WO2005016274A2 - Rnai treatment of eye disease - Google Patents

Rnai treatment of eye disease Download PDF

Info

Publication number
WO2005016274A2
WO2005016274A2 PCT/US2004/025276 US2004025276W WO2005016274A2 WO 2005016274 A2 WO2005016274 A2 WO 2005016274A2 US 2004025276 W US2004025276 W US 2004025276W WO 2005016274 A2 WO2005016274 A2 WO 2005016274A2
Authority
WO
WIPO (PCT)
Prior art keywords
tshr
expression
sirna
composition
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2004/025276
Other languages
French (fr)
Other versions
WO2005016274A3 (en
Inventor
Maya Eibschitz-Tsimhoni
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Michigan System
University of Michigan Ann Arbor
Original Assignee
University of Michigan System
University of Michigan Ann Arbor
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Michigan System, University of Michigan Ann Arbor filed Critical University of Michigan System
Publication of WO2005016274A2 publication Critical patent/WO2005016274A2/en
Publication of WO2005016274A3 publication Critical patent/WO2005016274A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]

Definitions

  • the present invention relates to RNA interference (RNAi) for preventing or reducing the expression of the thyroid stimulating hormone receptor (TSHr) gene in a target cell
  • RNAi RNA interference
  • the present invention relates to compositions comprising small interfering RNA duplexes (siRNAs), or vectors that encode siRNA, that inhibit the expression of the TSHr gene (e.g. by targeting TSHr mRNA), and methods of using these compositions to treat or prevent eye disease (e.g. Graves' ophthalmopathy) in a patient.
  • Graves' disease is the most common autoimmune disease in the U.S and accounts for 60-80% of thyrotoxicosis.
  • Graves' ophthalmopathy (GO) is characterized by an increase in the volume of orbital tissues within the bony orbits leading to exophthalmos, extraocular muscle dysfunction, periorbital edema, compressive optic neuropathy, and vision loss.
  • ophthalmopathy is not preventable, and treatment options for established symptomatic disease are limited. Few treatment options beyond palliative care are available.
  • Present palliative treatments including high dose corticosteroids, radiation therapy and surgery are either of questionable effectiveness or can result in disabling side effects. As such, what is needed is a new approach to preventing and treating the symptoms of GO.
  • the present invention relates to RNA interference (RNAi) for preventing or reducing the expression of the thyroid stimulating hormone receptor gene in a target cell.
  • RNAi RNA interference
  • the present invention provides compositions comprising small interfering RNA duplexes (siRNAs), or vectors that encode siRNA, that inhibit the expression of the TSHr gene (e.g. by targeting TSHr mRNA), and methods of using these compositions to treat or prevent eye disease (e.g. Graves' ophthalmopathy) in a patient.
  • the present invention provides methods for inhibiting the expression of the thyroid stimulating hormone receptor (TSHr) gene comprising; a) providing; i) a target cell expressing TSHr protein via expression of TSHr mRNA, and ii) a composition comprising a small interfering RNA duplex (siRNA), or a vector encoding the siRNA duplex, that targets the TSHr mRNA, b) contacting the target cell with the composition such that the TSHr mRNA is disabled (e.g. cleaved), thereby inhibiting expression of the TSHr protein by the TSHr gene.
  • the target cell is an orbital fibroblast or other cell in the eye (e.g. human eye).
  • the target cell is an orbital cell (e.g. an extraocular muscle cell, a preadipocyte, adipocyte and/or fibroblast).
  • the target cell is a thyroid cell, hi other embodiments, the contacting is conducted in vitro. In particular embodiments, the contacting is conducted in vivo.
  • the composition further comprises a nucleic acid transfecting agent (e.g. OLIGOFECTAMINE or similar agent).
  • the present invention provides methods comprising; a) providing; i) a patient with symptoms of eye disease, and ii) a composition comprising small interfering RNA duplexes (siRNAs), or vector encoding the siRNA, configured to inhibit expression of thyroid stimulating hormone receptor (TSHr) protein, b) administering the composition to the patient under conditions such that one or more symptoms of the eye disease are reduced or eliminated.
  • siRNAs small interfering RNA duplexes
  • TSHr thyroid stimulating hormone receptor
  • the present invention provides methods comprising; a) providing; i) a patient at risk for eye disease, and ii) a composition comprising small interfering RNA duplexes (siRNAs), or vectors encoding the siRNA, configured to inhibit expression of thyroid stimulating hormone receptor (TSHr) protein, b) administering the composition to the patient under conditions such that one or more symptoms of the eye disease are prevented.
  • the present invention provides compositions comprising; a) a composition comprising small interfering RNA duplexes (siRNAs), or vector encoding the siRNA, configured to inhibit expression of thyroid stimulating hormone receptor (TSHr) protein, and b) a nucleic acid transfecting agent.
  • kits comprising; a) a composition comprising small interfering RNA duplexes (siRNAs), or vector encoding the siRNA, configured to inhibit expression of thyroid stimulating hormone receptor (TSHr) protein, and b) printed material with instructions for employing the composition for treating a target cell expressing TSHr protein via expression of TSHr mRNA under conditions such that the TSHr mRNA is cleaved or otherwise disabled.
  • the eye disease is Graves' ophthalmopathy or similar eye disease, hi other embodiments, the patient at risk for eye disease has Graves' disease.
  • the administering is selected from intravenous, topically to the eye, orally, by inhalation, or other suitable method.
  • the composition further comprises a nucleic acid transfecting agent, hi other embodiments, the composition further comprises reagents suitable for ophthalmic administration, hi certain embodiments, the administering is under conditions such that the composition contacts the orbital cells including but not limited to extraocular muscle cells, preadipocytes, adipocytes and fibroblasts of the patient.
  • the present invention provides an eye dropper (or similar device) containing a composition comprising small interfering RNA duplexes (siRNAs), or vectors encoding said siRNA, configured to inhibit expression of thyroid stimulating hormone receptor (TSHr) protein, hi certain embodiments, the composition has a pH of about 7.4. In some embodiments, the composition is buffered. In certain embodiments, the siRNA duplexes comprise SEQ ID NO:2. hi other embodiments, the siRNA duplexes comprise a sequence selected from SEQ ID NOs:2-20.
  • FIGURES Figure 1 shows the nucleic acid sequence (SEQ ID NO:l) of the human TSHr gene.
  • Figure 2 shows the level of TSHr expression 4 hours post transfection with siRNA specific for the TSHr gene as compared to a control.
  • Figure 3 shows the level of TSHr expression 24 hours post transfection with siRNA specific for the TSHr gene as compares to a control.
  • Figure 4 shows the relative quantitation of TSHr at different times points post transfection with RNAi.
  • Figure 5 shows the level of TSHr expression 48 hours post transfection with siRNA specific for the TSHr gene as compares to a mock and a mismatch controls.
  • the terms “subject” and “patient” refer to any animal, such as a mammal like a dog, cat, bird, livestock, and preferably a human. Specific examples of “subjects” and “patients” include, but are not limited to, individuals with Graves' ophthalmopathy (GO), individuals with GO-related characteristics such as increase in the volume of tissue within the orbit.
  • GO Graves' ophthalmopathy
  • the phrase "symptoms of Graves' ophthalmopathy” include, but are not limited to, an accumulation of glycosaminoglycans, edema, inflammation and fibrosis in the endomysial connective tissues investing the extraocular-muslce fiber, as well as an increase in the volume of the tissue in the orbit.
  • the phrase “under conditions such that the symptoms are reduced” refers to any degree of qualitative or quantitative reduction in detectable symptoms of GO, including but not limited to, a detectable impact on the rate of recovery from disease, or the reduction of at least one symptom of GO.
  • transfection as used herein refers to the introduction of foreign DNA or RNA into eukaryotic cells.
  • Transfection may be accomplished by a variety of means known to the art including calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated transfection, OLIGOFECTAMINE, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, hpofection, protoplast fusion, retroviral infection, and biolistics.
  • a "composition comprising a given polynucleotide sequence” as used herein refers broadly to any composition containing the given polynucleotide sequence.
  • the composition may comprise an aqueous solution.
  • siRNAs refers to short interfering RNAs.
  • siRNAs comprise a duplex, or double-stranded region, of about 18-25 nucleotides long; often siRNAs contain from about two to four unpaired nucleotides at the 3' end of each strand. At least one strand of the duplex or double-stranded region of a siRNA is substantially homologous to or substantially complementary to a target RNA molecule.
  • the strand complementary to a target RNA molecule is the "antisense strand;" the strand homologous to the target RNA molecule is the "sense strand,” and is also complementary to the siRNA antisense strand.
  • siRNAs may also contain additional sequences; non-limiting examples of such sequences include linking sequences, or loops, as well as stem and other folded structures.
  • RNA interference refers to the silencing or decreasing of gene expression by siRNAs. It is the process of sequence-specific, post-transcriptional gene silencing in animals and plants, initiated by siRNA that is homologous in its duplex region to the sequence of the silenced gene.
  • the gene may be endogenous or exogenous to the organism, present integrated into a chromosome or present in a transfection vector that is not integrated into the genome. The expression of the gene is either completely or partially inhibited. RNAi may also be considered to inhibit the function of a target RNA; the function of the target RNA may be complete or partial.
  • the present invention relates to RNA interference (RNAi) for preventing or reducing the expression of the thyroid stimulating hormone receptor gene in a target cell.
  • RNAi RNA interference
  • the present invention provides compositions comprising small interfering RNA duplexes (siRNAs), or vectors that encode siRNA, that inhibit the expression of the TSHr gene (e.g. by targeting TSHr mRNA), and methods of using these compositions to treat or prevent eye disease (e.g. Graves' ophthalmopathy) in a patient.
  • eye disease e.g. Graves' ophthalmopathy
  • Graves' Ophthalmopathy Graves' disease is the most common autoimmune disease in the U.S and accounts for 60-80% of thyrotoxicosis. Graves' ophthalmopathy (GO) is a potentially disfiguring and sight-threatening component of Graves' disease. GO is clinically evident in up to 80- 90% of patients with Graves' disease (Bru and Heufelder, 1993, NEJM, 329: 1468-75, herein incorporated by reference). Prevalence of GO, although uncertain, has been estimated in studies in the US at 0.4% and in the UK at 1.1-1.6% (Nanderpump et al, 1995, Clin. Endocrinol. 43:55, herein incorporated by reference).
  • Exophthalmos is almost always bilateral and usually relatively symmetric. Exophthalmos reflects an increase in soft-tissue mass within the bony orbit and may result from enlargement of the extraocular muscles or increased orbital fat volume. In severe cases, exophthalmos may cause corneal exposure and damage. Periorbital edema, scleral injection, and chemosis are also frequent, hi 5 to 10% of patients, the muscle swelling will result in diplopia. The most serious manifestation is compression of the optic nerve at the apex of the orbit, leading to papilledema, peripheral field defects, and if left untreated, permanent loss of vision.
  • Tissue enlargement is effected by infiltration of immunocompetent cells, mainly macrophages and T lymphocytes, as well as by collagen and glycosaminoglycans.
  • T-cells release numerous cytokines capable of stimulating cell proliferation, glycosaminoglycan synthesis, recruitment of new fat cells from orbital adipose precursor cells, and expression of various immunomodulatory molecules by orbital preadipocyte fibroblasts. Production of thyroid stimulating antibodies is also dependent on T-cells. In later stages of the disease, these infiltrations of lymphocytes and resulting edema are replaced by scar tissue and fibrosis.
  • the symptoms and signs of GO result from the accumulation of glycosaminoglycans, edema, inflammation and fibrosis in the endomysial connective tissues investing the extraocular-muscle fibers.
  • the close clinical association between Graves' hyperthyroidism and GO has led to the concept that there may be an autoantigen common to thyroid and orbital tissues that is recognized by circulating lymphocytes. Infiltration of the orbit by activated lymphocytes results in the local release of inflammatory cytokines and leads to the characteristic histologic and clinical features of GO.
  • the thyroid stimulating hormone receptor (TSHr) is the proposed autoantigen (Weetman et al, Orbital autoantigens. In: Hahn RS (ed): Thyroid eye disease.
  • TSHr protein has been measured in the orbit using polyclonal and monoclonal TSHr antibodies with the receptor being expressed on orbital adipose/connective tissue (Spitzweg et al, Soc. Eur. J. Endocrinol. 1997; 136:599-607, herein incorporated by reference).
  • TSHr expression has been shown to be much higher during the active stages of GO than during the inactive stages of the disease (Wakelkamp et al, Clin Endocrinol 2003; 58: 280- 7, herein incorporated by reference, Bahn RS, Thyroid. 2002;12(3): 193-5.).
  • the TSHr is a member of the family of G protein-coupled receptors (Paschke and Ludgate, N Engl J Med 1997;337 : 1675-81 , herein incorporated by reference).
  • the TSHr antigen is unusual among the glycoprotein hormone receptors in undergoing intramolecular cleavage into a ligand-binding a subunit and a large transmembrane ⁇ subunit (Loosfelt et al, Proc. Natl. Acad. Sci. USA. 1992; 89:3765-3769, herein incorporated by reference). An intervening C peptide region is removed, leading to shedding of heavily glycosylated ⁇ subunits from the cell surface (Couet et al, J Biol Chem. 1996; 271:4545-4552, and Tanaka et al, Molec Cell Endocrinol. 1999; 150: 113-119, herein incorporated by reference).
  • T lymphocytes CD8 or CD4
  • memory T-cells and B-cells T lymphocytes and B-cells.
  • IFN interferon
  • TGF- ⁇ transforming growth factor- ⁇
  • IL interleukin
  • IL-l ⁇ , TGF- ⁇ , IF- ⁇ are potent stimulators of glycosaminoglycan production by orbital fibroblasts.
  • Sensitivity to the glycosaminoglycan- stimulating effect of IL-l ⁇ and TGF- ⁇ does not differ from orbital connective tissue, extraocular endomysial connective tissue, abdominal skin, and pretibial skin, nor are there differences in sensitivity between fibroblasts from patients with ophthalmopathy and fibroblasts from normal subjects (Korducki et al, Invest Ophthalmol Vis Sci 1992; 33:2037- 42, herein incorporated by reference), i contrast, IL- ⁇ stimulates the production of glycosaminoglycan in orbital fibroblasts but not in fibroblasts derived from pretibial or abdominal skin. Another relevant effect of cytokines on orbital fibroblasts is their ability to stimulate cell proliferation.
  • IL-l ⁇ , IL- 4, insulin-like growth factor I, TGF- ⁇ , and platelet derived growth factor (PDGF) all stimulate the proliferation of orbital fibroblasts from patients with ophthalmopathy.
  • the proliferation of orbital fibroblasts from normal subjects is stimulated by the same cytokines with the exception of IL- 1 ⁇ .
  • Most current therapy provided to patients with GO continues to be based on descriptive case series data or the judgment of individual clinicians. Mild to moderate ophthahnopathy often improves spontaneously. Severe ophthalmopathy improves in about sixty per cent of patients with high doses of glucocorticoids, orbital irradiation, or both.
  • glucocorticoids decrease glycosaminoglycan synthesis and secretion by orbital fibroblasts.
  • Many studies have documented the effectiveness of high dose oral glucocorticoids on soft tissue changes and optic neuropathy, whereas the decrease in proptosis and the improvement in ocular motility have not always been impressive.
  • Orbital decompression is effective in patients with optic neuropathy and exophthalmos, either as the initial treatment or after the failure of glucocorticoid treatment.
  • immunosuppressive agents such as cyclosporine A, azathioprine, chlorambucil, cyclophosphamide, and ciamexone are either ineffective in TAO or carry an unfavorable benefit-risk relationship (Bartalena et al, Endocrin Rev 2000;21(2): 168-199, herein incorporated by reference).
  • Smith and Rosenbaum in a retrospective series of patients with non-infectious orbital inflammatory disease including three patients with GO have suggested that methotrexate may be useful as a steroid-sparing agent (Smith and Rosenbaum, Br J Ophthalmol 2001;85:1220-4).
  • a murine model of GO has been established by immunizing with TSHr fusion protein (Costagliola et al, Endocrinology. 1994; 135:2150-9, herein incorporated by reference), transferring TSHr-primed T-cells (Costagliola et al, Endocrinology. 1996; 137:4637-43, herein incorporated by reference), and or immunizing with a cDNA for the TSHr in an expression vector (Costagliola et al, . J Jmmunol. 1998; 160:1458-65, herein incorporated by reference).
  • the type of response induced varies with the genetic background of the mice such that thyroiditis, TSH-binding inhibiting immunoglobulins, and elevated circulating thyroxine (T4) are obtained in BALB/c (H2d) mice, while a destructive thyroiditis and reduced circulating T4 are obtained in NOD (H2g) mice.
  • T4 circulating thyroxine
  • BALB/c mice H2d mice
  • NOD mice H2g mice.
  • Analysis of the phenotype of the lymphocytic infiltrate of the two strains indicates that both contain activated T-cells expressing the receptor for IL-2, but the BALB/c mice contain B-cells, IL- 10 and IL-4 producing cells, suggesting a Th2 response, whereas the NOD mice display hallmarks of a Thl response with destruction of the gland.
  • RNA Interference RNAi represents an evolutionary conserved cellular defense for controlling the expression of foreign genes in most eukaryotes, including humans. RNAi is triggered by double-stranded RNA (dsRNA) and causes sequence-specific mRNA degradation of single- stranded target RNAs homologous in response to dsRNA.
  • the mediators of mRNA degradation are small interfering RNA duplexes (siRNAs), which are normally produced from long dsRNA by enzymatic cleavage in the cell.
  • siRNAs are generally approximately twenty-one nucleotides in length (e.g.
  • RNA-induced silencing complex RNA-induced silencing complex
  • siRNAs Beyond their value for validation of gene function, siRNAs also hold great potential as gene-specific therapeutic agents (Tuschl and Borkhardt, Molecular fritervent. 2002; 2(3):158-67, herein incorporated by reference).
  • the transfection of siRNAs into animal cells results in the potent, long-lasting post- transcriptional silencing of specific genes (Caplen et al, Proc Natl Acad Sci U.S.A. 2001; 98: 9742-7; Elbashir et al., Nature. 2001; 411:494-8; Elbashir et al., Genes Dev. 2001;15: 188-200; and Elbashir et al., EMBO J.
  • siRNAs are extraordinarily effective at lowering the amounts of targeted RNA, and by extension proteins, frequently to undetectable levels.
  • the silencing effect can last several months, and is extraordinarily specific, because one nucleotide mismatch between the target RNA and the central region of the siRNA is frequently sufficient to prevent silencing Brummelkamp et al, Science 2002; 296:550-3; and Holen et al, Nucleic Acids Res. 2002; 30: 1757-66, both of which are herein incorporated by reference.
  • RNAi for TSHr As discussed above, the present invention provides RNAi for inhibiting the expression of the TSHr antigen in cells. Preferably, inhibition of the level of TSHr expression in cells, such as the orbital fibroblasts of a patient, prevents and/or reduces the symptoms of eye disease, such as GO.
  • Oligoengine's web page has one such design tool that finds RNAi candidates based on Elbashir's (Elbashir, 2002) criteria.
  • Other design tools may also be used, such as the Cenix Bioscience design tool offered by Ambion.
  • Si2 silencing duplex offered by Oligoengine.
  • RNA folding software programs available that allow one to determine if the mRNA has a tendency to fold on its own and form a "hair-pin" (which in the case of dsRNAi is not as desirable since one goal is to have the RNAi attach to the mRNA and not itself).
  • One preferred configuration is an open configuration with three or less bonds. Generally, a positive delta G is desirable to show that it would not tend to fold on itself spontaneously.
  • siRNA candidate molecules that are generated can be, for example, screened in an animal model of Grave's ophthalmopathy for the quantitative evaluation of TSHr expression in vivo using similar techniques as described above.
  • an animal model for GO can be accomplished in several ways.
  • One preferred model is that developed by Costagliola (using primed splenocytes to human TSHr) as this model has been shown to generate orbital pathology that closely mimics that seen in humans in the highest percentage of animals compared to other methods.
  • mice Groups of 6 week- old female BALB/c mice are immunized with the extracellular domain of the human TSHr (MBP-ECD), produced as a maltose-binding protein fusion (Costagliola et al, 1994), in an adjuvant of alum plus attenuated Bordetella pertussis toxin on days 0 (100 ⁇ g), 14, 28 and 35 (50 ⁇ g) (Costagliola et al, 1994). On day 43, the mice are killed, and the spleens and thyroids are removed from these antigen-treated animals; the latter examined histologically to verify that thyroiditis had been induced.
  • MBP-ECD human TSHr
  • the spleen cells from both MBP-ECD-primed animals will be disrupted mechanically and cultured for 64 hours at 3 x 106/ml in RPMI supplemented with 10% FCS, 5 x 10-5 M ⁇ -mercaptoethanol, and 20 ⁇ g/ml of MBP-ECD.
  • Groups of 6 week-old female BALB/c mice are immunized in the tail vein with a total volume of 100-200 ⁇ l of PBS containing - 10 unfractionated splenocytes from primed syngeneic animals. Orbital tissue is removed from the animal model and assayed for TSHr.
  • TSHr specific siRNAs of the present invention may be synthesized chemically.
  • Chemical synthesis can be achieved by any method known or discovered in the art.
  • TSHr specific siRNAs of the present invention maybe synthesized by methods which comprise synthesis by transcription, hi some embodiments, transcription is in vitro, as from a DNA template and bacteriophage RNA polymerase promoter, in other embodiments, synthesis is in vivo, as from a gene and a promoter.
  • Separate-stranded duplex siRNA, where the two strands are synthesized separately and annealed, can also be synthesized chemically by any method known or discovered in the art.
  • ds siRNA are synthesized by methods which comprise synthesis by transcription.
  • the two strands of the double-stranded region of a siRNA are expressed separately by two different expression cassettes, either in vitro (e.g., in a transcription system) or in vivo in a host cell, and then brought together to form a duplex.
  • the present invention provides a composition comprising an expression cassette comprising a promoter and a gene that encodes a siRNA specific for TSHr or other autoimmune antigen.
  • the transcribed siRNA forms a single strand of a separate-stranded duplex (or double-stranded, or ds) siRNA of about 18 to 25 base pairs long; thus, formation of ds siRNA requires transcription of each of the two different strands of a ds siRNA.
  • the term "gene" in the expression cassette refers to a nucleic acid sequence that comprises coding sequences necessary for the production of a siRNA.
  • a gene includes but is not limited to coding sequences for a strand of a ds siRNA.
  • a DNA expression cassette comprises a chemically synthesized or recombinant DNA molecule containing at least one gene, or desired coding sequence for a single strand of a ds siRNA, and appropriate nucleic acid sequences necessary for the expression of the operably linked coding sequence, either in vitro or in vivo.
  • Expression in vitro may include expression in transcription systems and in transcription/ translation systems.
  • Expression in vivo may include expression in a particular host cell and/or organism.
  • Nucleic acid sequences necessary for expression in a prokaryotic cell or in a prokaryotic in vitro expression system are well known and usually include a promoter, an operator, and a ribosome binding site, often along with other sequences.
  • Nucleic acid sequences necessary for expression via bacterial RNA polymerases include a template DNA strand which has a polymerase promoter region followed by the complement of the RNA sequence desired (or the coding sequence or gene for the siRNA).
  • a complementary strand is annealed to the promoter portion of the template strand.
  • the gene may encode a transcript that contains at least one cleavage site, such that when cleaved results in at least two cleavage products.
  • Such products can include the two opposite strands of a ds siRNA.
  • the promoter may be constitutive or inducible; the promoter may also be tissue or organ specific (e.g. specific to the eye), or specific to a developmental phase.
  • the promoter is positioned 5' to the transcribed region.
  • Other promoters are also contemplated; such promoters include other polymerase HI promoters and microRNA promoters.
  • a eukaryotic expression cassette further comprises a transcription termination signal suitable for use with the promoter; for example, when the promoter is recognized by RNA polymerase HI, the termination signal is an RNA polymerase HI termination signal.
  • the cassette may also include sites for stable integration into a host cell genome.
  • the compositions comprise a vector comprising a gene encoding an siRNA specific for TSHr or preferably at least one expression cassette comprising a promoter and a gene which encodes a sequence necessary for the production of a siRNA specific for TSHr (an siRNA gene).
  • the vectors may further comprise marker genes, reporter genes, selection genes, or genes of interest, such as experimental genes.
  • Vectors of the present invention include cloning vectors and expression vectors. Expression vectors may be used in in vitro transcription/translation systems, as well as in in vivo in a host cell.
  • Expression vectors used in vivo in a host cell may be transfected into a host cell, either transiently, or stably.
  • a vector may also include sites for stable integration into a host cell genome.
  • a variety of transcription vectors containing bacteriophage RNA polymerase promoters are available.
  • DNA synthesis can be used to add a bacteriophage RNA polymerase promoter upstream of a siRNA coding sequence.
  • DNA linearized with a restriction enzyme, can then be used as a transcription template (See for example Milligan, JF and Uhlenbeck, OC (1989) Methods in Enzymology 180: 51-64).
  • vectors include, but are not limited to, chromosomal, nonchromosomal and synthetic DNA sequences (e.g., derivatives of viral DNA such as vaccinia, adeno virus, fowl pox virus, and pseudorabies). It is contemplated that any vector may be used as long as it is expressed in the appropriate system (either in vitro or in vivo) and viable in the host when used in vivo; these two criteria are sufficient for transient transfection. For stable transfection, the vector is also replicable in the host.
  • mammalian expression vectors comprise an origin of replication, suitable promoters and enhancers, and also any necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking non-transcribed sequences, i other embodiments, DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required non-transcribed genetic elements.
  • a gene sequence in an expression vector which is not part of an expression cassette comprising a siRNA gene (specific for TSHr) is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis, hi some embodiments, the gene sequence is a marker gene or a selection gene.
  • Promoters useful in the present invention include, but are not limited to, the cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, and mouse metallothionein promoters and other promoters known to control expression of gene in mammalian cells or their viruses.
  • recombinant expression vectors include origins of replication and selectable markers permitting transformation of the host cell (e.g., dihydrofolate reductase or neomycin resistance for eukaryotic cell culture).
  • transcription of DNA encoding a gene is increased by inserting an enhancer sequence into the vector.
  • Enhancers are cis- acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription.
  • Enhancers useful in the present invention include, but are not limited to, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adeno virus enhancers.
  • the design of a vector is configured to deliver the RNAi for more permanent inhibition.
  • RNAi-Ready pSIREN Vectors offer the RNAi-Ready pSIREN Vectors, that allow both a Plasmid-based vectors and an
  • the present invention provides compositions comprising cells transfected by an expression cassette of the present invention as described above, or by a vector of the present invention, where the vector comprises an expression cassette (or simply the siRNA gene) of the present invention, as described above.
  • the host cell is a mammalian cell.
  • a transfected cell may be a cultured cell or a tissue, organ, or organismal cell.
  • cultured host cells include, but are not limited to, Chinese hamster ovary (CHO) cells, COS-7 lines of monkey kidney fibroblasts, 293T, C127, 3T3, HeLa, orbital fibroblasts, and BHK cell lines.
  • host cells in vivo include tumor tissue and eye tissue.
  • the cells may be transfected transiently or stably (e.g. DNA expressing the siRNA is stably integrated and expressed by the host cell's genome).
  • the cells may also be transfected with an expression cassette of the present invention, or they are transfected with an expression vector of the present invention, hi some embodiments, transfected cells are cultured mammalian cells, preferably human cells.
  • cells to be transfected in vitro are typically cultured prior to transfection according to methods which are well known in the art, as for example by the preferred methods as defined by the American Tissue Culture Collection, hi certain embodiments of the present invention, cells are transfected with siRNAs that are synthesized exogenously (or in vitro, as by chemical methods or in vitro transcription methods), or they are transfected with expression cassettes or vectors, which express siRNAs within the transfected cell. i some embodiments, cells are transfected with siRNAs by any method known or discovered in the art which allows a cell to take up exogenous RNA and remain viable.
  • Non-limiting examples include electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, osmotic shock, temperature shock, and electroporation, and pressure treatment.
  • the siRNAs are introduced in vivo by Hpofection, as has been reported (as, for example, by Elbashir et al. (2001) Nature 411 : 494-498, herein incorporated by reference).
  • expression cassettes or vectors comprising at least one expression cassette are introduced into the desired host cells by methods known in the art, including but not limited to transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter (See e.g., Wu et al. (1992) J. Biol. Chem., 267:963; Wu and Wu (1988) J. Biol. Chem., 263:14621; and Williams et al. (1991) Proc. Natl. Acad. Sci. USA 88:272). Receptor-mediated DNA delivery approaches are also used (Curiel et al. (1992) Hum.
  • various methods are used to enhance transfection of the cells. These methods include but are not limited to osmotic shock, temperature shock, and electroporation, and pressure treatment.
  • the vector can be introduced in vivo by hpofection.
  • liposomes for encapsulation and transfection of nucleic acids in vitro.
  • Synthetic cationic lipids designed to limit the difficulties and dangers encountered with liposome mediated transfection can be used to prepare liposomes for in vivo transfection of a gene encoding a marker.
  • cationic lipids may promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes.
  • Particularly useful lipid compounds and compositions for transfer of nucleic acids are described in WO95/18863 and WO96/17823, and in U.S. Pat. No.
  • a nucleic acid in vivo, is also useful for facilitating transfection of a nucleic acid in vivo, such as a cationic oligopeptide (e.g., WO95/21931), peptides derived from DNA binding proteins (e.g., WO96/25508), or a cationic polymer
  • a sequence encoding a siRNA in vivo is also possible to introduce a sequence encoding a siRNA in vivo as a naked DNA, either as an expression cassette or as a vector.
  • Methods for formulating and administering naked DNA to mammalian muscle tissue are disclosed in U.S. Pat. Nos. 5,580,859 and 5,589,466, both of which are herein incorporated by reference.
  • Stable transfection typically requires the presence of a selectable marker in the vector used for transfection. Transfected cells are then subjected to a selection procedure.
  • selection involves growing the cells in a toxic substance, such as G418 or Hygromycin B, such that only those cells expressing a transfected marker gene conferring resistance to the toxic substance upon the transfected cell survive and grow.
  • a toxic substance such as G418 or Hygromycin B
  • Typical selectable markers are well known, and include genes encoding resistance to G418 or hygromycin B.
  • the transfecting agent is OLIGOFECTAMINE.
  • OLIGOFECTAMINE is a lipid based transfection reagent.
  • lipid based transfection reagents that were designed for the transfection of dsRNAis are the Transit-TKO reagent which is provided by Minis (Madison, WI) and the j etSI which was introduced by Polyp lus-trasfection SAS.
  • the Silencer siRNA Transfection Kit provided by Ambion's includes siPORT Amine and siPORT Lipid transfection agents. Roche offers the Fugene 6 transfection reagents that are also lipid based. There is an option to use electroporation in cell culture.
  • a plasmid vector delivery system is transfected into the cell with OLIGOFECTAMINE provided by hivitrogen or with siPORT XP-1 transfection agent provided by Ambion.
  • certain chemical modifications of the dsRNAis such as changing the lipophilicity of the molecule maybe employed (e.g., attachment of lipophilic residues at the 3' termini of the dsRNA). Delivery of dsRNAs into organisms may also be achieved with methods previously developed for the application of antisense oligonucleotides such as injection of liposomes-encapsulated molecules.
  • kits comprising at least one expression cassette comprising a siRNA gene specific for TSHr.
  • a transcript from the expression cassette forms a double stranded siRNA of about 18 to 25 base pairs long
  • the expression cassette is contained within a vector, as described above, where the vector can be used in in vitro transcription or transcription/translation systems, or used in vivo to transfect cells, either transiently or stably.
  • the kit comprises at least two expression cassettes, each of which comprises a siRNA gene, such that at least one gene encodes one strand of a siRNA that combines with a strand encoded by a second cassette to form a ds siRNA; the ds siRNA so produced is any of the embodiments described above.
  • These cassettes may comprise a promoter and a sequence encoding one strand of a ds siRNA.
  • the two expression cassettes are present in a single vector; in other embodiments, the two expression cassettes are present in two different vectors.
  • a vector with at least one expression cassette, or two different vectors, each comprising a single expression cassette can be used in in vitro transcription or transcription/translation systems, or used in vivo to transfect cells, either transiently or stably.
  • the kit comprises at least one expression cassettes which comprises a gene which encodes two separate strands of a ds siRNA and a processing site between the sequences encoding each strand such that, when the gene is transcribed, the transcript is processed, such as by cleavage, to result in two separate strands which can combine to form a ds siRNA, as described above.
  • kits comprising; a) a composition comprising small interfering RNA duplexes (siRNAs) configured to inhibit expression of thyroid stimulating hormone receptor (TSHr) protein, and b) printed material with instructions for employing the composition for treating a target cell expressing TSHr protein via expression of TSHr mRNA under conditions such that the TSHr mRNA is cleaved or otherwise disabled.
  • the printed material comprises instructions for employing the composition for treating eye disease.
  • the present invention also provides methods of synthesizing siRNAs specific for TSHr (e.g. human TSHr).
  • the siRNAs may be synthesized in vitro or in vivo, hi vitro synthesis includes chemical synthesis and synthesis by in vitro transcription. In vitro transcription is achieved in a transcription system, as from a bacteriophage RNA polymerase, or in a transcription/translation system, as from a eukaryotic RNA polymerase. In vivo synthesis occurs in a transfected host cell.
  • the siRNAs synthesized in vitro either chemically or by transcription, are used to transfect cells.
  • the present invention also provides methods of transfecting host cells with siRNAs synthesized in vitro; in particular embodiments, the siRNAs are synthesized by in vitro transcription.
  • the present invention further provides methods of silencing the TSHr gene in vivo by transfecting cells with siRNAs synthesized in vitro.
  • the siRNAs is expressed in vitro in a transcription/ translation system from an expression cassette or expression vector, along with an expression vector encoding and expressing a reporter gene.
  • the present invention also provides methods of expressing siRNAs in vivo by transfecting cells with expression cassettes or vectors which direct synthesis of siRNAs in vivo.
  • the present invention also provides methods of silencing genes in vivo by transfecting cells with expression cassettes or vectors that direct synthesis of siRNAs in vivo.
  • the present invention also provides methods and compositions suitable for gene therapy to alter gene expression, production, or function (e.g. to treat a human patient with GO).
  • the present invention provides compositions comprising expression cassettes comprising a gene encoding a siRNA specific for TSHr, and vectors comprising such expression cassettes.
  • Viral vectors commonly used for in vivo or ex vivo targeting and therapy procedures are generally DNA-based vectors and retroviral vectors. Methods for constructing and using viral vectors are known in the art (See e.g., Miller and Rosman (1992) BioTech., 7:980-990, herein incorporated by reference).
  • the viral vectors are replication defective, that is, they are unable to replicate autonomously in the target cell, hi general, the genome of the replication defective viral vectors lack at least one region that is necessary for the replication of the virus in the infected cell.
  • These regions can either be eliminated (in whole or in part), or be rendered non-functional by any technique known to a person skilled in the art. These techniques include the total removal, substitution (by other sequences, in particular by the inserted nucleic acid), partial deletion or addition of one or more bases to an essential (for replication) region.
  • Such techniques may be performed in vitro (i.e., on the isolated DNA) or in situ, using the techniques of genetic manipulation or by treatment with mutagenic agents.
  • DNA viral vectors include an attenuated or defective DNA viruses, including, but not limited to, herpes simplex virus (HSV), papillomavirus, Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), and the like.
  • HSV herpes simplex virus
  • EBV Epstein Barr virus
  • AAV adeno-associated virus
  • Defective viruses that entirely or almost entirely lack viral genes, are preferred, as defective virus is not infective after introduction into a cell.
  • Use of defective viral vectors allows for administration to cells in a specific, localized area (such as the eye or area surrounding the eye), without concern that the vector can infect other cells. Thus, a specific tissue can be specifically targeted.
  • HSV1 vector a defective herpes virus 1 (HSV1) vector (Kaplitt et al. (1991) Mol. Cell. Neurosci., 2:320-330), defective herpes virus vector lacking a glycoprotein L gene (See e.g., Patent Publication RD 371005 A), or other defective herpes virus vectors (See e.g., WO 94/21807; and WO 92/05263); an attenuated adenovirus vector, such as the vector described by Stratford-Perricaudet et al. ((1992) J. Clin. Invest., 90:626-630; See also, La Salle et al.
  • HSV1 vector Kermanent al. (1991) Mol. Cell. Neurosci., 2:320-330
  • defective herpes virus vector lacking a glycoprotein L gene See e.g., Patent Publication RD 371005 A
  • other defective herpes virus vectors See e.g., WO
  • an appropriate immunosuppressive treatment is employed in conjunction with the viral vector (e.g., adenovirus vector), to avoid immuno- deactivation of the viral vector and transfected cells.
  • the viral vector e.g., adenovirus vector
  • immunosuppressive cytokines such as interleukin-12 (IL-12), interferon-gamma (IFN- ⁇ ), or anti-CD4 antibody
  • IL-12 interleukin-12
  • IFN- ⁇ interferon-gamma
  • anti-CD4 antibody can be administered to block humoral or cellular immune responses to the viral vectors.
  • a viral vector that is engineered to express a minimal number of antigens.
  • the vector is an adenovirus vector.
  • Adenoviruses are eukaryotic DNA viruses that can be modified to efficiently deliver a nucleic acid of the invention to a variety of cell types.
  • serotypes of adenovirus exist.
  • type 2 or type 5 human adenoviruses Ad 2 or Ad 5
  • adenoviruses of animal origin See e.g., WO 94/26914
  • useful adenoviruses of animal origin include adenoviruses of canine, bovine, murine (e.g., Mavl, Beard et al., Virol. (1990) 75-81), ovine, porcine, avian, and simian (e.g., SAV) origin.
  • the replication defective adenoviral vectors of the invention comprise the ITRs, an encapsidation sequence and the nucleic acid of interest.
  • At least the El region of the adenoviral vector is non-functional.
  • the deletion in the El region preferably extends from nucleotides 455 to 3329 in the sequence of the Ad5 adenovirus (PvuII-Bgi ⁇ fragment) or 382 to 3446 (HinfH-Sau3A fragment).
  • Other regions may also be modified, in particular the E3 region (e.g., WO 95/02697), the E2 region (e.g., WO 94/28938), the E4 region (e.g., WO 94/28152, WO 94/12649 and WO 95/02697), or in any of the late genes L1-L5.
  • the adenoviral vector has a deletion in the El region (Ad 1.0).
  • El-deleted adenoviruses are disclosed in EP 185,573, the contents of which are incorporated herein by reference.
  • the adenoviral vector has a deletion in the El and E4 regions (Ad 3.0). Examples of E1/E4- deleted adenoviruses are disclosed in WO 95/02697 and WO 96/22378.
  • the adenoviral vector has a deletion in the El region into which the E4 region and the nucleic acid sequence are inserted.
  • the replication defective recombinant adenoviruses according to the invention can be prepared by any technique known to the person skilled in the art (See e.g., Levrero et al. (1991) Gene 101:195; EP 185 573; and Graham (1984) EMBO J., 3:2917).
  • they can be prepared by homologous recombination between an adenovirus and a plasmid that carries, inter alia, the DNA sequence of interest (e.g. the sequence encoding the siRNA specific for TSHr).
  • the homologous recombination is accomplished following co- transfection of the adenovirus and plasmid into an appropriate cell line.
  • the cell line that is employed should preferably (i) be transformable by the elements to be used, and (ii) contain the sequences that are able to complement the part of the genome of the replication defective adenovirus, preferably in integrated form in order to avoid the risks of recombination.
  • Examples of cell lines that may be used are the human embryonic kidney cell line 293 (Graham et al. (1977) J. Gen. Virol., 36:59), which contains the left-hand portion of the genome of an Ad5 adenovirus (12%) integrated into its genome, and cell lines that are able to complement the El and E4 functions, as described in applications WO 94/26914 and WO 95/02697.
  • AAV adeno-associated viruses
  • the adeno-associated viruses are DNA viruses of relatively small size that can integrate, in a stable and site-specific manner, into the genome of the cells that they infect. They are able to infect a wide spectrum of cells without inducing effects on cellular growth, morphology or differentiation, and they do not appear to be involved in human pathologies.
  • the AAV genome has been cloned, sequenced and characterized. It encompasses approximately 4700 bases and contains an inverted terminal repeat (ITR) region of approximately 145 bases at each end, which serves as an origin of replication for the virus.
  • ITR inverted terminal repeat
  • the remainder of the genome is divided into two essential regions that carry the encapsidation functions: the left-hand part of the genome, that contains the rep gene involved in viral replication and expression of the viral genes; and the right-hand part of the genome, that contains the cap gene encoding the capsid proteins of the virus.
  • vectors derived from the AAVs for transferring genes in vitro and in vivo has been described (See e.g., WO 91/18088; WO 93/09239; US Pat. No. 4,797,368; US Pat. No., 5,139,941; and EP 488 528, all of which are herein incorporated by reference).
  • the replication defective recombinant AAVs according to the invention can be prepared by co- transfecting a plasmid containing the nucleic acid sequence of interest flanked by two AAV inverted terminal repeat (ITR) regions, and a plasmid carrying the AAV encapsidation genes (rep and cap genes), into a cell line that is infected with a human helper virus (for example an adenovirus).
  • ITR inverted terminal repeat
  • the gene can be introduced in a retroviral vector (e.g., as described in U.S. Pat. Nos. 5,399,346, 4,650,764, 4,980,289 and 5,124,263; all of which are herein incorporated by reference; Mann et al. (1983) Cell 33:153; Markowitz et al. (1988) J. Virol, 62:1120; WO 95/07358; and Kuo et al. (1993) Blood 82:845).
  • the retroviruses are integrating viruses that infect dividing cells.
  • the retro virus genome includes two LTRs, an encapsidation sequence and three coding regions (gag, pol and env).
  • the gag, pol and env genes are generally deleted, in whole or in part, and replaced with a heterologous nucleic acid sequence of interest.
  • These vectors can be constructed from, different types of retrovirus, such as, HIV, MoMuLN ("murine Moloney leukemia virus” MSN ("murine Moloney sarcoma virus"), HaSN (“Harvey sarcoma virus”); S ⁇ V (“spleen necrosis virus”); RSV (“Rous sarcoma virus”) and Friend virus.
  • the retrovirus (or other vector) allows the siR ⁇ A gene to integrate into the host cells genome (thus being expressed by the cell and the cell's progency).
  • a plasmid is constructed that contains the LTRs, the encapsidation sequence and the coding sequence. This construct is used to transfect a packaging cell line, which cell line is able to supply in trans the retroviral functions that are deficient in the plasmid.
  • the packaging cell lines are thus able to express the gag, pol and env genes.
  • the recombinant retroviral vectors can contain modifications within the LTRs for suppressing transcriptional activity as well as extensive encapsidation sequences that may include a part of the gag gene (Bender et al. (1987) J. Virol., 61 : 1639). Recombinant retroviral vectors are purified by standard techniques known to those having ordinary skill in the art.
  • retroviral vectors encode siRNAs with strand specificity; this avoids self-targeting of the viral genomic RNA; in particular embodiments, the retroviral vector comprise a U6 promoter (lives, H. et al. (1996) Gene 171, 203-8).
  • the retroviral vector comprise a U6 promoter (lives, H. et al. (1996) Gene 171, 203-8).
  • cells are taken from a patient and transfected (transiently or stably) and then reintroduced into the patient, hi particular embodiments, the cells reintroduced into the patient have the siRNA gene integrated inter their genome.
  • the RNAi-based drug is delivered using a polymer-based delivery mechanism.
  • the Polymer Vector delivery may be used with or without the attachment of inactivated viruses.
  • the siRNA e.g. polymer vector
  • the siRNA may be delivered via, for example, an eyedrop, injection, extended release medication and/or systemic application.
  • a slow drug release options such as the "Encapsulated Cell Technology" (from Neurotech) or other slow release systems that will be placed potentially in the orbit is used to treat a patient with siRNA duplexes (or vectors encoding the same) that target TSHr.
  • the siRNA or vectors encoding siRNA are in the fonn of an ophthalmic solution.
  • the osmotic value of the solution is about 0.9% sodium chloride (e.g. 0.6% to about 1%).
  • the ophthalmic solution have a pH of about 7.4 (e.g. 6.6 to 7.8, preferably 7.0 to 7.4). It is also preferred that the ophthalmic solution be buffered to prevent wide changes in the pH.
  • EXAMPLE 1 Cells Expressing TSHr This example describes establishing reproducible and simple assays for cells expressing TSHr.
  • Chinese hamster ovary (CHO) cells were chosen for expressing the human TSHr because of their ready availability and published experience with successful expression of TSHr in these cells (Perret et al, Biochem Biophys Res Commun.1990; 171(3):1044-50, herein incorporated by reference). These cells were cultured using an established protocol (Chazenbalk et al, J Clin Invest. 2002; 110: 209-217, herein incorporated by reference).
  • CHO cells are grown in 25 cm2 culture flasks in HAM- F12 medium supplemented with 10% fetal calf serum, 100 U/ml penicillin, 50 ug/ml gentamicin, 2.5 ug/ml amphotericin-B, and maintained in a 5% CO2 water- saturated incubator at 37°C.
  • CHO cells not expressing TSHr were used as controls.
  • TSHr expression was verified and measured using RNA gel electrophoresis and quantitative RT-PCR.
  • CHO control cells were obtained and were shown not to express the TSHr by the same techniques.
  • RNAi for inhibition of TSHr This example describes constructing RNAi for inhibition of TSHr.
  • the human TSHr sequence (accession number NM_000369) is shown in Figure 1.
  • the gene sequence of human TSHr was reviewed and potential siRNA candidates were looked for following the guidelines published by Elbashir (Elbashir et al, Methods 2002; 26: 199-213, herein incorporated by reference).
  • RNAi sequences were identified (shown below in Table 1):
  • AAATCCGCAGTACAACCCAGG (SEQ ID NO:2) 2. AAGTCCGATGAGTTCAACCCG (SEQ ID NO:3) 3. AATGCCTTGAATAGCCCCCTC (SEQ ID NO:4) 4. AACTCCCATCTAACCCCAAAG (SEQ ID NO:5) 5. AACCCCAAAGAAGCAAGGCCA (SEQ ID NO:6) 6 AAGGTTACCCACGACATGAGG (SEQ ID NO:7) 7. AAAGGTTACCCACGACATGAG (SEQ ID NO: 8) 8. AAGTCAGTATCTGCCTGCCCA (SEQ _D NO:9) 9. AAAGAGCTCCCCCTCCTAAAG (SEQ ID NO:10) 10. AAGAGCTCCCCCTCCTAAAGT (SEQ ID NO: 11) 11.
  • AAAATGTTCCCTGACCTGACC (SEQ ID NO: 12) 12 AATGAGAGCAGTATGCAGAGC (SEQ ID NO: 13) 13. AACCTGGCCTTTGCGGATTTC (SEQ ID NO:14) 14. AACACGGCTGGTTTCTTCACT (SEQ ID NO: 15) 15. AAAGTCAGTATCTGCCTGCCC (SEQIDNO:16) 16. AAATGTTCCCTGACCTGACCA (SEQ IDNO:17) 17. AATGTTCCCTGACCTGACCAA (SEQ IDNO:18) These sequences can be synthesized as a siRNA duplex. SEQ ID NO:2 was synthesized as a siRNA duplex by Dharmacon Laboratories (Lafayette, CO) and used in the next example.
  • EXAMPLE 3 Inhibiting TSHr Expression via RNAi in Cell Culture
  • SEQ ID NO:2 constructed as an siRNA duplex was introduced into CHO cell lines (described above) using OligofectamineTM since it has been shown to be non-toxic to cells and to have transfection efficiencies of RNAi approaching 90%-95% in prior studies (Elbashir et al, 2002, infra).
  • OligofectamineTM adenosine triphosphate
  • CHO cells expressing TSHr were transfected with this RNAi and quantitative RT-PCR measuring the level of TSHr RNA in samples taken at 0, 2, 4, 8, 12, 24, and 38 hours post transfection was performed.
  • A represents the mean cycles at threshold for the TSHr receptor at each time point.
  • B represents the mean cycles at threshold for GAPDH (internal control).
  • S is the value “E” for the control samples of TSHr with no RNAi transfection.
  • E-S is calculated to compare the level of TSHr RNA at each time point to the level prior to transfection. The value of 2 to the power of negative E - S is calculated to obtain the relative TSHr RNA in the sample at each time point (relative to the amount of GAPDH RNA and relative to the amount of TSHr RNA prior to transfection).
  • EXAMPLE 4 Treating Graves' Ophthalmopathy in a Human Patient
  • This example describes treating Graves' Ophthalmopathy (GO) in a human patient exhibiting symptoms of GO.
  • a buffered ophthalmic solution with an osmotic value of 0.9% NaCl, a pH 7.4, an eye safe transfecting agent, and a vector for expressing siRNA when transcribed e.g. expressing a siRNA duplex comprising SEQ ID NO:2
  • This treatment is repeated as necessary to reduce or eliminate the symptoms of GO in the patient's eyes.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to RNA interference (RNAi) for preventing or reducing the expression of the thyroid stimulating hormone receptor gene in a target cell. In particular, the present invention provides compositions comprising small interfering RNA duplexes (siRNAs), or vectors that encode SIRNA, that inhibit the expression of the TSHr gene (e.g. by targeting TSHr mRNA), and methods of using these compositions to treat or prevent eye disease (e.g. Graves’ ophthalmopathy) in a patient.

Description

RNAi Treatment of Eye Disease
The present Application claims priority to U.S. Provisional Application Serial Number 60/493,156 filed August 7, 2003, which is herein incorporated by reference.
FIELD OF THE INVENTION The present invention relates to RNA interference (RNAi) for preventing or reducing the expression of the thyroid stimulating hormone receptor (TSHr) gene in a target cell, hi particular, the present invention relates to compositions comprising small interfering RNA duplexes (siRNAs), or vectors that encode siRNA, that inhibit the expression of the TSHr gene (e.g. by targeting TSHr mRNA), and methods of using these compositions to treat or prevent eye disease (e.g. Graves' ophthalmopathy) in a patient.
BACKGROUND OF THE INVENTION Graves' disease is the most common autoimmune disease in the U.S and accounts for 60-80% of thyrotoxicosis. Graves' ophthalmopathy (GO) is characterized by an increase in the volume of orbital tissues within the bony orbits leading to exophthalmos, extraocular muscle dysfunction, periorbital edema, compressive optic neuropathy, and vision loss. At present, ophthalmopathy is not preventable, and treatment options for established symptomatic disease are limited. Few treatment options beyond palliative care are available. Present palliative treatments including high dose corticosteroids, radiation therapy and surgery are either of questionable effectiveness or can result in disabling side effects. As such, what is needed is a new approach to preventing and treating the symptoms of GO.
SUMMARY OF THE INVENTION The present invention relates to RNA interference (RNAi) for preventing or reducing the expression of the thyroid stimulating hormone receptor gene in a target cell. In particular, the present invention provides compositions comprising small interfering RNA duplexes (siRNAs), or vectors that encode siRNA, that inhibit the expression of the TSHr gene (e.g. by targeting TSHr mRNA), and methods of using these compositions to treat or prevent eye disease (e.g. Graves' ophthalmopathy) in a patient. In some embodiments, the present invention provides methods for inhibiting the expression of the thyroid stimulating hormone receptor (TSHr) gene comprising; a) providing; i) a target cell expressing TSHr protein via expression of TSHr mRNA, and ii) a composition comprising a small interfering RNA duplex (siRNA), or a vector encoding the siRNA duplex, that targets the TSHr mRNA, b) contacting the target cell with the composition such that the TSHr mRNA is disabled (e.g. cleaved), thereby inhibiting expression of the TSHr protein by the TSHr gene. hi certain embodiments, the target cell is an orbital fibroblast or other cell in the eye (e.g. human eye). In particular embodiments, the target cell is an orbital cell (e.g. an extraocular muscle cell, a preadipocyte, adipocyte and/or fibroblast). In some embodiments, the target cell is a thyroid cell, hi other embodiments, the contacting is conducted in vitro. In particular embodiments, the contacting is conducted in vivo. In some embodiments, the composition further comprises a nucleic acid transfecting agent (e.g. OLIGOFECTAMINE or similar agent). hi certain embodiments, the present invention provides methods comprising; a) providing; i) a patient with symptoms of eye disease, and ii) a composition comprising small interfering RNA duplexes (siRNAs), or vector encoding the siRNA, configured to inhibit expression of thyroid stimulating hormone receptor (TSHr) protein, b) administering the composition to the patient under conditions such that one or more symptoms of the eye disease are reduced or eliminated. In some embodiments, the present invention provides methods comprising; a) providing; i) a patient at risk for eye disease, and ii) a composition comprising small interfering RNA duplexes (siRNAs), or vectors encoding the siRNA, configured to inhibit expression of thyroid stimulating hormone receptor (TSHr) protein, b) administering the composition to the patient under conditions such that one or more symptoms of the eye disease are prevented. In other embodiments, the present invention provides compositions comprising; a) a composition comprising small interfering RNA duplexes (siRNAs), or vector encoding the siRNA, configured to inhibit expression of thyroid stimulating hormone receptor (TSHr) protein, and b) a nucleic acid transfecting agent. i some embodiments, the present invention provides kits comprising; a) a composition comprising small interfering RNA duplexes (siRNAs), or vector encoding the siRNA, configured to inhibit expression of thyroid stimulating hormone receptor (TSHr) protein, and b) printed material with instructions for employing the composition for treating a target cell expressing TSHr protein via expression of TSHr mRNA under conditions such that the TSHr mRNA is cleaved or otherwise disabled. In particular embodiments, the eye disease is Graves' ophthalmopathy or similar eye disease, hi other embodiments, the patient at risk for eye disease has Graves' disease. In some embodiments, the administering is selected from intravenous, topically to the eye, orally, by inhalation, or other suitable method. In additional embodiments, the composition further comprises a nucleic acid transfecting agent, hi other embodiments, the composition further comprises reagents suitable for ophthalmic administration, hi certain embodiments, the administering is under conditions such that the composition contacts the orbital cells including but not limited to extraocular muscle cells, preadipocytes, adipocytes and fibroblasts of the patient. In particular embodiments, the present invention provides an eye dropper (or similar device) containing a composition comprising small interfering RNA duplexes (siRNAs), or vectors encoding said siRNA, configured to inhibit expression of thyroid stimulating hormone receptor (TSHr) protein, hi certain embodiments, the composition has a pH of about 7.4. In some embodiments, the composition is buffered. In certain embodiments, the siRNA duplexes comprise SEQ ID NO:2. hi other embodiments, the siRNA duplexes comprise a sequence selected from SEQ ID NOs:2-20.
DESCRIPTION OF THE FIGURES Figure 1 shows the nucleic acid sequence (SEQ ID NO:l) of the human TSHr gene. Figure 2 shows the level of TSHr expression 4 hours post transfection with siRNA specific for the TSHr gene as compared to a control. Figure 3 shows the level of TSHr expression 24 hours post transfection with siRNA specific for the TSHr gene as compares to a control. Figure 4 shows the relative quantitation of TSHr at different times points post transfection with RNAi. Figure 5 shows the level of TSHr expression 48 hours post transfection with siRNA specific for the TSHr gene as compares to a mock and a mismatch controls.
DEFINITIONS To facilitate an understanding of the invention, a number of terms are defined below. As used herein, the terms "subject" and "patient" refer to any animal, such as a mammal like a dog, cat, bird, livestock, and preferably a human. Specific examples of "subjects" and "patients" include, but are not limited to, individuals with Graves' ophthalmopathy (GO), individuals with GO-related characteristics such as increase in the volume of tissue within the orbit. As use herein, the phrase "symptoms of Graves' ophthalmopathy" include, but are not limited to, an accumulation of glycosaminoglycans, edema, inflammation and fibrosis in the endomysial connective tissues investing the extraocular-muslce fiber, as well as an increase in the volume of the tissue in the orbit. The phrase "under conditions such that the symptoms are reduced" refers to any degree of qualitative or quantitative reduction in detectable symptoms of GO, including but not limited to, a detectable impact on the rate of recovery from disease, or the reduction of at least one symptom of GO. The term "transfection" as used herein refers to the introduction of foreign DNA or RNA into eukaryotic cells. Transfection may be accomplished by a variety of means known to the art including calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated transfection, OLIGOFECTAMINE, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, hpofection, protoplast fusion, retroviral infection, and biolistics. A "composition comprising a given polynucleotide sequence" as used herein refers broadly to any composition containing the given polynucleotide sequence. The composition may comprise an aqueous solution. The term "siRNAs" refers to short interfering RNAs. In some embodiments, siRNAs comprise a duplex, or double-stranded region, of about 18-25 nucleotides long; often siRNAs contain from about two to four unpaired nucleotides at the 3' end of each strand. At least one strand of the duplex or double-stranded region of a siRNA is substantially homologous to or substantially complementary to a target RNA molecule. The strand complementary to a target RNA molecule is the "antisense strand;" the strand homologous to the target RNA molecule is the "sense strand," and is also complementary to the siRNA antisense strand. siRNAs may also contain additional sequences; non-limiting examples of such sequences include linking sequences, or loops, as well as stem and other folded structures. siRNAs appear to function as key intermediaries in triggering RNA interference in invertebrates and in vertebrates, and in triggering sequence-specific RNA degradation during posttranscriptional gene silencing in plants. The term "RNA interference" or "RNAi" refers to the silencing or decreasing of gene expression by siRNAs. It is the process of sequence-specific, post-transcriptional gene silencing in animals and plants, initiated by siRNA that is homologous in its duplex region to the sequence of the silenced gene. The gene may be endogenous or exogenous to the organism, present integrated into a chromosome or present in a transfection vector that is not integrated into the genome. The expression of the gene is either completely or partially inhibited. RNAi may also be considered to inhibit the function of a target RNA; the function of the target RNA may be complete or partial.
DESCRIPTION OF THE INVENTION The present invention relates to RNA interference (RNAi) for preventing or reducing the expression of the thyroid stimulating hormone receptor gene in a target cell. In particular, the present invention provides compositions comprising small interfering RNA duplexes (siRNAs), or vectors that encode siRNA, that inhibit the expression of the TSHr gene (e.g. by targeting TSHr mRNA), and methods of using these compositions to treat or prevent eye disease (e.g. Graves' ophthalmopathy) in a patient. Detailed below is a discussion of I) Graves' Ophthalmopathy, H) RNAi, and HI) RNAi for TSHr.
I. Graves' Ophthalmopathy (GO) Graves' disease is the most common autoimmune disease in the U.S and accounts for 60-80% of thyrotoxicosis. Graves' ophthalmopathy (GO) is a potentially disfiguring and sight-threatening component of Graves' disease. GO is clinically evident in up to 80- 90% of patients with Graves' disease (Bahn and Heufelder, 1993, NEJM, 329: 1468-75, herein incorporated by reference). Prevalence of GO, although uncertain, has been estimated in studies in the US at 0.4% and in the UK at 1.1-1.6% (Nanderpump et al, 1995, Clin. Endocrinol. 43:55, herein incorporated by reference). Women have been found to be affected 3-10 times more frequently than men, approaching 2% of the population. The mean age of presentation for Graves' thyroid disease is 41 years, and the orbital disease occurs an average of 2.5 years later. In general, after an initial stage of increasing disability lasting for about a year, a plateau is reached, after which the disease gradually becomes inactive or burnt out over a period of 8-36 months, leaving various degrees of stigmata behind. Even though the disease is more common in women, the severity of disease tends to be greater in men and in patients above 50 years of age. In most instances, the orbital problems begin within 18 months after diagnosis of thyroid disease. Active disease refers to the stage in which manifestations appear, or become worse, and the patient progressively experiences the negative consequences of the disease. This is in contrast to the inactive, or burnt out stage of the disease, in which the disease process is stable, although the patient may still be considerably handicapped. Initial symptoms of GO may include complaints of foreign-body sensation, tearing, or photophobia, often accompanied by signs that include lid retraction, lid lag, lagophthalmos, prominence of the episcleral vessels over the horizontal rectus muscles, and lid edema (Bahn and Heufelder, 1993, infra). Clinically evident ophthalmopathy occurs in 50% of patients with Graves' disease, although the use of sensitive imaging techniques such as computed tomography and magnetic resonance imaging provides evidence of ocular involvement in 80-90%. About a third of patients have exophthalmos (Weetman, NEJM. 2000; 343(17): 1236-48, herein incorporated by reference). Exophthalmos is almost always bilateral and usually relatively symmetric. Exophthalmos reflects an increase in soft-tissue mass within the bony orbit and may result from enlargement of the extraocular muscles or increased orbital fat volume. In severe cases, exophthalmos may cause corneal exposure and damage. Periorbital edema, scleral injection, and chemosis are also frequent, hi 5 to 10% of patients, the muscle swelling will result in diplopia. The most serious manifestation is compression of the optic nerve at the apex of the orbit, leading to papilledema, peripheral field defects, and if left untreated, permanent loss of vision. It is frequently impossible to determine the disease activity of the pathologic process upon clinical ocular examination. There is no consensus on the best combination of tests for the assessment of the activity or severity of ophthahnopathy. The symptoms and signs of GO can be explained by the mechanical effects of an increase in the volume of tissue within the orbit. Tissue enlargement is effected by infiltration of immunocompetent cells, mainly macrophages and T lymphocytes, as well as by collagen and glycosaminoglycans. Once recruitment of T-cells to the orbital space and transmigration of the endothelial cell barrier have occurred, T-cells release numerous cytokines capable of stimulating cell proliferation, glycosaminoglycan synthesis, recruitment of new fat cells from orbital adipose precursor cells, and expression of various immunomodulatory molecules by orbital preadipocyte fibroblasts. Production of thyroid stimulating antibodies is also dependent on T-cells. In later stages of the disease, these infiltrations of lymphocytes and resulting edema are replaced by scar tissue and fibrosis. The symptoms and signs of GO result from the accumulation of glycosaminoglycans, edema, inflammation and fibrosis in the endomysial connective tissues investing the extraocular-muscle fibers. The close clinical association between Graves' hyperthyroidism and GO has led to the concept that there may be an autoantigen common to thyroid and orbital tissues that is recognized by circulating lymphocytes. Infiltration of the orbit by activated lymphocytes results in the local release of inflammatory cytokines and leads to the characteristic histologic and clinical features of GO. The thyroid stimulating hormone receptor (TSHr) is the proposed autoantigen (Weetman et al, Orbital autoantigens. In: Hahn RS (ed): Thyroid eye disease. Boston: Kluwer Academic Pub; 2001 : pp 1-20, herein incorporated by reference). Supporting the concept that TSHr is the autoantigen, TSHr protein has been measured in the orbit using polyclonal and monoclonal TSHr antibodies with the receptor being expressed on orbital adipose/connective tissue (Spitzweg et al, Soc. Eur. J. Endocrinol. 1997; 136:599-607, herein incorporated by reference). At the mRNA level, TSHr expression has been shown to be much higher during the active stages of GO than during the inactive stages of the disease (Wakelkamp et al, Clin Endocrinol 2003; 58: 280- 7, herein incorporated by reference, Bahn RS, Thyroid. 2002;12(3): 193-5.). The TSHr is a member of the family of G protein-coupled receptors (Paschke and Ludgate, N Engl J Med 1997;337 : 1675-81 , herein incorporated by reference). The TSHr antigen is unusual among the glycoprotein hormone receptors in undergoing intramolecular cleavage into a ligand-binding a subunit and a large transmembrane β subunit (Loosfelt et al, Proc. Natl. Acad. Sci. USA. 1992; 89:3765-3769, herein incorporated by reference). An intervening C peptide region is removed, leading to shedding of heavily glycosylated α subunits from the cell surface (Couet et al, J Biol Chem. 1996; 271:4545-4552, and Tanaka et al, Molec Cell Endocrinol. 1999; 150: 113-119, herein incorporated by reference). Most of the mononuclear cells infiltrating the orbital tissue are T lymphocytes (CD8 or CD4), but some are memory T-cells and B-cells. These infiltrating cells contain interferon (IFN)-γ, transforming growth factor-β (TGF-β), and interleukin (IL)-lα, which are also present in the connective tissue adjacent to aggregates of the cells. These cytokines are not demonstrable in normal orbital tissue. IL-lα, TGF-β, IF-γ are potent stimulators of glycosaminoglycan production by orbital fibroblasts. Sensitivity to the glycosaminoglycan- stimulating effect of IL-lα and TGF-β does not differ from orbital connective tissue, extraocular endomysial connective tissue, abdominal skin, and pretibial skin, nor are there differences in sensitivity between fibroblasts from patients with ophthalmopathy and fibroblasts from normal subjects (Korducki et al, Invest Ophthalmol Vis Sci 1992; 33:2037- 42, herein incorporated by reference), i contrast, IL- γ stimulates the production of glycosaminoglycan in orbital fibroblasts but not in fibroblasts derived from pretibial or abdominal skin. Another relevant effect of cytokines on orbital fibroblasts is their ability to stimulate cell proliferation. IL-lα, IL- 4, insulin-like growth factor I, TGF-β, and platelet derived growth factor (PDGF) all stimulate the proliferation of orbital fibroblasts from patients with ophthalmopathy. The proliferation of orbital fibroblasts from normal subjects is stimulated by the same cytokines with the exception of IL- 1 α. Most current therapy provided to patients with GO continues to be based on descriptive case series data or the judgment of individual clinicians. Mild to moderate ophthahnopathy often improves spontaneously. Severe ophthalmopathy improves in about sixty per cent of patients with high doses of glucocorticoids, orbital irradiation, or both. Recently, Gorman, et al, in a randomized prospective double-blind placebo controlled study of patients with moderate symptomatic GO undergoing orbital irradiation, demonstrated no clinically or statistically significant difference between treated and untreated orbits six months post irradiation (Gorman et al, Ophthalmology 2001;108:1523-1534, herein incorporated by reference). Glucocorticoids have been employed in the management of GO for more than forty years. Their effectiveness is attributable to their anti-inflammatory and immunosuppressive actions, including interference with the function of T and B lymphocytes, reduction in the recruitment of neutrophils, monocytes, and macrophages in the inflamed area, inhibition of the function of immunocompetent T-cells, and inhibition of the release of mediators including cytokines. hi addition, glucocorticoids decrease glycosaminoglycan synthesis and secretion by orbital fibroblasts. Many studies have documented the effectiveness of high dose oral glucocorticoids on soft tissue changes and optic neuropathy, whereas the decrease in proptosis and the improvement in ocular motility have not always been impressive. Recurrence of the active eye disease is a frequent problem with oral glucocorticoid therapy, not only when the drug is withdrawn, but also when the dose is tapered (Bartalena et al, Baillieres Clin Endocrinol Metab 1997;11:521-536, herein incorporated by reference). Orbital decompression is effective in patients with optic neuropathy and exophthalmos, either as the initial treatment or after the failure of glucocorticoid treatment. Other immunosuppressive agents such as cyclosporine A, azathioprine, chlorambucil, cyclophosphamide, and ciamexone are either ineffective in TAO or carry an unfavorable benefit-risk relationship (Bartalena et al, Endocrin Rev 2000;21(2): 168-199, herein incorporated by reference). Smith and Rosenbaum in a retrospective series of patients with non-infectious orbital inflammatory disease including three patients with GO have suggested that methotrexate may be useful as a steroid-sparing agent (Smith and Rosenbaum, Br J Ophthalmol 2001;85:1220-4). A murine model of GO has been established by immunizing with TSHr fusion protein (Costagliola et al, Endocrinology. 1994; 135:2150-9, herein incorporated by reference), transferring TSHr-primed T-cells (Costagliola et al, Endocrinology. 1996; 137:4637-43, herein incorporated by reference), and or immunizing with a cDNA for the TSHr in an expression vector (Costagliola et al, . J Jmmunol. 1998; 160:1458-65, herein incorporated by reference). The type of response induced varies with the genetic background of the mice such that thyroiditis, TSH-binding inhibiting immunoglobulins, and elevated circulating thyroxine (T4) are obtained in BALB/c (H2d) mice, while a destructive thyroiditis and reduced circulating T4 are obtained in NOD (H2g) mice. Analysis of the phenotype of the lymphocytic infiltrate of the two strains indicates that both contain activated T-cells expressing the receptor for IL-2, but the BALB/c mice contain B-cells, IL- 10 and IL-4 producing cells, suggesting a Th2 response, whereas the NOD mice display hallmarks of a Thl response with destruction of the gland. Only BALB/c mice demonstrate orbital pathology that mimics GO in humans (Many et al, J Immunol. 1999; 162:4966-74, herein incorporated by reference). GO develops most commonly in BALB/c mice receiving TSHr primed T-cells, approaching 65% of recipients (Ludgate, Thyroid 2002; 12: 205-8, herein incorporated by reference).
II. RNA Interference (RNAi) RNAi represents an evolutionary conserved cellular defense for controlling the expression of foreign genes in most eukaryotes, including humans. RNAi is triggered by double-stranded RNA (dsRNA) and causes sequence-specific mRNA degradation of single- stranded target RNAs homologous in response to dsRNA. The mediators of mRNA degradation are small interfering RNA duplexes (siRNAs), which are normally produced from long dsRNA by enzymatic cleavage in the cell. siRNAs are generally approximately twenty-one nucleotides in length (e.g. 21-23 nucleotides in length), and have a base-paired structure characterized by two nucleotide 3 '-overhangs. Following the introduction of a small RNA, or RNAi, into the cell, it is believed the sequence is delivered to an enzyme complex called RISC (RNA-induced silencing complex). RISC recognizes the target and cleaves it with an endonuclease. It is noted that if larger RNA sequences are delivered to a cell, RNase DI enzyme (Dicer) converts longer dsRNA into 21-23 nt ds siRNA fragments. Chemically synthesized siRNAs have become powerful reagents for genome-wide analysis of mammalian gene function in cultured somatic cells. Beyond their value for validation of gene function, siRNAs also hold great potential as gene-specific therapeutic agents (Tuschl and Borkhardt, Molecular fritervent. 2002; 2(3):158-67, herein incorporated by reference). The transfection of siRNAs into animal cells results in the potent, long-lasting post- transcriptional silencing of specific genes (Caplen et al, Proc Natl Acad Sci U.S.A. 2001; 98: 9742-7; Elbashir et al., Nature. 2001; 411:494-8; Elbashir et al., Genes Dev. 2001;15: 188-200; and Elbashir et al., EMBO J. 2001; 20: 6877-88, all of which are herein incorporated by reference). Methods and compositions for performing RNAi with siRNAs are described, for example, in U.S. Patent 6,506,559, herein incorporated by reference. siRNAs are extraordinarily effective at lowering the amounts of targeted RNA, and by extension proteins, frequently to undetectable levels. The silencing effect can last several months, and is extraordinarily specific, because one nucleotide mismatch between the target RNA and the central region of the siRNA is frequently sufficient to prevent silencing Brummelkamp et al, Science 2002; 296:550-3; and Holen et al, Nucleic Acids Res. 2002; 30: 1757-66, both of which are herein incorporated by reference.
III. RNAi for TSHr As discussed above, the present invention provides RNAi for inhibiting the expression of the TSHr antigen in cells. Preferably, inhibition of the level of TSHr expression in cells, such as the orbital fibroblasts of a patient, prevents and/or reduces the symptoms of eye disease, such as GO. A. Designing and Testing RNAi for TSHr Example 2 below describes a general strategy for finding siRNA molecules for inhibiting expression of the TSHr gene. In order to design siRNAs for TSHr (e.g. that target TSHr mRNA) software design tools are available in the art (e.g. on the internet). For example, Oligoengine's web page has one such design tool that finds RNAi candidates based on Elbashir's (Elbashir, 2002) criteria. Other design tools may also be used, such as the Cenix Bioscience design tool offered by Ambion. In addition, there is also the Si2 silencing duplex offered by Oligoengine. There are also RNA folding software programs available that allow one to determine if the mRNA has a tendency to fold on its own and form a "hair-pin" (which in the case of dsRNAi is not as desirable since one goal is to have the RNAi attach to the mRNA and not itself). One preferred configuration is an open configuration with three or less bonds. Generally, a positive delta G is desirable to show that it would not tend to fold on itself spontaneously. siRNA candidate molecules that are generated can be, for example, screened in an animal model of Grave's ophthalmopathy for the quantitative evaluation of TSHr expression in vivo using similar techniques as described above. As reviewed by Ludgate (Ludgate M, Thyroid 2002; 12: 205-8. and published by Costagliola et al, J Clin Invest 2000; 105: 803-11, and Rao et al, Endocrinology 2003; 144: 260-6, an animal model for GO can be accomplished in several ways. One preferred model is that developed by Costagliola (using primed splenocytes to human TSHr) as this model has been shown to generate orbital pathology that closely mimics that seen in humans in the highest percentage of animals compared to other methods. The basic technique for creating the animal model as outlined by Costagliola et al, Endocrinology. 1994; 135:2150-9, Costagliola et al, Endocrinology. 1996; 137:4637-43, and by Many et al, J Immunol. 1999; 162:4966-74, includes these steps: Groups of 6 week- old female BALB/c mice are immunized with the extracellular domain of the human TSHr (MBP-ECD), produced as a maltose-binding protein fusion (Costagliola et al, 1994), in an adjuvant of alum plus attenuated Bordetella pertussis toxin on days 0 (100 μg), 14, 28 and 35 (50 μg) (Costagliola et al, 1994). On day 43, the mice are killed, and the spleens and thyroids are removed from these antigen-treated animals; the latter examined histologically to verify that thyroiditis had been induced. The spleen cells from both MBP-ECD-primed animals will be disrupted mechanically and cultured for 64 hours at 3 x 106/ml in RPMI supplemented with 10% FCS, 5 x 10-5 M β-mercaptoethanol, and 20 μg/ml of MBP-ECD. Groups of 6 week-old female BALB/c mice are immunized in the tail vein with a total volume of 100-200 μl of PBS containing - 10 unfractionated splenocytes from primed syngeneic animals. Orbital tissue is removed from the animal model and assayed for TSHr.
B. Expression Cassettes TSHr specific siRNAs of the present invention may be synthesized chemically.
Chemical synthesis can be achieved by any method known or discovered in the art.
Alternatively, TSHr specific siRNAs of the present invention maybe synthesized by methods which comprise synthesis by transcription, hi some embodiments, transcription is in vitro, as from a DNA template and bacteriophage RNA polymerase promoter, in other embodiments, synthesis is in vivo, as from a gene and a promoter. Separate-stranded duplex siRNA, where the two strands are synthesized separately and annealed, can also be synthesized chemically by any method known or discovered in the art. Alternatively, ds siRNA are synthesized by methods which comprise synthesis by transcription. In some embodiments, the two strands of the double-stranded region of a siRNA are expressed separately by two different expression cassettes, either in vitro (e.g., in a transcription system) or in vivo in a host cell, and then brought together to form a duplex. Thus, in another aspect, the present invention provides a composition comprising an expression cassette comprising a promoter and a gene that encodes a siRNA specific for TSHr or other autoimmune antigen. In some embodiments, the transcribed siRNA forms a single strand of a separate-stranded duplex (or double-stranded, or ds) siRNA of about 18 to 25 base pairs long; thus, formation of ds siRNA requires transcription of each of the two different strands of a ds siRNA. The term "gene" in the expression cassette refers to a nucleic acid sequence that comprises coding sequences necessary for the production of a siRNA. Thus, a gene includes but is not limited to coding sequences for a strand of a ds siRNA. Generally, a DNA expression cassette comprises a chemically synthesized or recombinant DNA molecule containing at least one gene, or desired coding sequence for a single strand of a ds siRNA, and appropriate nucleic acid sequences necessary for the expression of the operably linked coding sequence, either in vitro or in vivo. Expression in vitro may include expression in transcription systems and in transcription/ translation systems. Expression in vivo may include expression in a particular host cell and/or organism. Nucleic acid sequences necessary for expression in a prokaryotic cell or in a prokaryotic in vitro expression system are well known and usually include a promoter, an operator, and a ribosome binding site, often along with other sequences. Eukaryotic in vitro transcription systems and cells are known to utilize promoters, enhancers, and termination and polyadenylation signals. Nucleic acid sequences necessary for expression via bacterial RNA polymerases (such as T3, T7, and SP6), referred to as a transcription template in the art, include a template DNA strand which has a polymerase promoter region followed by the complement of the RNA sequence desired (or the coding sequence or gene for the siRNA). In order to create a transcription template, a complementary strand is annealed to the promoter portion of the template strand. In any of the expression cassettes described above, the gene may encode a transcript that contains at least one cleavage site, such that when cleaved results in at least two cleavage products. Such products can include the two opposite strands of a ds siRNA. In an expression system for expression in a eukaryotic cell, the promoter may be constitutive or inducible; the promoter may also be tissue or organ specific (e.g. specific to the eye), or specific to a developmental phase. Preferably, the promoter is positioned 5' to the transcribed region. Other promoters are also contemplated; such promoters include other polymerase HI promoters and microRNA promoters. Preferably, a eukaryotic expression cassette further comprises a transcription termination signal suitable for use with the promoter; for example, when the promoter is recognized by RNA polymerase HI, the termination signal is an RNA polymerase HI termination signal. The cassette may also include sites for stable integration into a host cell genome. C. Vectors In other aspects of the present invention, the compositions comprise a vector comprising a gene encoding an siRNA specific for TSHr or preferably at least one expression cassette comprising a promoter and a gene which encodes a sequence necessary for the production of a siRNA specific for TSHr (an siRNA gene). The vectors may further comprise marker genes, reporter genes, selection genes, or genes of interest, such as experimental genes. Vectors of the present invention include cloning vectors and expression vectors. Expression vectors may be used in in vitro transcription/translation systems, as well as in in vivo in a host cell. Expression vectors used in vivo in a host cell may be transfected into a host cell, either transiently, or stably. Thus, a vector may also include sites for stable integration into a host cell genome. In some embodiments, it is useful to clone a siRNA gene downstream of a bacteriophage RNA polymerase promoter into a multicopy plasmid. A variety of transcription vectors containing bacteriophage RNA polymerase promoters (such as T7 promoters) are available. Alternatively, DNA synthesis can be used to add a bacteriophage RNA polymerase promoter upstream of a siRNA coding sequence. The cloned plasmid
DNA, linearized with a restriction enzyme, can then be used as a transcription template (See for example Milligan, JF and Uhlenbeck, OC (1989) Methods in Enzymology 180: 51-64).
In other embodiments of the present invention, vectors include, but are not limited to, chromosomal, nonchromosomal and synthetic DNA sequences (e.g., derivatives of viral DNA such as vaccinia, adeno virus, fowl pox virus, and pseudorabies). It is contemplated that any vector may be used as long as it is expressed in the appropriate system (either in vitro or in vivo) and viable in the host when used in vivo; these two criteria are sufficient for transient transfection. For stable transfection, the vector is also replicable in the host. Large numbers of suitable vectors are known to those of skill in the art, and are commercially available, hi some embodiments of the present invention, mammalian expression vectors comprise an origin of replication, suitable promoters and enhancers, and also any necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking non-transcribed sequences, i other embodiments, DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required non-transcribed genetic elements. In certain embodiments of the present invention, a gene sequence in an expression vector which is not part of an expression cassette comprising a siRNA gene (specific for TSHr) is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis, hi some embodiments, the gene sequence is a marker gene or a selection gene. Promoters useful in the present invention include, but are not limited to, the cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, and mouse metallothionein promoters and other promoters known to control expression of gene in mammalian cells or their viruses. In other embodiments of the present invention, recombinant expression vectors include origins of replication and selectable markers permitting transformation of the host cell (e.g., dihydrofolate reductase or neomycin resistance for eukaryotic cell culture). h some embodiments of the present invention, transcription of DNA encoding a gene is increased by inserting an enhancer sequence into the vector. Enhancers are cis- acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Enhancers useful in the present invention include, but are not limited to, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adeno virus enhancers. Preferably the design of a vector is configured to deliver the RNAi for more permanent inhibition. For example the pSilencer siRNA expression vector offered by
Ambion, the pSuper RNAi system offered by Oligoengine, and the GneSilencer System offered by EVIGENEX. These are all plasmid vector based RNAis. BD Biosciences offer the RNAi-Ready pSIREN Vectors, that allow both a Plasmid-based vectors and an
Adenoviral or a Retroviral delivery formats. Ambion offers the pSilencer adeno, an adeno viral vector for siRNA. For the design of a vector there is no limitation regarding the folding pattern since there is no concern regarding the formation of a hairpin or at least there are no studies that found any difference in performance related to the mRNA folding pattern. Therefore, SEQ ID NOS:2-l 8, for example, may be used with in a Vector (both Plasmid and Viral) delivery systems. There are additional sequences that could also be used with a vector:
AAGGATATTCAACGCATCCCC (SEQ IDNO:19) AAACTGAACGTCCCCCGCTTT (SEQ IDNO:20)
It is noted that Ambion offers a design tool for a vector on their web page, and BD Biosciences offers a manual for the design of a vector, both of which are useful for designing vectors for siRNA. D. Transfecting cells In yet other aspects, the present invention provides compositions comprising cells transfected by an expression cassette of the present invention as described above, or by a vector of the present invention, where the vector comprises an expression cassette (or simply the siRNA gene) of the present invention, as described above. In some embodiments of the present invention, the host cell is a mammalian cell. A transfected cell may be a cultured cell or a tissue, organ, or organismal cell. Specific examples of cultured host cells include, but are not limited to, Chinese hamster ovary (CHO) cells, COS-7 lines of monkey kidney fibroblasts, 293T, C127, 3T3, HeLa, orbital fibroblasts, and BHK cell lines. Specific examples of host cells in vivo include tumor tissue and eye tissue. The cells may be transfected transiently or stably (e.g. DNA expressing the siRNA is stably integrated and expressed by the host cell's genome). The cells may also be transfected with an expression cassette of the present invention, or they are transfected with an expression vector of the present invention, hi some embodiments, transfected cells are cultured mammalian cells, preferably human cells. In other embodiments, they are tissue, organ, or organismal cells (e.g. orbital fibroblasts). In the present invention, cells to be transfected in vitro are typically cultured prior to transfection according to methods which are well known in the art, as for example by the preferred methods as defined by the American Tissue Culture Collection, hi certain embodiments of the present invention, cells are transfected with siRNAs that are synthesized exogenously (or in vitro, as by chemical methods or in vitro transcription methods), or they are transfected with expression cassettes or vectors, which express siRNAs within the transfected cell. i some embodiments, cells are transfected with siRNAs by any method known or discovered in the art which allows a cell to take up exogenous RNA and remain viable. Non-limiting examples include electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, osmotic shock, temperature shock, and electroporation, and pressure treatment. In alternative, embodiments, the siRNAs are introduced in vivo by Hpofection, as has been reported (as, for example, by Elbashir et al. (2001) Nature 411 : 494-498, herein incorporated by reference). hi other embodiments expression cassettes or vectors comprising at least one expression cassette are introduced into the desired host cells by methods known in the art, including but not limited to transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter (See e.g., Wu et al. (1992) J. Biol. Chem., 267:963; Wu and Wu (1988) J. Biol. Chem., 263:14621; and Williams et al. (1991) Proc. Natl. Acad. Sci. USA 88:272). Receptor-mediated DNA delivery approaches are also used (Curiel et al. (1992) Hum. Gene Ther., 3:147; and Wu and Wu (1987) J. Biol. Chem., 262:4429). In some embodiments, various methods are used to enhance transfection of the cells. These methods include but are not limited to osmotic shock, temperature shock, and electroporation, and pressure treatment. Alternatively, the vector can be introduced in vivo by hpofection. For the past decade, there has been increasing use of liposomes for encapsulation and transfection of nucleic acids in vitro. Synthetic cationic lipids designed to limit the difficulties and dangers encountered with liposome mediated transfection can be used to prepare liposomes for in vivo transfection of a gene encoding a marker. The use of cationic lipids may promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes. Particularly useful lipid compounds and compositions for transfer of nucleic acids are described in WO95/18863 and WO96/17823, and in U.S. Pat. No.
5,459,127, herein incorporated by reference. Other molecules are also useful for facilitating transfection of a nucleic acid in vivo, such as a cationic oligopeptide (e.g., WO95/21931), peptides derived from DNA binding proteins (e.g., WO96/25508), or a cationic polymer
(e.g., WO95/21931). It is also possible to introduce a sequence encoding a siRNA in vivo as a naked DNA, either as an expression cassette or as a vector. Methods for formulating and administering naked DNA to mammalian muscle tissue are disclosed in U.S. Pat. Nos. 5,580,859 and 5,589,466, both of which are herein incorporated by reference. Stable transfection typically requires the presence of a selectable marker in the vector used for transfection. Transfected cells are then subjected to a selection procedure. Generally, selection involves growing the cells in a toxic substance, such as G418 or Hygromycin B, such that only those cells expressing a transfected marker gene conferring resistance to the toxic substance upon the transfected cell survive and grow. Such selection techniques are well known in the art. Typical selectable markers are well known, and include genes encoding resistance to G418 or hygromycin B. hi preferred embodiments, the transfecting agent is OLIGOFECTAMINE. OLIGOFECTAMINE is a lipid based transfection reagent. Additional example of lipid based transfection reagents that were designed for the transfection of dsRNAis are the Transit-TKO reagent which is provided by Minis (Madison, WI) and the j etSI which was introduced by Polyp lus-trasfection SAS. In addition, the Silencer siRNA Transfection Kit provided by Ambion's includes siPORT Amine and siPORT Lipid transfection agents. Roche offers the Fugene 6 transfection reagents that are also lipid based. There is an option to use electroporation in cell culture. Preferably a plasmid vector delivery system is transfected into the cell with OLIGOFECTAMINE provided by hivitrogen or with siPORT XP-1 transfection agent provided by Ambion. i certain embodiments, certain chemical modifications of the dsRNAis such as changing the lipophilicity of the molecule maybe employed (e.g., attachment of lipophilic residues at the 3' termini of the dsRNA). Delivery of dsRNAs into organisms may also be achieved with methods previously developed for the application of antisense oligonucleotides such as injection of liposomes-encapsulated molecules.
E. Kits The present invention also provides kits comprising at least one expression cassette comprising a siRNA gene specific for TSHr. In some aspects, a transcript from the expression cassette forms a double stranded siRNA of about 18 to 25 base pairs long, hi other embodiments, the expression cassette is contained within a vector, as described above, where the vector can be used in in vitro transcription or transcription/translation systems, or used in vivo to transfect cells, either transiently or stably. In other aspects, the kit comprises at least two expression cassettes, each of which comprises a siRNA gene, such that at least one gene encodes one strand of a siRNA that combines with a strand encoded by a second cassette to form a ds siRNA; the ds siRNA so produced is any of the embodiments described above. These cassettes may comprise a promoter and a sequence encoding one strand of a ds siRNA. In some further embodiments, the two expression cassettes are present in a single vector; in other embodiments, the two expression cassettes are present in two different vectors. A vector with at least one expression cassette, or two different vectors, each comprising a single expression cassette, can be used in in vitro transcription or transcription/translation systems, or used in vivo to transfect cells, either transiently or stably. In yet other aspects, the kit comprises at least one expression cassettes which comprises a gene which encodes two separate strands of a ds siRNA and a processing site between the sequences encoding each strand such that, when the gene is transcribed, the transcript is processed, such as by cleavage, to result in two separate strands which can combine to form a ds siRNA, as described above. In some embodiments, the present invention provides kits comprising; a) a composition comprising small interfering RNA duplexes (siRNAs) configured to inhibit expression of thyroid stimulating hormone receptor (TSHr) protein, and b) printed material with instructions for employing the composition for treating a target cell expressing TSHr protein via expression of TSHr mRNA under conditions such that the TSHr mRNA is cleaved or otherwise disabled. In certain embodiments, the printed material comprises instructions for employing the composition for treating eye disease.
F. Generating TSHr specific siRNA The present invention also provides methods of synthesizing siRNAs specific for TSHr (e.g. human TSHr). The siRNAs may be synthesized in vitro or in vivo, hi vitro synthesis includes chemical synthesis and synthesis by in vitro transcription. In vitro transcription is achieved in a transcription system, as from a bacteriophage RNA polymerase, or in a transcription/translation system, as from a eukaryotic RNA polymerase. In vivo synthesis occurs in a transfected host cell. The siRNAs synthesized in vitro, either chemically or by transcription, are used to transfect cells. Therefore, the present invention also provides methods of transfecting host cells with siRNAs synthesized in vitro; in particular embodiments, the siRNAs are synthesized by in vitro transcription. The present invention further provides methods of silencing the TSHr gene in vivo by transfecting cells with siRNAs synthesized in vitro. In other methods, the siRNAs is expressed in vitro in a transcription/ translation system from an expression cassette or expression vector, along with an expression vector encoding and expressing a reporter gene. The present invention also provides methods of expressing siRNAs in vivo by transfecting cells with expression cassettes or vectors which direct synthesis of siRNAs in vivo. The present invention also provides methods of silencing genes in vivo by transfecting cells with expression cassettes or vectors that direct synthesis of siRNAs in vivo.
G. Therapeutic Applications The present invention also provides methods and compositions suitable for gene therapy to alter gene expression, production, or function (e.g. to treat a human patient with GO). As described above, the present invention provides compositions comprising expression cassettes comprising a gene encoding a siRNA specific for TSHr, and vectors comprising such expression cassettes. Viral vectors commonly used for in vivo or ex vivo targeting and therapy procedures are generally DNA-based vectors and retroviral vectors. Methods for constructing and using viral vectors are known in the art (See e.g., Miller and Rosman (1992) BioTech., 7:980-990, herein incorporated by reference). Preferably, the viral vectors are replication defective, that is, they are unable to replicate autonomously in the target cell, hi general, the genome of the replication defective viral vectors lack at least one region that is necessary for the replication of the virus in the infected cell. These regions can either be eliminated (in whole or in part), or be rendered non-functional by any technique known to a person skilled in the art. These techniques include the total removal, substitution (by other sequences, in particular by the inserted nucleic acid), partial deletion or addition of one or more bases to an essential (for replication) region. Such techniques may be performed in vitro (i.e., on the isolated DNA) or in situ, using the techniques of genetic manipulation or by treatment with mutagenic agents. Preferably, the replication defective virus retains the sequences of its genome that are necessary for encapsidating the viral particles. DNA viral vectors include an attenuated or defective DNA viruses, including, but not limited to, herpes simplex virus (HSV), papillomavirus, Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), and the like. Defective viruses, that entirely or almost entirely lack viral genes, are preferred, as defective virus is not infective after introduction into a cell. Use of defective viral vectors allows for administration to cells in a specific, localized area (such as the eye or area surrounding the eye), without concern that the vector can infect other cells. Thus, a specific tissue can be specifically targeted. Examples of particular vectors include, but are not limited to, a defective herpes virus 1 (HSV1) vector (Kaplitt et al. (1991) Mol. Cell. Neurosci., 2:320-330), defective herpes virus vector lacking a glycoprotein L gene (See e.g., Patent Publication RD 371005 A), or other defective herpes virus vectors (See e.g., WO 94/21807; and WO 92/05263); an attenuated adenovirus vector, such as the vector described by Stratford-Perricaudet et al. ((1992) J. Clin. Invest., 90:626-630; See also, La Salle et al. (1993) Science 259:988-990); and a defective adeno-associated virus vector (Samulski et al. (1987) J. Virol., 61:3096-3101; Samulski et al. (1989) J. Virol., 63:3822-3828; and Lebkowski et al. (1988) Mol. Cell. Biol., 8:3988-3996). Preferably, for in vivo administration, an appropriate immunosuppressive treatment is employed in conjunction with the viral vector (e.g., adenovirus vector), to avoid immuno- deactivation of the viral vector and transfected cells. For example, immunosuppressive cytokines, such as interleukin-12 (IL-12), interferon-gamma (IFN-γ), or anti-CD4 antibody, can be administered to block humoral or cellular immune responses to the viral vectors. In addition, it is advantageous to employ a viral vector that is engineered to express a minimal number of antigens. In some embodiments, the vector is an adenovirus vector. Adenoviruses are eukaryotic DNA viruses that can be modified to efficiently deliver a nucleic acid of the invention to a variety of cell types. Various serotypes of adenovirus exist. Of these serotypes, type 2 or type 5 human adenoviruses (Ad 2 or Ad 5), or adenoviruses of animal origin (See e.g., WO 94/26914) are preferred. Examples of useful adenoviruses of animal origin include adenoviruses of canine, bovine, murine (e.g., Mavl, Beard et al., Virol. (1990) 75-81), ovine, porcine, avian, and simian (e.g., SAV) origin. Preferably, the replication defective adenoviral vectors of the invention comprise the ITRs, an encapsidation sequence and the nucleic acid of interest. Still more preferably, at least the El region of the adenoviral vector is non-functional. The deletion in the El region preferably extends from nucleotides 455 to 3329 in the sequence of the Ad5 adenovirus (PvuII-Bgiπ fragment) or 382 to 3446 (HinfH-Sau3A fragment). Other regions may also be modified, in particular the E3 region (e.g., WO 95/02697), the E2 region (e.g., WO 94/28938), the E4 region (e.g., WO 94/28152, WO 94/12649 and WO 95/02697), or in any of the late genes L1-L5. In particular embodiments, the adenoviral vector has a deletion in the El region (Ad 1.0). Examples of El-deleted adenoviruses are disclosed in EP 185,573, the contents of which are incorporated herein by reference. In another embodiment, the adenoviral vector has a deletion in the El and E4 regions (Ad 3.0). Examples of E1/E4- deleted adenoviruses are disclosed in WO 95/02697 and WO 96/22378. In still another embodiment, the adenoviral vector has a deletion in the El region into which the E4 region and the nucleic acid sequence are inserted. The replication defective recombinant adenoviruses according to the invention can be prepared by any technique known to the person skilled in the art (See e.g., Levrero et al. (1991) Gene 101:195; EP 185 573; and Graham (1984) EMBO J., 3:2917). In particular, they can be prepared by homologous recombination between an adenovirus and a plasmid that carries, inter alia, the DNA sequence of interest (e.g. the sequence encoding the siRNA specific for TSHr). The homologous recombination is accomplished following co- transfection of the adenovirus and plasmid into an appropriate cell line. The cell line that is employed should preferably (i) be transformable by the elements to be used, and (ii) contain the sequences that are able to complement the part of the genome of the replication defective adenovirus, preferably in integrated form in order to avoid the risks of recombination. Examples of cell lines that may be used are the human embryonic kidney cell line 293 (Graham et al. (1977) J. Gen. Virol., 36:59), which contains the left-hand portion of the genome of an Ad5 adenovirus (12%) integrated into its genome, and cell lines that are able to complement the El and E4 functions, as described in applications WO 94/26914 and WO 95/02697. Recombinant adenoviruses are recovered and purified using standard molecular biological techniques that are well known to one of ordinary skill in the art. The adeno-associated viruses (AAV) are DNA viruses of relatively small size that can integrate, in a stable and site-specific manner, into the genome of the cells that they infect. They are able to infect a wide spectrum of cells without inducing effects on cellular growth, morphology or differentiation, and they do not appear to be involved in human pathologies. The AAV genome has been cloned, sequenced and characterized. It encompasses approximately 4700 bases and contains an inverted terminal repeat (ITR) region of approximately 145 bases at each end, which serves as an origin of replication for the virus. The remainder of the genome is divided into two essential regions that carry the encapsidation functions: the left-hand part of the genome, that contains the rep gene involved in viral replication and expression of the viral genes; and the right-hand part of the genome, that contains the cap gene encoding the capsid proteins of the virus. The use of vectors derived from the AAVs for transferring genes in vitro and in vivo has been described (See e.g., WO 91/18088; WO 93/09239; US Pat. No. 4,797,368; US Pat. No., 5,139,941; and EP 488 528, all of which are herein incorporated by reference). These publications describe various AAV-derived constructs in which the rep and/or cap genes are deleted and replaced by a gene of interest, and the use of these constructs for transferring the gene of interest in vitro (into cultured cells) or in vivo (directly into an organism). The replication defective recombinant AAVs according to the invention can be prepared by co- transfecting a plasmid containing the nucleic acid sequence of interest flanked by two AAV inverted terminal repeat (ITR) regions, and a plasmid carrying the AAV encapsidation genes (rep and cap genes), into a cell line that is infected with a human helper virus (for example an adenovirus). The AAV recombinants that are produced are then purified by standard techniques. hi another embodiment, the gene can be introduced in a retroviral vector (e.g., as described in U.S. Pat. Nos. 5,399,346, 4,650,764, 4,980,289 and 5,124,263; all of which are herein incorporated by reference; Mann et al. (1983) Cell 33:153; Markowitz et al. (1988) J. Virol, 62:1120; WO 95/07358; and Kuo et al. (1993) Blood 82:845). The retroviruses are integrating viruses that infect dividing cells. The retro virus genome includes two LTRs, an encapsidation sequence and three coding regions (gag, pol and env). In recombinant retroviral vectors, the gag, pol and env genes are generally deleted, in whole or in part, and replaced with a heterologous nucleic acid sequence of interest. These vectors can be constructed from, different types of retrovirus, such as, HIV, MoMuLN ("murine Moloney leukemia virus" MSN ("murine Moloney sarcoma virus"), HaSN ("Harvey sarcoma virus"); SΝV ("spleen necrosis virus"); RSV ("Rous sarcoma virus") and Friend virus. Defective retroviral vectors are also disclosed in WO 95/02697. In preferred embodiments, the retrovirus (or other vector) allows the siRΝA gene to integrate into the host cells genome (thus being expressed by the cell and the cell's progency). In general, in order to construct recombinant retroviruses containing a nucleic acid sequence, a plasmid is constructed that contains the LTRs, the encapsidation sequence and the coding sequence. This construct is used to transfect a packaging cell line, which cell line is able to supply in trans the retroviral functions that are deficient in the plasmid. In general, the packaging cell lines are thus able to express the gag, pol and env genes. Such packaging cell lines have been described in the prior art, in particular the cell line PA317 (US Pat. No. 4,861,719, herein incorporated by reference), the PsiCRIP cell line (See, WO90/02806), and WO89/07150). In addition, the recombinant retroviral vectors can contain modifications within the LTRs for suppressing transcriptional activity as well as extensive encapsidation sequences that may include a part of the gag gene (Bender et al. (1987) J. Virol., 61 : 1639). Recombinant retroviral vectors are purified by standard techniques known to those having ordinary skill in the art. In some embodiments, retroviral vectors encode siRNAs with strand specificity; this avoids self-targeting of the viral genomic RNA; in particular embodiments, the retroviral vector comprise a U6 promoter (lives, H. et al. (1996) Gene 171, 203-8). In certain embodiments, cells are taken from a patient and transfected (transiently or stably) and then reintroduced into the patient, hi particular embodiments, the cells reintroduced into the patient have the siRNA gene integrated inter their genome. In some embodiments, as certain dsRNA are base-labile with a propensity to hydrolyze in aqueous media, the RNAi-based drug is delivered using a polymer-based delivery mechanism. One example are the products provided by SkinVisible. hi some embodiments, for the delivery into the in vivo cell (the cytoplasm) as a drug, the Polymer Vector delivery may be used with or without the attachment of inactivated viruses. In some embodiments, the siRNA (e.g. polymer vector) may be delivered via, for example, an eyedrop, injection, extended release medication and/or systemic application. In certain preferred embodiments, a slow drug release options such as the "Encapsulated Cell Technology" (from Neurotech) or other slow release systems that will be placed potentially in the orbit is used to treat a patient with siRNA duplexes (or vectors encoding the same) that target TSHr. However, other local applications to the eye or the orbit, injections, eyedrops and systemic application may also be employed to deliver the siRNA or vectors encoding siRNA specific for TSHr. hi certain preferred embodiments, the siRNA or vectors encoding siRNA are in the fonn of an ophthalmic solution. Preferably, the osmotic value of the solution is about 0.9% sodium chloride (e.g. 0.6% to about 1%). It is also preferred that the ophthalmic solution have a pH of about 7.4 (e.g. 6.6 to 7.8, preferably 7.0 to 7.4). It is also preferred that the ophthalmic solution be buffered to prevent wide changes in the pH. EXPERIMENTAL The following examples are provided in order to demonstrate and further illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof. hi the experimental disclosure which follows, the following abbreviations apply: N (normal); M (molar); mM (millimolar); μM (micromolar); mol (moles); minol (millimoles); μmol (micromoles); nmol (nanomoles); pmol (picomoles); g (grams); mg (milligrams); μg (micrograms); ng (nanograms); 1 or L (liters); ml (milliliters); μl (microliters); and C (degrees Centigrade).
EXAMPLE 1 Cells Expressing TSHr This example describes establishing reproducible and simple assays for cells expressing TSHr. Chinese hamster ovary (CHO) cells were chosen for expressing the human TSHr because of their ready availability and published experience with successful expression of TSHr in these cells (Perret et al, Biochem Biophys Res Commun.1990; 171(3):1044-50, herein incorporated by reference). These cells were cultured using an established protocol (Chazenbalk et al, J Clin Invest. 2002; 110: 209-217, herein incorporated by reference). Briefly, CHO cells are grown in 25 cm2 culture flasks in HAM- F12 medium supplemented with 10% fetal calf serum, 100 U/ml penicillin, 50 ug/ml gentamicin, 2.5 ug/ml amphotericin-B, and maintained in a 5% CO2 water- saturated incubator at 37°C. CHO cells not expressing TSHr were used as controls. TSHr expression was verified and measured using RNA gel electrophoresis and quantitative RT-PCR. CHO control cells were obtained and were shown not to express the TSHr by the same techniques. To establish appropriate controls to allow for critical detection of changes in TSHr expression, a TSHr primer and a GAPDH primer were tested and verified by gel electrophoresis prior to performing RT-PCR. EXAMPLE 2 Constructing RNAi for inhibition of TSHr This example describes constructing RNAi for inhibition of TSHr. The human TSHr sequence (accession number NM_000369) is shown in Figure 1. The gene sequence of human TSHr was reviewed and potential siRNA candidates were looked for following the guidelines published by Elbashir (Elbashir et al, Methods 2002; 26: 199-213, herein incorporated by reference). Briefly, targeted regions from the given cDNA sequence of the TSHr were searched for a 23-nt sequence motif AA(N19)TT (N = any nucleotide) selecting those sequences with approximately less than a 50% G/C content. Using this approach, 31 potential candidates were identified. Potential targeted sequences were then BLASTED against EST libraries to ensure that only the TSHr gene was targeted. The potential candidates were then checked for RNA folding qualities to ensure proper binding to the targeted mRNA (using a software program that predicts mRNA folding). Using this process, seventeen RNAi sequences were identified (shown below in Table 1):
TABLE 1 1. AAATCCGCAGTACAACCCAGG (SEQ ID NO:2) 2. AAGTCCGATGAGTTCAACCCG (SEQ ID NO:3) 3. AATGCCTTGAATAGCCCCCTC (SEQ ID NO:4) 4. AACTCCCATCTAACCCCAAAG (SEQ ID NO:5) 5. AACCCCAAAGAAGCAAGGCCA (SEQ ID NO:6) 6 AAGGTTACCCACGACATGAGG (SEQ ID NO:7) 7. AAAGGTTACCCACGACATGAG (SEQ ID NO: 8) 8. AAGTCAGTATCTGCCTGCCCA (SEQ _D NO:9) 9. AAAGAGCTCCCCCTCCTAAAG (SEQ ID NO:10) 10. AAGAGCTCCCCCTCCTAAAGT (SEQ ID NO: 11) 11. AAAATGTTCCCTGACCTGACC (SEQ ID NO: 12) 12 AATGAGAGCAGTATGCAGAGC (SEQ ID NO: 13) 13. AACCTGGCCTTTGCGGATTTC (SEQ ID NO:14) 14. AACACGGCTGGTTTCTTCACT (SEQ ID NO: 15) 15. AAAGTCAGTATCTGCCTGCCC (SEQIDNO:16) 16. AAATGTTCCCTGACCTGACCA (SEQ IDNO:17) 17. AATGTTCCCTGACCTGACCAA (SEQ IDNO:18) These sequences can be synthesized as a siRNA duplex. SEQ ID NO:2 was synthesized as a siRNA duplex by Dharmacon Laboratories (Lafayette, CO) and used in the next example. EXAMPLE 3 Inhibiting TSHr Expression via RNAi in Cell Culture This example describes inhibiting TSHr expression via RNAi in cell culture. In particular, SEQ ID NO:2, constructed as an siRNA duplex was introduced into CHO cell lines (described above) using Oligofectamine™ since it has been shown to be non-toxic to cells and to have transfection efficiencies of RNAi approaching 90%-95% in prior studies (Elbashir et al, 2002, infra). To quantify the effect of this RNAi on TSHr expression levels, CHO cells expressing TSHr were transfected with this RNAi and quantitative RT-PCR measuring the level of TSHr RNA in samples taken at 0, 2, 4, 8, 12, 24, and 38 hours post transfection was performed. Quantitative RT-PCR measuring the level of GAPDH RNA in the same samples was simultaneously performed for internal control. The results as shown below demonstrate a progressive reduction in TSHr RNA reaching a nadir at 24 hours post transfection (Fig 2, Fig 3, Fig 4 and Table 2). hi addition levels of TSHr expression were measured at 48 hours, post transfection with this RNAi as compared to mock and mismatch controls (Fig 5).
TABLE 2 Time post TSHr Cycle at GAPDH Cycle at transfection threshold (mean) = A threshold (mean) = B A - B = E E - S -(E- S) CHO-TSHr 23.2 15.16 8.04 = S 0 1 2 hour 24.06 15.53 8.53 0.49 0.712025 4 hour 23.53 15.16 8.37 0.33 0.795536 8 hour 23.6 14.73 8.87 0.83 0.562529 12 hour 24.6 15.66 8.94 0.9 0.535887 24 hour 24.15 15.06 9.09 1.05 0.482968 38 hour 23.63 15.6 8.03 -0.01 1.006956
Table 2. "A" represents the mean cycles at threshold for the TSHr receptor at each time point. "B" represents the mean cycles at threshold for GAPDH (internal control). "A B = E" is calculated to control for the number of cells at each time point. "S" is the value "E" for the control samples of TSHr with no RNAi transfection. "E-S" is calculated to compare the level of TSHr RNA at each time point to the level prior to transfection. The value of 2 to the power of negative E - S is calculated to obtain the relative TSHr RNA in the sample at each time point (relative to the amount of GAPDH RNA and relative to the amount of TSHr RNA prior to transfection).
EXAMPLE 4 Treating Graves' Ophthalmopathy in a Human Patient This example describes treating Graves' Ophthalmopathy (GO) in a human patient exhibiting symptoms of GO. In particular, a buffered ophthalmic solution with an osmotic value of 0.9% NaCl, a pH 7.4, an eye safe transfecting agent, and a vector for expressing siRNA when transcribed (e.g. expressing a siRNA duplex comprising SEQ ID NO:2) is administered via an eye dropper to the patient's eyes. This treatment is repeated as necessary to reduce or eliminate the symptoms of GO in the patient's eyes.
All publications and patents mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in chemistry, ophthalmology, and molecular biology or related fields are intended to be within the scope of the following claims.

Claims

We Claim:
1. A method of inhibiting the expression of the thyroid stimulating hormone receptor (TSHr) gene comprising; a) providing; i) a target cell expressing TSHr protein via expression of TSHr mRNA, and ii) a composition comprising a small interfering RNA duplex (siRNA), or a vector encoding said siRNA, that targets said TSHr mRNA, b) contacting said target cell with said composition such that said TSHr mRNA is cleaved, thereby inhibiting expression of said TSHr protein by said TSHr gene.
The method of Claim 1, wherein said target cell is an orbital cell. The method of Claim 1, wherein said contacting is conducted in vitro.
4. The method of Claim 1, wherein said contacting is conducted under conditions such said vector expresses said siRNA in said target cell.
5. The method of Claim 1 , wherein said composition further comprises a nucleic acid transfecting agent.
6. The method of Claim 1 , wherein said composition had an osmotic value of about 0.9% NaCl.
7. The method of Claim 1 , wherein said composition has a pH of about 7.4.
8. The method of Claim 1 , wherein said composition is buffered.
9. A composition comprising; a) small interfering RNA duplexes (siRNAs), or vectors encoding said siRNA, configured to inhibit expression of thyroid stimulating hormone receptor (TSHr) protein, and b) a nucleic acid transfecting agent.
10. The composition of Claim 9, wherein said composition had an osmotic value of about 0.9% NaCl. 11. The composition of Claim 9, wherein said composition has a pH of about
7.4.
12. The composition of Claim 9, wherein said composition is buffered.
PCT/US2004/025276 2003-08-07 2004-08-05 Rnai treatment of eye disease Ceased WO2005016274A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US49315603P 2003-08-07 2003-08-07
US60/493,156 2003-08-07

Publications (2)

Publication Number Publication Date
WO2005016274A2 true WO2005016274A2 (en) 2005-02-24
WO2005016274A3 WO2005016274A3 (en) 2005-07-14

Family

ID=34193168

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/025276 Ceased WO2005016274A2 (en) 2003-08-07 2004-08-05 Rnai treatment of eye disease

Country Status (1)

Country Link
WO (1) WO2005016274A2 (en)

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5801154A (en) * 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US20030143204A1 (en) * 2001-07-27 2003-07-31 Lewis David L. Inhibition of RNA function by delivery of inhibitors to animal cells
US5998148A (en) * 1999-04-08 1999-12-07 Isis Pharmaceuticals Inc. Antisense modulation of microtubule-associated protein 4 expression
US8153121B2 (en) * 2000-10-06 2012-04-10 Los Angeles Biomedical Research Institute at Harbor—UCLA Medical Center Diagnosis and therapy of antibody-mediated inflammatory autoimmune disorders

Also Published As

Publication number Publication date
WO2005016274A3 (en) 2005-07-14

Similar Documents

Publication Publication Date Title
JP5095414B2 (en) RNAi inhibition of CTGF to treat eye disorders
US8258112B2 (en) Methods and sequences to suppress primate huntington gene Expression
US7902352B2 (en) Isolated nucleic acid duplex for reducing huntington gene expression
CN103285026B (en) The suppression of the RNAi mediations of tumor necrosis factor alpha-related conditions
US20080152654A1 (en) COMPOSITIONS AND METHODS FOR siRNA INHIBITION OF ANGIOGENESIS
US20120178794A1 (en) RNAi-Mediated Inhibition of RHO Kinase for Treatment of Ocular Disorders
KR20090042297A (en) RNA-mediated inhibition of gremlin to treat IOP-related symptoms
JP2013176386A (en) COMPOSITION AND METHOD FOR SHORT INTERFERING NUCLEIC ACID INHIBITION OF Nav1.8
EP2585594B1 (en) Double stranded rna compounds to rhoa and use thereof
JP2009533475A (en) RNAI-mediated inhibition of splenic tyrosine kinase-related inflammatory conditions
US9765340B2 (en) RNAi-mediated inhibition of phosphodiesterase type 4 for treatment of CAMP-related ocular disorders
JP2006526989A (en) Inhibition of apoptosis-specific eIF-5A ("eIF-5A") using antisense oligonucleotides and siRNA as anti-inflammatory therapy
TW200916117A (en) RNAi-related inhibition of TNF α signaling pathway for treatment of ocular angiogenesis
KR101311275B1 (en) RNAi INHIBITION OF SERUM AMYLOID A FOR TREATMENT OF GLAUCOMA
US9926565B2 (en) Aptamer-RNAi therapeutic compositions
US20050250123A1 (en) Reducing galectin-12 activity to reduce formation of adipocytes
US7482323B2 (en) Intracellular interleukin-1 receptor antagonist and uses thereof
WO2025106594A1 (en) Pharmaceutical composition comprising elastin and method of use thereof
WO2025166047A1 (en) Composition and method for preventing or treating influenza
EP4161583A1 (en) Methods and pharmaceutical compositions for treating ocular diseases
HK1183694A (en) Double stranded rna compounds to rhoa and use thereof
HK1183694B (en) Double stranded rna compounds to rhoa and use thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase