane sequence.

4. A chimeric gene according to claim 2 or 3, wherein said artificial DNA sequence precedes said targeting DNA sequence.

5. A chimeric gene according to any of claims 2 to 4, wherein said artificial DNA sequence comprises a mutational hotspot sequence, said hotspot sequence being susceptible to mutagenesis by the action of a stress-inducing compound.

6. A chimeric gene according to any of claims 2 to 5, wherein said mutational hotspot sequence is susceptible to a stress-inducing compound inducing a point mutation, a frame shift mutation, a nucleotide transition or a nucleotide transversion.

7. A chimeric gene according to any of claims 1 to 6, wherein said DNA sequence encoding an assayable product is a reporter gene.

8. A chimeric gene according to any of claims 1 to 7, wherein said toxicologically- inducible promoter is a promoter of a gene responsive to heat stress, redox stress, protein stress, DNA stress, energy stress, osmotic stress, pH stress or membrane stress.

9. A chimeric gene according to any of claims 1 to 8, wherein said host cell is a prokaryotic cell selected from the group comprising G+ bacteria and G- bacteria.

10. A chimeric gene according to any of claims 1 to 8, wherein said host cell is an eukaryotic cell selected from the group comprising yeast and mammalian cells.

11. A recombinant vector carrying a chimeric gene according to any of claims 1 to 10.

12. A host cell transformed with a vector according to claim 11.

13. A host cell according to claim 12, wherein said host cell is a prokaryotic cell selected from the group comprising G+ bacteria and G- bacteria.

14. A host cell according to claim 12, wherein said host cell is an eukaryotic cell selected from the group comprising yeast and mammalian cells.

15. Method for identifying and characterizing a stress-inducing compound in a sample comprising the steps of: - separately culturing one or more host cells according to any of claims 12-14, - incubating said one or more cultures of said cells with said sample, - detecting an assayable product displayed at the surface of said host cell in each of said cultures.

16. Method for identifying and characterizing the toxicity of a stress-inducing compound or drug comprising the steps of: - separately culturing one or more host cells according to any of claims 12-14, - incubating said one or more cultures of said cells with said stress-inducing compound or drug at one or more concentrations, - detecting an assayable product displayed at the surface of said host cell in each of said cultures.

17. Method for identifying and characterizing an antitoxin to a stress-inducing compound or drug comprising the steps of: - determining the type of stress caused by said stress-inducing compound or drug by a method according to claim 15, - identifying a known stress-inducing compound which causes similar stress as the stress caused by said stress-inducing compound or drug, and - identifying an antitoxin to said known stress-inducing compound, said antitoxin being also suitable to act as an antitoxin for said stress-inducing compound or drug.

18. Method for identifying and characterizing a stress-inducing compound or drug having a decreased toxicity comprising the steps of: - separately culturing one or more host cells according to any of claims 12-14, modifying or eliminating a portion of said stress-inducing compound or drug, for obtaining a modified stress-inducing compound or drug, - incubating said one or more cultures of said cells with said modified stress- inducing compound or drug, and - detecting an assayable product displayed at the surface of said host cell in each of said cultures.

19. Method for identifying and characterizing the effects of an environmental matrix or an extract thereof on host cells comprising the steps of: - culturing a host cell according to any of claims 12-14 in an environmental matrix or an extract thereof; and - detecting an assayable product displayed at the surface of said host cell in said culture.

20. Method for identifying and characterizing interactions between different host cell types comprising the steps of: - co-culturing two or more host cells according to any of claims 12-14 wherein said host cells express different assayable products; - detecting assayable products displayed at the surface of said host cells in said co-culture.

21. Method for identifying and characterizing interactions between different host cell types in the presence of one or more stress-inducing compounds or drugs comprising the steps of: co-culturing two or more host cells according to any of claims 12-14 wherein said host cells express different assayable products; - incubating said co-culture of said cells with one or more stress-inducing compounds or drugs at one or more concentrations, - detecting assayable products displayed at the surface of said host cells in said co-culture.

22. A method according to any of claims 15-21 , wherein said method comprises direct and/or indirect detection of the assayable product displayed at the surface of the host cell.

23. A diagnostic kit for performing any of the methods according to any of claims 15-22, comprising at least one host cell according to any of claims 12-14.