JP2006526989A - Inhibition of apoptosis-specific eIF-5A ("eIF-5A") using antisense oligonucleotides and siRNA as anti-inflammatory therapy - Google Patents

Abstract

The present invention relates to apoptosis-specific eukaryotic initiation factor 5A (eIF-5A) (also called apoptosis-specific eIF-5A or eIF-5A1), apoptosis-specific eIF-5A nucleic acids and polypeptides, and apoptosis-specific The present invention relates to a method for preventing or suppressing apoptosis in cells using an antisense oligonucleotide or siRNA for blocking the expression of target eIF-5A. The present invention also relates to inhibiting or inhibiting the expression of inflammatory cytokines by inhibiting the expression of apoptosis-specific eIF-5A, or inhibiting the activation of NFκB.

Description

Related applications

  This application is a continuation-in-part of US Application Serial No. 10 / 383,614, filed March 10, 2003. This continuation-in-part is a continuation-in-part of U.S. Application Serial No. 10 / 277,969 filed on October 23, 2002, and this continuation-in-part application is filed on July 23, 2002. This is a continuation-in-part of serial number 10 / 200,148, which is a continuation-in-part of serial number 10 / 141,647 filed on May 7, 2002. The continuation-in-part is a continuation-in-part of US application serial number 9 / 909,796 filed on July 23, 2001. All of these applications are incorporated herein in their entirety. This application is filed on US Provisional Application No. 60 / 476,194 filed on June 6, 2003; US Provisional Application No. 60 / 504,731 filed on September 22, 2003; filed on December 10, 2003 US Provisional Application No. 60 / 528,249; US Provisional Application No. 60 / 557,671 filed on March 21, 2004; US Provisional Application No. 60 / (pending number notice pending on June 2, 2004) ) Is also claimed. All of these applications are incorporated herein in their entirety.

TECHNICAL FIELD OF THE INVENTION The present invention relates to apoptosis-specific eukaryotic initiation factor (“eIF-5A”) (also referred to as “apoptosis-specific eIF-5A” or “eIF-5A1”) and deoxyhypusine synthase (DHS). ) The present invention relates to apoptosis-specific eIF-5A and DHS nucleic acids and polypeptides, and methods for blocking the expression of apoptosis-specific eIF-5A and DHS.

BACKGROUND OF THE INVENTION Apoptosis is a genetically programmed cellular event that has distinct morphological features (eg, cell contraction, chromatin condensation, nuclear fragmentation, membrane bubble formation). Kerr et al. (1972), Br. J. Cancer, 26, 239-257; Wyllie et al. (1980), Int. Rev. Cytol., 68, 251-306. Apoptosis plays an important role in normal tissue growth and homeostasis, and defects in the apoptotic program are thought to be related to various human diseases (from neurodegenerative diseases and autoimmune diseases to tumors). It has been. Thompson (1995), Science, 267, 1456-1462; Mullauer et al. (2001), Mutat. Res., 488, 211-231. Although the morphological characteristics of apoptotic cells are well understood, the molecular pathways that regulate the process are just beginning to be elucidated.

  A group of proteins thought to play an important role in apoptosis is a family of cysteine proteases called caspases. Caspases appear to be required for most pathways of apoptosis. Creagh and Martin (2001), Biochem. Soc. Trans., 29, 696-701; Dales et al. (2001), Leuk. Lymphoma, 41, 247-253. Caspases initiate apoptosis by cleaving various cellular proteins in response to apoptotic stimuli, resulting in classic apoptosis (eg, cell contraction, membrane bubble formation, DNA fragmentation). Occur. Chang and Yang (2000), Microbiol. Mol. Biol. Rev., 64, 821-846.

  Pro-apoptotic proteins (eg, Bax, Bak) also play an important role in the apoptotic pathway by releasing caspase activating molecules (eg, mitochondrial cytochrome c) and promote cell death through apoptosis. Martinou and Green (2001), Nat. Rev. Mol. Cell. Biol., Volume 63-67; Zou et al. (1997) Cell 90, 405-413. Anti-apoptotic proteins (eg Bcl-2) promote cell survival by antagonizing the activity of proapoptotic proteins (Bax, Bak). Tsujimoto (1998) Genes Cells, volume 3, pages 697-707; Kroemer (1997), Nature Med., Volume 3, pages 614-620. The ratio Bax: Bcl-2 is believed to be one factor that determines cell fate. Excess Bax promotes apoptosis, and excess Bcl-2 promotes cell survival. Salomons et al. (1997), Int. J. Cancer, 71, 959-965; Wallace-Brodeur and Lowe (1999), Cell Mol. Life Sci., 55, 64-75.

  Another important protein involved in apoptosis is the protein encoded by the tumor suppressor gene p53. This protein is a transcription factor that regulates cell growth and induces apoptosis in damaged cells and possibly genetically unstable due to Bax upregulation. Bold et al. (1997), Surgical Oncology, volume 6, pages 133-142; Ronen et al. (1996); Schuler and Green (2001), Biochem. Soc. Trans., Volume 29, pages 684-688; Ryan et al. (2001), Curr. Opin. Cell Biol., 13, 332-337; Zoernig et al. (2001), Biochem. Biophys. Acta, 1551, F1-F37.

  Changes in the apoptotic pathway are thought to play an important role in many disease processes, including cancer. Wyllie et al. (1980), Int. Rev. Cytol., 68, 251-306; Thompson (1995), Science, 267, 1456-1462; Sen and D'Incalci (1992), FEBS Letters, 307, 122-127; McDonnell et al. (1995), Seminars in Cancer and Biology, 6, 53-60. Studies on cancer growth and progression have traditionally focused on cell growth. However, it has recently become clear that apoptosis plays an important role in tumorigenesis. In fact, much of what is currently known about apoptosis is learned using tumor models. This is because the regulatory state of apoptosis always changes in tumor cells. Bold et al. (1997), Surgical Oncology, Volume 6, pages 133-142.

  Cytokines are also involved in the apoptotic pathway. Biological systems require cell interactions for regulation, and a number of cytokines are generally involved in crosstalk between cells. Cytokines are mediators that various types of cells produce in response to a variety of stimuli. Cytokines are pleiotropic molecules that can exert many different effects on various types of cells, but are particularly important in the regulation of immune responses and the growth and differentiation of hematopoietic cells. When a cytokine acts on a target cell, cell survival, proliferation, activation, differentiation, and apoptosis are promoted depending on what the cytokine is, the relative concentration of the cytokine, and the presence of other mediators .

  It is becoming common to treat autoimmune diseases (eg psoriasis, rheumatoid arthritis, Crohn's disease) with anti-cytokines. The inflammatory cytokines IL-1 and TNF play an important role in the pathology of these chronic diseases. Treatment can be successfully done with anti-cytokine therapy that reduces the biological activity of these two cytokines (Dinarello and Abraham, 2002).

  Interleukin 1 (IL-1) is an important cytokine that mediates local and systemic inflammatory responses, and many diseases (eg vasculitis, osteoporosis, neurodegenerative diseases, diabetes, lupus nephritis, autoimmune diseases) (Such as rheumatoid arthritis)) may act synergistically with TNF. The importance of IL-1β in tumor angiogenesis and invasion has recently been demonstrated, as IL-1β knockout mice injected with melanoma cells are resistant to metastasis and angiogenesis (Voronov Et al., 2003).

  Interleukin 18 (IL-18) is a recently discovered member of the IL-1 family and is related to IL-1 in terms of structure, receptors and function. IL-18 is a central cytokine involved in inflammatory and autoimmune diseases because it has the ability to induce interferon gamma (IFN-γ), TNF-α, and IL-1. Both IL-1β and IL-18 can induce the production of TNF-α, a cytokine known to be involved in heart failure during myocardial ischemia (Maekawa et al., 2002). Inhibition of IL-18 by neutralization with IL-18 binding protein was found to reduce ischemia-induced heart failure in an ischemia / reperfusion model of the overmelted human atrial myocardium (Dinarello, 2001) ). Neutralization of IL-18 using mouse IL-18 binding protein can reduce the levels of IFN-γ, TNF-α, and IL-1β transcripts, a collagen-induced arthritis model • Reduced joint damage in mice (Banda et al., 2003). Infusion of IL-18 binding protein into melanoma model mice successfully prevented metastasis, and reduced production or availability of IL-18 may prove favorable for control of metastatic cancer (Carrascal et al., 2003). Yet another evidence of the importance of IL-18 as an inflammatory cytokine was that plasma levels of IL-18 were elevated in patients with chronic liver disease and that increased levels correlated with the extent of the disease (Ludwiczek et al., 2002). Similarly, IL-18 and TNF-α were elevated in diabetic patients with nephropathy (Moriwaki et al., 2003). Neuritis after traumatic brain injury is also mediated by inflammatory cytokines, so when IL-18 is blocked by IL-18 binding protein, the recovery of nerves is improved in mice with traumatic brain injury (Yatsiv et al., 2002).

  TNF-α, a member of the TNF family of cytokines, is an inflammatory cytokine that exerts a multifaceted effect ranging from the simultaneous differentiation of hematopoietic cells to the induction of inflammatory responses and the induction of cell death in many types of cells. Have. TNF-α is usually induced by bacterial lipopolysaccharides, parasites, viruses, tumor cells, and cytokines and generally has a favorable function of protecting cells from infection and cancer. However, inappropriate induction of TNF-α can be a major factor in diseases caused by acute and chronic inflammation (eg, autoimmune diseases), which can lead to cancer, AIDS, heart disease, and sepsis ( Review articles are in Aggarwal and Natarajan, 1996; Sharma and Anker, 2002). Experimental animal models of disease (ie, sepsis and rheumatoid arthritis) and human disease (ie, inflammatory bowel disease and acute graft-versus-host disease) revealed a positive effect of inhibiting TNF-α (Wallach Et al., 1999). Inhibiting TNF-α also has the effect of alleviating symptoms in patients with autoimmune disease (Crohn's disease (van Deventer, 1999), rheumatoid arthritis (Richard-Miceli and Dougados, 2001)). The ability of TNF-α to promote B lymphocyte survival and proliferation also plays a role in the development of B-cell chronic lymphocytic leukemia (B-CLL), and the level of TNF-α expressed by T cells in B-CLL Was positively correlated with tumor size and stage (Bojarska-Junak et al., 2002). Interleukin-1β (IL-1β) is known as a cytokine that induces the production of TNF-α.

  Therefore, excessive accumulation of various cytokines and TNF-α has adverse effects on the body (cell death, etc.), so there is a need for a method that reduces the level of cytokines in the body and prevents or reduces apoptosis. Yes. The present invention satisfies this need.

  Deoxyhypusine synthase (DHS) and hypusin-containing eukaryotic translation initiation factor 5A (eIF-5A) are known to play important roles in many cellular processes, such as cell proliferation and differentiation . Hysin, a unique amino acid, has been found in all eukaryotes and archaea studied so far, but not found in eubacteria, eIF-5A is the only known hypusin-containing It is a protein. Park (1988), J. Biol. Chem., 263, 7447-7449; Schuemann and Klink (1989), System. Appl. Microbiol., 11, 103-107; Bartig et al. (1990) Year), System. Appl. Microbiol., 13, 112-116; Gordon et al. (1987a), J. Biol. Chem., 262, 16585-16589. Active eIF-5A is formed in two post-translational steps. In the first step, deoxyhypusine is formed by transferring the 4-aminobutyl moiety of spermidine to the α-amino group of a specific lysine of the eIF-5A precursor using deoxyhypusine synthase as a catalyst. The second step involves the operation of hydroxylating the 4-aminobutyl moiety with deoxyhypusine hydroxylase to form hypusine.

  The amino acid sequence of eIF-5A is well conserved among species, and the amino acid sequence around the hypusine residue in eIF-5A is strictly conserved. This suggests that this modification may be important for survival. Park et al. (1993), Biofactors, Volume 4, pages 95-104. This assumption is based on the inactivation of the two isoforms of eIF-5A previously found in yeast, or the inactivation of the DHS gene that catalyzes the first step of activation of the isoform. It is also supported by the observation result that Schnier et al. (1991), Mol. Cell. Biol., 11, 3105-3114; Sasaki et al. (1996), FEBS Lett., 384, 151-154; Park et al. (1998), J. Biol. Chem., 273, 1677-1683. However, in yeast, deficiency of the eIF-5A protein only slightly reduced total protein synthesis. This suggests that eIF-5A is required to translate some specialized mRNAs rather than the overall synthesis of the protein. Tuite, M. (eds.), “Protein synthesis and targeting in yeast”, Kang et al. (1993) in NATO series H, “Effect of deficiency of initiation factor eIF-5A on cell growth and protein synthesis. " Recent findings that ligands that bind to eIF-5A share a very well-conserved motif also support the importance of eIF-5A. Xu and Chen (2001), J. Biol. Chem., 276, 2555-2561. Furthermore, the modified eIF-5A hypusine residue was found to be essential for sequence-specific binding to RNA, but binding did not protect the RNA from ribonuclease.

  In addition, when eIF-5A is deficient in cells, certain mRNAs accumulate significantly in the nucleus. This indicates that eIF-5A may be important in transferring a special class of mRNA from the nucleus to the cytoplasm. Liu and Tartakoff (1997), Special Issue of Molecular Biology of the Cell, Volume 8, page 426a. Proceedings No. 2476, 37th Annual Meeting of the American Society for Cell Biology. The fact that eIF-5A accumulates in the intranuclear filament associated with the nuclear pore and interacts with common nuclear export receptors is due to the fact that eIF-5A is not part of the polysome but is a nucleocytoplasmic shuttle protein It further suggests that Rosorius et al. (1999), J. Cell Science, Vol. 112, pages 2369-2380.

  The first cDNA for eIF-5A was cloned from humans in 1989 by Smit-McBride et al. Since then, eIF-5A cDNAs or genes have been cloned in various eukaryotes (eg, yeast, rat, chicken embryo, alfalfa, tomato). Smit-McBride et al. (1989), J. Biol. Chem., 264, pp. 1578-1583; Schnier et al. (1991) (yeast); Imahori, M. et al. ”, Sano, A. (1995), 81-88 pages (rats) in VNU Science Publishers, Netherlands; Rinaudo and Park (1992), FASEB J., Volume 6, pages A453 (chicken) Pay et al. (1991), Plant Mol. Biol., 17, 927-929 (Alfalfa); Wang et al. (2001), J. Biol. Chem., 276, 17541-17549. Page (tomato).

  Expression of eIF-5A mRNA has been investigated in various human tissues and mammalian cell lines. For example, it has been observed in human fibroblasts that expression of eIF-5A changes when serum is added after removal of serum. Pang and Chen (1994), J. Cell Physiol., 160, 531-538. It has also been observed in aged fibroblasts that the activity of deoxyhypusine synthase decreases with age and the eIF-5A precursor is enriched. However, it is not clear whether this reflects an average of changes that vary from isoform to isoform. Chen and Chen (1997), J. Cell Physiol., 170, 248-254.

  Various studies have shown that eIF-5A may be a cellular target for viral proteins (eg, human immunodeficiency virus type 1 Rev protein and human T cell leukemia virus type 1 Rex protein). Ruhl et al. (1993), J. Cell Biol., 123, pp. 139-1320; Katahira et al. (1995), J. Virol., 69, 3125-3133. Preliminary studies indicate that eIF-5A may interact with other RNA binding proteins (eg Rev) to target RNA. This suggests that such viral proteins may employ eIF-5A for viral RNA processing. Liu et al. (1997), Biol. Signals, Volume 6, pp. 166-174.

  Thus, although eIF-5A and DHS are known, there is still a need to understand how these proteins can participate in the apoptosis pathway and cytokine stimulation to alter apoptosis and cytokine expression. Yes. The present invention satisfies this need.

SUMMARY OF THE INVENTION The present invention relates to apoptosis-specific eukaryotic initiation factor 5A (eIF-5A) (also referred to as “apoptosis-specific eIF-5A” or “eIF-5A1”). The present invention relates to a method for preventing or suppressing intracellular apoptosis using an apoptosis-specific eIF-5A nucleic acid and polypeptide and an antisense oligonucleotide or siRNA for blocking the expression of apoptosis-specific eIF-5A. Also related. The present invention relates to a method of delivering siRNA to mammalian lung cells in vivo. The present invention also relates to the suppression or prevention of the expression of inflammatory cytokines by blocking the expression of apoptosis-specific eIF-5A. The present invention further relates to the inhibition or suppression of p53 expression by inhibiting the expression of apoptosis-specific eIF-5A. The present invention also relates to a method for increasing the expression of Bcl-2 by blocking or suppressing the expression of apoptosis factor 5A using an antisense oligonucleotide or siRNA. The present invention also provides a method of blocking the production of cytokines (particularly TNF-α in human epithelial cells). In another embodiment of the invention, retinal nerves in glaucomatous eyes are inhibited by suppressing the expression of apoptosis-specific eIF-5A using an antisense oligonucleotide targeted to apoptosis-specific eIF-5A. A method of preventing cell death of nodal cells is provided.

Detailed Description of the Invention Several isoforms of eukaryotic initiation factor 5A ("eIF-5A") have been previously isolated and are present in public data banks. The isoforms were thought to have overlapping functions. We have found that one isoform is up-regulated just before apoptosis is induced, and named that isoform as apoptosis-specific eIF-5A or eIF-5A1. The object of the present invention is apoptosis-specific eIF-5A and DHS involved in the activation of eIF-5A.

  Apoptosis-specific eIF-5A appears to be a suitable target in intervening in disease states caused by apoptosis because it acts at the level of post-translational regulation of downstream effectors and transcription factors involved in the apoptotic pathway. More specifically, apoptosis-specific eIF-5A appears to selectively promote downstream apoptosis effector and mRNA encoding transcription factors from the nucleus to the cytoplasm where they are translated. . Apoptosis initiation appears to be ultimately determined by a complex interaction between internal and external pro-apoptotic and anti-apoptotic signals. Lowe and Lin (2000), Carcinogenesis, Vol. 21, pages 485-495. Apoptosis-specific eIF-5A appears to shift the balance between these signals through the ability to promote translation of downstream apoptotic effectors and transcription factors, and move it in the direction of apoptosis.

  Accordingly, the present invention provides a method for inhibiting or reducing intracellular apoptosis by administering an agent that blocks or decreases the expression of apoptosis-specific eIF-5A or DHS. By reducing the expression of DHS, less DHS protein is available for activation of apoptosis-specific eIF-5A. One agent that can block or reduce the expression of apoptosis-specific eIF-5A or DHS is an apoptosis-specific eIF-5A or DHS antisense oligonucleotide. By reducing the activation of apoptosis-specific eIF-5A or by blocking the expression of apoptosis-specific eIF-5A, cell apoptosis can be delayed or prevented.

  By using antisense oligonucleotides, gene-specific suppression has been successfully realized both in vitro and in vivo. An antisense oligonucleotide is a synthetic short strand of DNA (or DNA analog), RNA (or RNA analog), or a DNA / RNA hybrid that is antisense (or complementary) to a specific DNA target or RNA target. It has become. Antisense oligonucleotides are designed to block expression of proteins encoded by DNA or RNA targets by binding to the target mRNA and halting expression at the transcription, translation, or splicing level . Antisense oligonucleotides modified by backbone to make them resistant to degradation (eg, delaying nuclease degradation by replacing the phosphodiester bond in the oligonucleotide with a phosphorothioate bond (Matzura and Eckstein, 1968)) (Blake et al., 1985) have been successfully tested in both cell cultures and disease model animals (Hogrefe, 1999). Other modifications that make antisense oligonucleotides more stable and more resistant are known to those of skill in the art and are understood as to what they are. Antisense oligonucleotides used in this specification include double-stranded or single-stranded DNA, double-stranded or single-stranded RNA, DNA / RNA hybrid, DNA analog, RNA analog, oligonucleotide having a base, Examples include oligonucleotides having sugar chains, oligonucleotides with modified backbones, and the like. By modifying these oligonucleotides by methods known to those skilled in the art, stability can be increased and resistance to degradation by nucleases can be increased. These modifications are known to those skilled in the art and include, for example, modification of the backbone of the oligonucleotide, modification of the sugar moiety, and modification of the base.

  The antisense oligonucleotide of the present invention preferably has a nucleotide sequence encoding part or all of the coding sequence of an apoptosis-specific eIF-5A polypeptide or DHS polypeptide. The inventors have transfected various cell lines with antisense oligonucleotides encoding a portion of the apoptosis-specific eIF-5A polypeptide described below and measured the number of cells that have undergone apoptosis. did. The cell population transfected with the antisense oligonucleotides had fewer cells that were apoptotic compared to a similar cell population that was not transfected with the antisense oligonucleotide. Figures 54-58 show that cells treated with apoptosis-specific eIF-5A antisense oligonucleotides had apoptosis compared to cells that were not transfected with apoptosis-specific eIF-5A antisense oligonucleotides. This indicates that the ratio is low.

  The present invention contemplates using a large number of suitable nucleic acid sequences encoding an apoptosis-specific eIF-5A polypeptide or DHS polypeptide. For example, according to the present invention, the nucleic acid sequence of apoptosis-specific eIF-5A (SEQ ID NOs: 1, 3, 4, 5, 11, 12, 15, 16, 19, 20, 21) and the DHS sequence (SEQ ID NOs: 6, 7, 8) ) Antisense oligonucleotides. The antisense oligonucleotide of the present invention does not need the full length of the SEQ ID NOs shown here, but it is sufficient if it has a length that can bind to mRNA and prevent expression of the mRNA. “Preventing or reducing expression” or “suppressing expression” means that protein and / or mRNA products from the target gene (eg, apoptosis-specific eIF-5A) are absent, or a decrease in their level is detectable. means.

  Specific examples of apoptosis-specific eIF-5A antisense oligonucleotides that do not include the entire coding sequence are apoptosis-specific eIF-5A antisense oligonucleotides having SEQ ID NOs: 35, 37, 39.

  “Antisense oligonucleotides for apoptosis-specific eIF-5A” include oligonucleotides that are substantially identical in sequence or substantially homologous to apoptosis-specific eIF-5A. Another antisense oligonucleotide of apoptosis-specific eIF-5A according to the present invention has a sequence substantially identical to the above sequence (ie 90% homology) or the above described under high stringency conditions Some have sequences that hybridize to SEQ ID NOs. In this specification, the phrase “substantially identical in sequence” or “substantially homologous” means that the structure or function is substantially the same in one sequence and another. Any differences in structure or function that exist between sequences that are substantially identical or between sequences that are substantially homologous will be minor. That is, the difference will not affect the ability of the array to function as described above in the desired application. The difference may be due to the inherent differences in codon usage among different species. When there is a significant amount of overlap or similarity between two or more different sequences, or when different sequences show similar physical properties despite differing lengths and structures The structural differences are considered minor. Such properties include, for example, the ability to hybridize under predetermined conditions, and in the case of proteins, immunological cross-reactivity, similar enzyme activity, and the like. Those skilled in the art will be able to easily measure each of these properties by known methods.

  Furthermore, two nucleotide sequences are “substantially complementary” if the sequences are at least about 70% identical. The coincidence is more preferably 80% or more, further preferably about 90% or more, and most preferably about 95% or more. Two amino acid sequences are substantially homologous if there is at least 70% homology between the active or functionally related portions of the polypeptide. More preferably, the homology is at least 80%, more preferably at least 90%, and most preferably at least 95%.

  Align sequences to make an optimal comparison to reveal percent identity between the two sequences (for example, gaps in one or both of the first and second amino acid sequences or nucleic acid sequences to achieve optimal alignment) Can be introduced and non-homologous sequences can be discarded for comparison). In a preferred embodiment, for comparison, at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the length of the reference sequence is aligned. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. If a position in the first sequence is occupied by the same amino acid residue or nucleotide that is present in the corresponding position in the second sequence, then the molecules are matched in position (As used herein, “identity” of an amino acid or nucleic acid has the same meaning as “homology” of the amino acid or nucleic acid). The percent match between two sequences is the match shared by those sequences, taking into account the number of gaps that need to be introduced and the length of each gap to obtain an optimal alignment of the two sequences It is a function of the number of positions to be performed.

  Comparison of sequences and determination of percent identity and similarity between two sequences can be accomplished using a mathematical algorithm. ("Computational Molecular Biology", edited by Lesk, AM, Oxford University Press, New York, 1988; "Biocomputing: Informatics and Genome Project", edited by Smith, DW, Academic Publishing, New York, 1993; Computer Analysis of Data, Part 1, Griffin, AM and Griffin, HG, Humana Publishing, New Jersey, 1994; “Sequence Analysis in Molecular Biology”, von Heinje, G., Academic Publishing, 1987; Primers for sequence analysis ”, Gribskov, M. and Devereux, J., M Stockton Publishing, New York, 1991).

  By further searching the sequence database using the nucleic acid and protein sequences according to the present invention as “query sequences”, for example, other members of the same family and related sequences can be identified. Such a search can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul et al. (1990), J. Mol. Biol., 215, 403-410. BLAST nucleotide searches can be performed using the NBLAST program. A BLAST protein search can be performed using the XBLAST program to obtain an amino acid sequence homologous to the protein of the present invention. To obtain a gapped alignment for comparison, use gapped BLAST as described in Altschul et al. (1997) Nucleic Acids Res., 25 (17), pages 3389-3402. Can do. When using a BLAST program and a BLAST program with a gap, the default parameters of the respective programs (for example, XBLAST and NBLAST) can be used.

  The term “apoptosis specific eIF-5A” includes functional derivatives thereof. The term “functional derivative” of a nucleic acid as used herein means a homologue or analog of a gene sequence or nucleotide sequence. Since functional derivatives can maintain the function of a given gene, they can be useful in the present invention. Does the “functional derivative” of apoptosis-specific eIF-5A described herein or a functional derivative of an antisense oligonucleotide of apoptosis-specific eIF-5A retain apoptosis-specific eIF-5A activity? These are fragments, mutants, analogs, and chemical derivatives of apoptosis-specific eIF-5A that retain specific immunological cross-activity for apoptosis-specific eIF-5A. A fragment of an apoptosis-specific eIF-5A polypeptide refers to any part of the molecule.

  Functional variants can also include substitutions with similar amino acids that do not alter function significantly or significantly. Amino acids essential for function can be identified by known methods. Examples of methods include site-directed mutagenesis and alanine scanning mutagenesis (Cunningham et al. (1989), Science, 244, 1081-1085). In the latter method, mutations are introduced only at all alanine residues in the molecule. Next, the obtained mutant molecule is examined for biological activity (for example, kinase activity) or assayed for in vitro proliferation activity. Sites essential for binding partner / substrate binding can also be examined by structural analysis (eg, crystallization, nuclear magnetic resonance, photoaffinity labeling) (Smith et al. (1992), J. Mol. Biol., 224). Vol., 899-904; de Vos et al. (1992), Science 255, 306-312).

  “Variant” means a molecule that is substantially similar to an entire gene or a fragment thereof. For example, a nucleotide substitution variant in which one or more nucleotides are substituted, but retains the ability to hybridize with a particular gene or encode an mRNA transcript that hybridizes with the original DNA. is there. “Homolog” means a fragment sequence or variant sequence from an animal of a different genus or species. “Analog” means a non-naturally occurring molecule, variant, or fragment thereof that has a function that is substantially similar to or associated with the entire molecule.

  Variant peptides include naturally occurring variants and variants produced by methods well known in the art. Such variants can be easily identified / created using the molecular techniques and sequence information disclosed in this specification. Furthermore, such variants can be easily distinguished from other proteins based on sequence and / or structural similarity to the eIF-5A or DHS proteins of the present invention. The degree of homology / match that exists is primarily based on whether the protein is a functional or non-functional variant, the amount of differences present in the paralog family, and the evolutionary distance between orthologs. It will be.

  Non-naturally occurring variants of eIF-5A polynucleotides or DHS polynucleotides, antisense oligonucleotides, proteins according to the present invention can be readily generated using recombinant techniques. Such variants include those with additions or substitutions in the nucleotide sequence or amino acid sequence. For example, one class of substitution is a conserved amino acid substitution. Such a substitution is a substitution in which one amino acid in a protein is replaced with another amino acid having similar properties. Commonly regarded as conserved substitutions are substitutions between the aliphatic amino acids alanine, valine, leucine, and isoleucine; replacement of the hydroxyl residues serine and threonine; the acidic residue aspartic acid Exchange between amide residues asparagine and glutamine; replacement of basic residues lysine and arginine; substitution between aromatic residues phenylalanine and tyrosine. A description of which amino acid changes are silent with respect to the phenotype can be found in Bowie et al., Science, 247, 1306-1310, 1990.

  In this specification, the term “hybridization” is generally used to mean nucleic acid hybridization under stringent conditions appropriate to the nature of the probe and target sequences, as will be apparent to those skilled in the art. . Hybridization and washing conditions are well known in the art and can be easily adjusted by varying the incubation time, temperature, and ionic strength of the solution depending on how much stringency is desired. it can. See, for example, Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Publishing, Cold Spring Harbor, New York, 1989.

  The choice of conditions depends on the length of the sequence to be hybridized (especially the length of the probe sequence), the relative G-C content of the nucleic acid, and the amount of mismatch allowed. Low stringency conditions are preferred when partial hybridization between strands with a low degree of complementarity is desired. High stringency conditions are preferred when complete complementarity or near perfect complementarity is desired. High stringency conditions mean that the hybridization solution contains 6x SSC, 0.01M EDTA, 1x Denhardt's solution, 0.5% SDS. Hybridization was cloned at about 68 ° C. In the case of DNA, it is carried out for about 3 to 4 hours, and in the case of eukaryotic total DNA, it is carried out for about 12 to 16 hours. In the case of low stringency, the hybridization temperature is about 42 ° C. below the melting point (Tm) of the double strand. Tm is known to be a function of G-C content, duplex length, and solution ionic strength.

  In this specification, the expression “hybridizes to the corresponding part” of a DNA or RNA molecule, for example, hybridizes to an oligonucleotide, or polynucleotide, or any nucleotide sequence (in sense or antisense direction). Because the molecules are approximately the same size and are sufficiently similar in sequence, they can recognize or hybridize to the sequence of another nucleic acid molecule that hybridizes under appropriate conditions. It means to do. For example, as long as there is a similarity of about 70% or more between two sequences, a sense molecule that is 100 nucleotides in length will recognize or hybridize to a portion of about 100 nucleotides in a nucleotide sequence. Or It should be understood that some mismatch in hybridization is allowed in the size of the “corresponding portion”. Thus, the “corresponding portion” may be shorter or longer than the molecule hybridizing to that portion, for example in the range of 20-30%, preferably about 12-15% or less.

  In addition, functional variants of polypeptides can also include substitutions with similar amino acids that do not alter function significantly or significantly. Amino acids essential for function can be identified by known methods. Examples of methods include site-directed mutagenesis and alanine scanning mutagenesis (Cunningham et al. (1989), Science, 244, 1081-1085). In the latter method, mutations are introduced only at all alanine residues in the molecule. The obtained mutant molecule is then examined for biological activity or assayed.

  The present invention also provides other agents that can block or reduce the expression of apoptosis-specific eIF-5A or DHS. One such agent is a short inhibitory RNA (“siRNA”). siRNA technology has emerged as an alternative to antisense oligonucleotides. This is because the concentration required to achieve a level of inhibition equal to or better than that achieved with antisense oligonucleotides is lower (Thompson, 2002). Long double-stranded RNAs have been used to silence the expression of specific genes in a variety of organisms (eg plants, nematodes, drosophila). An RNase III family of enzymes called Dicer processes its long double-stranded RNA into short interfering RNAs of 21-23 nucleotides. The short interfering RNA is now incorporated into the RNA-induced silencing complex (RISC). When the siRNA is unwound, RISC is activated and the single-stranded siRNA forms a base pair, which leads to the RISC being endogenous mRNA. When RISC recognizes an endogenous mRNA, the mRNA is cleaved and consequently the mRNA is not available for translation. Introducing long double-stranded RNA into mammalian cells produces a strong antiviral response, which can be avoided using siRNA (Elbashir et al., 2001). siRNA is widely used in cell cultures and routinely achieves a specific gene expression reduction of over 90%.

  It has also become common to use siRNA to block gene expression in disease model animals. Recent studies have shown that siRNA for luciferase can block the expression of luciferase from plasmids co-transfected into various organs of postnatal mice (Lewis et al., 2002). Hydrodynamic injection of the TNF family receptor Fas into the tail vein of mice can transfect more than 80% of hematopoietic cells and in the liver up to 10 days after the last injection Fas expression was reduced by 90% (Song et al., 2003). Fas siRNA could also protect mice from liver fibrosis and fulminant hepatitis. The development of sepsis in mice treated with lethal doses of lipopolysaccharide was prevented by using siRNA against TNF-α (Sφrensen et al., 2003). Given the long-lasting effects in cell culture, the ability to transfect cells in vivo, and the ability to resist degradation in serum in vivo, siRNAs express specific genes in vivo. It can be a very powerful drug to prevent (Bertrand et al., 2002).

  The inventors of the present invention transfected cells with apoptosis-specific eIF-5A siRNA and studied the effect on the expression of apoptosis-specific eIF-5A. FIG. 64 shows that cells transfected with apoptosis-specific eIF-5A siRNA have decreased production of apoptosis-specific eIF-5A protein. Figures 65-67 show that in cells transfected with apoptosis-specific eIF-5A siRNA, the percentage of cells that undergo apoptosis after exposure to camptothecin and TNA-α did not transfect with apoptosis-specific eIF-5A siRNA It is less than the number of cells. Thus, in one embodiment of the present invention, the cell is transfected with a vector containing an apoptosis-specific eIF-5A siRNA, thereby preventing the expression of apoptosis-specific eIF-5A in the cell.

  Preferred siRNAs for apoptosis-specific eIF-5A include those having SEQ ID NOs: 30, 31, 32, 33. Other siRNAs include those that substantially match these SEQ ID NOs (ie, 90% homology) or have sequences that hybridize to these SEQ ID NOs under high stringency conditions. Substantial sequence identity, substantially homologous, means as described above with respect to the antisense oligonucleotides of the invention. The expression “apoptosis-specific eIF-5A siRNA” includes the functional variants or derivatives described above with respect to the antisense oligonucleotides of the invention.

  Methods for delivering siRNA and methods for delivering expression constructs / vectors containing siRNA are known to those skilled in the art. US Application Nos. 2004/106567 and 2004/0086884, the contents of which are incorporated herein by reference, present a number of expression constructs / vectors and delivery mechanisms. Some examples of delivery mechanisms include viral vectors, non-viral vectors, liposome delivery vehicles, plasmid injection systems, artificial virus envelopes, lysine conjugates, and the like.

  Those skilled in the art will know what regulatory sequences are useful in expression constructs / vectors comprising antisense oligonucleotides or siRNAs. For example, the regulatory sequence can be a constitutive promoter, an inducible promoter, a tissue-specific promoter, or a combination thereof.

  Many diseases that are important in humans are caused by abnormalities in apoptosis. Such abnormalities can occur as a result of an increase in the number of pathogenic cells (eg, cancer) or loss of cells to a degree of damage (eg, degenerative disease). Examples of apoptosis-related diseases that can be prevented or treated using the methods and compositions of the present invention include neuro / neurodegenerative diseases (eg, Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (Lou Gehrig's disease). ), Autoimmune diseases (eg rheumatoid arthritis, systemic lupus erythematosus (SLE), multiple sclerosis), Duchenne muscular dystrophy (DMD), motor neuron disease, ischemia, myocardial ischemia, chronic heart failure, stroke, childhood spinal muscular atrophy , Cardiac arrest, renal failure, atopic dermatitis, sepsis, septic shock, AIDS, hepatitis, glaucoma, diabetes (type 1 and type 2), asthma, retinitis pigmentosa, osteoporosis, xenograft rejection, burns, etc. .

  One such disease caused by dysregulated apoptosis is glaucoma. Apoptosis in various visual tissues is a critical factor that leads to blindness in glaucoma patients. Glaucoma is a group of eye diseases that result from damage to the optic nerve and progresses to blindness. Apoptosis has been found to be a direct cause of this optic nerve damage.

  Early research in the field of glaucoma has shown that elevated intraocular pressure (“IOP”) prevents axonal transport at the level of the sieve plate (perforated collagenous connective tissue) and causes retinal ganglion cells to die I understood it. Quigley and Anderson (1976), Invest. Ophthalmol. Vis. Sci., 15, 606-616; Minckler, Bunt, Klock (1978), Invest. Ophthalmol. Vis. Sci., 17, 33 ~ 50 pages; Anderson and Hendrickson (1974), Ophthalmol. Vis. Sci., Vol. 13, 771-783; Quigley et al. (1980), Invest. Ophthalmol. Vis. Sci., Vol. 19, 505- 517 pages. Studies in glaucoma animal models and dead human tissues indicate that death of retinal ganglion cells in glaucoma is caused by apoptosis. Garcia-Valenzuela et al. (1995), Exp. Eye Res., 61, 33-44; Quigley et al. (1995), Invest. Ophthalmol. Vis. Sci., 36, 774-786; Haefliger IO, Flamer J. (eds.), “Nitric Oxide and Endothelin in the Pathogenesis of Glaucoma”, Monard in Lipincott-Raven (1998), New York, NY, pages 213-220. If axonal transport is blocked as a result of elevated IOP, trophic factors can be deficient and retinal ganglion cells can die. Quigley (1995), Aust. N.Z. J. Ophthalmol., 23 (2), 85-91. Optic nerve head astrocytes that have become glaucoma have also been found to increase levels of several neurotoxic substances. For example, increased production of tumor necrosis factor (TNF-α) (Yan et al. (2000), Arch. Ophthalmol., 118, 666-673) and nitric oxide synthase, an enzyme that generates nitric oxide. Increased production (Neufeld et al. (1997), Arch. Ophthalmol., 115, 497-503) has been seen in the optic nerve head of glaucomatous eyes. Furthermore, increased expression of inducible forms of nitric oxide synthase (iNOS) and TNF-α by activated retinal ganglion cells has been observed in a model rat of hereditary retinal disease. Cotinet et al. (1997), Glia, volume 20, pages 59-69; de Kozak et al. (1997), Ocul. Immunol. Inflamm., Volume 5, pages 85-94; Goureau et al. (1999), J Neurochem., Volume 72, pages 2506-2515. In the glaucomatous optic nerve head, excess nitric oxide is associated with axonal degeneration of retinal ganglion cells. Arthur and Neufeld (1999), Surv. Ophthalmol., Volume 43 (Supplement 1), pages S129-S135. Finally, it has been found that increased production of TNF-α by retinal ganglion cells in response to a stimulus of ischemia or increased hydrostatic pressure induces apoptosis in simultaneously cultured retinal ganglion cells. Tezel and Wax (2000), J. Neurosci., 20 (23), 8963-8700.

  Protecting retinal ganglion cells from apoptosis degeneration is being investigated as a new treatment that may prevent blindness from glaucoma. Success has been seen with the use of antisense oligonucleotides in animal models of eye diseases. In a model of transient global retinal ischemia, caspase-2 expression was increased during ischemia, mainly in the inner nucleus of the retina and the ganglion cell layer. Inhibition of caspases using antisense oligonucleotides showed significant histopathological and functional improvements in the electroretinogram. Singh et al. (2001), J. Neurochem., 77 (2), 466-475. In another study, transfection of the optic nerve has shown that retinal ganglion cells up-regulate the proapoptotic protein Bax and cause apoptosis. When Bax antisense oligonucleotides were repeatedly injected into the upper temporal retina of rats, local expression of Bax was blocked after optic nerve transfection, resulting in an increased number of surviving retinal ganglion cells. Isenmann et al. (1999), Cell Death Differ., Volume 6 (7), 673-682.

  Delivery of antisense oligonucleotides to retinal ganglion cells involves wrapping the antisense oligonucleotides in liposomes that are fused and inactivated by two hemagglutinating viruses (HVJ; Sendai virus). ) Coated with envelope (HVJ liposome). When injected into the vitreous of mice with an FITC-labeled antisense oligonucleotide encapsulated in HVJ liposomes, cells within 44% of the ganglion layer continued to emit strong fluorescence for 3 days, The fluorescence of the naked antisense oligonucleotide labeled with FITC disappeared after one day. Hangai et al. (1998), Arch. Ophthalmol., 116 (7), 976.

  One method of the present invention that achieves prevention or reduction of apoptosis is to prevent or reduce apoptosis in cells or tissues of the eye (eg, astrocytes, retinal ganglia, retinal glial cells, sieve plates). The purpose is to do. The death of retinal ganglion cells in glaucoma is caused by apoptosis and consequently blindness. Therefore, a method for preventing or reducing apoptosis in retinal ganglion cells by protecting retinal ganglion cells from degeneration due to apoptosis is a new treatment method for preventing blindness caused by glaucoma.

  The present invention provides a method for preventing or preventing retinal ganglion cell death in glaucomatous eyes by suppressing the expression of apoptosis-specific eIF-5A. Blocking apoptosis-specific eIF-5A expression reduces apoptosis. Apoptosis-specific eIF-5A is a powerful gene that appears to regulate the entire apoptotic process. Thus, controlling apoptosis at the optic nerve head means providing a treatment for glaucoma by blocking the expression of apoptosis-specific eIF-5A.

  Inhibition of apoptosis-specific eIF-5A expression is achieved by using human apoptosis-specific eIF-5A antisense oligonucleotides or siRNA in the eye cells (eg, sieve plates, astrocytes, retinal ganglion cells, retinal glial cells, etc.) It is realized by administration. Antisense oligonucleotides and siRNAs are as defined above. That is, it has a nucleotide sequence encoding at least a part of apoptosis-specific eIF-5A. Specific antisense oligonucleotides useful in this regard of the invention include SEQ ID NO: 26 or 27 or bind to a sequence complementary to SEQ ID NO: 26 or 27 under very severe conditions and are apoptotic specific. Contains an oligonucleotide that blocks expression of eIF-5A.

  According to another embodiment of the present invention, a method for suppressing the expression of apoptosis-specific eIF-5A in sieve plates, astrocytes, retinal ganglion cells, and retinal glial cells is provided. Antisense oligonucleotides or siRNAs targeting human apoptosis-specific eIF-5A (eg, SEQ ID NOs: 26 and 27) are administered to sieve cells, astrocytes, retinal ganglion cells, and retinal glial cells. These cells can be of human origin.

  In addition to its role in apoptosis, eIF-5A may play a role in the immune response. The inventors of the present invention correlate the level of apoptosis-specific eIF-5A with two cytokines (interleukin 1β “IL-1β” and interleukin 18 “IL-18”) in ischemic heart tissue Thus, we have also demonstrated that apoptosis-specific eIF-5A is involved in cell death as seen in ischemic heart tissue. This apoptosis-specific eIF-5A / interleukin correlation is not found in non-ischemic heart tissue. See FIGS. 50A-50F and FIG. Using PCR, the levels of apoptosis-specific eIF-5A, proliferating eIF-5A (“eIF-5A2”, another isoform), IL-1β, and IL-18 were measured in various heart tissues that became ischemic ( Measured and compared in patients with coronary artery bypass grafts and in patients with replacement valves (mitral valve and atrial valve).

  The strong relationship between these interleukins and apoptosis-specific eIF-5A suggests that the inflammatory and apoptotic pathways in ischemia may be regulated through the regulation of apoptosis-specific eIF-5A levels. Suggests. Another evidence that apoptosis-specific eIF-5A is involved in the immune response is that the expression level of eIF-5A in human peripheral blood mononuclear cells (PBMC) is usually low, but specific for T lymphocytes The fact is that stimulation with stimulation dramatically increases the expression of apoptosis-specific eIF-5A (Bevec et al., 1994). This suggests that an apoptosis-specific eIF-5A plays a role in T cell proliferation and / or activation. Since activated T cells can produce a variety of cytokines, apoptosis-specific eIF-5A may be required as a nucleocytoplasmic shuttle for cytokine mRNA. The authors of the above paper also found that elevated levels of eIF-5A in PBMCs of HIV-1 patients may contribute to efficient HIV replication in the cells (Ruhl et al., 1993). ). This is because eIF-5A is a cell binding factor for HIV Rev protein and is known to be required for HIV replication.

  More recently, it has been found that eIF-5A expression increases during dendritic cell maturation (Kruse et al., 2000). Dendritic cells are antigen-presenting cells that stimulate T-cell-mediated immunization by stimulating helper T cells and killer T cells (Steinman, 1991). Immature dendritic cells lack the ability to stimulate T cells and require appropriate stimulation (ie inflammatory cytokines and / or bacterial products) to become mature cells capable of activating T cells. Inhibition of deoxyhypusine synthase, an enzyme required for eIF-5A activation, prevents CD83 expression on the surface of dendritic cells, thereby activating T lymphocytes by dendritic cells (Kruse et al., 2000). Thus, eIF-5A may promote dendritic cell maturation by acting as a nucleocytoplasmic shuttle for CD83 mRNA.

  In both of these two studies on the role of eIF-5A in the immune system (Bevec et al., 1994; Kruse et al., 2000), the authors have revealed which isoforms of eIF-5A are being investigated. The reason is not clear. As explained above, humans have two isoforms of eIF-5A. They are apoptosis-specific eIF-5A (“eIF-5A1”) and proliferating eIF-5A (“eIF-5A2”), which are encoded on different chromosomes. Prior to the discovery of the inventor of the present invention, it was thought that functions were duplicated in both of these isoforms. The oligonucleotide described by Bevec et al. Used to detect eIF-5A mRNA in stimulated PBMC is 100% homologous to human apoptosis-specific eIF-5A, and this study shows that the growth of eIF- It was before 5A was cloned. Similarly, the primers described by Kruse et al. Used to detect eIF-5A by reverse transcriptase chain reaction during dendritic cell maturation are human apoptosis-specific eIF-5A and 100 % Homology.

  The present invention regulates apoptosis-specific eIF-5A expression to control dendritic cell maturation rate and PBMC activation, which in turn can control the rate of T cell-mediated immunization Related to making. Since U-937 cells are known to express eIF-5A mRNA, the inventors used U-937 cells to induce apoptosis-specific eIF-5A when monocytes differentiate into adherent macrophages. (Bevec et al., 1994). U-937 cells are a human monocytic cell line that grows in suspension. When stimulated with PMA, they become adhesive and differentiate into macrophages. When the medium is changed to remove PMA, the cells become inactive and can subsequently produce cytokines (Barrios-Rodiles et al., J. Immunol., 163, 963-969, 1999). Macrophages respond to lipopolysaccharide (LPS: found in the outer membrane of many bacteria and are generally known to induce inflammatory responses) and produce both TNF-α and IL-1β (Barrios-Rodiles et al., 1999). See FIG. 78, which shows stem cell differentiation and the resulting cytokines. U-937 cells also produce IL-6 and IL-10 when stimulated with LPS (Izeboud et al., J. Receptor & Signal Transduction Research, 19 (1-4), 191-202, 1999).

  Using U-937 cells, we demonstrated that apoptosis-specific eIF-5A is up-regulated during monocyte differentiation and TNF-α secretion. See FIG. Thus, according to one aspect of the present invention, there is provided a method of preventing or delaying macrophage maturation to prevent or reduce cytokine production. This method involves administering an agent capable of reducing the expression of DHS or apoptosis-specific eIF-5A. By reducing or eliminating DHS expression, activation of apoptosis-specific eIF-5A is reduced or eliminated. Apoptosis-specific eIF-5A is up-regulated during monocyte differentiation and TNF-α secretion, suggesting that apoptosis-specific eIF-5A is required for these events to occur ing. Therefore, by reducing or eliminating the activation of apoptosis-specific eIF-5A, or by directly reducing or eliminating the expression of apoptosis-specific eIF-5A, it is possible to reduce or eliminate monocyte differentiation and TNF-α secretion. be able to. Any agent that can reduce the expression of DHS or apoptosis-specific eIF-5A can be used. Such agents are, for example, the antisense oligonucleotides and siRNAs described herein.

  The inventors have utilized cell lines believed to produce cytokines in response to specific stimuli, and have used human apoptosis-specific eIF-5A as a nucleocytoplasmic shuttle for cytokine mRNAs in vitro. By functioning, we studied the ability of human apoptosis-specific eIF-5A to promote cytokine translation. Several recent studies have found that human hepatocyte cell lines can respond to cytokine stimulation by inducing the production of other cytokines. HepG2 is a well-characterized human hepatocellular carcinoma cell line that has been found to be sensitive to cytokines. HepG2 cells respond to IL-1β and rapidly produce TNF-α mRNA and TNF-α protein in a dose-dependent manner (Frede et al., 1996; Rowell et al., 1997; Wordemann et al., 1998). Year). Therefore, HepG2 cells were used as a model system for studying the regulation of TNF-α production. When the inventors of the present invention transfect an antisense oligonucleotide against apoptosis factor 5A into HepG2 cells, human apoptosis-specific eIF-5A is blocked in the cells, thereby producing TNF- produced by the cells. It was shown that α decreases.

  Thus, in one embodiment of the present invention, a method for reducing cytokine levels is provided. This method includes an operation of administering an agent capable of decreasing the expression of apoptosis factor 5A1. When the expression of the apoptosis factor 5A1 is decreased, the expression of the cytokine is also decreased, and as a result, the amount of cytokine produced by the cell is also decreased. The cytokine is preferably an inflammatory cytokine, and examples thereof include IL-1, IL-18, IL-6, TNF-α and the like.

  Antisense oligonucleotides are those described above. Human specific apoptosis-specific eIF-5A antisense oligonucleotides were selected from the group consisting of SEQ ID NOs: 35, 37, 39 or selected from the group consisting of SEQ ID NOs: 35, 37, 39 An antisense oligonucleotide that hybridizes to a sequence under high stringency conditions.

  The agent can also comprise a human apoptosis-specific eIF-5A siRNA. The siRNA is as described above. The specific siRNA has a sequence selected from the group consisting of SEQ ID NO: 30, 31, 32, 33 or hybridizes under high stringency conditions with a sequence selected from the group consisting of SEQ ID NO: 30, 31, 32, 33 SiRNA. Figures 65-67 show that cells transfected with human apoptosis-specific eIF-5A siRNA have a lower percentage of cells that undergo apoptosis after exposure to camptothecin and TNA-α compared to untransfected cells. I understand that.

  The present invention also relates to a method for reducing the expression of p53. This method includes an operation of administering an agent capable of decreasing the expression of apoptosis factor 5A (for example, the above-mentioned antisense oligonucleotide or siRNA). When the expression of apoptosis-specific eIF-5A is decreased, the expression of p53 is decreased as shown in FIG. 52 and Example 10.

  The present invention also relates to a method for reducing the expression of Bcl-2. This method involves administering an agent capable of reducing the expression of human apoptosis-specific eIF-5A. Preferred drugs include the above-mentioned antisense oligonucleotides and siRNA. Decreasing the expression of apoptosis-specific eIF-5A increases the expression of Bcl-2, as shown in FIG. 63 and Example 13. FIG. 63 shows that in cells transfected with apoptosis-specific eIF-5A siRNA, the production of apoptosis-specific eIF-5A protein decreases and the production of Bcl-2 protein increases. Decreased expression of apoptosis-specific eIF-5A correlates with increased expression of BCL-2.

  According to the present invention, there is provided a method for reducing the level of TNF-α in a patient in need of lowering the level of TNF-α, wherein the patient is treated with an apoptosis-specific eIF-5A antisense oligonucleotide as described above. Alternatively, a method comprising an operation of administering siRNA is also provided. As can be seen from FIG. 69 and Example 14, in cells transfected with the apoptosis-specific eIF-5A antisense oligonucleotide of the present invention, the production of TNF-α after induction with IL-1 was reduced in the antisense. • Fewer than cells that were not transfected with the oligonucleotide.

  Furthermore, according to the present invention, there is provided a method for treating a pathological condition characterized by increased levels of IL-1, TNF-α, IL-6, and IL-18. Thus, a method including the operation of administering an agent (antisense oligonucleotide or siRNA) that decreases the expression of apoptosis-specific eIF-5A is provided.

  Pathological conditions known to be characterized by elevated levels of IL-1, TNF-α, IL-6 include rheumatoid arthritis, osteoarthritis, asthma, allergy, arteritis, Crohn's disease, inflammation Bowel disease (ibd), ulcerative colitis, coronary heart disease, cystic fibrosis, diabetes, lupus, multiple sclerosis, Graves' disease, periodontitis, glaucoma, macular degeneration, eye surface (eg cone) Corneal) disease, organ ischemia (heart, kidney), reperfusion injury, sepsis, multiple myeloma, rejection of organ transplant, psoriasis, eczema. Therefore, by reducing the expression of apoptosis-specific eIF-5A using the antisense oligonucleotide, siRNA and method of the present invention, it is possible to release these pathological conditions.

  The present invention also provides a method of delivering siRNA to a mammalian lung in vivo. SiRNA against apoptosis-specific eIF-5A was administered intraperitoneally (mixed with water) into mice. 24 hours after administration of siRNA against apoptosis-specific eIF-5A, lipopolysaccharide (LPS) was administered intranasally in mice. After another 24 hours, the right lung was removed and myeloperoxidase was measured. Mouse apoptosis-specific eIF-5A siRNA inhibited myeloperoxidase by approximately 90% compared to control siRNA. In this experiment, each group had 5 mice. The results of this experiment show that siRNA was successfully delivered to mammalian lung tissue in vivo and that siRNA against apoptosis-specific eIF-5A blocked the expression of apoptosis-specific eIF-5A, resulting in myeloperoxidase It shows that the production of was suppressed. Myeloperoxidase (“MPO”) is a lysosomal enzyme found in neutrophils. Myeloperoxidase is an enzyme that converts hydrogen chloride to hypochlorous acid using hydrogen peroxidase. Hypochlorous acid reacts with and destroys bacteria. Myeloperoxidase is also produced when the artery is inflamed. Thus, it is clear that myeloperoxidase is associated with neutrophil and inflammatory responses. The inventors of the present invention have used myRNA to down-regulate apoptosis-specific eIF-5A, thereby allowing myeloperoxidase in lung tissue after exposure to LPS (which usually causes an inflammatory response including production of myeloperoxidase). It was clarified that there was a significant decrease. Thus, the inventor of the present invention can reduce or suppress the amount of myeloperoxidase in lung tissue, and as a result, the siRNA against apoptosis-specific eIF-5A can reduce or suppress the inflammatory response. .

  LPS is a bacterial macromolecular cell surface antigen that, when administered in vivo, triggers a network of inflammatory responses. Supplying LPS intranasally increases the number of neutrophils in the lungs. One of the major events is the activation of mononuclear phagocytes through a receptor-mediated process, resulting in the release of a number of cytokines (eg TNF-α). This time, when neutrophils that are induced by TNF-α and adhere to endothelial cells increase, massive infiltration into the lung space occurs.

  Thus, the inventor of the present invention not only showed that apoptosis-specific eIF-5A and immune response are correlated, but also that siRNA against apoptosis-specific eIF-5A suppresses myeloperoxidase production (ie inflammation) Part of the response is also shown. The inventors of the present invention have also shown that siRNA can be delivered to lung tissue in vivo by simple intranasal delivery. siRNA was mixed only in water. This is a big breakthrough and a big discovery. This is because other artisans have attempted to design acceptable delivery methods for siRNA.

  The ability to reduce inflammation is directly important in many diseases. MPO levels are a very important predictor of cytokine-induced inflammation due to myocardial infarction and autoimmune diseases. This ability to reduce or suppress the inflammatory response may be useful for the treatment of inflammation related diseases such as autoimmune diseases. Furthermore, the ability to lower MPO can also be a means of protecting patients from ischemia and myocardial infarction.

  In another experiment, mice were similarly treated with siRNA against apoptosis-specific eIF-5A. Lipopolysaccharide (LPS) was administered to mice to induce inflammation and immune system responses. Under controlled conditions, LPS kills thymocytes. Thymocytes are important precursor cells of the immune system that are produced by the thymus and protect it from infection. However, using siRNA against apoptosis-specific eIF-5A, about 90% of thymocytes could survive in the presence of LPS. Since thymocytes are precursors of T cells, when thymocytes are destroyed, T cells are not made, thereby weakening the body's innate immunity and consequently preventing bacterial infections. Thus, using siRNA against apoptosis-specific eIF-5A can reduce inflammation without destroying the body's innate immune defense system (as can be seen from the reduced level of MPO in the first example) .

  One embodiment of the invention relates to reducing the level of NKF beta (“NFκB”) by inhibiting apoptosis-specific eIF-5A using siRNA targeting apoptosis-specific eIF-5A. NFκB is a major cell signaling molecule for inflammation. Activation of NFκB induces COX-2 expression, resulting in tissue inflammation. The expression of the gene encoding COX-2, which is thought to be important for the production of large amounts of prostaglandins at the site of inflammation, is thought to be regulated at the transcriptional level by NFκB. NFκB is present in the cytoplasm of the cell and is bound to its inhibitor. When stimulated by injury or inflammation, NFκB is released from the inhibitor. NFκB moves into the nucleus and activates genes involved in COX-2 expression. Therefore, inflammation can be reduced by reducing the level of NFκB.

  In one experiment, epithelial cells (HT-29 cells) are treated with siRNA targeting apoptosis-specific eIF-5A. Thereafter, when TNF or interferon γ and LPS were added over 1 hour, inflammation was induced by NFκB. The results of this experiment show that blocking the expression of apoptosis-specific eIF-5A using siRNA decreased the level of NFκB activated by interferon γ and LPS. See FIG.

  One embodiment of the present invention provides a method for blocking the expression of endogenous apoptosis-specific eIF-5A in a cell. The inhibition of the expression is preferably carried out using the above-described apoptosis-specific eIF-5A antisense polynucleotide or siRNA according to the present invention. Expression of endogenous apoptosis-specific eIF-5A has a variety of effects on cells. For example, it is observed that the expression of various proteins, factors, receptors, cytokines is reduced (p53; inflammatory cytokines (see FIGS. 112, 113, 114); myeloperoxidase; active NFκB; TLR4 (FIG. 109); TNFR-1 (FIG. 111); iNOS). Decreased expression of endogenous apoptosis-specific eIF-5A increases the level of Bcl-2 expression in the cell.

  It is to be understood that the antisense nucleic acid siRNA of the present invention is administered in the form of a composition that also includes a pharmacologically acceptable base when used in animals for the purpose of prevention or treatment. Suitable pharmacologically acceptable bases include, for example, one or more of water, saline, phosphate buffered saline, dextrose, glycerin, ethanol, and the like, or combinations thereof. Pharmacologically acceptable bases further include wetting agents, emulsifiers, preservatives, and buffers as small amounts of adjuvants to extend the life of the binding protein and increase its effectiveness. May be. Injectable compositions are formulated so that the release of the active ingredient occurs immediately, over a long period of time or after administration to a mammal, as is well known in the art. Can be

  The composition of the present invention can be in various forms. For example, there are solid, semi-solid and liquid dosage forms. Specific examples include tablets, pills, powders, solutions, dispersions, suspensions, liposomes, suppositories, injectable solutions, and infusion solutions. The preferred form depends on the intended route of administration and what treatment is to be performed.

  Such compositions can be prepared by methods well known in the pharmaceutical art. When making the composition, the active ingredient is usually mixed with the base, diluted with the base, or trapped in the base. The base can be in the form of, for example, a capsule, sachet, paper, or other container. Where the base functions as a diluent, it can be a solid, semi-solid, or liquid and functions as a vehicle, excipient, or solvent for the active ingredient. Thus, the composition may be in the form of tablets, lozenges, cachets, elixirs, suspensions, aerosols (as solids or contained in liquid media), ointments, active gelatin capsules containing, for example, up to 10% by weight of active compound Gelatin capsules, suppositories, injectable solutions, suspensions, sterile packaged powders, topical patches are possible.

  Now that the present invention has been described in its entirety, the invention will be more readily understood by reference to the following examples given as specific examples. The examples are intended to assist the understanding of the present invention, and it is not assumed that the scope of the present invention is limited to these examples in any way. The examples do not include detailed descriptions of conventional methods. Such methods are well known to those skilled in the art and are described in numerous publications. Conventional methods (for example, methods used when constructing vectors and plasmids, methods used when inserting nucleic acids encoding polypeptides into such vectors and plasmids, and introducing plasmids into host cells) Detailed descriptions of the methods used and the methods used when expressing and measuring genes and gene products by the host cells can be found in numerous publications. For example, Sambrook, J. et al., 1989, “Molecular Cloning: Laboratory Manual”, 2nd edition, Cold Spring Harbor Laboratory Publishing. All references mentioned in this specification are incorporated herein in their entirety.

Example 1
Visualization of apoptosis in rat corpus luteum by DNA laddering The degree of apoptosis was investigated by DNA laddering. Genomic DNA was isolated from dispersed luteal cells or excised luteal tissue using a QIAamp DNA blood kit (Qiagen) according to the manufacturer's instructions. The corpus luteum was excised before induction of apoptosis by treatment with PGF-2α, and 1 hour and 24 hours after induction of apoptosis. Label the ends of isolated 500 ng DNA with 0.2 μCi [α- ³² P] dCTP, 1 mM Tris, 0.5 mM EDTA, 3 units Klenow enzyme, 0.2 pM dATP, 0.2 pM dGTP, 0.2 This was achieved by incubating with pM dTTP for 30 minutes at room temperature. Unincorporated nucleotides were removed by passing the sample through a 1 ml Sepadex G-50 column according to Sambrook et al. Samples were then separated by Tris-acetate-EDTA (1.8%) gel electrophoresis. The gel was dried at room temperature under vacuum for 30 minutes and exposed to X-ray film at -80 ° C. for 24 hours.

In one experiment, the degree of apoptosis in superovulated luteal bodies of rats was examined at 0, 1, and 24 hours after injection of PGF-2α. For the 0 hour control, ovaries were removed without injection of PGF-2α. Laddering of low molecular weight DNA fragments reflecting the nuclease activity associated with apoptosis is not evident in control corpus luteum tissue excised prior to treatment with PGF-2α, but is identified within 1 hour of inducing apoptosis It becomes prominent and becomes prominent by 24 hours after inducing apoptosis. This is shown in FIG. The uppermost photograph in this figure is a radiograph of a Northern blot examined using the 3 'untranslated region of rat corpus luteum apoptosis-specific DHS cDNA labeled with ³² P-dCTP. The lower photo is a gel of total RNA stained with ethidium bromide. Each lane contains 10 μg of RNA. This data indicates that apoptosis-specific eIF-5A transcripts are down-regulated after removal of serum.

  In another experiment, corresponding control rats were treated with saline rather than PGF-2α. 15 minutes after treatment with saline or PGF-2α, the corpus luteum was removed from the rat. Genomic DNA was isolated from the corpus luteum 3 and 6 hours after removal of the corpus luteum from the rat. DNA laddering and increased genomic DNA end labeling were evident 6 hours after removal of tissue from rats treated with PGF-2α, but not 3 hours after removal of tissue. See FIG. DNA laddering, which reflects apoptosis, is also evident when the corpus luteum is excised 15 minutes after treatment with PGF-2α and in vitro conditions are maintained in EBSS (Gibco) for 6 hours. The nuclease activity associated with apoptosis is also evident from the more extensive end labeling of genomic DNA.

In another experiment, superovulation was induced by subcutaneous injection of 500 μg of PGF-2α. Control rats were treated with the same volume of saline. After 15-30 minutes, the ovaries were removed and subdivided using collagenase. The dispersed rat-derived cells are treated with PGF-2α and then incubated in 10 mm glutamine + 10 mm spermidine for 1 hour, followed by another 5 hours in 10 mm glutamine without spermidine (Lane 2) or incubated in 10 mm glutamine + 10 mm spermidine for 1 hour, then incubated in 10 mm glutamine + 1 mm spermidine for an additional 5 hours (lane 3). Control cells from saline-treated rats were dispersed with collagenase and incubated for 1 hour followed by an additional 5 hours in glutamine alone (lane 1). 500 ng of DNA from each sample was labeled with [α- ³² P] dCTP using Klenow enzyme, separated on a 1.8% agarose gel and exposed to film for 24 hours. The results are shown in FIG.

In yet another experiment, superovulated rats were injected subcutaneously with spermidine at a rate of 1 mg per 100 g body weight followed by 500 μg of PGF-2α. However, spermidine was divided into three equal parts at a rate of 0.333 mg per 100 g body weight, 24 hours before, 12 hours before and 2 hours before subcutaneous injection of PGF-2α. Control rats were divided into three groups. That is, a group not injected, a group injected with spermidine three times but not injected with PGF-2α, and a group treated with PGF-2α after three injections of the same amount of physiological saline. The ovaries were removed from the rats 1 hour 35 minutes or 3 hours after treatment with prostaglandins and the DNA was isolated. 500 ng of DNA from each sample was labeled with [α- ³² P] dCTP using Klenow enzyme, separated on a 1.8% agarose gel and exposed to film for 24 hours. Lane 1 was not injected (rats were euthanized simultaneously with lanes 3-5); lane 2 was injected three times with spermidine (rats were euthanized simultaneously with lanes 3-5); lane 3 was saline After 3 injections, PGF-2α was injected (rat was euthanized 1 hour and 35 minutes after treatment with PGF-2α); Lane 4 was injected 3 times with spermidine followed by PGF-2α (PGF- Rats were euthanized 1 hour and 35 minutes after treatment with 2α); Lane 5 was injected with spermidine three times followed by PGF-2α (1 hour and 35 minutes after treatment with PGF-2α. Lane 6 was injected with spermidine three times, then PGF-2α was injected (rat was euthanized 3 hours and 45 minutes after treatment with PGF-2α); Lane 7 was injected with spermidine three times, Injection of PGF-2α (rats were euthanized 3 hours 45 minutes after treatment with PGF-2α). The results are shown in FIG.

RNA isolation
Total RNA was isolated from luteal tissue removed from rats at various times after induction of apoptosis with PGF-2α. Briefly, the tissue (5g) was ground in liquid nitrogen. The ground powder was mixed with 30 ml guanidinium buffer (4 M guanidinium isothiocyanate, 2.5 mM NaOAc, pH 8.5, 0.8% β-mercaptoethanol). The mixture was filtered through 4 layers of miraculose and centrifuged at 10,000 xg for 30 minutes at 4 ° C. The supernatant was then subjected to cesium chloride gradient centrifugation at 11,200 × g for 20 hours. The pelleted RNA was washed with 75% ethanol, resuspended in 600 ml of DEPC-treated water, and RNA was precipitated at −70 ° C. using 1.5 ml of 95% ethanol and 60 ml of 3M NaOAc.

Genomic DNA isolation and laddering
Genomic DNA was isolated from dispersed luteal cells or excised luteal tissue using a QIAamp DNA blood kit (Qiagen) according to the manufacturer's instructions. Label to the end of 500 ng of DNA, 0.2 μCi [α- ³² P] dCTP, 1 mM Tris, 0.5 mM EDTA, 3 units Klenow enzyme, 0.2 pM dATP, 0.2 pM dGTP, 0.2 pM dTTP And at room temperature for 30 minutes. Unincorporated nucleotides were removed by passing the sample through a 1 ml Sepadex G-50 column according to the method described by Maniatis et al. Samples were then separated by Tris-acetate-EDTA (2%) gel electrophoresis. The gel was dried at room temperature under vacuum for 30 minutes and exposed to X-ray film at -80 ° C. for 24 hours.

Plasmid DNA isolation, DNA sequencing
Plasmid DNA was isolated using the alkaline lysis method described by Sambrook et al. Full-length positive cDNA clones were sequenced using dideoxy sequencing. Sanger et al., Proc. Natl. Acad. Sci. USA, Volume 74, pages 5463-5467. Open reading frames were compiled and analyzed by BLAST search (GenBank, Bethesda, MD), BCM search launcher (multi-sequence alignment, pattern-guided multiple alignment method (F. Corpet, Nuc. Acids Res., No. 1) 16), pages 10881-10890, see 1987))) to achieve sequence alignment. Sequences and sequence alignments are shown in FIGS.

Northern blot hybridization of rat corpus luteum RNA
On a 1% non-denaturing formaldehyde agarose gel, 20 mg of total RNA was isolated from rat corpus luteum in various stages of apoptotic state and immobilized on a nylon membrane. Using a random primer kit (Boehringer), the membrane was examined using rat apoptotic-specific eIF-5A full-length cDNA (SEQ ID NO: 1) labeled with ³² P-dCTP (7 × 10 ⁷ cpm) . Alternatively, the membrane was examined (7 × 10 ⁷ cpm) using rat DHS full-length cDNA (SEQ ID NO: 6) labeled with ³² P-dCTP using a random primer kit (Boehringer). The membrane was washed once at room temperature with 1 × SSC, 0.1% SDS and washed 3 times at 65 ° C. with 0.2 × SSC, 0.1% SDS. The membrane was dried and exposed to X-ray film overnight at -70 ° C.

  It can be seen that both apoptosis-specific eIF-5A and DHS were up-regulated in luteal tissue undergoing apoptosis. The expression of apoptosis-specific eIF-5A was significantly increased after inducing apoptosis by treatment with PGF-2α. It was small at time 0, increased significantly within 1 hour of treatment, increased further within 8 hours of treatment, and slightly increased within 24 hours of treatment (FIG. 14). DHS expression was low at time 0, increased significantly within 1 hour of treatment, increased further within 8 hours of treatment, and slightly increased again within 24 hours of treatment (Figure 15).

Partial-length apoptosis-specific eIF-5A sequence corresponding to the 3 'end of the gene generated in the rat corpus luteum RT-PCR product that causes apoptosis using primers based on the sequence of yeast, fungus, and human apoptosis-specific eIF-5A ( SEQ ID NO: 11) was generated by RT-PCR from apoptotic rat corpus luteum RNA template. At that time, oligonucleotide primers designed from the apoptosis-specific eIF-5A sequences of yeast, fungus and human were used. The upstream primer used to isolate the 3 ′ end of the rat apoptosis-specific eIF-5A gene is a 20 nucleotide degenerate primer: 5′TCSAARACHGGNAAGCAYGG3 ′ (SEQ ID NO: 9). However, S is C or G, R is A or G, H is any one of A, T, and C, Y is C or T, and N is any nucleic acid. The downstream primer used to isolate the 3 ′ end of the rat eIF-5A gene contains 42 nucleotides: 5GCGAAGCTTCCATGG CTCGAGTTTTTTTTTTTTTTTTTTTTT3 ′ (SEQ ID NO: 10). Reverse transcriptase chain reaction (RT-PCR) was performed. Briefly, 5 mg downstream primer was used to synthesize the first strand of cDNA. Next, this first strand was used as a template in RT-PCR using both upstream and downstream primers.

  Separation of the RT-PCR product on an agarose gel revealed that a 900 bp fragment was present, so it was subcloned and pBluescript® (Stratagene cloning using blunt end ligation)・ Systems, La Jolla, Calif.) And sequenced (SEQ ID NO: 11). The cDNA sequence at the 3 ′ end is SEQ ID NO: 11, and the amino acid sequence at the 3 ′ end is SEQ ID NO: 12. See FIGS. 1-2.

  A partial length apoptosis-specific eIF-5A sequence (SEQ ID NO: 15) corresponding to the 5 ′ end of the gene and overlapping the 3 ′ end was generated by RT-PCR from apoptotic rat corpus luteum RNA template. The 5 ′ primer was a 24-mer with the sequence 5′CAGGTCTAGAGTTGGAATCGAAGC3 ′ (SEQ ID NO: 13) designed for the human eIF-5A sequence. The 3 ′ primer was a 30-mer having a sequence of 5′ATATCTCGAGCCTT GATTGCAACAGCTGCC3 ′ (SEQ ID NO: 14) designed according to the 3 ′ end RT-PCR fragment. Reverse transcriptase polymerase chain reaction (RT-PCR) was performed. Briefly, 5 mg downstream primer was used to synthesize the first strand of cDNA. Next, this first strand was used as a template in RT-PCR using both upstream and downstream primers.

  Separation of the RT-PCR product on an agarose gel revealed the presence of a 500 bp fragment, which was subcloned and cloned into the XbaI and XhoI cloning sites present in the upstream and downstream primers, respectively. The site was incorporated into pBluescript® (Stratagene Cloning Systems, La Jolla, Calif.) And sequenced (SEQ ID NO: 15). The cDNA sequence at the 5 ′ end is SEQ ID NO: 15, and the amino acid sequence at the 5 ′ end is SEQ ID NO: 16. See Figure 2.

  Since the 3 ′ and 5 ′ end sequences of rat apoptosis-specific eIF-5A (SEQ ID NO: 11 and SEQ ID NO: 15, respectively) overlap, a full-length cDNA sequence (SEQ ID NO: 1) was obtained. An alignment of this full-length sequence and the sequence in the GeneBank database was made and compared. See FIGS. 1-2. The cDNA clone encodes a polypeptide consisting of 154 amino acids (SEQ ID NO: 2), and the calculated molecular weight is 16.8 kDa. The nucleotide sequence (SEQ ID NO: 1) of the full-length cDNA of rat apoptosis-specific corpus luteum eIF-5A gene obtained by RT-PCR is shown in FIG. 3, and the corresponding amino acid sequence is SEQ ID NO: 9. An alignment of the resulting full-length amino acid sequence of eIF-5A with human and mouse eIF-5A sequences was made. See FIGS. 7-9.

Using a primer based on the human DHS sequence, a partial length DHS sequence (SEQ ID NO: 6) corresponding to the 3 ′ end of the gene generated from the apoptotic rat corpus luteum RT-PCR product was transferred from the apoptotic rat corpus luteum RNA template to RT- Made by PCR. At that time, a pair of oligonucleotide primers designed from human DHS sequences was used. The 5 ′ primer is a 20-mer having the sequence 5′GTCTGTGTATTATTGGGCCC3 ′ (SEQ ID NO: 17); the 3 ′ primer is a 42-mer having the sequence 5′GCGAAGCTTCCATGGC TCGAGTTTTTTTTTTTTTTTTTTTTT3 ′ (SEQ ID NO: 18). Reverse transcriptase polymerase chain reaction (RT-PCR) was performed. Briefly, 5 mg downstream primer was used to synthesize the first strand of cDNA. Next, this first strand was used as a template in RT-PCR using both upstream and downstream primers.

  Separation of the RT-PCR product on an agarose gel revealed that a 606 bp fragment was present, so it was subcloned and pBluescript® (Stratagene cloning using blunt end ligation)・ Systems, La Jolla, Calif.) And sequenced (SEQ ID NO: 6). The nucleotide sequence (SEQ ID NO: 6) of the partial length cDNA of the rat apoptosis-specific corpus luteum eIF-5A gene obtained by RT-PCR is shown in FIG. 4, and the corresponding amino acid sequence is SEQ ID NO: 7.

Genomic DNA isolation and Southern analysis Genomic DNA was isolated from ovaries excised from rats for Southern blotting. Approximately 100 mg of ovarian tissue was divided into small pieces and placed in 15 ml test tubes. The tissue was washed twice with 1 ml of PBS while gently shaking the tissue suspension, and then removed from the PBS using a pipette. The tissue was resuspended in 2.06 ml DNA buffer (0.2 M Tris-HCl (pH 8.0) and 0.1 mM EDTA) and 240 μl 10% SDS and 100 μl proteinase K (Boehringer Mannheim; 10 mg / ml) was added. The tissue was placed in a shaking water bath and brought to 45 ° C. overnight. The next day, an additional 100 μl of proteinase K (10 mg / ml) was added and the tissue suspension was incubated in a 45 ° C. water bath for an additional 4 hours. After incubation, the tissue suspension was extracted once with the same amount of phenol: chloroform: isoamyl alcohol (25: 24: 1) and once with the same amount of chloroform: isoamyl alcohol (24: 1). After extraction, 1/10 volume of 3M sodium acetate (pH 5.2) and 2 volumes of ethanol were added. Using a glass pipette sealed with a Bunsen burner in the form of a hook, the DNA string was pulled from the solution and transferred to a clean centrifuge tube. The DNA was washed once in 70% ethanol and dried in air for 10 minutes. The DNA pellet was dissolved in 500 μl of 10 mM Tris-HCl (pH 8.0), 10 μl RNase A (10 mg / ml) was added and incubated at 37 ° C. for 1 hour. Extract DNA once with phenol: chloroform: isoamyl alcohol (25: 24: 1), add 1/10 volume of 3M sodium acetate (pH 5.2) and double volume of ethanol to precipitate DNA I let you. The DNA was pelleted by centrifugation at 13,000 xg for 10 minutes at 4 ° C. The DNA pellet was washed once in 70% ethanol, and the DNA was dissolved in 200 μl of 10 mM Tris-HCl (pH 8.0) by stirring the DNA overnight at 4 ° C.

Genomic DNA isolated from rat ovaries was digested with various restriction enzymes for Southern blot analysis. Enzymes are those that do not cleave the endogenous gene or that cleave only once. 10 μg of genomic DNA, 20 μl of 10 × reaction buffer and 100 U restriction enzyme were reacted in a total reaction volume of 200 μl for 5-6 hours. Digested DNA was loaded on a 0.7% agarose gel and electrophoresed at 40 volts for 6 hours or 15 volts overnight. After electrophoresis, the gel was depurinated in 0.2N HCl for 10 minutes, then washed twice in denaturing solution (0.5M NaOH, 1.5M NaCl) for 15 minutes each time. Washing was performed twice for 15 minutes each in a sum buffer (1.5 M NaCl, 0.5 M Tris-HCl (pH 7.4)). Transfer DNA to nylon membrane and hybridize the membrane to 40% formamide, 6x SSC, 5x Denhardt solution (1x Denhardt solution contains 0.02% Ficoll, 0.02% PVP, 0.02% BSA) , 0.5% SDS, 1.5 mg denatured salmon sperm DNA). CDNA of 3'UTR of 700 bp PCR fragment of the rat eIF-5A (650 bp is 3'UTR, the code portion is 50 bp), the labeled [α- ³² P] dCTP by random primer method, 1 × 10 ⁶ cpm / Added to the membrane at the rate of ml.

Similarly, [α- ³² P] dCTP is labeled on the 606 bp PCR fragment of rat DHS cDNA (coding portion is 450 bp and 156 bp is 3'UTR) by the random primer method, and the rate is 1 × 10 ⁶ cpm / ml. To the second same membrane. The blot was hybridized overnight at 42 ° C., then washed twice with 2 × SSC and 0.1% SDS at 42 ° C. and twice with 1 × SSC and 0.1% SDS at 42 ° C. The blot was then exposed to film for 3-10 days.

Rat corpus luteum genomic DNA was cleaved as shown in FIG. 20 using restriction enzymes, and examined using eIF-5A full-length cDNA labeled with ³² P-dCTP. Hybridization under high stringency conditions revealed that full-length cDNA probes hybridize with several restriction fragments of DNA samples digested with the respective restriction enzymes. This indicates that there are several isoforms in eIF-5A. Of particular note is that digestion of rat genomic DNA with EcoRV, which has one restriction site within the open reading frame of apoptosis-specific eIF-5A, reveals a restriction fragment of the apoptosis-specific isoform of eIF-5A. Second, it was detected by Southern blot. These two fragments are indicated by two arrows in FIG. Restriction fragments corresponding to the apoptosis-specific isoforms of eIF-5A are indicated by single arrows in the lanes labeled EcoR1 and BamH1. EcoR1 and BamH1 are restriction enzymes that do not have a restriction site to be cleaved within the open reading frame. This result suggests that apoptosis-specific eIF-5A is a gene with only one copy in the rat. As shown in FIGS. 5 to 13, the eIF-5A gene is very well conserved among species, so there is a significant amount of conserved parts between isoforms in any species. Expect it.

FIG. 21 is a Southern blot of rat genomic DNA examined using a partial length cDNA of rat corpus luteum DHS labeled with ³² P-dCTP as a probe. This genomic DNA was cut with EcoRV. EcoRV is an enzyme that does not cleave the partial length cDNA used as a probe. There are clearly two restriction fragments. This indicates that there are two copies of this gene or that it contains an intron with an EcoRV site.

Example 2
This example shows the changes after administration of apoptosis-specific eIF-5A (enhancement of apoptosis using apoptosis-specific eIF-5A in the sense direction).

In all experiments based on COS-7 cell culture and RNA transfection, COS-7 cells (African green monkey kidney fibroblasts transformed with a mutant of SV40 encoding wild type T antigen) Cell-like cell line) was used. COS-7 cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) containing 0.584 g / l L-glutamine, 4.5 g / l glucose, and 0.37% sodium bicarbonate. This medium was supplemented with 10% fetal bovine serum (FBS) and 100 units of penicillin / streptomycin. The cells were grown at 37 ° C. in a humid environment with 5% CO _{2 and} 95% air. Cells were subcultured every 3-4 days by peeling off adherent cells with a solution containing 0.25% trypsin and 1 mM EDTA. The detached cells were placed in a new culture dish containing fresh medium at a separation ratio of 1:10.

  COS-7 cells used for RNA isolation were grown in 150 mm dishes (Corning) treated with tissue culture. The cells were detached and collected using a solution containing trypsin-EDTA. Peeled cells were placed in a centrifuge tube and pelleted by centrifuging at 3000 rpm for 5 minutes. The supernatant was removed and the cell pellet was snap frozen in liquid nitrogen. GenElute mammalian total RNA miniprep kit (Sigma) was used according to manufacturer's instructions to isolate RNA from frozen cells.

Recombinant plasmid construction and transfection into COS-7 cells Rat's apoptosis-specific eIF-5A full-length coding sequence in sense orientation, rat apoptosis-specific eIF-5A 3 'untranslated region (UTR) A recombinant plasmid containing in the antisense direction was constructed using pHM6 (Roche Molecular Biochemicals), a mammalian epitope tag expression vector. This vector is shown in FIG. This vector consists of CMV promoter (human cytomegalovirus immediate early promoter / enhancer), HA (nonapeptide epitope tag derived from influenza hemagglutinin), BGH pA (bovine growth hormone polyadenylation signal), f1 ori (origin of f1), SV40 ori (SV40 early promoter and origin), neomycin (neomycin resistance (G418) gene), SV40 pA (SV40 polyadenylation signal), Col E1 (ColE1 origin), ampicillin ( Ampicillin resistance gene). The rat apoptotic-specific eIF-5A full-length coding sequence and the rat apoptotic-specific eIF-5A 3'UTR are PCR from the original rat eIF-5A RT-PCR fragment contained in pBluescript (SEQ ID NO: 1). Amplified by The following primers were used to amplify full-length eIF-5A: forward primer 5'GCC AAGCTT AATGGCAGATGATTT GG3 '(SEQ ID NO: 59) (Hind3) and reverse primer 5'CT GAATTC CAGT TATTTTGCCATGG3' (SEQ ID NO: 60) ( EcoR1). The following primers were used to amplify 3'UTR rat apoptosis-specific eIF-5A: forward primer 5'AAT GAATTC CGCCATGACAGAGGAGGC3 '(SEQ ID NO: 61) (EcoR1) and reverse primer 5'GCG AAGCTT CCATGG CTCGAG TTTTTTTTTTTTTTTTTTTTT ( SEQ ID NO: 62) (Hind3).

  The rat full-length apoptosis-specific eIF-5A PCR product isolated after agarose gel electrophoresis was 430 bp in length, whereas the 3'UTR rat apoptosis-specific eIF-5A PCR product was long. Was 697 bp. Both PCR products were subcloned into the Hind3 and EcoR1 sites of pHM6 to create pHM6-full-length apoptosis-specific eIF-5A and pHM6-antisense 3′UTReIF-5A. Subcloning the rat full-length apoptosis-specific eIF-5A PCR product and placing it in the same frame as the nonapeptide epitope tag derived from influenza hemagglutinin (HA) upstream of the multiple cloning site and anti- [HA] Peroxidase antibody was used to allow detection of recombinant protein. Human cytomegalovirus immediate early promoter / enhancer promotes expression, resulting in high levels of expression in mammalian cell lines. This plasmid contains the neomycin resistance (G418) gene that allows for the selection of stable transfectants and the SV40 that allows episomal replication in cells that express the large T40 antigen of SV40 (eg COS-7). It is characterized by including an initial promoter and origin.

  COS-7 cells used for transfection experiments are cultured on 24-well culture plates (Corning) when used for protein extraction, and on cell culture slides (Falcon) with four chambers when used for staining. Cultured. Cells were grown in DMEM supplemented with 10% FBS but lacking penicillin / streptomycin until confluence was 50-70%. Transfection sufficient for one well of a 24-well plate or for culture slides by diluting 0.32 μg of plasmid DNA in 42.5 μl of serum-free DMEM and incubating this mixture at room temperature for 15 minutes A medium was prepared. 1.6 μl of transfection reagent Lipofectamine (Gibco-BRL) was diluted in 42.5 μl of serum-free DMEM and incubated at room temperature for 5 minutes. After 5 minutes, the lipofectamine mixture was added to the DNA mixture and incubated at room temperature for 30-60 minutes. The transfected cells were washed once with serum-free DMEM and then placed on the transfection medium and the cells were again placed in the growth chamber for 4 hours.

  After incubation, 0.17 ml DMEM + 20% FBS was added to the cells. Cells were cultured for an additional 40 hours before inducing apoptosis and then stained or harvested for Western blot analysis. As a control, mock transfection was also performed. At that time, plasmid DNA was removed from the transfection medium.

Protein extraction and Western blotting Transfected cells were washed with PBS (8 g / l NaCl, 0.2 g / l KCl, 1.44 g / l Na ₂ HPO ₄ , 0.24 g / l) for Western blotting. After washing twice in KH ₂ PO ₄ , 150 μl warm SDS gel-loading buffer (50 mM Tris-HCl, pH 6.8, 100 mM dithiothreitol, 2% SDS, 0.1% bromophenol • Blue, 10% glycerin) was added to separate the protein from the cells. The cell lysate was placed in a microcentrifuge tube and heated to 95 ° C. for 10 minutes and then centrifuged at 13,000 × g for 10 minutes. The supernatant was transferred to a new microcentrifuge tube and stored at −20 ° C. until ready to use.

  To perform Western blotting, 2.5 μg or 5 μg of total protein was separated on a 12% SDS-polyacrylamide gel. The separated protein was transferred to a polyvinylidene fluoride membrane. The membrane is then incubated for 1 hour in blocking solution (PBS containing 5% skim milk powder and 0.02% sodium azide) and 3 times 15 minutes each in PBS-T (PBS + 0.05% Tween 20). Washed twice. Membranes were stored overnight at 4 ° C. in PBS-T. The next day, the membrane was warmed to room temperature and then blocked for 30 seconds in 1 μg / ml polyvinyl alcohol. The membrane was washed 5 times in deionized water and then blocked for 30 minutes in a PBS solution containing 5% milk. Primary antibodies were preincubated for 30 minutes in a PBS solution containing 5% milk and then incubated with the membrane.

  Several primary antibodies were used. Anti- [HA] peroxidase antibody (Roche Molecular Biochemicals) was diluted 5000 times and used to detect expression of the recombinant protein. Since this antibody is conjugated to peroxidase, no secondary antibody was required. The blot was washed and developed by chemiluminescence. Another primary antibody used is a monoclonal antibody derived from an oncogene and recognizes p53 (Ab-6), Bcl-2 (Ab-1), and c-Myc (Ab-2). Monoclonal antibodies against p53 were used at a dilution of 0.1 μg / ml, and monoclonal antibodies against Bcl-2 and c-Myc were both used at a dilution of 0.83 μg / ml. The membrane was incubated with the primary antibody for 60-90 minutes and then washed 3 times for 15 minutes each in PBS-T. The secondary antibody was then diluted in PBS containing 1% milk and incubated with the membrane for 60-90 minutes. When p53 (Ab-6) was used as the primary antibody, the secondary antibody used was a 1000-fold dilution of alkaline phosphatase (Rockland) conjugated with goat anti-mouse IgG. When Bcl-2 (Ab-1) and c-Myc (Ab-2) were used as primary antibodies, peroxidase (Sigma) conjugated with rabbit anti-mouse IgG was diluted 5000 times and used. The membrane was incubated with secondary antibody and then washed 3 times in PBS-T.

The blot was developed using two detection methods. The methods are a colorimetric measurement method and a chemiluminescence method. The colorimetric method was used only when p53 (Ab-6) was used as a primary antibody together with a secondary antibody conjugated with alkaline phosphatase. The bound antibodies were 0.33 mg / ml nitroblue tetrazolium, 0.165 mg / ml 5-bromo-4-chloro-3-indolyl phosphate, 100 mM NaCl, 5 mM MgCl ₂ , 100 mM Tris- The blot was visualized by incubating in the dark in a solution consisting of HCl (pH 9.5). The color reaction was stopped by incubating the blot in PBS containing 2 mM EDTA. The chemiluminescent detection method was used with all other primary antibodies (anti- [HA] peroxidase, Bcl-2 (Ab-1), c-Myc (Ab-2)). Using an ECL plus Western blotting detection kit (Amersham Pharmacia Biotech), the bound antibody conjugated with peroxidase was detected. Briefly, after the membrane was blotted slightly and dried, it was incubated for 5 minutes in the dark with a 40: 1 mixture of reagent A and reagent B. Membranes were blotted dry, sandwiched between acetate sheets and exposed to X-ray film for 10 seconds to 10 minutes.

Induction of apoptosis in COS-7 cells
Two methods were used to induce apoptosis in transfected COS-7 cells. It is serum deficiency and treatment with actinomycin D (Streptomyces, Calbiochem). In both cases, the medium was removed 40 hours after transfection. When performing serum starvation experiments, the medium was replaced with serum-free and antibiotic-free DMEM. Cells grown in antibiotic-free DMEM supplemented with 10% FBS were used as controls. When inducing apoptosis with actinomycin D, the medium was replaced with antibiotic-free DMEM supplemented with 10% FBS and 1 μg / ml of actinomycin D dissolved in methanol. Control cells were grown in antibiotic-free DMEM supplemented with 10% FBS and the same amount of methanol as above. In both methods, the percentage of apoptotic cells was measured 48 hours later by staining with Hoechst or annexin V-Cy3. Induction of apoptosis was also confirmed by Northern blot analysis as shown in FIG.

Hoechst staining The nuclei of transfected COS-7 cells were labeled using nuclear dye Hoechst to identify apoptotic cells based on morphological characteristics (eg nuclear fragmentation and condensation). As a fixing agent, a mixture of anhydrous methanol and glacial acetic acid in a ratio of 3: 1 was prepared immediately before use. The same amount of fixing agent was added to the medium of COS-7 cells growing on the culture slide and incubated for 2 minutes. The medium / fixer mixture was removed from the cells and discarded, and 1 ml of fixer was added to the cells. After 5 minutes, the fixative was discarded and 1 ml of fresh fixative was added to the cells and incubated for 5 minutes. After the fixing agent was discarded and the cells were dried in air for 4 minutes, 1 ml of Hoechst stain (PBS containing 0.5 μg / ml Hoechst 33258) was added. After incubating in the dark for 10 minutes, the staining solution was discarded and the slides were washed 3 times with deionized water for 1 minute each. After washing, 1 ml McKilben buffer (0.021 M citrate, 0.058 M Na ₂ HPO ₄ .7H ₂ O; pH 5.6) was added to the cells and incubated for 20 minutes in the dark. The buffer was discarded and the cells were dried in the air for 5 minutes in the dark and the chamber separating the wells of the culture slide was removed. A vector shield mounting medium for fluorescence (Vector Laboratories) was added to a few drops of the slide and a cover glass was placed over the top. Stained cells were observed with a fluorescence microscope using a UV filter. Lightly stained cells or fragmented nuclei were designated as apoptosis.

Annexin V-Cy3 staining Annexin V-Cy3 apoptosis detection kit (Sigma) was used to fluorescently label externalized phosphatidylserine on apoptotic cells. This kit was used according to the manufacturer's protocol, with the following changes. Briefly, transfected COS-7 cells growing on 4 chamber culture slides were washed twice with PBS and 3 times with 1 × binding buffer. 150 μl of staining solution (1 × binding buffer containing 1 μg / ml AnnCy3) was added and the cells were incubated for 10 minutes in the dark. The staining solution was then removed and the cells were washed 5 times with 1 × binding buffer. The chamber walls were removed from the culture slide, a few drops of 1 × binding buffer were placed on the cells, and a cover glass was placed over the top. Stained cells were observed with a fluorescence microscope using a green filter to visualize the red fluorescence of positively stained (apoptotic) cells. Total cell count was determined by counting the number of cells under visible light.

Example 3
This example demonstrates the changes after administration of apoptosis-specific eIF-5A.

  FIG. 23 is a flow chart showing a procedure for performing transient transfection on COS-7 cells using the general procedure and method described in the previous two examples. Cells in serum-free medium were incubated with lipofectamine containing plasmid DNA for 4 hours, serum was added and incubated for an additional 40 hours. Cell analysis is then performed after an additional 48 hours of incubation in normal medium containing serum (ie, no further treatment), or after serum is depleted for 48 hours to induce apoptosis, or with actinomycin D This was done after treatment for 48 hours to induce apoptosis.

  FIG. 22 is a Western blot showing transient expression of foreign protein in COS-7 cells after transfection with pHM6. Protein isolation from COS-7 cells can be achieved 48 hours after mock transfection or pHM6-LacZ, pHM6-antisense 3'rF5A (pHM6-antisense 3'UTR rat apoptosis-specific eIF -5A) or pHM6-sense rF5A (pHM6-full length rat apoptosis-specific eIF-5A) was performed 48 hours after transfection. 5 μg of protein from each sample was fractionated by SDS-PAGE, transferred to a PVDF membrane, and Western blot was performed using anti- [HA] peroxidase. Bound antibody was detected by chemiluminescence and exposed to X-ray film for 30 seconds. LacZ expression (lane 2) and rat sense / apoptosis specific eIF-5A expression (lane 4) are clearly visible.

  As previously described, COS-7 cells were either mock transfected or transfected with pHM6-sense rF5A (pHM6-full length rat apoptosis-specific eIF-5A). Forty hours after transfection, cell apoptosis was induced by removing the serum for 48 hours. The proteolytic activity of caspase contained in the transfected cell extract was measured using a fluorescence measurement homogeneous caspase assay kit (Roche Diagnostics). DNA fragmentation was also measured using the FragEL DNA fragmentation apoptosis detection kit (Oncogene). In this kit, the exposed 3′-OH end of a DNA fragment is labeled with deoxynucleotides labeled with fluorescein.

  Another COS-7 cell was either mock-transfected or transfected with pHM6-sense rF5A (pHM6-full length rat apoptosis-specific eIF-5A). Forty hours after transfection, cells are grown in normal medium containing serum for an additional 48 hours (no further treatment) or induced to induce apoptosis by leaving the serum removed for 48 hours Alternatively, cell apoptosis was induced by treatment with 0.5 μg / ml actinomycin D for 48 hours. Cells were stained with Hoechst 33258 or annexin V-Cy3. Staining with Hoechst 33258 indicates that the nucleus was fragmented with apoptosis. Staining with annexin V-Cy3 indicates that phosphatidylserine was exposed with apoptosis. Stained cells were also observed with a fluorescence microscope using a green filter and the percentage of cells undergoing apoptosis was determined by counting. The total number of cells was counted with visible light.

  Figure 25 shows that increased apoptosis is reflected in increased caspase activity when transient transfection of rat OSM with pHM6 containing full-length apoptosis-specific eIF-5A in the sense orientation was performed on COS-7 cells. Which indicates that. Expression of rat apoptosis-specific eIF-5A increased caspase activity by 60%.

  FIG. 26 shows that increased apoptosis is reflected in increased DNA fragmentation when transient transfection of rat pHM6 with full-length apoptosis-specific eIF-5A in the sense orientation was performed on COS-7 cells. It is shown that. Expression of rat apoptosis-specific eIF-5A resulted in a 273% increase in DNA fragmentation. Figure 27 shows that apoptosis is detected by increased nuclear fragmentation when transient transfection of pHM6 with rat full-length apoptosis-specific eIF-5A in sense orientation is performed on COS-7 cells It is shown that. Cells expressing rat apoptosis-specific eIF-5A have more fragmented nuclei. FIG. 28 shows that increased apoptosis is reflected in increased nuclear fragmentation when transient transfection of pHM6 with rat full-length apoptosis-specific eIF-5A in sense orientation was performed on COS-7 cells It is shown that. Expression of rat apoptosis-specific eIF-5A increases nuclear fragmentation by 27% compared to controls in non-serum-deficient samples compared to controls in serum-deficient samples Increased by 63%.

  Figure 29 shows that apoptosis is detected by exposure of phosphatidylserine when transient transfection of pHM6 with sense-directed full-length apoptosis-specific eIF-5A in rats is performed on COS-7 cells. Show. Figure 30 shows that increased apoptosis is reflected in increased phosphatidylserine exposure when transient transfection of pHM6 with rat full-length apoptosis-specific eIF-5A in the sense orientation was performed on COS-7 cells. It is shown that. Expression of rat apoptosis-specific eIF-5A increases phosphatidylserine exposure by 140% compared to controls in samples without serum deficiency, compared to controls in samples lacking serum Increased by 198%.

  Figure 31 shows that increased apoptosis is reflected in increased nuclear fragmentation when transient transfection of rat pHM6 with sense-directed full-length apoptosis-specific eIF-5A in rats was performed on COS-7 cells It is shown that. Expression of rat apoptosis-specific eIF-5A increased nuclear fragmentation by 115% compared to controls in untreated samples and 62% compared to controls in treated samples. Figure 32 shows that COS-7 cells that had been transiently transfected with pHM6 transiently containing rat full-length apoptosis-specific eIF-5A in the sense orientation were treated with no further treatment and further induced apoptosis. It is the figure which compared the increase in apoptosis in the case.

Example 4
This example demonstrates the changes after administration of apoptosis-specific eIF-5A.

  COS-7 cells were either mock transfected or transfected with pHM6-sense rF5A (pHM6-full length rat apoptosis-specific eIF-5A) and incubated for 40 hours. A 5 μg sample of the protein extract from each sample was fractionated by SDS-PAGE, transferred to a PVDF membrane, and Western blotting was performed using a monoclonal antibody that recognizes Bcl-2. Peroxidase conjugated with rabbit anti-mouse IgG was used as a secondary antibody, and the bound antibody was detected by chemiluminescence and exposed to X-ray film. The results are shown in FIG. Cells transfected with pHM6-sense rF5A detect less Bcl-2 than cells transfected with pHM6-LacZ. Therefore, it can be seen that Bcl-2 is down-regulated by the pHM6-sense rF5A structure.

  Separate COS-7 cells can be mock transfected, pHM6-antisense 3'rF5A (pHM6-antisense 3'UTR rat apoptosis specific eIF-5A) or pHM6-sense rF5A (pHM6-full length) Rat apoptosis-specific eIF-5A) was transfected. Forty hours after transfection, cell apoptosis was induced by removing the serum for 48 hours. A 5 μg sample of the protein extract from each sample was fractionated by SDS-PAGE, transferred to a PVDF membrane, and Western blotting was performed using a monoclonal antibody that recognizes Bcl-2. Peroxidase conjugated with rabbit anti-mouse IgG was used as a secondary antibody, and the bound antibody was detected by chemiluminescence and exposed to X-ray film.

  In addition, COS-7 cells were either mock transfected or transfected with pHM6-LacZ or pHM6-sense rF5A (pHM6-full length rat apoptosis-specific eIF-5A) and incubated for 40 hours. A 5 μg sample of the protein extract from each sample was fractionated by SDS-PAGE, transferred to a PVDF membrane, and Western blotting was performed using a monoclonal antibody that recognizes p53. Alkaline phosphatase conjugated with goat anti-mouse IgG was used as a secondary antibody and bound antibody was detected by colorimetry.

  Finally, COS-7 cells were either mock transfected or transfected with pHM6-LacZ or pHM6-sense rF5A (pHM6-full length rat apoptosis-specific eIF-5A) and incubated for 40 hours. A 5 μg sample of the protein extract from each sample was fractionated by SDS-PAGE, transferred to a PVDF membrane, and examined using a monoclonal antibody that recognizes p53. Corresponding protein blots were examined with anti- [HA] peroxidase to reveal the expression level of rat apoptosis-specific eIF-5A. Alkaline phosphatase conjugated with goat anti-mouse IgG was used as a secondary antibody and bound antibody was detected by chemiluminescence.

  FIG. 33 shows down-regulation of Bcl-2 upon transient transfection of COS-7 cells with pHM6 containing rat full-length apoptosis-specific eIF-5A in the sense orientation. The upper photo is a blot of protein stained with Coomassie-Blue; the lower photo is the corresponding Western blot. Cells transfected with pHM6-sense rF5A have less detectable Bcl-2 than cells transfected with pHM6-LacZ.

  FIG. 34 shows up-regulation of Bcl-2 when COS-7 cells were transiently transfected with pHM6 containing the 3 ′ end of apoptosis-specific eIF-5A in the antisense direction. The upper photo is a blot of protein stained with Coomassie-Blue; the lower photo is the corresponding Western blot. Cells transfected with pHM6-antisense 3′rF5A have more detectable Bcl-2 than cells transfected with mock or cells transfected with pHM6-sense rF5A.

  FIG. 35 shows the up-regulation of c-Myc when transient transfection of COS-7 cells with pHM6 containing rat full-length apoptosis-specific eIF-5A in the sense orientation. The upper photo is a blot of protein stained with Coomassie-Blue; the lower photo is the corresponding Western blot. Higher levels of c-Myc are detected in cells transfected with pHM6-sense rF5A than in cells transfected with pHM6-LacZ or mock-transfected controls.

  FIG. 36 shows p53 upregulation when transient transfection of COS-7 cells with pHM6 containing rat full-length apoptosis-specific eIF-5A in the sense orientation. The upper photo is a blot of protein stained with Coomassie-Blue; the lower photo is the corresponding Western blot. Cells transfected with pHM6-sense rF5A detect higher levels of p53 than cells transfected with pHM6-LacZ or mock-transfected controls.

  FIG. 37 shows that p53 upregulation is dependent on the expression of pHM6-full-length apoptosis-specific eIF-5A in COS-7 cells. More rat apoptosis-specific eIF-5A was detected in the first transfection than in the second transfection. Shown are a Western blot examined with anti-p53, a corresponding protein blot stained with Coomassie-Blue, and a Western blot using p53. For the first transfection, more p53 is detected in cells transfected with pHM6-sense rF5A than in cells transfected with pHM6-LacZ or mock-transfected controls. In the second transfection with less expression of rat apoptosis-specific eIF-5A, p53 levels in cells transfected with pHM6-sense rF5A, cells transfected with pHM6-LacZ, and mock-transfected controls No difference was detected.

Example 5
FIG. 47 shows an experiment that mimics the heartbeat of a human heart with heart tissue and then induces myocardial infarction. FIG. 49 shows the state of the laboratory. A section of human heart tissue removed during valve replacement surgery was hooked to the electrode. A small weight was attached to the heart tissue to make it easier to measure heart rate intensity. Electrical stimulation was applied from the electrode, and the tissue started to beat. Ischemia was induced after measuring gene expression levels of both apoptosis-specific eIF-5A and proliferating eIF-5A in heart tissue. See FIG. In pre-ischemic heart tissue, the production of both apoptosis-specific eIF-5A and proliferating eIF-5A was low, and both were approximately the same. During this time, a buffer solution containing oxygen and carbon dioxide at 92.5% and 7.5%, respectively, was supplied to the heart. Thereafter, ischemia was induced by lowering the oxygen level and raising the nitrogen level, eventually leading to “myocardial infarction”. The heart tissue stopped beating. So when the oxygen level was restored to normal and an electrical stimulus was applied, the heart tissue began to beat again. After “myocardial infarction”, the expression levels of apoptosis-specific eIF-5A and proliferating eIF-5A were measured again. This time, the level of apoptosis-specific eIF-5A showed a marked increase, while the expression level of proliferating eIF-5A was much less. See FIG.

  After “myocardial infarction”, the heart did not beat as strongly as before. This can be seen from the less pressure / motion of the attached weight. This indicates that cardiac tissue cells were dying rapidly due to the presence of apoptosis-specific eIF-5A.

  The results of EKG are shown in FIG. On the left side of the figure, the heartbeat of a normal heart is shown (heart tissue before ischemia). EKG after “myocardial infarction” (straight line) and after the heart resumes pulsation indicates that the activity is reduced due to the death of muscle cells. This EKG indicates that the heart beat has become relatively weak.

Example 6
The cell culture conditions are shown in the following examples.
Culture of human sieve plate cells and astrocytes A pair of human eyeballs was obtained from the Canadian Eye Bank (Ontario Branch) within 48 hours after death. The optic nerve head (with poles) was removed and placed in Dulbecco's Modified Eagle Medium (DMEM) supplemented with antibiotic / antimycotic, glutamine, and 10% FBS for 3 hours. The optic nerve head (ONH) button was collected from each tissue sample and cut into small pieces with shredder scissors. Grafts were cultured in DMEM in 12.5 cm ² plastic culture flasks. Live grafts were observed for growth within a month. When the cell confluency reached 90%, it was treated with trypsin and subjected to fractional subculture to generate a population of sieve plate (LC) cells and astrocytes. Specifically, LC cells were subcultured in 25 cm ² plastic culture flasks containing DMEM supplemented with gentamicin, glutamine, and 10% FBS, whereas astrocytes, The cells were grown in a 25 cm ² flask containing EBM complete medium (Cronetics) without FBS. After 10 days of subculture, FBS was added into the astrocyte culture. Cells were maintained and subcultured according to this protocol.

  Using the fluorescent antibody staining method on an 8-well culture slide, the purity of the population was examined to determine what the cell population was obtained by fractional subculture. Cells were fixed in 10% formalin solution and washed 3 times with Dulbecco's phosphate buffered saline (DPBS). After blocking the reaction with DPBS containing 2% skim milk, the antibody was diluted with DPBS containing 1% BSA and added to cells in 6 wells. The remaining two wells were treated with 1% bovine serum albumin (BSA) solution only as a control and no primary antibody was used. Cells were incubated with primary antibody for 1 hour at room temperature and then washed 3 times with DPBS. Appropriate secondary antibody was diluted with DPBS containing 1% BSA, added to each well and incubated for 1 hour. After washing with DPBS, the chamber separating the wells of the culture slide was removed from the slide, and the slide was soaked in double distilled water and then dried in air. Fluoromount (Vector Laboratories) was added to each slide and covered with a 22 × 60 mm coverglass slip from above.

  Immunofluorescence staining was observed with a fluorescence microscope equipped with appropriate filters and compared to control wells that were not treated with primary antibody. Unless otherwise noted, all primary antibodies were obtained from Sigma. All secondary antibodies were purchased from Molecular Probes. The primary antibodies used to identify LC cells were anti-collagen I, anti-collagen IV, anti-laminin, anti-cell fibronectin. Primary antibodies used to identify astrocytes were anti-galactocerebroside (Chemicon International), anti-A2B5 (Chemicon International), anti-NCAM, and anti-human von Willebrand factor. Other antibodies used in both cell populations include anti-glia fibers (GFAP) and anti-α smooth muscle actin. When a cell population is positively stained for collagen I, collagen IV, laminin, cellular fibronectin, α-smooth muscle actin, and negatively stained for glial fibers (GFAP), the cell population contains LC cells. It became clear that. When the cell population is positively stained for NCAM, glial fibers (GFAP), and negatively stained for galactocerebroside, A2B5, human von Willebrand factor, α-smooth muscle actin, the cell population is star-shaped. It was revealed that cells were included.

  In this preliminary experiment, culturing was started using three human eyeballs. LC cell lines # 506, # 517, and # 524 were established from the optic nerve heads of 83-year-old male, 17-year-old male, and 26-year-old female, respectively. All LC cell lines were fully characterized and found to contain more than 90% LC cells.

The ability of antisense oligonucleotides to suppress the expression of apoptosis-specific eIF-5A protein using human colon cancer cell line RKO (American standard culture collection CRL-2577) expressing wild-type p53 cultured in RKO cells Examined. RKO was cultured in minimal essential eagle medium (MEM) with non-essential amino acids, Earl's salt and L-glutamine. This medium was supplemented with 10% fetal bovine serum (FBS) and 100 units of penicillin / streptomycin. The cells were grown at 37 ° C. in a humid environment consisting of 5% CO ₂ and 95% air. Cells were subcultured every 3-4 days and adherent cells were detached using a solution containing 0.25% trypsin and 1 mM EDTA. The detached cells were placed in a new culture dish containing fresh medium at a split ratio of 1:10 to 1:12.

Using HepG2, a cultured human hepatocellular carcinoma cell line of HepG2 cells, antisense oligonucleotides against human apoptosis-specific eIF-5A produce TNF-α in response to treatment with IL-1β Investigate the ability to prevent. HepG2 cells were cultured in DMEM supplemented with gentamicin, glutamine and 10% FBS and grown at 37 ° C. in a humid environment consisting of 5% CO ₂ and 95% air.

Example 7
Induction of apoptosis
Apoptosis was induced in RKO cells using actinomycin D and RNA polymerase inhibitor, and apoptosis was induced in slab plate cells using camptothecin and topoisomerase inhibitor. Actinomycin D was used at a concentration of 0.25 μg / ml, and camptothecin was used at concentrations of 20, 40, and 50 μM. Apoptosis was also induced in the sieve plate cells using a combination of camptothecin (50 μM) and TNF-α (10 ng / ml). The combination of camptothecin and TNF-α was found to be more effective in inducing apoptosis than using camptothecin or TNF-α alone.

Antisense Oligonucleotides Three sets of antisense oligonucleotides that target human apoptosis-specific eIF-5A were designed by Molecular Research Labs and purchased from the company. The sequence (# 1) of the first antisense oligonucleotide targeting human apoptosis-specific eIF-5A was 5′CCT GTC TCG AAG TCC AAG TC3 ′ (SEQ ID NO: 63). The sequence of the second antisense oligonucleotide targeting human apoptosis-specific eIF-5A (# 2) was 5'GGA CCT TGG CGT GGC CGT GC3 '(SEQ ID NO: 64). The sequence of the third antisense oligonucleotide targeting human apoptosis-specific eIF-5A (# 3) was 5′CTC GTA CCT CCC CGC TCT CC3 ′ (SEQ ID NO: 65). The sequence of the control oligonucleotide was 5'CGT ACC GGT ACG GTT CCA GG3 '(SEQ ID NO: 66). Transfection efficiency was examined using antisense oligonucleotides (Molecular Research Labs) labeled with fluorescein isothiocyanate (FITC). The sequence of the antisense oligonucleotide was 5′GGA CCT TGG CGT GGC CGT GCX3 ′ (SEQ ID NO: 67) (X is a FITC label). All antisense oligonucleotides were fully phosphorothioated.

Transfection of antisense oligonucleotides The ability of apoptosis-specific eIF-5A antisense oligonucleotides to block the expression of apoptosis-specific eIF-5A protein was investigated in RKO cells. RKO cells were transfected with antisense oligonucleotides using a transfection reagent called Oligofectamine (Invitrogen). Cells were distributed into 24-well plates 24 hours prior to transfection. At that time, 157,000 cells were contained in MEM medium supplemented with 10% FBS but lacking penicillin / streptomycin per well. After 24 hours, the cells often reached about 50% confluence. RKO cells were mock-transfected or transfected with 100 nM or 200 nM antisense oligonucleotides. By diluting 0 μl, or 1.25 μl, or 2.5 μl of a 20 μM antisense oligonucleotide in serum-free MEM to a final volume of 42.5 μl, this mixture is incubated at room temperature for 15 minutes to 24 Sufficient transfection medium was prepared for one well of the well plate. 1.5 μl of oligofectamine was diluted in 6 μl of serum-free MEM and incubated at room temperature for 7.5 minutes. After 5 minutes, the diluted oligofectamine mixture was added to the DNA mixture and incubated for 20 minutes at room temperature. After the cells were washed once with serum-free MEM, 200 μl of MEM was added to the cells, and 50 μl of transfection medium was added from above. Cells were returned to the growth chamber and incubated for 4 hours. After incubation, 125 μl of MEM + 30% FBS was added to the cells. Cells were then cultured for a further 48 hours and treated with 0.25 μg / ml actinomycin D for 24 hours, after which the cell extract was collected and subjected to Western blot analysis.

  Following the same procedure as described for RKO cells, transfection into sieve plate cells was also investigated using antisense oligonucleotides and oligofectamines 100 nM and 200 nM. However, effective transfection of sieve plate cells requires the addition of antisense oligonucleotides diluted in serum-free medium to 1 μM to 10 μM to the cells over 24 hours, and then the medium is added to fresh antisense oligonucleotides. This was realized by performing the operation of replacing the medium with diluted serum-containing medium every 24 hours for a total of 2 to 5 days.

  The transfection efficiency of the antisense oligonucleotide is the same as that of apoptosis-specific eIF-5A antisense oligonucleotide # 2 (SEQ ID NO: 64), but the FITC-labeled antisense oligonucleotide has a 3 'end conjugated to FITC. Optimized and monitored by transfecting. RKO cells and sieve plate cells were transfected with FITC-labeled antisense oligonucleotides on 8-well culture slides. After 48 hours, the cells were washed with PBS and fixed in PBS containing 3.7% formaldehyde for 10 minutes. The wells were taken out, and an encapsulant (Vectashield) was added, followed by covering with a cover glass. Next, using a fluorescein filter (Green H546, filter set 48915), the nucleus of the cell was made visible by a fluorescence microscope under UV light. Cells that emitted bright green fluorescence were judged to have taken up the oligonucleotide.

Apoptosis detection Cells transfected with various antisense oligonucleotides and induced with camptothecin, then treated with control antisense oligonucleotide, or apoptosis-specific eIF-5A antisense oligonucleotide Among the cells treated with (SEQ ID NO: 26), the proportion of cells that had undergone apoptosis was examined. Two methods were used to detect apoptotic sieve plate cells. That is, Hoechst staining method and Dead End (registered trademark) fluorescence measurement TUNEL method. Nuclear dye Hoechst was used to label sieving cell nuclei and identify apoptotic cells based on morphological characteristics (eg nuclear fragmentation and condensation). As a fixing agent, a mixture of anhydrous methanol and glacial acetic acid in a ratio of 3: 1 was prepared immediately before use. The same amount of fixing agent was added to the medium of COS-7 cells growing on the culture slide and incubated for 2 minutes. The medium / fixer mixture was removed from the cells and discarded, and 1 ml of fixer was added to the cells. After 5 minutes, the fixative was discarded and 1 ml of fresh fixative was added to the cells and incubated for 5 minutes. After the fixing agent was discarded and the cells were dried in air for 4 minutes, 1 ml of Hoechst stain (PBS containing 0.5 μg / ml Hoechst 33258) was added. After incubating in the dark for 10 minutes, the staining solution was discarded and the slides were washed 3 times with deionized water for 1 minute each. After washing, a few drops of McKilben buffer (0.021 M citric acid, 0.058 M Na ₂ HPO ₄ · 7H ₂ O; pH 5.6) were added to the cells and a cover glass was placed over the top. Stained cells were observed with a fluorescence microscope using a UV filter. Lightly stained cells or fragmented nuclei were designated as apoptosis. A minimum of 200 cells were counted per well.

Dead end (registered trademark) fluorescence measurement TUNEL (Promega) was used to detect DNA fragmentation, which is one of the characteristics of apoptotic cells. After Hoechst staining, the culture slides are gently washed with distilled water and the slides are placed in PBS (137 mM NaCl, 2.68 mM KCl, 1.47 mM KH ₂ PO ₄ , 8.1 mM Na ₂ HPO ₄ ) for 5 minutes each. Further washing was performed by soaking twice and the slide was blotted onto a paper towel between washes. Cells were made permeable by immersing the cells in PBS containing 0.2% Triton X-100 for 5 minutes. The cells were then washed again by immersing the slide in PBS twice for 5 minutes, and the slide was blotted onto a paper towel between washes. 25 μl of equilibration buffer per well (200 mM potassium cacodylate (pH 6.6), 25 mM Tris-HCl (pH 6.6), 0.2 mM dithiothreitol, 0.25 mg / ml bovine serum albumin, 2.5 mM cobalt chloride) was added and incubated for 5-10 minutes. Equilibration buffer and nucleotide mixture (50 μM fluorescein-12-dUTP, 100 μM dATP, 10 mM Tris-HCl (pH 7.6), 1 mM EDTA) and terminal deoxynucleotidyl transferase enzyme during equilibration 30 μl of reaction mixture for each well was prepared by mixing (Tdt, 25 U / μl) at a ratio of 45: 5: 1. After incubation in equilibration buffer, 30 μl of reaction mixture was added per well and a coverslip was placed over the top. The reaction was allowed to run for 1 hour at 37 ° C. in the dark. The reaction was terminated by immersing the slide in 2 × SSC (0.3 M NaCl, 30 mM sodium citrate pH 7.0) and then incubated for 15 minutes. The slides were then washed by immersing in PBS three times for 5 minutes each. PBS was removed by wiping around the wells using a Kim wipe, a mounting medium (Oncogene Research Project, JA1750-4ML) was added to each well, and a cover glass was placed over the slide. Cells were observed with a fluorescence microscope using a UV filter (UV-G365, filter set 487902), and Hoechst-stained nuclei were counted. All brightly stained or fragmented nuclei were considered apoptotic. In the same field, the cells were observed using a fluorescein filter (Green H546, filter set 48915). All cells with bright green fluorescence were considered apoptotic. The percentage of cells undergoing apoptosis in the field was calculated by dividing the bright green nuclei counted using the fluorescein filter by the total number of nuclei counted under the UV filter. A minimum of 200 cells were counted per well.

  54 to 57 show the results of these experiments. The percentage of apoptotic cells in the sample transfected with apoptosis-specific eIF-5A is clearly much smaller than that seen in cells transfected with the control oligonucleotide.

Protein Extraction and Western Blotting Transfected RKO cells were washed with PBS and 40 μl warm lysis buffer (0.5% SDS, 1 mM dithiothreitol, 50 mM Tris-HCl (pH 8.0) per well. The protein was recovered from the cells by adding)) and subjected to Western blot analysis. The cells were detached, and the resulting extract was transferred to a microcentrifuge tube, boiled for 5 minutes, and stored at -20 ° C. Bio-Rad protein assay (Bio-Rad) was used according to the manufacturer's instructions to quantify the protein.

  To perform the Western blot, 5 μg of total protein was separated on a 12% SDS-polyacrylamide gel. The separated protein was transferred to a polyvinylidene fluoride membrane. The membrane was then incubated in blocking solution (PBS containing 5% skim milk powder) for 1 hour and washed 3 times for 15 minutes each in 0.05% Tween-20 / PBS. Membranes were stored overnight at 4 ° C. in PBS-T. The next day, the membrane was warmed to room temperature and then blocked in 1 μg / ml polyvinyl alcohol for 30 seconds. The membrane was washed 5 times in deionized water and then blocked for 30 minutes in a 0.025% Tween-20 / PBS solution containing 5% milk. The primary antibody was preincubated for 30 minutes in a 0.025% Tween-20 / PBS solution containing 5% milk and then incubated with the membrane.

  Several primary antibodies were used. It consists of a monoclonal antibody (Ab-6) from Oncogene that recognizes p53 and a polyclonal antibody against a synthetic peptide homologous to the C-terminus of human apoptosis-specific eIF-5A (amino-CRLPEGDLGKEIEQKYD-carboxy) (SEQ ID NO: 68). (Gallus Immunotech). This polyclonal antibody was generated in chickens. In order to confirm that the same amount of protein was loaded, an anti-β-actin antibody (Oncogene) was also used. The monoclonal antibody against p53 was used after diluting to 0.05 μg / ml, the antibody against apoptosis-specific eIF-5A was used after being diluted 1000 times, and the antibody against actin was used after being diluted 20,000 times. . After incubating the membrane with the primary antibody for 60-90 minutes, the membrane was washed 3 times for 15 minutes each in 0.05% Tween-20 / PBS. The secondary antibody was then diluted in 0.025% Tween-20 / PBS containing 1% milk and incubated with the membrane for 60-90 minutes. When p53 (Ab-6) was used as the primary antibody, the secondary antibody used was a 5,000-fold diluted peroxidase (Sigma) conjugated with rabbit anti-mouse IgG. When anti-apoptosis-specific eIF-5A was used as a primary antibody, a rabbit anti-chicken IgY-conjugated peroxidase (Gallus Immunotech) was diluted 5000 times and used. The secondary antibody used with actin was a 5-fold dilution of peroxidase (Calbiochem) conjugated with goat anti-mouse IgM. The membrane was incubated with secondary antibody and then washed 3 times in PBS-T.

  Using an ECL plus Western blotting detection kit (Amersham Pharmacia Biotech), the bound antibody conjugated with peroxidase was detected. Briefly, the membrane was lightly blotted and dried, then incubated with a mixture of reagent A and reagent B in a ratio of 40: 1 for 5 minutes in the dark. The membrane was blotted dry and then sandwiched between acetate sheets and exposed to X-ray film for 10 seconds to 30 minutes. The membrane was detached by soaking in stripping buffer (100 mM 2-mercaptoethanol, 2% SDS, 62.5 mM Tris-HCl, pH 6.7) and incubated at 50 ° C. for 30 minutes. The membrane was then washed in deionized water and washed twice for 10 minutes in a large volume of 0.05% Tween-20 / PBS. The membrane was peeled off and blotted up to 3 times.

Example 8
Construction of siRNA A short inhibitory RNA (siRNA) against human apoptosis-specific eIF-5A was used to specifically suppress the expression of apoptosis-specific eIF-5A in RKO cells and sieve cells. Six siRNAs were made by performing transcription in vitro using the Silencer® siRNA Construction Kit (Ambion). Four siRNAs against human apoptosis-specific eIF-5A were produced (siRNA # 1 to # 4) (SEQ ID NOs: 30 to 33). Two siRNAs were used as controls. One is an siRNA against GAPDH included in the kit, and the other has the reverse sequence of apoptosis-specific eIF-5A siRNA # 1 (SEQ ID NO: 30), which itself is an apoptosis-specific eIF- This siRNA does not target 5A (siRNA # 5) (SEQ ID NO: 34). These siRNAs were made according to the manufacturer's protocol. Briefly, by annealing a T7 promoter primer using a DNA oligonucleotide encoding the desired siRNA strand as a template for T7 RNA polymerase, a Klenow fragment and a fill-in reaction are performed. Individual strands of siRNA were generated. After performing a transcription reaction on both the sense strand and the antisense strand, the reactions were combined, the two siRNA strands were annealed, treated with DNase and RNase, and purified on a column. The sequence of the DNA oligonucleotide used to make the siRNA (underlined on the annealing site of the T7 primer) was as follows: siRNA # 1 antisense 5'AAAGGAATGACTTCCAGCTGA CCTGTCTC 3 '(SEQ ID NO: 69) and siRNA # 1 sense 5'AATCAGCTGGAAGTCATTCCT CCTGTCTC 3' (SEQ ID NO: 70); siRNA # 2 antisense 5'AAGATCGTCGAGATGTCTACT CCTGTCTC 3 '(SEQ ID NO: 71) siRNA # 2 sense 5'AAAGTAGACATCTCGACGATC CCTGTCTC 3 '(SEQ ID NO: 72); siRNA # 3 antisense 5'AAGGTCCATCTGGTTGGTATT CCTGTCTC 3' (SEQ ID NO: 73) and siRNA # 3 sense 5'AAAATACCAACCAGATGGACC CCTGTCTC 3 '(SEQ ID NO: 74); siRNA # 4 antisense 5'AAGCTGGACTCCTCCTACACA CCTGTCTC 3 '(SEQ ID NO: 75) and siRNA # 4 sense 5'AATGTGTAGGAGGAGTCCAGC CCTGTCTC 3' (SEQ ID NO: 76); siRNA # 5 antisense 5'AAAGTCGACCTTCAGTAAGGA CCTGTCTC 3 '(SEQ ID NO: 77) and siRNA # 5 sense 5'AATCCTTACTGAAGGTCGACT CCTGTCTC 3 '(SEQ ID NO: 78).

  GAMDH siRNA was labeled with FAM using Silencer (registered trademark) siRNA labeling kit-FAM (Ambion), and the uptake of siRNA into RKO cells and sieve plate cells was monitored. After transfection of the cells on 8-well culture slides, the cells were washed with PBS and fixed for 10 minutes in PBS containing 3.7% formaldehyde. The well was removed, an encapsulant (Vectashield) was added, and a cover glass was applied. Using a fluorescein filter, the uptake of FAM-labeled siRNA was seen under a fluorescent microscope under UV light. GAPDH siRNA was labeled according to the manufacturer's protocol.

siRNA Transfection RKO cells and sieve plate cells were transfected with siRNA according to the same transfection protocol. RKO cells were planted on 8-well culture slides or 24-well plates at a rate of 46,000 and 105,800 per well, respectively, and transfection was performed the next day. The sieve plate cells were transfected when the cell confluency was 40-70%. The sieve plate cells were generally seeded on 8-well culture slides at a rate of 750,000 to 100,000 per well and transfected 3 days later. To prepare enough transfection medium for one well of an 8-well culture slide, 25.5 pmoles of siRNA stock was diluted with Opti-Mem (Sigma) to a final volume of 21.2 μl. 0.425 μl of Lipofectamine 2000 was diluted with Opti-Mem to a final volume of 21.2 μl and then incubated at room temperature for 7-10 minutes. The diluted Lipofectamine 2000 mixture was then added to the diluted siRNA mixture and incubated at room temperature for 20-30 minutes. After the cells were washed once with serum-free medium, 135 μl of serum-free medium was added to the cells, and 42.4 μl of transfection medium was added from above. Cells were returned to the growth chamber and incubated for 4 hours. After incubation, 65 μl of serum free medium + 30% FBS was added to the cells. Transfection of siRNA into cells used for Western blot analysis was performed in 24-well plates. At that time, the conditions were the same as for transfection in 8-well slides except that the volume was increased to 2.3 times.

  After transfection, RKO cells and sieve plate cells were incubated for 72 hours, and cell extracts were collected and subjected to Western blot analysis. To examine the efficiency of siRNA against apoptosis-specific eIF-5A in blocking apoptosis, 48 or 72 hours after transfection, phloem cells were mixed with 50 μl camptothecin (Sigma) and 10 ng / ml TNF-α (Rainco). To induce apoptosis. Cells were stained with Hoechst after 24 or 48 hours, and the percentage of cells undergoing apoptosis was measured.

Example 9
Quantification of TNF-α produced by HepG2 cells
HepG2 cells were seeded at a rate of 20,000 per well in a 48-well plate. After 72 hours, the media was removed and fresh media containing 2.5 μM control antisense oligonucleotide or 2.5 μM apoptosis-specific eIF-5A antisense oligonucleotide # 2 was added to the cells. Fresh medium containing antisense oligonucleotides was added 24 hours later. After incubation with the oligonucleotide for a total of 48 hours, the medium was replaced with medium containing interleukin 1β (IL-1β, 1000 pg / ml; Rainco Technologies) and incubated for 6 hours. The medium was collected and frozen (−20 ° C.), and TNF-α was quantified. Incubation of untreated cells (without antisense oligonucleotide or IL-1β) and cells treated with IL-1β alone was performed in parallel and served as a control. Each treatment was performed twice. An ELISA assay (Assay Design) was used according to the manufacturer's protocol to measure TNF-α released into the medium.

Example 10
The following experiment shows that the apoptosis-specific eIF-5A antisense oligonucleotide was able to block the expression of apoptosis-specific eIF-5A as well as p53.

  RKO cells are not transfected, mock transfected, or 200 nM apoptosis-specific eIF-5A antisense oligonucleotides # 1, # 2, # 3 (SEQ ID NOs: 25, 26, 27) Transfected. RKO cells were also transfected with 100 nM apoptosis-specific eIF-5A antisense oligonucleotide # 2 (SEQ ID NO: 26). 48 hours after transfection, cells were treated with 0.25 μg / ml actinomycin D. After 24 hours, cell extracts were collected and 5 μg protein from each sample was separated on an SDS-PAGE gel, transferred to a PVDF membrane, and Western blotted with an antibody against apoptosis-specific eIF-5A. . After detecting chemiluminescence, the membrane was peeled off and examined again using an antibody against p53. After detecting chemiluminescence, the membrane was peeled off and examined again using an antibody against actin. FIG. 52 shows the level of protein produced by RKO cells after treatment with antisense oligonucleotides 1, 2, and 3 (SEQ ID NOs: 25, 26, and 27, respectively, of apoptosis-specific eIF-5A). In RKO cells, apoptosis-specific eIF-5A and p53 production was reduced after transfection with an apoptosis-specific eIF-5A antisense oligonucleotide.

Example 11
The following experiment shows that apoptosis-specific eIF-5A nucleotides can reduce apoptosis.

  In one experiment, sieve plate cell line # 506 was either transfected with 100 nM antisense oligonucleotide labeled with FITC using (A) Oligofectamine transfection reagent, or (B) labeled with FITC. The 10 μM naked antisense oligonucleotide was diluted directly in serum-free medium and transfected. After 24 hours, fresh media containing 10% FBS and fresh antisense oligonucleotide diluted to 10 μM was added to the cells. After 48 hours in total, cells (A) and (B) were fixed and made visible with a fluorescence microscope under UV light by using a fluorescein filter. FIG. 53 shows the uptake state of the fluorescence-labeled antisense oligonucleotide.

  In another experiment, sieve plate cell line # 506 was transfected with 10 μM control antisense oligonucleotide or apoptosis-specific eIF-5A antisense oligonucleotide # 2 (SEQ ID NO: 26) for a total of 4 days. Forty-eight hours after initiating treatment with the antisense oligonucleotide, cells were treated with 20 μM or 40 μM camptothecin for 48 hours. The medium containing the antisense oligonucleotide and camptothecin was changed daily. The percentage of cells undergoing apoptosis was examined by labeling the cells with Hoechst and TUNEL. See FIG.

  In another experiment, sieve plate cell line # 506 was transfected with 10 μM control antisense oligonucleotide or apoptosis-specific eIF-5A antisense oligonucleotide # 2 (SEQ ID NO: 26). After 24 hours, the medium was changed and fresh antisense oligonucleotide was added. Forty-eight hours after initiating treatment with the antisense oligonucleotide, the antisense oligonucleotide was removed and the cells were treated with 20 μM camptothecin for 3 days. The camptothecin-containing medium was changed every day. The percentage of cells undergoing apoptosis was examined by labeling the cells with Hoechst and TUNEL. See FIG.

  In yet another experiment, sieve plate cell line # 517 was transfected with 1 μM control antisense oligonucleotide or apoptosis-specific eIF-5A antisense oligonucleotide # 2 (SEQ ID NO: 26) for a total of 5 days. . Forty-eight hours after initiating treatment with antisense oligonucleotides, cells were treated with 20 μM camptothecin for 3 or 4 days. The medium containing the antisense oligonucleotide and camptothecin was changed daily. The percentage of cells undergoing apoptosis was examined by labeling the cells with Hoechst and TUNEL. See FIG.

  In another experiment, sieve plate cell line # 517 was transfected with 2.5 μM control antisense oligonucleotide or apoptosis-specific eIF-5A antisense oligonucleotide # 2 (SEQ ID NO: 26) for a total of 5 days. . Forty-eight hours after initiating treatment with the antisense oligonucleotide, the cells were treated with 40 μM camptothecin for 3 days. The medium containing the antisense oligonucleotide and camptothecin was changed daily. The percentage of cells undergoing apoptosis was examined by labeling the cells with Hoechst. See FIG.

  In another experiment, sieve plate cell line # 517 was transfected with 1 μM or 2.5 μM control antisense oligonucleotide or apoptosis-specific eIF-5A antisense oligonucleotide # 2 (SEQ ID NO: 26) for a total of 5 days. I did it. Forty-eight hours after initiating treatment with the antisense oligonucleotide, the cells were treated with 40 μM camptothecin for 3 days. The medium containing the antisense oligonucleotide and camptothecin was changed daily. The percentage of cells undergoing apoptosis was examined by labeling the cells with Hoechst. See FIG.

  In another experiment, leave the sieve plate cell line # 517 untreated, or leave the sieve plate cell line # 517 with 10 ng / ml TNF-α, or with 50 μM camptothecin, or 10 ng / ml TNF-α. Treated with +50 μM camptothecin. The percentage of cells undergoing apoptosis was examined by labeling the cells with Hoechst. See FIG.

  In another experiment, sieve plate cell lines # 506 and # 517 were combined with 2.5 μM or 5 μM control antisense oligonucleotide or apoptosis-specific eIF-5A antisense oligonucleotide # 2 (SEQ ID NO: 26) in total. Transfected for 2 days. Fresh medium containing antisense oligonucleotides was added 24 hours later. Forty-eight hours after initiating treatment with antisense oligonucleotides, cells were treated with 50 μM camptothecin and 10 ng / ml TNF-α for 2 days. The percentage of cells undergoing apoptosis was examined by labeling the cells with Hoechst. See FIG.

  In another experiment, sieve plate cell lines # 506, # 517, # 524 were combined with 2.5 μM control antisense oligonucleotide or apoptosis-specific eIF-5A antisense oligonucleotide # 2 (SEQ ID NO: 26) And transfected for 2 days. Fresh medium containing antisense oligonucleotides was added 24 hours later. Forty-eight hours after initiating treatment with antisense oligonucleotides, cells were treated with 50 μM camptothecin and 10 ng / ml TNF-α for 2 days. The percentage of cells undergoing apoptosis was examined by labeling the cells with Hoechst. See FIG.

Example 12
The following experiments show that expression of apoptosis-specific eIF-5A is less in cells transfected with siRNA targeting apoptosis-specific eIF-5A. This experiment also shows that siRNA targeting apoptosis-specific eIF-5A can reduce apoptosis.

  In one experiment, (A) Lipofectamine 2000 transfection reagent with serum or (B) Lipofectamine 2000 transfection reagent without serum was used during transfection and labeled with FAM on sieve plate cell line # 517 100 nM siRNA was transfected. After a total of 24 hours, cells (A) and (B) were fixed and made visible with a fluorescence microscope under UV light using a fluorescein filter. See FIG.

  In another experiment, RKO cells were transfected with 100 nM siRNA in the presence or absence of serum during transfection. Six siRNAs were transfected. 2 control siRNAs (siRNA # 5 (SEQ ID NO: 34), siRNA targeting GAPDH) and 4 siRNAs targeting siRNA # 1 to # 4 (siRNA # 1- # 4) (SEQ ID NO: 30- 33)). 72 hours after transfection, cell extracts were collected, 5 μg protein from each sample was separated on an SDS-PAGE gel, transferred to a PVDF membrane, and Western blotted with an antibody against apoptosis-specific eIF-5A Was done. After detecting chemiluminescence, the membrane was peeled off and examined again using an antibody against bcl-2. After detecting chemiluminescence, the membrane was peeled off and examined again using an antibody against actin. See FIG.

  In another experiment, sieve plate cell lines # 506 and # 517 were transfected with 100 mM siRNA. Six siRNAs were transfected. 2 control siRNAs (siRNA # 5 (SEQ ID NO: 34), siRNA targeting GAPDH) and 4 siRNAs targeting siRNA # 1 to # 4 (siRNA # 1- # 4) (SEQ ID NO: 30- 33)). 72 hours after transfection, cell extracts were collected, 5 μg protein from each sample was separated on an SDS-PAGE gel, transferred to a PVDF membrane, and Western blotted with an antibody against apoptosis-specific eIF-5A Was done. After detecting chemiluminescence, the membrane was peeled off and examined again using an antibody against bcl-2. After detecting chemiluminescence, the membrane was peeled off and examined again using an antibody against actin. See FIG.

  In another experiment, sieve plate cell line # 506 was transfected with 100 mM siRNA. Six siRNAs were transfected. 2 control siRNAs (siRNA # 5 (SEQ ID NO: 34), siRNA targeting GAPDH) and 4 siRNAs targeting siRNA # 1 to # 4 (siRNA # 1- # 4) (SEQ ID NO: 30- 33)). Forty-eight hours after transfection, the medium was replaced with medium containing 50 μM camptothecin and 10 ng / ml TNF-α. After 24 hours, the percentage of cells undergoing apoptosis was examined by labeling the cells with Hoechst. See FIG.

  In another experiment, sieve plate cell line # 506 was transfected with 100 mM siRNA. Six siRNAs were transfected. 2 control siRNAs (siRNA # 5 (SEQ ID NO: 34), siRNA targeting GAPDH) and 4 siRNAs targeting siRNA # 1 to # 4 (siRNA # 1- # 4) (SEQ ID NO: 30- 33)). 72 hours after transfection, the medium was replaced with medium containing 50 μM camptothecin and 10 ng / ml TNF-α. After 24 hours, the percentage of cells undergoing apoptosis was examined by labeling the cells with Hoechst. See FIG.

  In another experiment, sieve plate cell line # 506 was left untreated or sieve plate cell line # 506 was transfected with 100 mM siRNA. Six siRNAs were transfected. 2 control siRNAs (siRNA # 5 (SEQ ID NO: 34), siRNA targeting GAPDH) and 4 siRNAs targeting siRNA # 1 to # 4 (siRNA # 1- # 4) (SEQ ID NO: 30- 33)). 72 hours after transfection, the medium was replaced with medium containing 50 μM camptothecin and 10 ng / ml TNF-α. Fresh medium was also added to untransfected and untreated control cells. After 48 hours, the percentage of cells undergoing apoptosis was examined by labeling the cells with Hoechst. See FIG.

  FIG. 68 shows a photograph of sieve plate cell line # 506, which was transfected with siRNA, treated with camptothecin and TNF-α, and then stained with Hoechst in the experiment shown in FIG. 67 and Example 13.

Example 13
This example shows that treatment of human cell lines with antisense oligonucleotides against apoptosis-specific eIF-5A results in less TNF-α produced by the cells.

  HepG2 cells were treated for a total of 2 days with 2.5 μM control antisense oligonucleotide or apoptosis-specific eIF-5A antisense oligonucleotide # 2. Fresh medium containing antisense oligonucleotides was added 24 hours later. Another cell was left untreated for 2 days. Forty-eight hours after starting treatment, cells were treated with fresh medium containing IL-1β (1000 pg / ml) for 6 hours. At the end of the experiment, the medium was collected and frozen (−20 ° C.), and TNF-α was quantified. TNF-α released into the medium was measured using an ELISA assay purchased from Assay Designs. See FIG. Cells transfected with an antisense oligonucleotide of apoptosis-specific eIF-5A produced less TNF-α.

Example 14
HT-29 cells (human colorectal adenocarcinoma) were transfected with siRNA against apoptosis-specific eIF-5A or with a control siRNA having the reverse sequence. The siRNA used was:
Position 690 (3'UTR)% G / C = 48
5′AAGCUGGACUCCUCCUACACA3 ′ (SEQ ID NO: 79).
The control siRNA used was:
% G / C = 39
5'AAACACAUCCUCCUCAGGUCG3 '(SEQ ID NO: 80).

  After 48 hours, cells were treated with interferon γ (IFN-γ) for 16 hours. After 16 hours, cells were washed with fresh medium and treated with lipopolysaccharide (LPS) for 8 or 24 hours. At each time point (8 hours or 24 hours), cells were removed from the cell culture medium, frozen, and TNF-α present in the culture medium was quantified by ELISA. Cell lysates were also collected, protein quantified, and TNF-α values were adjusted to pg / mg protein (to control differences in cell numbers in different wells). The result of Western blot is shown in FIG. 74A, and the result of ELISA is shown in FIG. 74B. FIG. 75 shows the results when the same experiment was performed with a larger cell density.

Example 15
Tissue culture conditions for U-937 cell line
U-937 is a human monocytic cell line that grows in suspension, becomes adherent and differentiates into macrophages when stimulated with PMA (which cannot be obtained directly from ATCC) (ATCC Number CRL-1593.2). Cells in a 37 ° C. incubator containing 5% CO ₂ with 2 mM L-glutamine, 1.5 g / l sodium bicarbonate, 4.5 g / l glucose, 10 mM hepes, Maintained in RPMI 1640 medium containing 1.0 mM sodium pyruvate and 10% fetal calf serum. Cells were split twice a week into fresh media (split ratio 1: 4 or 1: 5) and cell density was always maintained between 10 ^{5 and} 2 × 10 ⁶ per ml. Cells were cultured in suspension in plastic T-25 flasks treated with tissue culture and experiments were performed in 24-well plates.

Two days before the start of the experimental experiment to examine changes over time , the cell density was adjusted to 3 × 10 ⁵ cells per ml of medium. On the day of the experiment, cells in the logarithmic growth phase were collected. The cell suspension was transferred to a 15 ml tube and centrifuged at 400 × g for 10 minutes at room temperature. The supernatant was aspirated and the cell pellet was washed with fresh medium and resuspended in fresh medium. The cells were again centrifuged at 400 × g for 10 minutes, the supernatant was aspirated and the cell pellet was finally resuspended in fresh medium. The same volume of cell suspension was mixed with trypan blue solution (PBS containing 0.4% trypan blue dye), and live cells were counted using a hemocytometer and microscope. Cells were diluted to 4 × 10 ⁵ cells per ml.

24-well plates were prepared with PMA or DMSO (control vehicle) added to each well. 1 ml of cell suspension was added to each well so that each well contained only 400,000 cells and 0.1% DMSO + 162 nM PMA, or 0.1% DMSO only. Cells were maintained in a 37 ° C. incubator containing 5% CO ₂ . Cells were harvested from separate wells at times 0, 24, 48, 72, 96, 99, and 102 hours. See Figure 76 for a summary of experimental time points and additives.

  The medium was changed after 72 hours. Since some cells adhered and other cells were in suspension, care was taken not to disturb the adhered cells. The media from each well was carefully transferred to the corresponding microcentrifuge tube, and the tube was centrifuged at 14,000 × g for 3 minutes. The microcentrifuge tube was aspirated and the cell pellet was resuspended in fresh medium (1 ml, (−) DMSO, (−) PMA) and returned to the original well. Cells become inactive with this fresh medium without PMA. At 96 hours, LPS (100 ng / ml) was added and cells were harvested at 3 hours (99 hours) and 6 hours (102 hours).

  At each time point above, suspended cells and media were transferred from each well to a microcentrifuge tube. Cells were pelleted by centrifugation at 14,000 xg for 3 minutes. The medium (supernatant) was transferred to a clean tube and stored for ELISA / cytokine analysis (−20 ° C.). Cells remaining in the well were washed with PBS (1 ml, 37 ° C.), and this PBS was also used for washing the cell pellet in the corresponding microcentrifuge tube. Cells were pelleted again by centrifugation at 14,000 xg for 3 minutes. Cells were lysed using boiling lysis buffer (50 mM Tris (pH 7.4) and 2% SDS). Adherent and suspended cells from each well were pooled. After boiling the sample, it was stored at -20 ° C.

Western blotting The protein concentration in each cell sample was measured by the BCA (bicinchoninic acid) method using BSA (bovine serum albumin) as a standard protein. Protein samples (5 μg total protein) were separated by 12% SDS-PAGE electrophoresis and transferred to a PVDF membrane. The membrane was blocked with polyvinyl alcohol (1 μg / ml, 30 seconds) and PBS-t (1 hour) containing 5% skim milk. Membranes were examined using a mouse monoclonal antibody against human eIF-5A (BD Biosciences, catalog number 611976; diluted 20,000 times in 5% skim milk, 1 hour). The membrane was washed 3 times with PBS-t for 10 minutes each. The secondary antibody was an anti-mouse antibody conjugated with horseradish peroxidase (Sigma, diluted 1: 5000 in 1% skim milk, 1 hour). The membrane was washed 3 times with PBS-t for 10 minutes each. Protein bands were visualized by chemiluminescence (ECL detection system, Amersham Pharmacia Biotech).

  To make sure that each gel lane was loaded with the same amount of protein, the membrane was stripped and examined for actin. The membrane was peeled off (100 mM 2-mercaptoethanol, 2% SDS, 62.5 mM Tris-HCl (pH 6.7); 30 minutes at 50 ° C.), washed and blocked as described above. Membranes were examined with actin primary antibody (actin monoclonal antibody produced in the mouse body; Oncogene, Ab-1, diluted 20,000 times in 5% skim milk). Secondary antibody, washing and detection were the same as described above.

  FIG. 77 shows that eIF-5A is up-regulated while monocytes (U-937) differentiate and TNF-α is subsequently secreted.

Example 16
Inhibition of IL-8 production in response to interferon gamma by apoptosis-specific eIF-5A siRNA
HT-29 (human colon adenocarcinoma) cells were transfected with siRNA against apoptosis-specific eIF-5A. Approximately 48 hours after transfection, the medium was changed. At that time, a part of the test sample contained interferon γ, and another part of the sample did not contain interferon γ. 16 hours after the addition of interferon γ, the cells were washed, and a medium containing TNF-α and a medium containing no TNF-α were added to the cells. Medium (used to detect IL-8 by ELISA) and cell lysate were harvested after 8 or 24 hours.

  FIGS. 79 and 80 show IL-8 produced in response to TNF-α and interferon. When cells are treated with TNF after being treated with interferon gamma, the cells produce more IL-8 than with either treatment alone. This may be due to the fact that TNF receptor 1 is known to be upregulated in response to interferon. Since cells have more receptors, they can respond better to TNF when cells are “treated” with interferon. The siRNA against apoptosis-specific eIF-5A had no effect on IL-8 (previous experiment) produced in response to TNF alone, but the siRNA produced in response to interferon Blocked nearly all 8 and blocked a significant amount of IL-8 produced as a result of the combined treatment of interferon and TNF. This result indicates that the inventors have obtained a pathway to IL-8 by signal transduction not through TNF but through interferon by using siRNA against apoptosis-specific eIF-5A. FIG. 81 is a Western blot showing that apoptosis-specific eIF-5A was up-regulated in HT-29 cells in response to interferon γ (4 times in 8 hours).

Example 17
Culture of human sieve plates A pair of human eyeballs was obtained within 48 hours after death from the Canadian eye bank (Ontario Branch). The optic nerve head (with poles) was removed and placed in Dulbecco's Modified Eagle Medium (DMEM) supplemented with antibiotics / antifungals, glutamine, and 10% FBS for 3 hours. The optic nerve head (ONH) button was collected from each tissue sample and cut into small pieces with shredder scissors. Grafts were cultured in DMEM in 12.5 cm ² plastic culture flasks. Live grafts were observed for growth within a month. When the cell confluency reached 90%, it was treated with trypsin and subjected to fractional subculture to generate a population of sieve plate (LC) cells and astrocytes. LC cells were expanded by subculture in 25 cm ² plastic culture flasks containing DMEM supplemented with gentamicin, glutamine and 10% FBS. Cells were maintained and subcultured according to this protocol.

  Using the fluorescent antibody staining method on an 8-well culture slide, the purity of the population was examined to determine what the cell population was obtained by fractional subculture. Cells were fixed in 10% formalin solution and washed 3 times with Dulbecco's phosphate buffered saline (DPBS). After blocking the reaction with DPBS containing 2% skim milk, the antibody was diluted with DPBS containing 1% BSA and added to cells in 6 wells. The remaining two wells were treated with 1% bovine serum albumin (BSA) solution and secondary antibody alone as controls. Cells were incubated with primary antibody for 1 hour at room temperature and then washed 3 times with DPBS. Appropriate secondary antibody was diluted with DPBS containing 1% BSA, added to each well and incubated for 1 hour. The slides were washed with DPBS, then washed in water, dried in air, and Fluoromount (Vector Laboratories) was added thereon. Immunofluorescence staining was observed with a fluorescence microscope equipped with appropriate filters and compared to control wells that were not treated with primary antibody. Unless otherwise noted, all primary antibodies were obtained from Sigma. All secondary antibodies were purchased from Molecular Probes. Primary antibodies used to identify LC cells were anti-collagen I, anti-collagen IV, anti-laminin, anti-cell fibronectin, anti-glial fibrillary acidic protein (GFAP), anti-α smooth muscle actin. When a cell population is positively stained for collagen I, collagen IV, laminin, cellular fibronectin, α-smooth muscle actin, and negatively stained for glial fibers (GFAP), the cell population contains LC cells. It became clear that. In this experiment, culture was initiated using two sets of human eyes. LC cell lines # 506 and # 517 were established from the optic nerve heads of an 83-year-old man and a 17-year-old man, respectively. All LC cell lines were fully characterized and found to contain more than 90% LC cells.

LC cell treatment
Apoptosis was induced in the sieve plate cells by combining 50 μM camptothecin (Sigma) and 10 ng / ml TNF-α (Rainco Technologies). The combination of camptothecin and TNF-α was found to be more effective in inducing apoptosis than camptothecin or TNF-α alone.

siRNA Construction and Transfection Using a short inhibitory RNA (siRNA) for human apoptosis-specific eIF-5A, the expression of eIF-5A was specifically suppressed in sieve plates. Six siRNAs were made by performing transcription in vitro using the Silencer® siRNA Construction Kit (Ambion). Four siRNAs against human apoptosis-specific eIF-5A were prepared (siRNA # 1 to # 4). Two siRNAs were used as controls. One is an siRNA against GAPDH included in the kit, and the other has the reverse sequence of apoptosis-specific eIF-5A siRNA # 1 (SEQ ID NO: 30), which itself is an apoptosis-specific eIF- This siRNA does not target 5A (siRNA # 5). These siRNAs were made according to the manufacturer's protocol. The siRNA targeting eIF-5A and the control siRNA had the following sequences: siRNA # 1 5'AAAGGAATGACTTCCAGCTGA3 '(SEQ ID NO: 81); siRNA # 2 5'AAGATCGTCGAGATGTCTACT3' (SEQ ID NO: 82); siRNA # 3 5'AAGGTCCATCTGGTTGGTATT3 '(SEQ ID NO: 83); siRNA # 4 5'AAGCTGGACTCCTCCTACACA3' (SEQ ID NO: 84) ); SiRNA # 5 5'AAAGTCGACCTTCAGTAAGGA3 '(SEQ ID NO: 85). Using Lipofectamine 2000, siRNA were transfected into sieve plate cells.

  The sieve plate cells were transfected when the cell confluency was 40-70%. The sieve plate cells were generally seeded on 8-well culture slides at a rate of 750,000 to 100,000 per well and transfected 3 days later. To prepare sufficient transfection medium for one well of an 8-well culture slide, 25.5 pmoles of siRNA was diluted with Opti-Mem (Sigma) to a final volume of 21.2 μl. 0.425 μl of Lipofectamine 2000 was diluted with Opti-Mem to a final volume of 21.2 μl and then incubated at room temperature for 7-10 minutes. The diluted Lipofectamine 2000 mixture was then added to the diluted siRNA mixture and incubated at room temperature for 20-30 minutes. After the cells were washed once with serum-free medium, 135 μl of serum-free medium was added to the cells, and 42.4 μl of transfection medium was added from above. Cells were returned to the growth chamber and incubated for 4 hours. After incubation, 65 μl of serum free medium + 30% FBS was added to the cells. Transfection of siRNA into cells used for Western blot analysis was performed in 24-well plates. At that time, the conditions were the same as for transfection in 8-well slides except that the volume was increased to 2.3 times. After transfection, sieve plate cells were incubated for 72 hours and then treated with 50 μM camptothecin (Sigma) and 10 ng / ml TNF-α (Rainco Technologies) to induce apoptosis. Next, cell lysates were collected and subjected to Western blotting. Alternatively, cell apoptosis was examined.

Detection of apoptotic cells Transfected cells were treated with TNF-α and camptothecin for 24 hours and then stained with Hoechst 33258 to examine the percentage of cells undergoing apoptosis. Briefly, cells were fixed with a 3: 1 mixture of anhydrous methanol and glacial acetic acid and then incubated with Hoechst stain (PBS containing 0.5 μg / ml Hoechst 33258). After incubation in the dark for 10 minutes, the staining solution was discarded, the chamber separating the wells of the culture slide was removed, and the slide was washed 3 times with deionized water for 1 minute each. After washing, a few drops of McKilben buffer (0.021 M citric acid, 0.058 M Na ₂ HPO ₄ · 7H ₂ O; pH 5.6) were added to the cells and a cover glass was placed over the top. Stained cells were observed with a fluorescence microscope using a UV filter. Lightly stained cells or fragmented nuclei were designated as apoptosis. A minimum of 200 cells were counted per well. Dead end (registered trademark) fluorescence measurement TUNEL (Promega) was used to detect DNA fragmentation, which is one of the characteristics of apoptotic cells. After Hoechst staining, the culture slides are gently washed with distilled water and the slides are placed in PBS (137 mM NaCl, 2.68 mM KCl, 1.47 mM KH ₂ PO ₄ , 8.1 mM Na ₂ HPO ₄ ) for 5 minutes each. Further washing was performed by soaking twice and the slide was blotted onto a paper towel between washes. Cells were made permeable by immersing the cells in PBS containing 0.2% Triton X-100 for 5 minutes. The cells were then washed again by immersing the slide in PBS twice for 5 minutes, and the slide was blotted onto a paper towel between washes. 25 μl of equilibration buffer per well (200 mM potassium cacodylate (pH 6.6), 25 mM Tris-HCl (pH 6.6), 0.2 mM dithiothreitol, 0.25 mg / ml bovine serum albumin, 2.5 mM cobalt chloride) was added and incubated for 5-10 minutes. During equilibration, equilibration buffer and nucleotide mixture (50 μM fluorescein-12-dUTP, 100 μM dATP, 10 mM Tris-HCl (pH 7.6), 1 mM EDTA) and terminal deoxynucleotidyl transferase enzyme 30 μl of reaction mixture was prepared in each well by mixing (Tdt, 25 U / μl) in a ratio of 45: 5: 1. After incubation in equilibration buffer, 30 μl of reaction mixture was added per well and a coverslip was placed over the top. The reaction was allowed to run for 1 hour at 37 ° C. in the dark. The reaction was terminated by immersing the slides in 2 × SSC (0.3 M NaCl, 30 mM sodium citrate pH 7.0) and incubating for 15 minutes. The slides were then washed by soaking in PBS 3 times for 5 minutes each. PBS was removed by wiping around the wells using a Kim wipe, a mounting medium (Oncogene Research Project, JA1750-4ML) was added to each well, and a cover glass was placed over the slide. Cells were observed with a fluorescence microscope using a UV filter (UV-G365, filter set 487902), and Hoechst-stained nuclei were counted. All brightly stained or fragmented nuclei were considered apoptotic. In the same field, the cells were observed using a fluorescein filter (Green H546, filter set 48915). All cells with bright green fluorescence were considered apoptotic. The percentage of cells undergoing apoptosis in the field was calculated by dividing the bright green nuclei counted using the fluorescein filter by the total number of nuclei counted under the UV filter. A minimum of 200 cells were counted per well.

Protein Extraction and Western Blot Analysis For Western blotting, sieve plates growing on 24-well plates were washed with PBS (8 g / l NaCl, 0.2 g / l KCl, 1.44 g / l Na After washing twice in ₂ HPO ₄ , 0.24 g / l KH ₂ PO ₄ ), by adding 50 μl lysis buffer (2% SDS, 50 mM Tris-HCl, pH 7.4) The protein was isolated from the cells. Cell lysates were placed in microcentrifuge tubes, boiled for 5 minutes, and stored at -20 ° C until ready to use. Protein concentration was determined using a bicinchoninic acid kit (BCA; Sigma). For Western blotting, 5 μg of total protein was separated on a 12% SDS-polyacrylamide gel. The separated protein was transferred to a polyvinylidene fluoride membrane. The membrane is then incubated for 1 hour to block the solution (PBS containing 5% skim milk powder and 0.02% sodium azide) and in 15 minutes each in PBS-T (PBS + 0.05% Tween 20). Washed twice. Membranes were stored overnight in PBS-T at 4 ° C. The next day, the membrane was warmed to room temperature and then blocked for 30 seconds in 1 μg / ml polyvinyl alcohol. The membrane was washed 5 times in deionized water and then blocked for 30 minutes in a PBS solution containing 5% milk. The primary antibody was preincubated for 30 minutes in a PBS solution containing 5% milk and then incubated with the membrane. The primary antibodies used were anti-eIF-5A (BD Transduction Laboratories) diluted 20,000 times and anti-β-actin (Oncogene). Membranes were washed 3 times in PBS-T and incubated for 1 hour with appropriate HRP-conjugated secondary antibody diluted in PBS containing 1% milk. The blot was washed, and peroxidase-conjugated antibody was detected using ECL plus Western blotting detection kit (Amersham Pharmacia Biotech).

Results Two sieve plate (LC) cell lines were established from optic nerve heads collected from male donors aged 83 years (# 506) to 17 years (# 517). Cells isolated from human sieving cells, like those observed in other studies (Lambert et al., 2001), were widespread, flat and had prominent nuclei. Similar to the results of characterization performed in other groups, LC cells have demonstrated immunoreactivity for α-smooth muscle actin (FIG. 82a) and a number of extracellular matrix proteins such as cellular fibronectin (FIG. 82b), Laminin (Figure 82c), collagen I and collagen IV (data not shown) are shown (Clark et al., 1995; Hernandez et al., 1998; Hernandez and Yang, 2000; Lambert et al., 2001). A negative immune activity of LC cells against glial fibrillary acidic protein (GFAP) was also observed, which is consistent with previous findings (Figure 82d) (Lambert et al., 2001). These findings support that the isolated cells are LC cells rather than optic nerve head astrocytes.

  Since TNF-α is thought to play an important role in the process of glaucoma, we investigated the sensitivity of LC cells to the cytotoxic effects of TNF-α. Confluent LC cells were exposed to camptothecin, to TNF-α, or to a combination of camptothecin and TNF-α for 48 hours (FIG. 83). Hoechst staining revealed that single TNF-α was not cytotoxic to LC cells. When treated with camptothecin, approximately 30% of the LC cells died. However, when LC cells were treated with both camptothecin and TNF-α, a synergistic increase in apoptosis was observed, which killed 45% of LC cells within 48 hours. These results indicate that when LC cells are treated with camptothecin to cause apoptosis, they can respond to the cytotoxic effect of TNF-α.

  eIF-5A is a nucleocytoplasmic shuttle protein that is known to be necessary for cell division, and has recently been suggested to be involved in apoptosis. When camptothecin or camptothecin + TNF-α is used, the expression of apoptosis-specific eIF-5A is induced in LC cells, leading to apoptosis. Apoptosis-specific eIF-5A expression was not significantly altered by treatment with camptothecin except for a slight decrease (FIG. 84A). However, significant up-regulation of apoptosis-specific eIF-5A protein was observed at 8 and 24 hours after treatment with camptothecin + TNF-α (FIG. 84B). These results indicate that apoptosis-specific eIF-5A expression is induced only by exposure to TNF-α and that expression correlates with the induction of apoptosis. This implies that apoptosis-specific eIF-5A plays a role in the apoptotic pathway downstream of the TNF-α receptor binding.

  To examine the importance of apoptosis-specific eIF-5A during the induction of apoptosis in LC cells using TNF-α, four siRNAs targeting siRNA # 1- # 4 targeting apoptosis-specific eIF-5A ) Was designed and synthesized by in vitro transcription. In order to clarify that siRNA is effective in suppressing the expression of apoptosis-specific eIF-5A, each siRNA was transfected into LC cell lines # 506 and # 517, and the apoptosis-specific eIF-5A protein in the cell lysate was transfected. Expression was examined after 72 hours (Figure 85). For comparison, cells were also transfected with siRNA against GAPDH and / or a control siRNA (siRNA # 5) that has the same chemical composition as siRNA # 1, but does not recognize apoptosis-specific eIF-5A. Any siRNA against apoptosis-specific eIF-5A was able to suppress the expression of apoptosis-specific eIF-5A in both LC cell lines (Figure 85). SiRNA against GAPDH was used as another control. This is because the siRNA is an active siRNA that can suppress the expression of the target protein GAPDH, unlike the control siRNA # 5, which has the reverse sequence of siRNA # 1 and does not have a cellular target (data not shown) . All four siRNAs against apoptosis-specific eIF-5A could also protect transfected LC cells (# 506) from apoptosis induced by treatment with TNF-α and camptothecin for 24 hours (Figure 86). Using Hoechst staining to detect cell death, siRNA (siRNA # 1 to # 4) can induce apoptosis of LC cells, 59% (siRNA # 1), 35% (siRNA # 2), 50% (siRNA # 3), 69% (siRNA # 4) decreased. Interestingly, siRNA against GAPDH also reduced LC cell apoptosis by 42% (FIG. 86). GAPDH has cell functions other than its role as a glycolytic enzyme, for example, the functions proposed during apoptosis of brain neurons (Ishitani and Chuang, 1996; Ishitani et al., 1996a; Ishitani et al., 1996 b). In a similar experiment, we also showed that siRNA # 1 could reduce LC cell line # 517 apoptosis by 53% in response to TNF-α and camptothecin (FIG. 87). This indicates that apoptosis-specific eIF-5A siRNA protects LC cells isolated from various optic nerve heads. These results indicate that apoptosis-specific eIF-5A is indeed functional during apoptosis and may play an important mediator in the pathway leading to apoptosis induced by TNF-α in LC cells It is shown that.

  DNA fragments using terminal deoxynucleotidyl transferase dUTP-digoxigenin nick end labeling (TUNEL) to confirm that LC cells exposed to TNF-α and camptothecin are dead in classical apoptosis Chemicalization was evaluated on the spot. Three hours after transfection with apoptosis-specific eIF-5A siRNA (siRNA # 1) or control siRNA (siRNA # 5), LC cells (# 506) were treated with TNF-α and camptothecin for 24 hours. Cells were also stained with Hoechst to make the nuclei easier to see. 46% of the LC cells transfected with the control siRNA were positive for TUNEL staining, whereas only 8% of the LC cells transfected with apoptosis-specific eIF-5A siRNA # 1 were positive. (Figure 88). This indicates that protection from apoptosis by apoptosis-specific eIF-5A siRNA exceeds 80%. Similar results were obtained with apoptosis-specific eIF-5A siRNA # 4, which increased protection from apoptosis by more than 60% compared to control siRNA (data not shown).

Example 18
Blood collection and PBMC preparation Approximately 10 ml of blood was collected from each healthy donor. The blood was collected by venipuncture and placed in a vacuum container containing sodium citrate as an anticoagulant. Samples were processed within 24 hours of collection.

  60% SIP (9 parts v / v percoll and 1 part v / v 1.5M NaCl) was placed as a cushion on the bottom of a 15 ml conical tube. The blood was then layered over it so that the blood and percoll were mixed as little as possible. Samples were centrifuged at 1000 xg for a total of 30 minutes. It slowly accelerated for the first 5 minutes and slowed slowly for the last 5 minutes. Pure serum located at the top of the resulting gradient was removed and a white cushion of PBMC (1-2 ml) was collected and added dropwise to a test tube containing 10 ml of warm RPMI + 15% FBS. PBMC were pelleted and counted.

A time schedule that provides stimuli to induce cytokine production in PBMC
PBMCs were isolated and seeded at 2 × 10 ^{5 to} 5 × 10 ⁵ cells per well. Cells were treated with phorbol 12-myristate 13-acetate (PMA; 100 ng per well). The medium was changed after 72 hours. The medium did not contain any stimulating factor. This time 96 hours later, PMA was added to PBMC followed by addition of lipopolysaccharide (LPS; 100 ng per well; from E. coli serotype 0111) to the wells. Samples were collected before LPS was added (96 hours) and at various times after the addition, as shown in FIG. Both adherent cells (like monocytes and macrophages) and suspension cells (like lymphocytes) were collected. To collect samples and analyze cytokine secretion, the media from each well was transferred to a clean microcentrifuge tube and centrifuged at 13,000 xg for 3 minutes to remove any debris. The resulting pellet was collected with adherent cells. The medium was stored at −20 ° C. and divided into 200-250 μl aliquots prior to analysis. Cells were washed with 1 ml of 37 ° C phosphate buffered saline (PBS) and then boiled lysis buffer (50 mM Tris pH 7.2, 2% SDS; 100 μl per well) Dissolved in. Cell lysates were boiled, frozen and stored at -20 ° C. The Western blot is shown in FIG. 92 and the corresponding ELISA results are shown in FIG.

Induction of apoptosis-specific eIF-5A expression by stimulating PBMC
PBMCs were isolated and seeded at 2 × 10 ^{5 to} 5 × 10 ⁵ cells per well. In order to clarify which stimulating factor induces apoptosis-specific eIF-5A, and to know whether the stimulating factors synergize with each other, PBMC is treated with phytohemagglutinin (PHA; 100 ng / ml), phorbol 12-milli Stimulated with either state 13-acetate (PMA; 100 ng per well), lipopolysaccharide (LPS; 100 ng / ml), or all three (100 ng / ml each). Samples were collected 12 and 36 hours after stimulation and analyzed for the expression of apoptosis-specific eIF-5A (FIG. 94).

Transfection into PBMC
PBMCs were transfected on the day PBMCs were prepared. Cells were seeded at 2 × 10 ^{5 to} 5 × 10 ⁵ cells per well (150 μl per well in a 24-well plate). Cells were transfected individually into each well (donors 77, 78, 79; FIGS. 95 and 96) or all were placed in a conical tube at once before being seeded (donors 80, 84; FIG. 96). For each well containing cells to be transfected, 15 pmoles of siRNA was diluted with 50 μl of Opti-Mem (Sigma). 1 μl of Lipofectamine 2000 (Invitrogen) was diluted with 49 μl of Opti-Mem (Sigma), incubated for 7-10 minutes, added to the diluted siRNA and incubated for 25 minutes. Transfection medium was placed on the cells and the cells were incubated for 4 hours in a growth chamber at 37 ° C. The final transfection medium contained 9% serum. Following incubation, 250 μl of serum free RPMI + 21% FBS was added to the cells to a final serum concentration of 15%.

Stimulation to induce cytokine production in transfected PBMC 72 hours after transfection of PBMC as outlined above, lipopolysaccharide (LPS; 100 ng per well; E. coli serum (From type 0111) was added to the cells in 500 μl of medium. Samples were collected at 24 hours after stimulation. Both LPS-treated wells and wells that received only transfection (ie, no stimulation) were collected. To collect samples and analyze cytokine secretion, the media from each well was transferred to a clean microcentrifuge tube and centrifuged at 13,000 xg for 3 minutes to remove any debris. The resulting pellet was collected with adherent cells. The medium was stored at −20 ° C. and divided into 200-250 μl aliquots prior to analysis. Cells were washed with 1 ml of 37 ° C phosphate buffered saline (PBS) and then boiled lysis buffer (50 mM Tris pH 7.2, 2% SDS; 100 μl per well) Dissolved in. Cell lysates were boiled, frozen and stored at -20 ° C for protein quantification with BCA.

Example 19
Cell culture
HT-29 cells (human rectal colorectal adenocarcinoma cell line) were maintained in RPMI with 10% fetal bovine serum (FBS). U937 (histiocytic lymphoma cell line) was grown in suspension in RPMI with 10% FBS. Both cell lines were maintained at 37 ° C. in a humid environment with 5% CO ₂ . In order to conduct experiments with U937 cells, the cells were counted and the cells were adjusted to 3 × 10 ⁵ cells per ml 2 days before the start of the experiment. On the first day of the experiment, cells are harvested by centrifugation at 400 xg for 10 minutes, and the resulting cell pellet is resuspended in fresh RPMI medium containing 10% FBS and centrifuged. Once again, the re-pelleted cells were resuspended in fresh RPMI medium without FBS. Cells were counted and adjusted to 2 × 10 ⁶ per ml.

siRNA
An siRNA sequence was designed based on the human apoptosis-specific eIF-5A sequence, and the siRNA sequence was synthesized by the Dharmacon RNA method. The apoptosis-specific eIF-5A siRNA (h5A1) target sequence was 5′NNGCUGGACUCCUCCUACACA3 ′. The corresponding double-stranded siRNA sequence is
5'GCUGGACUCCUCCUACACAdTdT3 '
3'dTdTCGACCUGAGGAGGAUGUGU5 '.
The control siRNA (h control) sequence was 5'NNACACAUCCUCCUCAGGUCG3 '. The corresponding double-stranded siRNA sequence is
5'ACACAUCCUCCUCAGGUCGdTdT3 '
It was 3'dTdTUGUGUAGGAGGAGUCCAGC5 '.

Transfection into HT-29 cells The day before transfection, HT-29 cells were seeded in 24-well plates at 105,000 cells per well. For each well containing cells to be transfected, 25.5 pmoles of siRNA was diluted with 50 μl of Opti-Mem (Sigma). 1 μl of Lipofectamine 2000 (Invitrogen) was diluted with 49 μl of Opti-Mem (Sigma), incubated for 7-10 minutes, added to the diluted siRNA and incubated for 25 minutes. After the transfected cells were washed once with serum-free RPMI, 300 μl of serum-free RPMI was added, and 100 μl of transfection medium was placed thereon. Cells were returned to the growth chamber and incubated for 4 hours. After incubation, 300 μl of serum-free RPMI + 30% FBS was added to the cells.

Electroporation apoptosis-specific eIF-5A of U937 cells and control siRNA were diluted with Opti-Mem medium (Sigma). 400 μl of cells (800,000 cells) and 100 pmoles of siRNA were mixed in a 0.4 mm electroporation cuvette. Cells were electroporated at 300 V, 10 ms, 1 pulse using an ECM 830 electrosquare perforator (BTX, San Diego, Calif.). After electroporation, the cells were gently mixed and added to wells containing RPMI and concentrated FBS to a final FBS concentration of 10%.

Treatment of HT-29 cells TNF-α production was induced in HT-29 cells according to the method developed by Suzuki et al. (2003). 48 hours after transfection, HT-29 cells were stimulated with 200 units / ml of interferon γ (Roche Diagnostics). 16 hours after stimulation with interferon γ (IFN-γ), cells were washed with medium, and lipopolysaccharide (LPS; 100 ng / ml; from E. coli serotype 0111) was added at a rate of 100 μg / ml. . After 8 or 24 hours of stimulation with LPS, the media from each well was transferred to a microcentrifuge tube and stored at −20 ° C. for TNF-α examination by ELISA. Cells are washed with 1 ml phosphate buffered saline (PBS) heated to 37 ° C and then lysed in boiling lysis buffer (50 mM Tris (pH 7), 2% SDS). It was. Cell lysates were boiled and stored frozen at -20 ° C. Protein concentration in the cell lysate was determined by bicinchoninic acid assay (BCA) using bovine serum albumin as a reference.

  IL-8 production in HT-29 cells was induced by treatment with IFN-γ. After transfection, HT-29 cells were treated with 200 units / ml IFN-γ for 48 hours. After 24 hours of treatment, the medium from each well was transferred to a microcentrifuge tube and stored at −20 ° C. until IL-8 was examined by liquid phase electrochemiluminescence (ECL) method. Cells are washed with 1 ml phosphate buffered saline (PBS) heated to 37 ° C and then lysed in boiling lysis buffer (50 mM Tris (pH 7), 2% SDS). It was. Cell lysates were boiled and stored frozen at -20 ° C. Protein concentration in the cell lysate was determined by bicinchoninic acid assay (BCA) using bovine serum albumin as a reference.

Differentiation induction in U937 cells
U937 cells were harvested and counted 16 hours after electroporation. 200,000 cells per ml of medium were added to each well of a 24-well plate. Macrophage differentiation was promoted by the addition of phorbol 12-myristate 13-acetate (PMA; 100 ng / ml). Forty-eight hours after the addition of PMA, more than 80% of monocytes changed from suspended cells (monocytes) to adherent cells (macrophages). At 48 hours, medium and non-adherent cells were removed and fresh RPMI medium (1 ml per well) containing 10% FBS was added. Cells became inactive when left in fresh medium for 24 hours.

Stimulation to induce cytokine production in U937 cells
72 hours after adding PMA to U937 cells, lipopolysaccharide (LPS; 100 ng / ml; from E. coli serotype 0111), or interferon gamma (IFN-γ; 100 units / ml), or LPS and IFN The -γ combination was added to the wells. Sample collection was performed before the addition of the stimulating factor (72 hours) and at various times after the addition, as shown in FIG. To collect samples and analyze cytokine secretion, the media from each well was transferred to a clean microcentrifuge tube and centrifuged at 13,000 xg for 3 minutes to remove any debris. The medium was stored at −20 ° C. and divided into 200-250 μl aliquots prior to analysis. Cells were washed with 1 ml of 37 ° C phosphate buffered saline (PBS) and then boiled lysis buffer (50 mM Tris pH 7.2, 2% SDS; 75 μl per well) Dissolved in. Similar wells were pooled. Cell lysates were boiled, frozen and stored at -20 ° C.

Cytokine quantification All media samples were stored at -20 ° C. TNFα was quantified using Assay Design's ELISA kit according to the manufacturer's instructions. At that time, 0 to 250 pg of TNF-α was supplied per ml as a reference. To perform the experiment on U937, media samples for TNFα were diluted 20-fold (0 hours, 3 hours LPS) or 80-fold (6 hours, 24 hours, 30 hours LPS) with RPMI + 10% FBS. IL-1β, IL-8, and IL-6 were quantified by liquid phase electrochemiluminescence (ECL). Medium from experiments with HT-29 was not diluted. All cytokine measurement results were corrected for the amount of total cellular protein per well.

  IL-8, IL-1β, and IL-6 were examined in the liquid phase. Briefly, purified monoclonal mouse anti-human IL-8, IL-6, IL-1β antibodies (R & D Systems) were labeled with biotin (Eigen, Gaithersburg, MD). Furthermore, ruthenium (Eigen) was labeled on goat anti-human IL-8, IL-6, IL-1β antibodies (R & D Systems) according to the manufacturer's instructions. This biotinylated antibody is diluted to a final concentration of 1 mg / ml in PBS (pH 7.4) (ECL buffer) containing 0.25% BSA, 0.5% Tween 20, and 0.01% azide. I made it. For each assay tube, 25 ml of biotinylated antibody is vigorously shaken with 25 ml of a solution containing 1 mg / ml of paramagnetic beads coated with streptavidin (Dynal, Lake Success, NY). And preincubation for 30 minutes at room temperature. After adding test sample (25 ml) diluted in RPMI or standard in advance to tube, add 25 ml ruthenylated antibody (diluted with ECL buffer to a final concentration of 1 mg / ml) Added. The tube was then shaken for an additional 2 hours. The reaction was stopped by adding 200 ml of PBS per tube, and the amount of chemiluminescence was measured using an aurigen analyzer (Eigen).

Using SDS-PAGE and Western blotting bovine serum albumin as a reference, the concentration of protein in the cell lysate was measured by the bicinchoninic acid assay (BCA). 5 μg of total cellular protein was separated by 10% or 14% SDS-PAGE (sodium dodecyl sulfate / polyacrylamide gel electrophoresis). A 10% gel was used to analyze proteins over 50 kDa (TLR4, IFN-γ, TNF-R1, iNOS), whereas a 14% gel was used to analyze apoptosis-specific eIF-5A (17 kDa) . Use a semi-dry transfer unit (Bio-Rad) and transfer the gel to polyvinylidene fluoride using transfer buffer (48 mM Tris, 39 mM glycine, 1.3 mM SDS, pH 9.2; 15 V for 18 minutes). Transferred to (PVDF) membrane. The membrane was blocked for 1 hour with PBS-t containing 5% skim milk (PBS containing 0.1% Tween 20). The primary antibody was diluted with this blocking solution and all blots were incubated at room temperature with shaking. Primary antibodies used were apoptosis-specific eIF-5A (BD Biosciences; 1: 20,000; 1 hour incubation; recognizes both apoptosis-specific eIF-5A and eIF-5A2), TLR4 (Santa Cruz Bio Technology; TLR4 (H-80): sc-10741; 1: 1000; 2 hours incubation), IFN-γRα (Santa Cruz Biotechnology; IFN-γRα (C-20): sc-700; 1: 1000; 1 hour incubation), TNF-R1 (Santa Cruz Biotechnology; TNF-R1 (H-5): sc-8436; 1: 200; 3 hours incubation), iNOS (BD Transduction Laboratories: 610431; 1: 10,000; incubated for 1 hour), β-actin (Oncogene; Actin (Ab-1); 1: 20,000; incubated for 1 hour). After incubation with the primary antibody, the blot was washed 3 times with PBS-t for 5-10 minutes. Secondary antibody conjugated with horseradish peroxidase (HRP) was diluted with 1% skim milk and incubated with the membrane for 1 hour. Secondary antibodies used were anti-mouse IgG-HRP (Sigma; 1: 5000; for apoptosis-specific eIF-5A and TNF-R1), anti-rabbit IgG-HRP (Amersham Pharmacia Biotech; 1: 2500) For TLR4 and IFN-γRα) and anti-mouse IgM-HRP (Calbiochem; 1: 5000; for actin). After incubation with the secondary antibody, the blot was washed 4 times with PBS-t for 5-10 minutes. Blots were developed using an enhanced chemiluminescence detection reagent (ECL; Amersham Pharmacia Biotech) according to the manufacturer's instructions and the bands visualized on X-ray film (Fuji Film).

RT-PCR
To observe the transfected HT-29 cells changing the expression of TLR4 mRNA in response to IFN-γ, RT-PCR was performed according to Medvedev et al. (2002). To confirm that the same amount of cDNA was used in all samples, GAPDH expression was used as a control. While increasing the number of PCR cycles (20, 25, 30, 35 cycles), the optimal number of cycles at which amplification products could be detected under non-saturating conditions was determined. PCR products were detected by incorporation of ethidium bromide and separated by agarose gel electrophoresis. TLR4 and GAPDH transcripts can be obtained using RT-PCR of total mRNA isolated after treatment of siRNA-transfected HT-29 cells with IFN-γ for 6 hours or without IFN-γ. Was detected. HT-29 cells were transfected with siRNA as previously described. 48 hours after transfection, cells were treated with 200 units of IFN-γ per ml. Control cells not treated with IFN-γ only changed the medium. Total mRNA was isolated for adherent cells using the GenElute mammalian RNA miniprep kit (Sigma) according to the manufacturer's protocol. The medium was removed and the cells were washed twice with warm PBS. Lysis buffer was added to the cells, the lysate was transferred to a microcentrifuge tube, and total RNA was isolated according to the manufacturer's protocol.

The primers for TLR4 (NM_003266) were:
Forward primer 5'CGGATGGCAACATTTAGAATTAGT3 '
Reverse primer 5'TGATTGAGACTGTAATCAAGAACC3 '
Expected fragment size: 674 bp.

Primers for GAPDH (BC023632) were:
Forward primer 5'CTGATGCCCCCATGTTCGTCAT3 '
Reverse primer 5'CCACCACCCTGTTGCTGTAG3 '
Expected fragment size: 599 bp.

Total RNA was reverse transcribed under the following conditions:
blend:
RNA 2.5μg
Poly (T) primer 6.25μl
Depc water until 13.75μl
Heat to 70 ° C for 5 minutes
Cool on ice for 5 minutes Additives:
5 × AMV buffer 5.0 μl
dNTP (10 mM) 2.5 μl
RNase inhibitor 1.25 μl
AMV RT 2.5μl
Heat to 42 ° C for 60 minutes
Heat to 70 ° C for 10 minutes.

Only one PCR reaction was performed under the following conditions:
10 x Tsg buffer 2.0 μl
dNTP (10 mM) 0.4 μl
Forward primer (25 pmol / μl) 0.4 μl
Reverse primer (25 pmol / μl) 0.4 μl
MgCl ₂ (15 mM) 2.0 μl
CDNA 0.8μl
H ₂ O 13.88μl
Tsg polymerase 0.12 μl.

PCR conditions for TLR4 were as follows:
Heat to 95 ° C for 5 minutes
95 ° C for 1 minute, 55 ° C for 1 minute, 72 ° C for 2 minutes for 20 cycles, 25 cycles, or 30 cycles, or 35 cycles
Elongation at 72 ° C for 10 minutes
Reduce to 4 ° C.

GAPDH PCR conditions were as follows:
Heat to 95 ° C for 5 minutes
95 ° C for 1 minute, 57 ° C for 1 minute, 72 ° C for 2 minutes for 20 cycles, 25 cycles, or 30 cycles, or 35 cycles
Elongation at 72 ° C for 10 minutes
Reduce to 4 ° C.

FIG. 1 shows the nucleotide sequence (SEQ ID NO: 11) at the 3 ′ end of rat apoptosis-specific eIF-5A and the amino acid sequence (SEQ ID NO: 12) based on that sequence. FIG. 2 shows the nucleotide sequence (SEQ ID NO: 15) at the 5 ′ end of rat apoptosis-specific eIF-5A cDNA and the amino acid sequence (SEQ ID NO: 16) based on that sequence. FIG. 3 is the nucleotide sequence (SEQ ID NO: 1) of the full-length cDNA of rat luteum apoptosis-specific eIF-5A. The amino acid sequence is shown in SEQ ID NO: 2. FIG. 4 shows the nucleotide sequence (SEQ ID NO: 6) at the 3 ′ end of rat apoptosis-specific DHS cDNA and the amino acid sequence (SEQ ID NO: 7) based on that sequence. FIG. 5 shows the full-length nucleotide sequence (SEQ ID NO: 20) of rat luteum apoptosis-specific eIF-5A cDNA and the nucleotide sequence of human eIF-5A (SEQ ID NO: 3) (registration number BC000751 or NM_001970, SEQ ID NO: 3). Alignment. Figure 6 shows the alignment of the full-length nucleotide sequence (SEQ ID NO: 20) of rat luteal apoptosis-specific eIF-5A cDNA with the nucleotide sequence of human eIF-5A (SEQ ID NO: 4) (registration number NM_020390, SEQ ID NO: 4). is there. FIG. 7 is an alignment of the full-length nucleotide sequence (SEQ ID NO: 20) of rat luteum apoptosis-specific eIF-5A cDNA with the nucleotide sequence of mouse eIF-5A (registration number BC003889). The mouse nucleotide sequence (BC003889) is SEQ ID NO: 5. FIG. 8 shows the derived full-length amino acid sequence (SEQ ID NO: 2) of rat luteal apoptosis-specific eIF-5A and the derived amino acid sequence of human eIF-5A (SEQ ID NO: 21) (registration number BC000751 or NM_001970). Is an alignment. Figure 9 shows the alignment of the derived full-length amino acid sequence (SEQ ID NO: 2) of rat luteum apoptosis-specific eIF-5A and the derived amino acid sequence of human eIF-5A (SEQ ID NO: 22) (registration number NM_020390). It is. FIG. 10 shows the alignment of the derived full-length amino acid sequence (SEQ ID NO: 2) of rat luteal apoptosis-specific eIF-5A and the derived amino acid sequence of mouse eIF-5A (SEQ ID NO: 23) (registration number BC003899). It is. FIG. 11 shows the partial length nucleotide sequence (residues 1 to 453 of SEQ ID NO: 6) of rat luteum apoptosis-specific DHS cDNA and the nucleotide sequence of human DHS (SEQ ID NO: 8) (registration number BC000333, SEQ ID NO: 8). Is an alignment. FIG. 12 is a restriction map of the rat luteal apoptosis-specific eIF-5A cDNA. FIG. 13 is a restriction map of partial length cDNA of rat apoptosis-specific DHS. Fig. 14 shows a Northern blot of total RNA (top) and a gel stained with ethidium bromide, probed with the 3 'end of rat luteal apoptosis-specific eIF-5A cDNA labeled with ³² P-dCTP. (Bottom). Figure 15 shows a Northern blot of total RNA (top) and a gel stained with ethidium bromide (bottom), using the 3 'end of rat luteal apoptosis-specific DHS cDNA labeled with ³² P-dCTP as a probe. ). FIG. 16 is a diagram of a DNA laddering experiment in which the degree of apoptosis was investigated in rat superovulatory yolk after injection of PGF-2α. FIG. 17 is an agarose gel of genomic DNA isolated from apoptotic rat corpus luteum, showing DNA laddering after treatment of rats with PGF-2α. FIG. 18 is a diagram of a DNA laddering experiment in which the degree of apoptosis in cells in which the rat superovulatory luteal body was dispersed was examined in rats exposed to PGF-2α after treatment with spermidine. FIG. 19 is a diagram of a DNA laddering experiment in which the degree of apoptosis in the rat superovulatory yolk was examined in rats treated with spermidine and / or PGF-2α. FIG. 20 is a Southern blot of rat genomic DNA examined using ³² P-dCTP-labeled rat luteal apoptosis specific eIF-5A partial length cDNA as a probe. FIG. 21 is a mammalian epitope tag expression vector pHM6 (Roche Molecular Biochemicals). Figure 22 shows the total RNA isolated from COS-7 cells after induction of apoptosis by removal of serum, and labeled with ³² P-dCTP at the 3 'untranslated end of rat luteal apoptosis-specific DHS cDNA. Northern blot (upper) and gel stained with ethidium bromide (lower). FIG. 23 is a flow chart showing the procedure for transient transfection of COS-7 cells. FIG. 24 is a Western blot of transient expression of foreign protein in COS-7 cells after transfection with pHM6. Figure 25 shows that increased apoptosis is reflected in increased caspase activity when transient transfection of rat OSM with pHM6 containing full-length apoptosis-specific eIF-5A in the sense orientation was performed on COS-7 cells. Which indicates that. FIG. 26 shows that increased apoptosis is reflected in increased DNA fragmentation when transient transfection of rat pHM6 with full-length apoptosis-specific eIF-5A in the sense orientation was performed on COS-7 cells. It is shown that. Figure 27 shows that apoptosis is detected by increased nuclear fragmentation when transient transfection of pHM6 with rat full-length apoptosis-specific eIF-5A in sense orientation is performed on COS-7 cells It is shown that. FIG. 28 shows that increased apoptosis is reflected in increased nuclear fragmentation when transient transfection of pHM6 with rat full-length apoptosis-specific eIF-5A in sense orientation was performed on COS-7 cells It is shown that. Figure 29 shows that apoptosis is detected by exposure of phosphatidylserine when transient transfection of pHM6 with sense-directed full-length apoptosis-specific eIF-5A in rats is performed on COS-7 cells. Show. Figure 30 shows that increased apoptosis is reflected in increased phosphatidylserine exposure when transient transfection of pHM6 with rat full-length apoptosis-specific eIF-5A in the sense orientation was performed on COS-7 cells. It is shown that. Figure 31 shows that increased apoptosis is reflected in increased nuclear fragmentation when transient transfection of rat pHM6 with sense-directed full-length apoptosis-specific eIF-5A in rats was performed on COS-7 cells It is shown that. FIG. 32 shows that apoptosis is increased when COS-7 cells are transiently transfected with pHM6 containing rat full-length apoptosis-specific eIF-5A in the sense orientation. Figure 33 shows that Bcl-2 is down-regulated when COS-7 cells are transiently transfected with pHM6 containing rat full-length apoptosis-specific eIF-5A in the sense orientation. ing. The upper photo is a blot of protein stained with Coomassie-Blue; the lower photo is the corresponding Western blot. Figure 34 shows COS-7 cells transiently transfected with pHM6 containing the full-length apoptosis-specific eIF-5A of the rat in the antisense orientation in Coomassie-blue when examined with Bcl-2 as a probe. Stained protein blot and corresponding Western blot. Fig. 35 shows COS-7 cells transiently transfected with pHM6 containing rat full-length apoptosis-specific eIF-5A in the sense orientation stained with Coomassie-Blue when c-Myc was probed. Protein blot and the corresponding Western blot. Figure 36 shows a protein stained with Coomassie-Blue when COS-7 cells transiently transfected with pHM6 containing rat full-length apoptosis-specific eIF-5A in the sense orientation were examined using p53 as a probe. And the corresponding Western blot. FIG. 37A corresponds to a protein blot stained with Coomassie-Blue when the expression of pHM6 full-length rat apoptosis-specific eIF-5A in COS-7 cells was examined using an anti- [HA] peroxidase probe. Western blot. Protein blots stained with Coomassie-blue when expression of pHM6 full-length rat apoptosis-specific eIF-5A in COS-7 cells using the p53 probe and corresponding Western blots. FIG. 37B corresponds to a blot of protein stained with Coomassie-blue when the expression of pHM6 full-length rat apoptosis-specific eIF-5A in COS-7 cells was examined using an anti- [HA] peroxidase probe. Western blot. Protein blots stained with Coomassie-blue when expression of pHM6 full-length rat apoptosis-specific eIF-5A in COS-7 cells using the p53 probe and corresponding Western blots. FIG. 37C corresponds to a blot of protein stained with Coomassie-blue when the expression of pHM6 full-length rat apoptosis-specific eIF-5A in COS-7 cells was examined using an anti- [HA] peroxidase probe. Western blot. Protein blots stained with Coomassie-blue when expression of pHM6 full-length rat apoptosis-specific eIF-5A in COS-7 cells using the p53 probe and corresponding Western blots. FIG. 38 is an alignment of human eIF-5A2 (SEQ ID NO: 24) and human eIF-5A2 (SEQ ID NO: 22) (GenBank accession number XM — 113401) isolated from RKO cells. The consensus sequence is shown in SEQ ID NO: 28. FIG. 39 is a graph showing the percentage of apoptosis that occurred in RKO and RKO-E6 cells after transient transfection. RKO and RKO-E6 cells were transiently transfected with pHM6-LacZ or pHM6-apoptosis specific eIF-5A. RKO cells transfected with pHM6-apoptosis-specific eIF-5A and then treated with actinomycin D increased apoptosis by 240% compared to cells transfected with pHM6-LacZ but not treated with actinomycin D . RKO-E6 cells transfected with pHM6-apoptosis-specific eIF-5A and then treated with actinomycin D had 105% apoptosis compared to cells transfected with pHM6-LacZ but not treated with actinomycin D Increased. FIG. 40 is a graph showing the percentage of apoptosis that occurred in RKO cells after transient transfection. RKO cells were transfected with one of pHM6-LacZ, pHM6-apoptosis-specific eIF-5A, pHM6-eIF-5A2, and pHM6-apoptosis-specific eIF-5A. RKO cells transfected with pHM6-apoptosis-specific eIF-5A had a 25% increase in apoptosis compared to control cells transfected with pHM6-LacZ. This increase was not evident in cells transfected with apoptosis-specific eIF-5A with truncated pHM6-eIF-5A2 or pHM6. FIG. 41 is a graph showing the percentage of apoptosis that occurred in RKO cells after transient transfection. RKO cells were not transfected or were transiently transfected with pHM6-LacZ or pHM6-apoptosis specific eIF-5A. When corrected for transfection efficiency, 60% of cells transfected with pHM6-apoptosis-specific eIF-5A were apoptotic. FIG. 42A shows the results of analysis of apoptosis of RKO cells after transient transfection by flow cytometry. RKO cells are either non-transfected or transiently transfected with either pHM6-LacZ, pHM6-apoptosis-specific eIF-5A, pHM6-eIF-5A2, or pHM6-apoptosis-specific eIF-5A Was done. The table shows the percentage of cells that have undergone apoptosis. This ratio was calculated based on the area under the peak of each gate. When correction for apoptosis in background untransfected cells was made, 80% of cells transfected with pHM6-apoptosis specific eIF-5A were apoptotic. Cells transfected with either pHM6-LacZ, pHM6-eIF-5A2 or pHM6 truncated apoptosis-specific eIF-5A showed only background levels of apoptosis. FIG. 42B shows the result of flow cytometry analysis of apoptosis of RKO cells after transient transfection. RKO cells are either non-transfected or transiently transfected with either pHM6-LacZ, pHM6-apoptosis-specific eIF-5A, pHM6-eIF-5A2, or pHM6-apoptosis-specific eIF-5A Was done. The table shows the percentage of cells that have undergone apoptosis. This ratio was calculated based on the area under the peak of each gate. When correction for apoptosis in background untransfected cells was made, 80% of cells transfected with pHM6-apoptosis specific eIF-5A were apoptotic. Cells transfected with either pHM6-LacZ, pHM6-eIF-5A2 or pHM6 truncated apoptosis-specific eIF-5A showed only background levels of apoptosis. FIG. 43 is a Western blot of proteins extracted from RKO cells treated with 0.25 μg / ml actinomycin D for 0, 3, 7, 24, and 48 hours. The upper figure is a Western blot using anti-p53 as the primary antibody. The middle figure is a Western blot using anti-apoptosis specific eIF-5A as the primary antibody. The figure below confirms that the same amount was loaded by detecting chemiluminescence after staining the membrane used for the anti-apoptosis specific eIF-5A blot with Coomassie Blue. p53 and apoptosis-specific eIF-5A are both upregulated by treatment with actinomycin. FIG. 44 is a bar graph showing that both apoptosis-specific eIF-5A and proliferating eIF-5A are expressed in heart tissue. Heart tissue was taken from a patient who received a coronary artery bypass graft (“CABG”). The gene expression level of pHM6-apoptosis-specific eIF-5A (light gray bar) is compared to proliferating eIF-5A (dark gray bar). The X axis is the patient identification number. The Y-axis is the number of pg for 1 ng of 18s (number of picograms of messenger RNA / number of nanograms of ribosomal RNA 18S). FIG. 45 is a bar graph showing that both apoptosis-specific eIF-5A and proliferating eIF-5A are expressed in heart tissue. Heart tissue was collected from a patient whose valve was replaced. The gene expression level of apoptosis-specific eIF-5A (light gray bar) is compared with proliferating eIF-5A (dark gray bar). The X axis is the patient identification number. The Y-axis is the number of pg for 1 ng of 18s (number of picograms of messenger RNA / number of nanograms of ribosomal RNA 18S). FIG. 46 is a bar graph showing the results of measuring the gene expression levels of apoptosis-specific eIF-5A (eIF5a) and proliferated eIF-5A (eIF5b) in pre-ischemic heart tissue and post-ischemic heart tissue by real-time PCR. is there. The Y-axis is the number of pg for 1 ng of 18s (number of picograms of messenger RNA / number of nanograms of ribosomal RNA 18S). FIG. 47 is a schematic diagram of an experiment performed on heart tissue. Heart tissue was exposed to normal oxygen levels and the expression levels of apoptosis-specific eIF-5A and proliferating eIF-5A were measured. Thereafter, hypoxemia and ischemia were induced by reducing the amount of oxygen supplied to the heart tissue, and finally myocardial infarction was caused in the heart tissue. The expression levels of apoptosis-specific eIF-5A and proliferative eIF-5A were measured and compared with the expression levels of heart tissue before being damaged by ischemia. FIG. 48 is an electrocardiogram (EKG) of heart tissue before and after inducing ischemia. FIG. 49 shows the state of the laboratory equipped with the experimental apparatus shown in FIG. FIG. 50A is a table describing patient data showing that levels of apoptosis-specific eIF-5A correlate with levels of IL-1β and IL-18. FIG. 50A is data collected from a patient who received a coronary artery bypass graft (CABG). FIG. 50B is a table that describes patient data showing that levels of apoptosis-specific eIF-5A correlate with levels of IL-1β and IL-18. FIG. 50B is a table describing data collected from patients with valve replacement. FIG. 50C is a graph showing that apoptosis-specific eIF-5A correlates with IL-18 in patients undergoing CABG. FIG. 50D is a graph showing that proliferative eIF-5A correlates with IL-18 in patients undergoing CABG. FIG. 50E is a graph showing that apoptosis-specific eIF-5A correlates with IL-18 in patients with valve replacement. FIG. 50F is a graph showing that proliferative eIF-5A correlates with IL-18 in patients with valve replacement. FIG. 51 is a table describing patient data, and the patient data used in FIGS. 50B to 50E were obtained from this table. FIG. 51A is a table listing patient data. FIG. 51B is a table listing patient data. FIG. 51C is a table listing patient data. FIG. 51D is a table listing patient data. FIG. 52 shows the level of protein produced by RKO cells after treatment with antisense oligonucleotides 1, 2, and 3 (SEQ ID NOs: 35, 36, and 37, respectively) (of apoptosis-specific eIF-5A). In RKO cells, apoptosis-specific eIF-5A and p53 production decreased after transfection with an apoptosis-specific eIF-5A antisense oligonucleotide. FIG. 53 shows the uptake state of fluorescently labeled antisense oligonucleotides. Figure 54 shows that the percentage of cells that had undergone apoptosis-specific eIF-5A antisense oligonucleotides compared to cells that had not been transfected with apoptosis-specific eIF-5A antisense oligonucleotides. Indicates that it is decreasing. Figure 55 shows that in the cells treated with apoptosis-specific eIF-5A antisense oligonucleotide, the percentage of cells that had undergone apoptosis compared to cells that were not transfected with apoptosis-specific eIF-5A antisense oligonucleotide. Indicates that it is decreasing. Figure 56 shows that in the cells treated with apoptosis-specific eIF-5A antisense oligonucleotide, the percentage of cells that had undergone apoptosis compared to cells that were not transfected with apoptosis-specific eIF-5A antisense oligonucleotide. Indicates that it is decreasing. Figure 57 shows that the percentage of cells that had undergone apoptosis-specific eIF-5A antisense oligonucleotides compared to cells that had not been transfected with apoptosis-specific eIF-5A antisense oligonucleotides. Indicates that it is decreasing. Figure 58 shows that the percentage of cells that had undergone apoptosis-specific eIF-5A antisense oligonucleotides compared to cells that had not been transfected with apoptosis-specific eIF-5A antisense oligonucleotides. Indicates that it is decreasing. FIG. 59 shows that treatment of sieve plate cells with TNF-α + camptothecin increased the number of cells undergoing apoptosis. Figure 60 shows that in cells treated with apoptosis-specific eIF-5A antisense oligonucleotide, the percentage of cells that had undergone apoptosis compared to cells that were not transfected with apoptosis-specific eIF-5A antisense oligonucleotide. Indicates that it is decreasing. Figure 61 shows that the percentage of cells that had undergone apoptosis-specific eIF-5A antisense oligonucleotides compared to cells that had not been transfected with apoptosis-specific eIF-5A antisense oligonucleotides. Indicates that it is decreasing. FIG. 62 is a photograph showing the state of uptake of labeled siRNA by sieving plate cells when serum is present and when there is no serum. FIG. 63 shows that cells transfected with apoptosis-specific eIF-5A siRNA have decreased production of apoptosis-specific eIF-5A protein and increased production of Bcl-2 protein. Decreased expression of apoptosis-specific eIF-5A correlates with increased expression of BCL-2. FIG. 64 shows that cells transfected with apoptosis-specific eIF-5A siRNA have reduced production of apoptosis factor 5a protein. Figure 65 shows that cells transfected with apoptosis-specific eIF-5A siRNA had a lower proportion of cells undergoing apoptosis after exposure to camptothecin and TNA-α compared to untransfected cells. Yes. Figure 66 shows that cells transfected with apoptosis-specific eIF-5A siRNA had a lower proportion of cells undergoing apoptosis after exposure to camptothecin and TNA-α compared to untransfected cells. Yes. Figure 67 shows that cells transfected with apoptosis-specific eIF-5A siRNA had a lower proportion of cells undergoing apoptosis after exposure to camptothecin and TNA-α compared to untransfected cells. Yes. FIG. 68 is a photograph of sieve plate cell line # 506 transfected with siRNA, treated with camptothecin and TNA-α, and then stained with Hoechst in the experiment shown in FIG. 67 and Example 13. Apoptotic cells appear to be brighter stained cells. The cells have smaller nuclei, smaller shapes and irregularities due to the condensation of chromatin. FIG. 69 shows that HepG2 cells transfected with apoptosis-specific eIF-5A and exposed to IL-1 secreted less TNA-α than cells that were not transfected. FIG. 70 shows the sequence of human apoptosis-specific eIF-5A (SEQ ID NO: 29) and the sequences of five siRNAs according to the present invention (SEQ ID NOs: 30, 31, 32, 33, 34). FIG. 71 shows the sequence of human apoptosis-specific eIF-5A (SEQ ID NO: 29) and the sequences of three antisense oligonucleotides according to the present invention (SEQ ID NOs: 35, 37, 39 in order from the top). FIG. 72 shows the binding positions of three antisense oligonucleotides (SEQ ID NOs: 25 to 27 in order from the top) targeting human apoptosis-specific eIF-5A. The full length nucleotide sequence is SEQ ID NO: 19. FIG. 73A shows a nucleotide alignment of human apoptosis-specific eIF-5A and human proliferative eIF-5A (SEQ ID NOs: 41 and 42 in order from the top). FIG. 73B is an alignment of the amino acid sequences of human apoptosis-specific eIF-5A and human proliferative eIF-5A (SEQ ID NOs: 43 and 22 in order from the top). FIG. 74A is a Western blot showing that siRNA against apoptosis-specific eIF-5A was reduced without blocking the production of TNA-α in HT-29 cells transfected with the siRNA. FIG. 74B shows the result of ELISA. FIG. 75 shows the result of ELISA. In cells treated with siRNA against apoptosis-specific eIF-5A, TNA-α production was reduced compared to control cells. FIG. 76 is a time schedule for the U-937 differentiation experiment. See Example 16. FIG. 77 shows the results of Western blot, which shows that apoptosis-specific eIF-5A is up-regulated while TNA-α is secreted after monocyte differentiation. FIG. 78 shows stem cell differentiation and inhibition of cytokine production using siRNA against apoptosis-specific eIF-5A. FIG. 79 is a bar graph showing that IL-8 is produced in response to TNA-α and interferon. This graph shows that siRNA against apoptosis-specific eIF-5A almost completely blocked the production of IL-8 in response to interferon, and that IL-8 produced significant amounts as a result of the combination of interferon and TNA. It has been shown. FIG. 80 is another bar graph showing that IL-8 is produced in response to TNA-α and interferon. This graph shows that siRNA against apoptosis-specific eIF-5A almost completely blocked the production of IL-8 in response to interferon, and that IL-8 produced significant amounts as a result of the combination of interferon and TNA. It has been shown. FIG. 81 is a Western blot of HT-29 cells treated with IFN-γ for 8 and 24 hours. This blot shows that apoptosis-specific eIF-5A was up-regulated in HT-29 cells in response to IFN-γ (4 times at 8 hours). Figure 82 characterization of sieve plate cells by immunofluorescence. Immunofluorescence revealed the characteristics of phloem cells (# 506) isolated from the optic nerve head of an 83-year-old man. The primary antibodies were a) actin; b) fibronectin; c) laminin; d) GFAP. All photos were taken at 400x magnification. FIG. 83 is a graph showing the percentage of cells in sieve plate cell line # 506 that have undergone apoptosis in response to treatment with camptothecin and TNF-α. On a culture slide with 8 wells, cells of the sieve cell line # 506 were planted at a rate of 40,000 per well. Three days later, the LC cells were treated with 10 ng / ml TNF-α or with 50 μM camptothecin or with 10 ng / ml TNF-α + 50 μM camptothecin. The same amount of DMSO, a camptothecin control vehicle, was added to untreated control cells. 48 hours after the treatment, the cells were stained with Hoechst 33258 and observed with a fluorescence microscope using a UV filter. Cells with brightly stained condensed or fragmented nuclei were counted as apoptotic cells. FIG. 84 is the expression level of apoptosis-specific eIF-5A during treatment with camptothecin or camptothecin + TNF-α. 24 well plates were seeded with 40,000 cells per well of sieve plate cell line # 506. After 3 days, the LC cells were treated with 50 μM camptothecin or with 10 ng / ml TNF-α + 50 μM camptothecin, and protein lysates were harvested after 1 hour, 4 hours, 8 hours, and 24 hours. The same amount of DMSO was added to control cells as a control vehicle, and cell lysates were collected after 1 hour and 24 hours. 5 μg of protein from each sample was isolated by SDS-PAGE, transferred to a PVDF membrane, and Western blotted using an anti-apoptosis specific eIF-5A antibody. Bound antibody was detected by chemiluminescence and exposed to X-ray film. The membrane was then peeled off and blotted again using anti-β-actin as an internal loading control. FIG. 85 shows the expression level of apoptosis-specific eIF-5A in cells of sieve plate cell lines # 506 and # 517 after transfection with siRNA. A 24-well plate was seeded with cells from the sieve cell lines # 506 and # 517 at a rate of 10,000 cells per well. Three days later, the LC cells were transfected with GADH siRNA, apoptosis-specific eIF-5A siRNA # 1 to # 4 (SEQ ID NO: 30 to 33), or control siRNA # 5 (SEQ ID NO: 34). Three days after transfection, protein lysates were collected, 5 μg of protein from each sample was isolated by SDS-PAGE, transferred to a PVDF membrane, and Western blotted using an anti-apoptosis specific eIF-5A antibody. Bound antibody was detected by chemiluminescence and exposed to X-ray film. The membrane was then peeled off and blotted again using anti-β-actin as an internal loading control. This figure shows that apoptosis-specific eIF-5A protein production is reduced in cells treated with apoptosis-specific eIF-5A siRNA. FIG. 86 shows the percentage of cells in the sieve plate cell line # 506 that were transfected with apoptosis-specific eIF-5A siRNA and treated with TNF-α and camptothecin. On a culture slide with 8 wells, cells of the sieve plate cell line # 506 were seeded at a rate of 7500 cells per well. Three days later, the LC cells were transfected with GADH siRNA, apoptosis-specific eIF-5A siRNA # 1 to # 4 (SEQ ID NO: 30 to 33), or control siRNA # 5 (SEQ ID NO: 34). 72 hours after transfection, transfected cells were treated with 10 ng / ml TNF-α and 50 μM camptothecin. After 24 hours, the cells were stained with Hoechst 33258 and observed with a fluorescence microscope using a UV filter. Cells with brightly stained condensed or fragmented nuclei were counted as apoptotic cells. This graph represents the average of n = 4 independent experiments. The figure shows that when treated with camptothecin, cells treated with apoptosis-specific eIF-5A siRNA have a lower percentage of apoptosis compared to cells not transfected with apoptosis-specific eIF-5A siRNA. ing. FIG. 87 shows the percentage of cells in the sieve plate cell line # 517 that were transfected with apoptosis-specific eIF-5A siRNA # 1 and treated with TNF-α and camptothecin. On a culture slide with 8 wells, cells of sieve plate cell line # 517 were seeded at a rate of 7500 cells per well. Three days later, the LC cells were transfected with apoptosis-specific eIF-5A siRNA # 1 (SEQ ID NO: 30) or control siRNA # 5 (SEQ ID NO: 34). 72 hours after transfection, transfected cells were treated with 10 ng / ml TNF-α and 50 μM camptothecin. After 24 hours, the cells were stained with Hoechst 33258 and observed with a fluorescence microscope using a UV filter. Cells with brightly stained condensed or fragmented nuclei were counted as apoptotic cells. Here are the results of two independent experiments. This figure shows that cells treated with siRNA had a lower rate of apoptosis. FIG. 88 shows the result of labeling TUNEL on cells of the sieve cell line # 506 transfected with apoptosis-specific eIF-5A siRNA and treated with TNF-α and camptothecin. On a culture slide with 8 wells, cells of the sieve plate cell line # 506 were seeded at a rate of 7500 cells per well. Three days later, the LC cells were transfected with apoptosis-specific eIF-5A siRNA # 1 (SEQ ID NO: 30) or control siRNA # 5 (SEQ ID NO: 34). 72 hours after transfection, transfected cells were treated with 10 ng / ml TNF-α and 50 μM camptothecin. After 24 hours, cells were stained with Hoechst 33258 and DNA fragmentation was assessed in situ using the terminal deoxynucleotidyl transferase dUTP-digoxigenin nick end labeling (TUNEL) method. Photo A is a slide observed with a fluorescence microscope using a fluorescein filter in order to visualize TUNEL labeling of fragmented DNA of apoptotic cells. Photo B is the same slide viewed through a UV filter to visualize Hoechst stained nuclei. Here, the results of two independent experiments are shown. All photos were taken at 400x magnification. FIG. 89 is a design diagram of siRNA against apoptosis-specific eIF-5A. The siRNA has SEQ ID NOs: 45, 48, 51, 54, 56. The full length nucleotide sequence is shown in SEQ ID NO: 29. FIG. 90 shows the experimental results that the activity of NKkB is reduced by siRNA against apoptosis-specific eIF-5A in the presence of interferon γ and LPS. FIG. 91 is a time schedule for the PBMC experiment (see Example 18). FIG. 92 is a time course of Western blot for cell lysates from PBMC collected from two donors. When PBMCs were treated with PMA and stimulated with LPS, the expression of apoptosis-specific eIF-5A was increased. FIG. 93 shows that when PBMC were treated with PMA and stimulated with LPS, the expression of apoptosis-specific eIF-5A was increased. This coincides with increased production of TNF. FIG. 94 shows that PBMC responds to LPS independent of PMA differentiation. FIG. 95 shows that PBMC transfected with apoptosis-specific eIF-5A siRNA suppresses the expression of apoptosis-specific eIF-5A. Figure 96 shows that PBMCs transfected with apoptosis-specific eIF-5A siRNA and then stimulated with LPS produced less TNF than PBMCs not transfected with apoptosis-specific eIF-5A siRNA . FIG. 97 is a Western blot for cell lysates from HT-29 cells treated with interferon γ and HT-29 cells not treated with interferon γ. FIG. 98 is a Western blot for cell lysates from HT-29 cells transfected with control siRNA or apoptosis-specific eIF-5A siRNA. This figure shows that the apoptosis-specific eIF-5A siRNA blocks the expression of apoptosis-specific eIF-5A. FIG. 99 shows that TNF production levels are reduced in HT-29 cells transfected with apoptosis-specific eIF-5A siRNA. FIG. 100 shows that apoptosis in HT-29 cells transfected with apoptosis-specific eIF-5A siRNA is less than control cells. Both control cells and siRNA transfected cells were treated with interferon gamma and also treated with TNF-α. FIG. 101 shows that TLR4 protein expression is lower in HT-29 cells transfected with apoptosis-specific eIF-5A siRNA than in control cells. FIG. 102 shows that TNFR1 protein expression is less in HT-29 cells transfected with apoptosis-specific eIF-5A siRNA than in control cells. FIG. 103 shows that iNOS protein expression is less in HT-29 cells transfected with apoptosis-specific eIF-5A siRNA than in control cells. FIG. 104 shows that expression of TLR4 mRNA is less in HT-29 cells transfected with apoptosis-specific eIF-5A siRNA than in control cells. FIG. 105 is a time schedule for processing U937. FIG. 106 shows that in U937 cells, apoptosis-specific eIF-5A is upregulated by PMA. FIG. 107 shows that in U937 cells, apoptosis-specific eIF-5A is upregulated by LPS. FIG. 108 shows that the expression of apoptosis-specific eIF-5A protein is further reduced after many hours of treatment with siRNA. FIG. 109 shows that siRNA-mediated downregulation of apoptosis-specific eIF-5A coincides with a decrease in TLR4. FIG. 110 shows that in U937 cells, siRNA-mediated downregulation of apoptosis-specific eIF-5A occurs simultaneously with fewer glycosylated forms of interferon gamma receptor. FIG. 111 shows that siRNA-mediated apoptosis-specific down regulation of eIF-5A occurs simultaneously with a decrease in TNFR1 in U937 cells. FIG. 112 shows that in U937 cells, siRNA-mediated downregulation of apoptosis-specific eIF-5A coincides with a decrease in LPS-induced TNF-α production. FIG. 113 shows that siRNA-mediated downregulation of apoptosis-specific eIF-5A occurs simultaneously with the decrease in production of IL-1β induced by LPS in U937 cells. FIG. 114 shows that in U937 cells, siRNA-mediated downregulation of apoptosis-specific eIF-5A occurs simultaneously with a decrease in IL-8 production induced by LPS. FIG. 115 shows that in U937 cells, IL-6 production is independent of siRNA-mediated apoptosis-specific eIF-5A downregulation.

[Sequence Listing]

Claims (28)

  An antisense oligonucleotide for apoptosis-specific eIF-5A that suppresses endogenous expression of apoptosis-specific eIF-5A in cells.   The antisense oligonucleotide of claim 1, wherein the apoptosis-specific eIF-5A is encoded by the nucleotide sequence of SEQ ID NO: 20.   2. The antisense oligonucleotide of claim 1, wherein the apoptosis-specific eIF-5A is encoded by the nucleotide sequence of SEQ ID NO: 41.   The antisense oligonucleotide according to claim 1, which has the sequence shown in SEQ ID NO: 35.   The antisense oligonucleotide according to claim 1, which has the sequence shown in SEQ ID NO: 37.   The antisense oligonucleotide according to claim 1, which has the sequence shown in SEQ ID NO: 39.   An expression vector for transfecting a mammalian cell, comprising the antisense oligonucleotide of claim 1 and a regulatory sequence operably linked to the antisense oligonucleotide, Said expression vector allowing transcription of an antisense oligonucleotide.   An expression vector for transfecting a mammalian cell, comprising the antisense oligonucleotide according to claim 4 and a regulatory sequence operably linked to the antisense oligonucleotide, Said expression vector allowing transcription of an antisense oligonucleotide.   An expression vector for transfecting a mammalian cell, comprising the antisense oligonucleotide according to claim 5 and a regulatory sequence operably linked to the antisense oligonucleotide, Said expression vector allowing transcription of an antisense oligonucleotide.   An expression vector for transfecting a mammalian cell, comprising the antisense oligonucleotide of claim 6 and a regulatory sequence operably linked to the antisense oligonucleotide, Said expression vector allowing transcription of an antisense oligonucleotide.   A method for blocking the expression of apoptosis-specific eIF-5A in a cell, comprising the step of administering the expression vector according to claim 7 to the cell, whereby an antisense oligo of apoptosis-specific eIF-5A The method, wherein the nucleotide blocks the expression of endogenous apoptosis-specific eIF-5A in the cell.   A method for blocking the expression of apoptosis-specific eIF-5A in a cell, comprising the step of administering to the cell the expression vector according to any one of claims 8, 9 or 10, whereby Wherein said anti-sense oligonucleotide of eIF-5A inhibits the expression of endogenous apoptosis-specific eIF-5A in the cell.   Inhibiting the expression of endogenous apoptosis-specific eIF-5A in the cell suppresses apoptosis in the cell, decreases the expression of p53 in the cell, and the cytokine produced in the cell Decreased levels of Bcl-2 in the cells; decreased levels of myeloperoxidase produced in the cells; decreased levels of active NFκbeta in the cells; levels of TLR4 in the cells 12. The method of claim 11, wherein the method has an effect selected from the group consisting of a decrease, a decrease in the level of TNFR-1 in the cell, and a decrease in the level of iNOS in the cell.   Inhibiting the expression of endogenous apoptosis-specific eIF-5A in the cell suppresses apoptosis in the cell, decreases the expression of p53 in the cell, and the cytokine produced in the cell Decreased levels of Bcl-2 in the cells; decreased levels of myeloperoxidase produced in the cells; decreased levels of active NFκbeta in the cells; levels of TLR4 in the cells 13. The method of claim 12, wherein the method has an effect selected from the group consisting of a decrease, a decrease in the level of TNFR-1 in the cell, and a decrease in the level of iNOS in the cell.   A method of delivering siRNA to mammalian lung cells in vivo, comprising the step of mixing the siRNA with water and supplying it into the nasal cavity of a mammal.   An apoptosis-specific eIF-5A siRNA that suppresses endogenous expression of apoptosis-specific eIF-5A in cells.   17. The siRNA of claim 16, wherein the apoptosis-specific eIF-5A is encoded by the nucleotide sequence of SEQ ID NO: 20.   17. The siRNA of claim 16, wherein the apoptosis-specific eIF-5A is encoded by the nucleotide sequence of SEQ ID NO: 41.   17. The siRNA of claim 16, having the sequence set forth in SEQ ID NO: 30.   The siRNA according to claim 16, which has the sequence shown in SEQ ID NO: 31.   17. The siRNA of claim 16, having the sequence set forth in SEQ ID NO: 32.   The siRNA according to claim 16, which has the sequence shown in SEQ ID NO: 33.   A method of blocking the expression of apoptosis-specific eIF-5A in a cell, comprising the step of administering to the cell the siRNA according to claim 16, whereby the apoptosis-specific eIF-5A siRNA is expressed in the cell. Said method of blocking the expression of endogenous apoptosis-specific eIF-5A.   A method for blocking the expression of apoptosis-specific eIF-5A in a cell comprising the step of administering to the cell the siRNA according to any one of claims 19, 20, 21 or 22, whereby apoptosis The method, wherein the specific eIF-5A siRNA blocks expression of endogenous apoptosis-specific eIF-5A in the cell.   A method of blocking the expression of apoptosis-specific eIF-5A in a cell, comprising the step of administering to the cell the siRNA according to claim 16, whereby the apoptosis-specific eIF-5A siRNA is expressed in the cell. Said method of blocking the expression of endogenous apoptosis-specific eIF-5A.   A method for blocking the expression of apoptosis-specific eIF-5A in a cell comprising the step of administering to the cell the siRNA according to any one of claims 19, 20, 21 or 22, whereby apoptosis The method, wherein the specific eIF-5A siRNA blocks expression of endogenous apoptosis-specific eIF-5A in the cell.   Inhibiting the expression of endogenous apoptosis-specific eIF-5A in the cell suppresses apoptosis in the cell, decreases the expression of p53 in the cell, and the cytokine produced in the cell Decreased levels of Bcl-2 in the cells; decreased levels of myeloperoxidase produced in the cells; decreased levels of active NFκbeta in the cells; levels of TLR4 in the cells 26. The method of claim 25, wherein the method has an effect selected from the group consisting of a decrease, a decrease in the level of TNFR-1 in the cell, and a decrease in the level of iNOS in the cell.   Inhibiting the expression of endogenous apoptosis-specific eIF-5A in the cell suppresses apoptosis in the cell, decreases the expression of p53 in the cell, and the cytokine produced in the cell Decreased levels of Bcl-2 in the cells; decreased levels of myeloperoxidase produced in the cells; decreased levels of active NFκbeta in the cells; levels of TLR4 in the cells 27. The method of claim 26, wherein the method has an effect selected from the group consisting of a decrease, a decrease in the level of TNFR-1 in the cell, and a decrease in the level of iNOS in the cell.

Images