WO2005014863A1 - Mutations in ion channels - Google Patents
Mutations in ion channels Download PDFInfo
- Publication number
- WO2005014863A1 WO2005014863A1 PCT/AU2004/001051 AU2004001051W WO2005014863A1 WO 2005014863 A1 WO2005014863 A1 WO 2005014863A1 AU 2004001051 W AU2004001051 W AU 2004001051W WO 2005014863 A1 WO2005014863 A1 WO 2005014863A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- exon
- disease
- intron
- ion
- ion channel
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70571—Receptors; Cell surface antigens; Cell surface determinants for neuromediators, e.g. serotonin receptor, dopamine receptor
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/04—Drugs for skeletal disorders for non-specific disorders of the connective tissue
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
- A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/04—Centrally acting analgesics, e.g. opioids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/06—Antimigraine agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/08—Antiepileptics; Anticonvulsants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
- A61P25/16—Anti-Parkinson drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/18—Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/22—Anxiolytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/24—Antidepressants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/06—Antiarrhythmics
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- the present invention is concerned with mutations in proteins having biological functions as ion channels and, more particularly, with such mutations where they are associated with diseases such as epilepsy and disorders associated with ion channel dysfunction including, but not restricted to, hyper- or hypo-kalemic periodic paralysis, myotonias , malignant hyperthermia, myasthenia, cardiac arrhythmias, episodic ataxia, migraine, Alzheimer's disease, Parkinson's disease, schizophrenia, hyperekplexia, anxiety, depression, phobic obsessive symptoms , neuropathic pain , inflammatory pain , chronic/acute pain, Bartter ' s syndrome, polycystic kidney disease, Dent's disease, hyperinsulinemic hypoglycemia of infancy, cystic fibrosis, congenital stationary night blindness and total colour-blindness .
- diseases such as epilepsy and disorders associated with ion channel dysfunction including, but not restricted to, hyper- or hypo-kalemic periodic paralysis, myotonias
- Epilepsies constitute a diverse collection of brain disorders that affect about 3% of the population at some time in their lives (Annegers , 1996).
- An epileptic seizure can be defined as an episodic change in behaviour caused by the disordered firing of populations of neurons in the central nervous system. This results in varying degrees of involuntary muscle contraction and often a loss of consciousness.
- Epilepsy syndromes have been classified into more than 40 distinct types based upon characteristic symptoms, types of seizure, cause, age of onset and EEG patterns (Commission on Classification and Terminology of the International League against Epilepsy, 1989) .
- the single feature that is common to all syndromes is the persistent increase in neuronal excitability that is both occasionally and unpredictably expressed as a seizure.
- epilepsy A genetic contribution to the aetiology of epilepsy has been estimated to be present in approximately 40% of affected individuals (Gardiner, 2000) .
- epileptic seizures may be the end-point of a number of molecular aberrations that ultimately disturb neuronal synchrony, the genetic basis for epilepsy is likely to be heterogeneous.
- Mendelian diseases which include epilepsy as part of the phenotype. In these diseases, seizures are symptomatic of underlying neurological involvement such as disturbances in brain structure or function.
- epilepsy syndromes in which epilepsy is the sole manifestation in the affected individuals . These are termed idiopathic and account for over 60% of all epilepsy cases .
- Idiopathic epilepsies have been further divided into partial and generalized sub-types . Partial (focal or local) epileptic fits arise from localized cortical discharges , so that only certain groups of muscles are involved and consciousness may be retained. However, in generalized epilepsy, EEG discharge shows no focus such that all subcortical regions of the brain are involved. Although the observation that generalized epilepsies are frequently inherited is understandable, the mechanism by which genetic defects, presumably expressed constitutively in the brain, give rise to partial seizures is less clear. The molecular genetic era has resulted in spectacular advances in classification, diagnosis and biological understanding of numerous inherited neurological disorders including muscular dystrophies , familial neuropathies and spinocerebellar degenerations .
- IGE idiopathic generalized epilepsies
- the sub- syndromes are identified by age of onset and the pattern of seizure types (absence, myoclonus and tonic-clonic) . Some patients , particularly those with tonic-clonic seizures alone do not fit a specifically recognized sub- syndrome. Arguments for regarding these as separate syndromes, yet recognizing that they are part of a neurobiological continuum, have been presented previously (Berkovic et al . 1987; 1994; Reutens and Berkovic, 1995) . GEFS + was originally recognized through large multi- generation families and comprises a variety of sub- syndromes .
- Febrile seizures plus (FS + ) is a sub-syndrome where children have febrile seizures occurring outside the age range of 3 months to 6 years, or have associated febrile tonic-clonic seizures . Many amily members have a phenotype indistinguishable from the classical febrile convulsion syndrome and some have FS + with additional absence, myoclonic, atonic, or complex partial seizures.
- the severe end of the GEFS + spectrum includes myoclonic- astatic epilepsy.
- the cumulative incidence for epilepsy by age 30 years (proportion suffering from epilepsy at some time) is 1.5% (Hauser et al . , 1993) . Accurate estimates for the cumulative incidence of the IGEs are unavailable .
- This mutation results in the loss of a critical disulphide bridge of this regulatory subunit and causes a loss of function in vitro .
- Families linked to 2q are also known and mutations in the pore-forming ⁇ subunit of the neuronal sodium channel (SCNlA) have been identified (PCT/AU01/01648 ; Wallace et al . , 2001 ; Escayg et al . , 2000) .
- Studies on the more common small families with GEFS + have not revealed these or other mutations to date .
- SCNlB and SCNlA mutations in GEFS + four other gene defects have been discovered for human idiopathic epilepsies through the study of large families.
- mutations in two potassium channel genes were identified in benign familial neonatal convulsions (Singh et al . , 1998; Biervert et al . , 1998; Charlier et al . , 1998). Although initially regarded as a special form of IGE, this unusual syndrome is probably a form of inherited focal epilepsy . Further to these studies , mutations in other genes have been identified to be causative of epilepsy. These include mutations in the beta-2 subunit (CHRNB2) of the neuronal nicotinic acetylcholine receptor (PCT/AU01/00541 ; Phillips et al .
- CHRNB2 beta-2 subunit
- PCT/AU01/00541 neuronal nicotinic acetylcholine receptor
- mice mutants have ataxia in addition to generalized spike-and-wave discharges with absences or tonic-clonic seizures .
- Recessive mutations in calcium channel subunit genes have been found in lethargic (CACNB4) , tottering/leaner (CACNA1A) , and stargazer (CACNG2) mutants.
- the slow-wave epilepsy mouse mutant has a mutation in the sodium/hydrogen exchanger gene, which may have important downstream effects on pH-sensitive ion channels .
- idiopathic epilepsies comprise a family of channelopathies with mutations in ion channel subunits of voltage-gated (eg SCNlA, SCNlB, KCNQ2 , KCNQ3) or ligand- gated (eg CHRNA4 , CHRNB2 , GABRG2 , GABRD) types.
- voltage-gated eg SCNlA, SCNlB, KCNQ2 , KCNQ3
- ligand- gated eg CHRNA4 , CHRNB2 , GABRG2 , GABRD
- Neurological disorders other than epilepsy that are associated with ion channel mutations include episodic ataxia, migraine, Alzheimer's disease, Parkinson's disease, schizophrenia, hyperekplexia, anxiety, depression, phobic obsessive symptoms, as well as neuropathic pain, inflammatory pain and chronic/acute pain.
- Some kidney disorders such as Bartter' s syndrome, polycystic kidney disease and Dent's disease, secretion disorders such as hyperinsulinemic hypoglycemia of infancy and cystic fibrosis, and vision disorders such as congenital stationary night blindness and total colourblindness may also be linked to mutations in ion channels .
- IGEs idiopathic generalised epilepsies
- PCT/AU01/00872 the disclosure of which is incorporated herein by reference
- IGE and GEFS + cases are due to the combination of two mutations in multi-subunit ion channels. These are typically point mutations resulting in a subtle change of unction .
- the critical postulate is that two mutations, usually, but not exclusively, in different subunit alleles ("digenic model”) , are required for clinical expression of IGE. It was further proposed that a) A number of different mutated subunit pairs can be responsible for IGE .
- nucleic acid molecule coding for a protein having a biological function as part of an ion channel in a mammal wherein a mutation event selected rom the group consisting of point mutations, deletions, insertions and rearrangements has occurred so as to affect the functioning of the ion channel .
- this single mutation alone will produce a phenotype of epilepsy or other neuro/physiological disorders associated with ion channel dysfunction .
- a single mutation alone does not produce, say, an epilepsy phenotype
- one or more additional isolated nucleic acid molecules coding for proteins having a biological function as part of an ion channel in a mammal , wherein a mutation event selected from the group consisting of point mutations , deletions , insertions and rearrangements has occurred so as to affect the functioning of the ion channel .
- the cumulative ef ect of the mutations in each isolated nucleic acid molecule in vivo is to produce a epilepsy or another neuro/physiological disorders in said mammal .
- the mutations may be in nucleic acid molecules coding for protein subunits belonging to the same ion channel or may be in nucleic acid molecules coding for protein subunits that belong to different ion channels .
- mutations are point mutations and the ion channels are voltage-gated channels such as a sodium, potassium, calcium or chloride channels or are ligand- gated channels such as members of the nAChR/GABA super family of receptors , or a functional fragment or homologue thereof.
- Mutations may include those in non-coding regions of the ion channel subunits (eg mutations in the promoter region which affect the level of expression of the subunit gene , mutations in intronic sequences which affect the correct splicing of the subunit during mRNA processing, or mutations in the 5' or 3' untranslated regions that can affect translation or stability of the mRNA) . Mutations may also and more preferably will be in coding regions of the ion channel subunits (eg nucleotide mutations may give rise to an amino acid change in the encoded protein or nucleotide mutations that do not give rise to an amino acid change but may affect the stability of the mRNA) . Mutation combinations may be selected from, but are not restricted to, those identified in Table 1.
- a method of identifying a subject predisposed to a disorder associated with ion channel dysfunction comprising ascertaining whether at least one of the genes encoding ion channel subunits in said subject has undergone a mutation event selected from the group consisting of the mutation events set forth in the following Table : Subunit Exon/Intron DNA Mutation Gene SCNlA Exon 5 c 664C ⁇ T SCNlA Exon 8 cl l 52G ⁇ A SCNlA Exon 9 cl l 83G- C SCNlA Exon 9 cl 207T ⁇ C SCNlA Exon 9 cl237T-»A SCNlA Exon 9 cl2 65T ⁇ A SCNlA Exon 21 c4219C ⁇ T SCNlA Exon 26 c5339T ⁇ C SCNlA Exon 26 c5674C- T SCNlB Exon 3 c254 G ⁇ A SCN2A Exon 6A c
- GABRD Intron 6 IVS6+130insC GABRD Intron 6 IVS6+73delCGCGCCCACCGCCCCTTCCGCG
- GABRG3 Intron 8 IVS8-102C ⁇ -T
- a method of identifying a subject predisposed to a disorder associated with ion channel dysfunction comprising ascertaining whether at least one of the genes encoding ion channel subunits in said subject has undergone a mutation event as set forth in one of SEQ ID Numbers: 1-72.
- an isolated nucleic acid molecule encoding a mutant or variant ion channel subunit wherein a mutation event selected from the group consisting of the mutation events set forth in the following Table : Subunit Exon/Intron DNA Mutation Gene SCNlA Exon 5 c664C ⁇ T SCNlA Exon 8 cl l 52G- A SCNlA Exon 9 cll 83G-»C SCNlA Exon 9 cl207T ⁇ C SCNlA Exon 9 cl237T ⁇ A SCNlA Exon 9 cl265T->A SCNlA Exon 21 c4219C ⁇ T SCNlA Exon 26 c5339T ⁇ C SCNlA Exon 26 c5674C ⁇ T SCNlB Exon 3 c254G ⁇ A SCN2A Exon 6A c668G ⁇ A SCN2A Exon 16 c2674G ⁇ A SCN2A Exon 17 c3007C-
- an isolated nucleic acid molecule encoding a mutant or variant ion channel subunit wherein a mutation event has occurred as set forth in one of SEQ ID Numbers: 1-72.
- the mutation event disrupts the functioning of an ion channel so as to produce a phenotype of epilepsy, and/or one or more other disorders associated with ion channel dysfunction, including but not restricted to, hyper- or hypo-kalemic periodic paralysis, myotonias, malignant hyperthermia, myasthenia, cardiac arrhythmias, episodic ataxia, migraine, Alzheimer's disease, Parkinson's disease, schizophrenia, hyperekplexia, anxiety, depression, phobic obsessive symptoms, neuropathic pain, inflammatory pain, chronic/acute pain, Bartter 's syndrome, polycystic kidney disease, Dent's disease, hyperinsulinemic hypoglycemia of infancy, cystic fibrosis, congenital stationary night blindness and total colourblin
- an isolated nucleic acid molecule encoding a mutant KCNQ2 subunit, wherein the mutation event has occurred in the C-terminal domain of the KCNQ2 subunit and leads to a disturbance in the calmodulin binding affinity of the subunit, so as to produce an epilepsy phenotype.
- the mutations are in exon 8 or exon 15 of the KCNQ2 subunit and result in the replacement of an arginine residue with a glycine residue at amino acid position 353, or the replacement of a leucine residue with an arginine at amino acid position 619.
- the R353G mutation occurs as a result of a C to G nucleotide substitution at position 1057 of the KCNQ2 coding sequence as shown in SEQ ID NO: 44.
- the L619R mutation occurs as a result of a T to G nucleotide substitution at position 1856 of the KCNQ2 coding sequence as shown in SEQ ID NO: 47.
- the mutations are in exon 11 or exon 14 of the KCNQ2 subunit and result in the replacement of an arginine residue with a stop codon at amino acid position 430, or the replacement of an arginine residue with a serine at amino acid position 570.
- the R430X mutation occurs as a result of a C to T nucleotide substitution at position 1288 of the KCNQ2 coding sequence as shown in SEQ ID NO: 45.
- the R570S mutation occurs as a result of an A to T nucleotide substitution at position 1710 of the KCNQ2 coding sequence as shown in SEQ ID NO: 46.
- these mutations create a phenotype of benign familial neonatal seizures (BFNS)-.
- BFNS benign familial neonatal seizures
- the cumulative effect of the mutations in each isolated nucleic acid molecule in vivo is to produce an epilepsy or another disorder associated with ion channel dysfunction as described above in said mammal .
- the isolated nucleic acid molecules have a nucleotide sequence as shown in any one of SEQ ID Numbers : 1-72. The sequences correspond to the novel DNA mutations or variants laid out in Table 1.
- an isolated nucleic acid molecule comprising any one of the nucleotide sequences set forth in SEQ ID Numbers : 1-72.
- nucleic acid molecule consisting of any one of the nucleotide sequences set forth in SEQ ID Numbers: 1-72.
- the nucleotide sequences of the present invention can be engineered using methods accepted in the art for a variety of purposes. These include, but are not limited to, modification of the cloning, processing, and/or expression of the gene product. PCR reassembly of gene fragments and the use of synthetic oligonucleotides allow the engineering of the nucleotide sequences of the present invention. For example, oligonucleotide-mediated site- directed mutagenesis can introduce further mutations that create new restriction sites, alter expression patterns and produce splice variants etc .
- the invention includes each and every possible variation of a polynucleotide sequence that could be made by selecting combinations based on possible codon choices . These combinations are made in accordance with the standard triplet genetic code as applied to the polynucleotide sequences of the present invention, and all such variations are to be considered as being specifically disclosed.
- the nucleic acid molecules of this invention are typically DNA molecules, and include cDNA, genomic DNA, synthetic forms, and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified, or may contain non-natural or derivatised nucleotide bases as will be appreciated by those skilled in the art. Such modifications include labels, methylation, intercalators , alkylators and modified linkages . In some instances it may be advantageous to produce nucleotide sequences possessing a substantially different codon usage than that of the polynucleotide sequences of the present invention.
- codons may be selected to increase the rate of expression of the peptide in a particular prokaryotic or eukaryotic host corresponding with the frequency that particular codons are utilized by the host.
- Other reasons to alter the nucleotide sequence without altering the encoded amino acid sequences include the production of RNA transcripts having more desirable properties , such as a greater half- life, than transcripts produced from the naturally occurring mutated sequence .
- the invention also encompasses production of nucleic acid sequences of the present invention entirely by synthetic chemistry. Synthetic sequences may be inserted into expression vectors and cell systems that contain the necessary elements for transcriptional and translational control of the inserted coding sequence in a suitable host.
- These elements may include regulatory sequences, promoters, 5' and 3' untranslated regions and specific initiation signals (such as an ATG initiation codon and Kozak consensus sequence) which allow more efficient translation of sequences encoding the polypeptides of the present invention.
- specific initiation signals such as an ATG initiation codon and Kozak consensus sequence
- additional control signals may not be needed.
- exogenous translational control signals as described above should be provided by the vector.
- Such signals may be of various origins, both natural and synthetic.
- the efficiency of expression may be enhanced by the inclusion of enhancers appropriate for the particular host cell system used (Scharf et al .
- the invention also includes nucleic acid molecules that are the complements of the sequences described herein.
- the present invention allows for the preparation of purified polypeptide or protein from the polynucleotides of the present invention, or variants thereof.
- host cells may be transformed with a novel nucleic acid molecule as described above, or with nucleic acid molecules encoding two or more mutant ion channel subunits . If the mutant subunits form a part of the same ion channel a receptor protein containing two or more mutant subunits may be isolated. If the mutant subunits are subunits of different ion channels the host cells will express two or more mutant receptor proteins.
- said host cells are transfected with an expression vector comprising a DNA molecule according to the invention or, in particular, DNA molecules encoding two or more mutant ion channel subunits.
- expression vector/host systems may be utilized to contain and express sequences encoding polypeptides of the invention . These include , but are not limited to, microorganisms such as bacteria transformed with plasmid or cosmid DNA expression vectors; yeast transformed with yeast expression vectors; insect cell systems infected with viral expression vectors (e.g., baculovirus) ; or mouse or other animal or human tissue cell systems . Mammalian cells can also be used to express a protein using a vaccinia virus expression system. The invention is not limited by the host cell or vector employed.
- polynucleotide sequences, or variants thereof, of the present invention can be stably expressed in cell lines to allow long term production of recombinant proteins in mammalian systems.
- Sequences encoding the polypeptides of the present invention can be transformed into cell lines using expression vectors which may contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector.
- the selectable marker confers resistance to a selective agent, and its presence allows growth and recovery of cells which successfully express the introduced sequences.
- Resistant clones of stably transformed cells may be propagated using tissue culture techniques appropriate to the cell type.
- the protein produced by a transformed cell may be secreted or retained intracellularly depending on the sequence and/or the vector used.
- expression vectors containing polynucleotides which encode a protein may be designed to contain signal sequences which direct secretion of the protein through a prokaryotic or eukaryotic cell membrane.
- a host cell strain may be chosen for its ability to modulate expression of the inserted sequences or to process the expressed protein in the desired ashion .
- modifications of the polypeptide include , but are not limited to, acetylation, glycosylation, phosphorylation, and acylation.
- Post-translational cleavage of a "prepro" form of the protein may also be used to specify protein targeting, folding, and/or activity.
- Different host cells having specific cellular machinery and characteristic mechanisms for post- translational activities are available from the American Type Culture Collection (ATCC) and may be chosen to ensure the correct modification and processing of the foreign protein.
- ATCC American Type Culture Collection
- vectors which direct high levels of expression of this protein may be used, such as those containing the T5 or T7 inducible bacteriophage promoter.
- the present invention also includes the use of the expression systems described above in generating and isolating fusion proteins which contain important functional domains of the protein. These fusion proteins are used for binding, structural and functional studies as well as for the generation of appropriate antibodies.
- the appropriate cDNA sequence is inserted into a vector which contains a nucleotide sequence encoding another peptide (for example, glutathionine succinyl transferase) .
- the fusion protein is expressed and recovered from prokaryotic or eukaryotic cells .
- the fusion protein can then be purified by affinity chromatography based upon the fusion vector sequence .
- the desired protein is then obtained by enzymatic cleavage of the fusion protein. Fragments of the polypeptides of the present invention may also be produced by direct peptide synthesis using solid-phase techniques .
- Automated synthesis may be achieved by using the ABI 431A Peptide Synthesizer (Perkin-Elmer) .
- Various fragments of this protein may be synthesized separately and then combined to produce the full-length molecule.
- the present invention is also concerned with polypeptides having a biological function as an ion channel in a mammal , wherein a mutation event selected from the group consisting of substitutions, deletions, truncations, insertions and rearrangements has occurred so as to affect the functioning of the ion channel .
- this single mutation alone will produce an epilepsy phenotype or other neuro/physiological disorders associated with ion channel dysfunction.
- a single mutation alone does not produce, say, an epilepsy phenotype
- one or more additional isolated mammalian polypeptides having biological functions as part of an ion channel in a mammal , wherein a mutation event selected from the group consisting of substitutions, deletions, truncations , insertions and rearrangements has occurred so as to affect the functioning of the ion channel .
- the cumulative effect of the mutations in each isolated mammalian polypeptide in vivo being to produce epilepsy or another neuro/physiological disorder in said mammal.
- the mutations may be in polypeptide subunits belonging to the same ion channel as described above, but may also be in polypeptide subunits that belong to different ion channels .
- the mutation is an amino acid substitution and the ion channel is a voltage-gated channel such as a sodium, potassium, calcium or chloride channel or a ligand-gated channel such as a member of the nAChR/GABA super family of receptors , or a functional fragment or homologue thereof.
- Mutation combinations may be selected from, but are not restricted to, those represented in Table 1.
- an isolated polypeptide said polypeptide being a mutant or variant ion channel subunit wherein a mutation event selected from the group consisting of the mutation events set forth in the following Table : Subunit Amino Acid Change Gene SCNlA R222X SCNlA 384X SCNlA A395P SCNlA F403L SCNlA Y413N SCNlA V422E SCNlA R1407X SCNlA M1780T SCNlA R1892X SCNlB R85H SCN2A R223Q SCN2A V892I SCN2A L1003I SCN2A T1200A SCN2A R1319Q CHRNA5 VI341 CHRNA2 A125T CHRNA3 ⁇ R37H KCNQ2 K69fsX119 KCNQ2 M1V KCNQ2 MIT KCNQ2 R353G KCNQ2 R430X KCNQ2 R570S KCNQ
- polypeptide in a further aspect of the invention there is provided an isolated polypeptide, said polypeptide being a mutant or variant ion channel subunit wherein a mutation event has occurred such that the polypeptide has the amino acid sequence set forth in one of SEQ ID Numbers: 73-95.
- the mutation event disrupts the functioning of an ion channel so as to produce a phenotype of epilepsy, and/or one or more other disorders associated with ion channel dysfunction, including but not restricted to, hyper- or hypo-kalemic periodic paralysis, myotonias, malignant hyperthermia, myasthenia, cardiac arrhythmias, episodic ataxia, migraine, Alzheimer's disease, Parkinson's disease, schizophrenia, hyperekplexia, anxiety, depression, phobic obsessive symptoms, neuropathic pain, inflammatory pain, chronic/acute pain, Bartter 's syndrome, polycystic kidney disease, Dent's disease, hyperinsulinemic hypoglycemia of infancy, cystic fibrosis, congenital stationary night blindness and total colourblindness .
- the isolated polypeptide has an amino acid sequence as shown in any one of SEQ ID Numbers: 73-95.
- the sequences correspond to the novel amino acid changes laid out in Table 1 for those instances where the DNA mutation results in an amino acid change .
- an isolated polypeptide said polypeptide being a mutant KCNQ2 subunit, wherein the mutation event has occurred in the C-terminal domain of the KCNQ2 subunit and leads to a disturbance in the calmodulin binding affinity of the subunit, so as to produce an epilepsy phenotype .
- the mutations are substitutions in which an arginine residue is replaced with a glycine residue, or a leucine residue is replaced with an arginine.
- the substitutions are R353G and L619R transitions as illustrated by SEQ ID NOS: 92 and 95 respectively.
- the mutations result in the replacement of an arginine for a stop codon, or an arginine is replaced with a serine.
- the mutations are R430X and R570S transitions as illustrated by SEQ ID NOS: 93 and 94 respectively.
- the isolated polypeptides have an amino acid sequence as shown in any one of SEQ ID Numbers: 73-95.
- the sequences correspond to the novel amino acid changes laid out in Table 1.
- an isolated polypeptide comprising the amino acid sequence set forth in any one of SEQ ID Numbers: 73-95.
- a method of preparing a polypeptide comprising the steps of: (1) culturing host cells transfected with an expression vector comprising a nucleic acid molecule as described above under conditions effective for polypeptide production; and (2) harvesting the mutant ion channel subunit.
- the mutant ion channel subunit may be allowed to assemble with other subunits constituting the channel that are either wild-type or themselves mutant subunits, whereby the assembled ion channel is harvested.
- a polypeptide which is the product of the process described above. Substantially purified protein or fragments thereof can then be used in further biochemical analyses to establish secondary and tertiary structure.
- Such methodology includes , but is not restricted to, X-ray crystallography of crystals of the proteins or of the assembled ion channel incorporating the proteins or by nuclear magnetic resonance (NMR) .
- NMR nuclear magnetic resonance
- Determination of structure allows for the rational design of pharmaceuticals to interact with the ion channel as a whole or through interaction with a specific subunit protein (see drug screening below) , alter the overall ion channel protein charge configuration or charge interaction with other proteins, or to alter its function in the cell.
- the mutant ion channel subunits included as part of the present invention will be useful in further applications which include a variety of hybridisation and immunological assays to screen for and detect the presence of either a normal or mutated gene or gene product.
- the invention enables therapeutic methods for the treatment of epilepsy as well as other disorders associated with ion channel dysfunction and also enables methods for the diagnosis or prognosis of epilepsy as well as other disorders associated with ion channel dysfunction .
- a method of treating epilepsy as well as other disorders associated with ion channel dysfunction including but not restricted to, hyper- or hypo-kalemic periodic paralysis, myotonias, malignant hyperthermia, myasthenia, cardiac arrhythmias, episodic ataxia, migraine, Alzheimer's disease, Parkinson's disease, schizophrenia, hyperekplexia, anxiety, depression, phobic obsessive symptoms, neuropathic pain, inflammatory pain, chronic/acute pain, Bartter 's syndrome, polycystic kidney disease, Dent's disease, hyperinsulinemic hypoglycemia of infancy, cystic fibrosis, congenital stationary night blindness or total colour-blindness, comprising administering a selective antagonist, agonist or modulator of an ion channel or ion channel subunit, when the ion channel contains a mutation in a subunit comprising the channel, as described above, to a subject in need of such treatment
- Said mutation event may be causative of the disorder when expressed alone or when expressed in combination with one or more additional mutations in subunits of the same or different ion channels , which are typically those identified in Table 1.
- a selective antagonist, agonist or modulator of an ion channel or ion channel subunit when the ion channel contains a mutation in a subunit comprising the channel, as described above said mutation being causative of epilepsy as well as other disorders associated with ion channel dysfunction, including but not restricted to, hyper- or hypo-kalemic periodic paralysis, myotonias, malignant hyperthermia, myasthenia, cardiac arrhythmias, episodic ataxia, migraine, Alzheimer's disease, Parkinson's disease, schizophrenia, hyperekplexia, anxiety, depression, phobic obsessive symptoms, neuropathic pain, inflammatory pain, chronic/acute pain, Bartter 's syndrome, polycystic kidney disease, Dent's disease
- a suitable antagonist, agonist or modulator will restore wild-type function to the ion channel or channels containing the mutations of the present invention, or will negate the effects the mutant channel or channels have on cell function.
- a mutant ion channel may be used to produce antibodies specific for the mutant channel that is causative of the disease or to screen libraries of pharmaceutical agents to identify those that bind the mutant ion channel.
- an antibody, which specifically binds to a mutant ion channel or mutant ion channel subunit of the invention may be used directly as an agonist, antagonist or modulator, or indirectly as a targeting or delivery mechanism for bringing a pharmaceutical agent to cells or tissues that express the mutant ion channel .
- an antibody which is immunologically reactive with a polypeptide as described above, but not with a wild-type ion channel or ion channel subunit thereof.
- an antibody to an assembled ion channel containing a mutation in a subunit comprising the channel which is causative of epilepsy or another disorder associated with ion channel dysfunction when expressed alone or when expressed in combination with one or more other mutations in subunits of the same or different ion channels.
- Such antibodies may include, but are not limited to, polyclonal, monoclonal, chimeric, and single chain antibodies as would be understood by the person skilled in the art.
- various hosts including rabbits, rats, goats, mice, humans, and others may be immunized by injection with a polypeptide as described above or with any fragment or oligopeptide thereof which has immunogenic properties .
- Various adjuvants may be used to increase immunological response and include, but are not limited to, Freund's, mineral gels such as aluminium hydroxide, and surface-active substances such as lysolecithin.
- Adjuvants used in humans include BCG (bacilli Calmette-Guerin) and Corynebacterium parvum .
- the oligopeptides , peptides, or fragments used to induce antibodies to the mutant ion channel have an amino acid sequence consisting of at least 5 amino acids, and, more preferably, of at least 10 amino acids. It is also preferable that these oligopeptides, peptides, or fragments are identical to a portion of the amino acid sequence of the natural protein and contain the entire amino acid sequence of a small, naturally occurring molecule. Short stretches of ion channel amino acids may be fused with those of another protein, such as KLH, and antibodies to the chimeric molecule may be produced. Monoclonal antibodies to a mutant ion channel may be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture.
- Monoclonal antibodies produced may include, but are not limited to, mouse-derived antibodies, humanised antibodies and fully human antibodies .
- Antibodies may also be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature. (For example, see Orlandi et al .
- Antibody fragments which contain specific binding sites for a mutant ion channel may also be generated.
- such fragments include, F(ab')2 fragments produced by pepsin digestion of the antibody molecule and Fab fragments generated by reducing the disulfide bridges of the F(ab')2 fragments.
- Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity. (For example, see Huse et al . , 1989) .
- Various immunoassays may be used for screening to identify antibodies having the desired specificity.
- a method of treating epilepsy as well as other disorders associated with ion channel dysfunction including but not restricted to, hyper- or hypo-kalemic periodic paralysis, myotonias, malignant hyperthermia, myasthenia, cardiac arrhythmias, episodic ataxia, migraine, Alzheimer's disease, Parkinson's disease, schizophrenia, hyperekplexia, anxiety, depression, phobic obsessive symptoms, neuropathic pain, inflammatory pain, chronic/acute pain, Bartter 's syndrome, polycystic kidney disease, Dent's disease, hyperinsulinemic hypoglycemia of infancy, cystic fibrosis, congenital stationary night blindness or total colour-blindness, comprising administering an isolated nucleic acid molecule which is the complement (antisense) of any one of the nucleic acid molecules described above and which encodes an RNA molecule that hybridizes with the mRNA encoding a mutant ion channel subunit of
- an isolated nucleic acid molecule which is the complement (antisense) of a nucleic acid molecule of the invention and which encodes an RNA molecule that hybridizes with the mRNA encoding a mutant ion channel subunit of the invention, in the manufacture of a medicament for the treatment of epilepsy as well as other disorders associated with ion channel dysfunction, including but not restricted to, hyper- or hypo-kalemic periodic paralysis, myotonias, malignant hyperthermia, myasthenia, cardiac arrhythmias, episodic ataxia, migraine, Alzheimer's disease, Parkinson's disease, schizophrenia, hyperekplexia, anxiety, depression, phobic obsessive symptoms, neuropathic pain, inflammatory pain, chronic/acute pain, Bartter ' s syndrome, polycystic kidney disease, Dent's disease, hyperinsulinemic hypoglycemia of infancy, cystic fibrosis, congenital stationary night
- a vector expressing the complement (antisense) of the polynucleotides of the invention may be administered to a subject in need of such treatment.
- Many methods for introducing vectors into cells or tissues are available and equally suitable for use in vivo, in vitro, and ex vivo .
- vectors may be introduced into stem cells taken from the patient and clonally propagated for autologous transplant back into that same patient. Delivery by transfection, by liposome injections, or by polycationic amino polymers may be achieved using methods which are well known in the art. (For example, see Goldman et al . , 1997) .
- Additional antisense or gene-targeted silencing strategies may include, but are not limited to, the use of antisense oligonucleotides, injection of antisense RNA, transfection of antisense RNA expression vectors, and the use of RNA interference (RNAi) or short interfering RNAs (siRNA) . Still further, catalytic nucleic acid molecules such as DNAzymes and ribozymes may be used for gene silencing (Breaker and Joyce, 1994; Haseloff and Gerlach, 1988) . These molecules function by cleaving their target mRNA molecule rather than merely binding to it as in traditional antisense approaches .
- RNA interference RNA interference
- siRNA short interfering RNAs
- a suitable agonist, antagonist or modulator may include peptides , phosphopeptides or small organic or inorganic compounds that can restore wild-type activity of ion channels containing mutations in the subunits which comprise the channels as described above .
- Peptides , phosphopeptides or small organic or inorganic compounds suitable for therapeutic applications may be identified using nucleic acids and peptides of the invention in drug screening applications as described below. Molecules identified from these screens may also be of therapeutic application in affected individuals carrying other ion channel subunit gene mutations if the molecule is able to correct the common underlying functional deficit imposed by these mutations and those of the invention .
- a method of treating epilepsy as well as other disorders associated with ion channel dysfunction comprising administering a compound that is a suitable agonist, antagonist or modulator of an ion channel and that has been identified using the mutant ion channel subunits of the invention.
- an appropriate approach for treatment may be combination therapy. This may involve the administering an antibody or complement (antisense) to a mutant ion channel or ion channel subunit of the invention to inhibit its functional effect, combined with administration of wild-type ion channel subunits which may restore levels of wild-type ion channel formation to normal levels. Wild-type ion channel subunits of the invention can be administered using gene therapy approaches as described above for complement administration .
- a method of treating epilepsy as well as other disorders associated with ion channel dysfunction comprising administration of an antibody or complement to a mutant ion channel or ion channel subunit of the invention in combination with administration of wild-type ion channel subunits .
- a mutant ion channel or ion channel subunit of the invention in combination with the use of wild-type ion channel subunits , in the manufacture of a medicament for the treatment of epilepsy as well as other disorders associated with ion channel dysfunction.
- any of the agonists , antagonists, modulators, antibodies, complementary sequences or vectors of the invention may be administered in combination with other appropriate therapeutic agents .
- Selection of the appropriate agents may be made by those skilled in the art, according to conventional pharmaceutical principles .
- the combination of therapeutic agents may act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, therapeutic efficacy with lower dosages of each agent may be possible, thus reducing the potential for adverse side effects.
- Any of the therapeutic methods described above may be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
- nucleic acid molecules of the invention as well as peptides of the invention, particularly purified mutant ion channel subunit polypeptide and cells expressing these, are useful for the screening of candidate pharmaceutical agents for the treatment of epilepsy as well as other as other disorders associated with ion channel dysfunction, including but not restricted to, hyper- or hypo-kalemic periodic paralysis, myotonias, malignant hyperthermia, myasthenia, cardiac arrhythmias, episodic ataxia, migraine, Alzheimer's disease, Parkinson's disease, schizophrenia, hyperekplexia, anxiety, depression, phobic obsessive symptoms, neuropathic pain, inflammatory pain, chronic/acute pain, Bartter 's syndrome, polycystic kidney disease, Dent's disease, hyperinsulinemic hypoglycemia of infancy, cystic fibrosis, congenital stationary night blindness or total colour-blindness .
- a screening assay may include a cell-based assay utilising eukaryotic or prokaryotic host cells that are stably transformed with recombinant molecules expressing the polypeptides or fragments of the invention, in competitive binding assays.
- Binding assays will measure the formation of complexes between a specific mutant ion channel subunit polypeptide or ion channel incorporating a mutant ion channel subunit polypeptide, and the compound being tested, or will measure the degree to which a compound being tested will inhibit or restore the formation of a complex between a specific mutant ion channel subunit polypeptide or ion channel incorporating a mutant ion channel subunit polypeptide, and its interactor or ligand.
- the invention is particularly useful for screening compounds by using the polypeptides of the invention in transformed cells, transfected or injected oocytes, or animal models bearing mutated ion channel subunits such as transgenic animals or gene targeted (knock-in) animals (see transformed hosts) .
- Drug candidates can be added to cultured cells that express a single mutant ion channel subunit or combination of mutant ion channel subunits (appropriate wild-type ion channel subunits should also be expressed for receptor assembly) , can be added to oocytes transfected or injected with either a mutant ion channel subunit or combination of mutant ion channel subunits (appropriate wild-type ion channel subunits must also be injected for receptor assembly) , or can be administered to an animal model containing a mutant ion channel or combination of mutant ion channels . Determining the ability of the test compound to modulate mutant ion channel activity can be accomplished by a number of techniques known in the art. These include for example measuring the effect on the current of the channel (e.g.
- Non cell-based assays may also be used for identifying compounds that can inhibit or restore binding between the polypeptides of the invention or ion channels incorporating the polypeptides of the invention, and their interactors .
- Such assays are known in the art and include for example AlphaScreen technology (PerkinElmer Life Sciences, MA, USA) .
- This application relies on the use of beads such that each interaction partner is bound to a separate bead via an antibody . Interaction of each partner will bring the beads into proximity, such that laser excitation initiates a number of chemical reactions ultimately leading to fluorophores emitting a light signal .
- Candidate compounds that inhibit the binding of the mutant ion channel subunit, or ion channel incorporating the mutant subunit, with its interactor will result in loss of light emission, while candidate compounds that restore the binding of the mutant ion channel subunit, or ion channel incorporating the mutant subunit, with its interactor will result in positive light emission.
- High-throughput drug screening techniques may also employ methods as described in WO84/03564.
- Small peptide test compounds synthesised on a solid substrate can be assayed for mutant ion channel subunit polypeptide or mutant ion channel binding . Bound mutant ion channel or mutant ion channel subunit polypeptide is then detected by methods well known in the art.
- purified polypeptides of the invention can be coated directly onto plates to identify interacting test compounds .
- the invention also contemplates the use of competition drug screening assays in which neutralizing antibodies capable of specifically binding the mutant ion channel compete with a test compound for binding thereto .
- the antibodies can be used to detect the presence of any peptide that shares one or more antigenic determinants of the mutant ion channel.
- the polypeptides of the present invention may also be used for screening compounds developed as a result of combinatorial library technology. This provides a way to test a large number of different substances for their ability to modulate activity of a polypeptide.
- a substance identified as a modulator of polypeptide function may be peptide or non-peptide in nature. Non-peptide "small molecules" are often preferred for many in vivo pharmaceutical applications. In addition, a mimic or mimetic of the substance may be designed for pharmaceutical use.
- mimetics based on a known pharmaceutically active compound is a common approach to the development of novel pharmaceuticals. This is often desirable where the original active compound is difficult or expensive to synthesise or where it provides an unsuitable method of administration.
- a mimetic particular parts of the original active compound that are important in determining the target property are identified. These parts or residues constituting the active region of the compound are known as its pharmacophore . Once found, the pharmacophore structure is modelled according to its physical properties using data from a range of sources including x-ray diffraction data and NMR. A template molecule is then selected onto which chemical groups which mimic the pharmacophore can be added.
- the selection can be made such that the mimetic is easy to synthesise, is likely to be pharmacologically acceptable, does not degrade in vivo and retains the biological activity of the lead compound. Further optimisation or modification can be carried out to select one or more final mimetics useful for in vivo or clinical testing. It is also possible to isolate a target-specific antibody and then solve its crystal structure . In principle, this approach yields a pharmacophore upon which subsequent drug design can be based as described above. It may be possible to avoid protein crystallography altogether by generating anti-idiotypic antibodies (anti- ids) to a functional, pharmacologically active antibody.
- anti- ids anti-idiotypic antibodies
- the binding site of the anti-ids would be expected to be an analogue of the original receptor.
- the anti-id could then be used to isolate peptides from chemically or biologically produced peptide banks .
- Another alternative method for drug screening relies on structure-based rational drug design. Determination of the three dimensional structure of the polypeptides of the invention, or the three dimensional structure of the ion channels which incorporate these polypeptides allows for structure-based drug design to identify biologically active lead compounds .
- Three dimensional structural models can be generated by a number of applications, some of which include experimental models such as x-ray crystallography and NMR and/or from in silico studies of structural databases such as the Protein Databank (PDB) .
- PDB Protein Databank
- three dimensional structural models can be determined using a number of known protein structure prediction techniques based on the primary sequences of the polypeptides (e.g. SYBYL - Tripos Associated, St. Louis, MO) , de novo protein structure design programs (e.g. MODELER - MSI Inc., San Diego, CA, or MOE - Chemical Computing Group, Montreal, Canada) or ah initio methods (e.g. see US Patent Numbers 5331573 and 5579250) .
- structure- based drug discovery techniques can be employed to design biologically-active compounds based on these three dimensional structures.
- Such techniques are known in the art and include examples such as DOCK (University of California, San Francisco) or AUTODOCK (Scripps Research Institute, La Jolla, California) .
- a computational docking protocol will identify the active site or sites that are deemed important for protein activity based on a predicted protein model .
- Molecular databases such as the Available Chemicals Directory (ACD) are then screened for molecules that complement the protein model .
- ACD Available Chemicals Directory
- compositions for use in accordance with the present invention can be formulated in a conventional manner using one or more physiological acceptable carriers, excipients or stabilisers whi ⁇ h are well known.
- Acceptable carriers, excipients or stabilizers are non-toxic at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including absorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins ; binding agents including hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides , and other carbohydrates including glucose, mannose, or dextrins ; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or non-ionic surfactants such as Tween, Pluronics or polyethylene glycol (PEG) .
- buffers such as phosphate, citrate, and other organic acids
- antioxidants including absorbic
- compositions for use in accordance with the present invention will be based on the proposed route of administration.
- Routes of administration may include, but are not limited to, inhalation, insufflation (either through the mouth or nose), oral, buccal, rectal or parental administration.
- Polynucleotide sequences encoding an ion channel subunit may be used for the diagnosis or prognosis of epilepsy, as well as other as other disorders associated with ion channel dysfunction, including but not restricted to, hyper- or hypo-kalemic periodic paralysis, myotonias, malignant hyperthermia, myasthenia, cardiac arrhythmias, episodic ataxia, migraine, Alzheimer's disease, Parkinson's disease, schizophrenia, hyperekplexia, anxiety, depression, phobic obsessive symptoms, neuropathic pain, inflammatory pain, chronic/acute pain, Bartter 's syndrome, polycystic kidney disease, Dent's disease, hyperinsulinemic hypoglycemia of infancy, cystic fibrosis, congenital stationary night blindness or total colour-blindness, and the use of the nucleic acid molecules incorporated as part of the invention in diagnosis or prognosis of these disorders, or a predisposition to these disorders,
- the nucleic acid molecules incorporating the novel mutation events laid out in Table 1 may be used for this purpose .
- the polynucleotides that may be used for diagnostic or prognostic purposes include oligonucleotide sequences, genomic DNA and complementary RNA and DNA molecules .
- the polynucleotides may be used to detect and quantitate gene expression in biological samples .
- Genomic DNA used for the diagnosis or prognosis may be obtained from body cells, such as those present in the blood, tissue biopsy, surgical specimen, or autopsy material.
- the DNA may be isolated and used directly for detection of a specific sequence or may be amplified by the polymerase chain reaction (PCR) prior to analysis.
- PCR polymerase chain reaction
- RNA or cDNA may also be used, with or without PCR amplification.
- nucleotide sequences of the invention may be useful in assays that detect the presence of associated disorders, particularly those mentioned previously.
- the nucleotide sequences may be labelled by standard methods and added to a fluid or tissue sample from a patient under conditions suitable for the formation of hybridisation complexes. After a suitable incubation period, the sample is washed and the signal is quantitated and compared with a standard value . If the amount of signal in the patient sample is significantly altered in comparison to a control sample then the presence of altered levels of nucleotide sequences in the sample indicates the presence of the associated disorder.
- Such assays may also be used to evaluate the efficacy of a particular therapeutic treatment regimen in animal studies, in clinical trials, or to monitor the treatment of an individual patient.
- the nucleotide sequence of each gene can be compared between normal tissue and diseased tissue in order to establish whether the patient expresses a mutant gene.
- a normal or standard profile for expression is established. This may be accomplished by combining body fluids or cell extracts taken from normal subjects, either animal or human, with a sequence, or a fragment thereof, encoding the relevant ion channel subunit gene, under conditions suitable for hybridisation or amplification.
- Standard hybridisation may be quantified by comparing the values obtained from normal subjects with values from an experiment in which a known amount of a substantially purified polynucleotide is used.
- Another method to identify a normal or standard profile for expression of an ion channel subunit gene is through quantitative RT-PCR studies .
- RNA isolated from body cells of a normal individual is reverse transcribed and real-time PCR using oligonucleotides specific for the relevant gene is conducted to establish a normal level of expression of the gene.
- Standard values obtained in both these examples may be compared with values obtained from samples from patients who are symptomatic for a disorder. Deviation from standard values is used to establish the presence of a disorder.
- hybridisation assays or quantitative RT-PCR studies may be repeated on a regular basis to determine if the level of expression in the patient begins to approximate that which is observed in the normal subject.
- the results obtained from successive assays may be used to show the efficacy of treatment over a period ranging from several days to months .
- a polypeptide as described above in the diagnosis or prognosis of epilepsy as well as other disorders associated with ion channel dysfunction, including but not restricted to, hyper- or hypo-kalemic periodic paralysis, myotonias, malignant hyperthermia, myasthenia, cardiac arrhythmias, episodic ataxia, migraine, Alzheimer's disease, Parkinson's disease, schizophrenia, hyperekplexia, anxiety, depression, phobic obsessive symptoms, neuropathic pain, inflammatory pain, chronic/acute pain, Bartter 's syndrome, polycystic kidney disease, Dent's disease, hyperinsulinemic hypoglycemia of infancy, cystic fibrosis, congenital stationary night blindness or total colour-blindness.
- diagnosis or prognosis can be achieved by monitoring differences in the electrophoretic mobility of normal and mutant proteins that form the ion channel. Such an approach will be particularly useful in identifying mutants in which charge substitutions are present, or in which insertions, deletions or substitutions have resulted in a significant change in the electrophoretic migration of the resultant protein.
- diagnosis or prognosis may be based upon differences in the proteolytic cleavage patterns of normal and mutant proteins , diff rences in molar ratios of the various amino acid residues , or by functional assays demonstrating altered function of the gene products.
- antibodies that specifically bind mutant ion channels may be used for the diagnosis or prognosis of a disorder, or in assays to monitor patients being treated with a complete ion channel or agonists, antagonists, modulators or inhibitors of an ion channel.
- Antibodies useful for diagnostic or prognostic purposes may be prepared in the same manner as described above for therapeutics .
- Diagnostic or prognostic assays for ion channels include methods that utilize the antibody and a label to detect a mutant ion channel in human body fluids or in extracts of cells or tissues.
- the antibodies may be used with or without modification, and may be labelled by covalent or non-covalent attachment of a reporter molecule .
- a variety of protocols for measuring the presence of mutant ion channels including but not restricted to, ELISAs, RIAs , and FACS, are known in the art and provide a basis for diagnosing or prognosing a disorder.
- the expression of a mutant ion channel or combination of mutant ion channels is established by combining body fluids or cell extracts taken from test mammalian subjects, preferably human, with antibody to the ion channel or channels under conditions suitable for complex formation .
- the amount of complex formation may be quantitated by various methods , preferably by photometric means .
- Antibodies specific for the mutant ion channels will only bind to individuals expressing the said mutant ion channels and not to individuals expressing only wild- type channels (ie normal individuals) .
- Treatments can be directed to amend the combination of ion channel subunit mutations or may be directed to one mutation .
- Microarray In further embodiments , complete cDNAs , oligonucleotides or longer fragments derived from any of the polynucleotide sequences described herein may be used as probes in a microarray.
- the microarray can be used to diagnose or prognose epilepsy, as well as other disorders associated with ion channel dysfunction, through the identification of genetic variants , mutations , and polymorphisms in the ion channel subunits that form part of the invention, to understand the genetic basis of a disorder, or can be used to develop and monitor the activities of therapeutic agents .
- tissue material obtained from genetically modified non-human animal models generated as a result of the identification of specific ion channel subunit human mutations can be used in microarray experiments. These experiments can be condu ⁇ ted to identify the level of expression of specific ion channel subunits, or the level of expression of any ⁇ DNA ⁇ lone from whole-tissue libraries, in diseased tissue as opposed to normal ⁇ ontrol tissue.
- the present invention also provides for the production of genetically modified (knock-out, kno ⁇ k-in and transgeni ⁇ ) , non-human animal models ⁇ omprising nu ⁇ lei ⁇ a ⁇ id molecules containing the novel ion ⁇ hannel mutations or variants as laid out in Table 1.
- mice are useful for the study of the fun ⁇ tion of ion ⁇ hannels, to study the me ⁇ hanisms by whi ⁇ h ⁇ ombinations of mutations in ion ⁇ hannel subunits intera ⁇ t to give rise to disease and the effe ⁇ ts of these mutations on tissue development, for the s ⁇ reening of ⁇ andidate pharma ⁇ euti ⁇ al ⁇ ompounds , for the ⁇ reation of explanted mammalian ⁇ ell ⁇ ultures whi ⁇ h express mutant ion ⁇ hannels or ⁇ ombinations of mutant ion ⁇ hannels , and for the evaluation of potential therapeuti ⁇ interventions .
- Animal spe ⁇ ies whi ⁇ h are suitable for use in the animal models of the present invention in ⁇ lude, but are not limited to, rats, mi ⁇ e, hamsters, guinea pigs, rabbits, dogs, ⁇ ats , goats, sheep, pigs, and non-human primates su ⁇ h as monkeys and ⁇ himpanzees .
- geneti ⁇ ally modified mi ⁇ e and rats are highly desirable due to the relative ease in generating kno ⁇ k-in, kno ⁇ k-out or transgeni ⁇ s of these animals , their ease of maintenan ⁇ e and their shorter life spans .
- transgeni ⁇ yeast or invertebrates may be suitable and preferred be ⁇ ause they allow for rapid s ⁇ reening and provide for mu ⁇ h easier handling.
- non-human primates may be desired due to their similarity with humans .
- any mutant ion ⁇ hannel subunit gene of the invention ⁇ an be inserted into a mouse germ line using standard te ⁇ hniques su ⁇ h as oo ⁇ yte mi ⁇ roinje ⁇ tion.
- Gain of gene fun ⁇ tion ⁇ an mean the over-expression of a gene and its protein produ ⁇ t, or the gene i ⁇ ⁇ omplementation of a mutation of the gene under investigation.
- oo ⁇ yte inje ⁇ tion one or more ⁇ opies of the mutant gene ⁇ an be inserted into the pronu ⁇ leus of a just-fertilized mouse oo ⁇ yte. This oo ⁇ yte is then reimplanted into a pseudo-pregnant foster mother.
- the live-born mi ⁇ e ⁇ an then be s ⁇ reened for integrants using analysis of ail DNA for the presen ⁇ e of the relevant human ion ⁇ hannel subunit gene sequence.
- the transgene can be either a complete genomic sequence injected as a YAC, BAC, PAC or other chromosome DNA fragment, a cDNA with either the natural promoter or a heterologous promoter, or a minigene ⁇ ontaining all of the ⁇ oding region and other elements found to be ne ⁇ essary for optimum expression.
- a minigene ⁇ ontaining all of the ⁇ oding region and other elements found to be ne ⁇ essary for optimum expression to generate kno ⁇ k-out mi ⁇ e or kno ⁇ k-in mi ⁇ e, gene targeting through homologous re ⁇ ombination in mouse embryoni ⁇ stem (ES) ⁇ ells may be applied.
- Kno ⁇ k-out mi ⁇ e are generated to study loss of gene fun ⁇ tion in vivo while kno ⁇ k-in mi ⁇ e (whi ⁇ h are preferred) allow the study of gain of fun ⁇ tion or to study the effe ⁇ t of spe ⁇ ifi ⁇ gene mutations .
- Kno ⁇ k-in mi ⁇ e are similar to transgeni ⁇ mi ⁇ e however the integration site and ⁇ opy number are defined in the former.
- gene targeting ve ⁇ tors ⁇ an be designed su ⁇ h that they delete (kno ⁇ k-out) the protein ⁇ oding sequence of the relevant ion channel subunit gene in the mouse genome.
- knock-in mice can be produ ⁇ ed whereby a gene targeting ve ⁇ tor containing the relevant ion channel subunit gene ⁇ an integrate into a defined geneti ⁇ locus in the mouse genome.
- homologous recombination is catalysed by specifi ⁇ DNA repair enzymes that re ⁇ ognise homologous DNA sequences and exchange them via double crossover .
- Gene targeting vectors are usually introduced into ES cells using electroporation .
- ES ⁇ ell integrants are then isolated via an antibioti ⁇ resistance gene present on the targeting vector and are subsequently genotyped to identify those ES ⁇ ell ⁇ lones in which the gene under investigation has integrated into the locus of interest.
- conditional gene targeting may be employed. This allows genes to be deleted in a temporally and spatially ⁇ ontrolled fashion .
- appropriate ES ⁇ ells are transmitted through the germline to produ ⁇ e a novel mouse strain, however the a ⁇ tual deletion of the gene is performed in the adult mouse in a tissue spe ⁇ ifi ⁇ or time controlled manner.
- Conditional gene targeting is most commonly a ⁇ hieved by use of the ⁇ re/lox system.
- the enzyme are is able to re ⁇ ognise the 34 base pair loxP sequence su ⁇ h that loxP flanked (or floxed) DNA is re ⁇ ognised and ex ⁇ ised by ⁇ re .
- Tissue spe ⁇ ifi ⁇ are expression in transgeni ⁇ mi ⁇ e enables the generation of tissue spe ⁇ ifi ⁇ knock-out mice by mating gene targeted floxed mi ⁇ e with ere transgenic mice . Knock-out can be condu ⁇ ted in every tissue (Schwenk et al .
- Figure 1 provides an example of ion channel subunit stoichiometry and the effe ⁇ t of multiple versus single ion channel subunit mutations.
- Figure IA A typical channel may have five subunits of three different types .
- Figure IB In outbred populations complex diseases such as idiopathic generalized epilepsies may be due to mutations in two (or more) different subunit genes. Because only one allele of each subunit gene is abnormal , half the expressed subunits will have the mutation.
- Figure IC In inbred populations, both alleles of a single subunit gene will be affe ⁇ ted, so all expressed subunits will be mutated.
- Figure ID Autosomal dominant disorders ⁇ an be attributed to single ion ⁇ hannel subunit mutations that give rise to severe functional consequences .
- Figure 2 represents the location of mutations identified in the KCNQ2 ion channel subunit constituting the potassium ⁇ hannel. M: Missense mutation; T: Trun ⁇ ation mutation; F: Frameshift mutation; S: Spli ⁇ e site mutation.
- Figure 3 provides examples of epilepsy pedigrees where mutation profiles of ion channel subunits for individuals constituting the pedigree have begun to be determined.
- FIG. 4 shows the results of yeast two-hybrid analysis of R353G and L619R KCNQ2 mutants.
- Yeast were transformed with the empty DB (BAIT) plasmid (DBLeu) , DB- Q2C wt, DB-Q2C R353G mutant or the DB-Q2 L619R mutant as indicated in A and the AD-CaM (TARGET) vector was introduced by gap-repair.
- Yeast ⁇ ontrol strains InvitrogenTM were in ⁇ luded on all plates for comparison. Control 1 has no interaction.
- Control 2 has a weak interaction.
- Control 3 has a moderately strong interaction.
- Control 4 has a strong intera ⁇ tion and control 5 has a very strong interaction.
- B Growth of transformed yeast and controls on -leu -tryp selection. Yeast ⁇ an grow on -leu if they ⁇ ontain the DB plasmid, and -tryp if they have AD plasmid.
- C Growth of transformed yeast and ⁇ ontrols on -leu -tryp -his +40mM 3AT after 48hrs . Yeast ⁇ an grow on -his+3AT if the his reporter gene is a ⁇ tivated by interaction between the BAIT and TARGET plasmids.
- D-F Growth of transformed yeast and controls on -leu -tryp selection. Yeast ⁇ an grow on -leu if they ⁇ ontain the DB plasmid, and -tryp if they have AD plasmid.
- LacZ Filter assay for interaction between BAIT and TARGET plasmids photos taken after 2hrs (D) , 7hrs (E) and 24hrs (F) .
- Activation of the ⁇ -galactosidase reporter gene by interaction of the BAIT and TARGET plasmids leads to the dark appearance of colonies.
- Figure 5 shows the results of CaM affinity experiments with the R353G and L619R KCNQ2 mutants.
- the ⁇ hart below shows the values from the CPRG assay for ⁇ - galactosidase a ⁇ tivity as a measure of KCNQ2C-CaM binding efficien ⁇ y.
- the area of ea ⁇ h bar in the ⁇ hart equates to the CaM binding efficiency of the BAIT.
- Broken lines indicate statistical comparison by Student' s t test * P ⁇ 0.01, ** P ⁇ 0.001.
- Potassium channels are the most diverse class of ion channel.
- the C. elegans genome encodes about 80 different potassium channel genes and there are probably more in mammals.
- About ten potassium channel genes are known to be mutated in human disease and include four members of the KCNQ gene sub-family of potassium channels.
- KCNQ proteins have six transmembrane domains, a single P-loop that forms the selectivity filter of the pore, a positively charged fourth transmembrane domain that probably acts as a voltage sensor, and intra ⁇ ellular amino and carboxy termini.
- the C-terminus is long and contains a conserved "A domain" followed by a short stret ⁇ h thought to be involved in subunit assembly.
- KCNQ subunits are thought to combine to form a functional potassium channel. All five known KCNQ proteins ⁇ an form homomeri ⁇ ⁇ hannels in vitro and the formation of heteromers appears to be restri ⁇ ted to ⁇ ertain combinations. For instance KCNQ2 and KCNQ3 , which are predominantly expressed in the central nervous system, form a heteromultimeric ⁇ hannel that mediates the neuronal mus ⁇ arinic-regulated ⁇ urrent (M-current) , also known as the M-channel (or M-type K + ⁇ hannel) .
- M-current neuronal mus ⁇ arinic-regulated ⁇ urrent
- the M- ⁇ urrent is a slowly a ⁇ tivating, non-ina ⁇ tivating potassium ⁇ ondu ⁇ tan ⁇ e known to regulate neuronal ex ⁇ itability by determining the firing properties of neurons and their responsiveness to synapti ⁇ input (Wang et al . , 1998) . Be ⁇ ause it is the only ⁇ urrent a ⁇ tive at voltages near the threshold for a ⁇ tion potential initiation, the M- ⁇ urrent has a major impa ⁇ t on neuronal ex ⁇ itability.
- Sodium (the alpha subunit) and cal ⁇ ium channels are thought to have evolved from the potassium channel subunit, and they each consist of four domains covalently linked as the one molecule, each domain being equivalent to one of the subunits that asso ⁇ iate to form the potassium ⁇ hannel.
- Ea ⁇ h of the four domains of the sodium and calcium channels are comprised of six transmembrane segments .
- Voltage-gated sodium channels are required to generate the electrical excitation in neurones, heart and skeletal muscle fibres, whi ⁇ h express tissue spe ⁇ ifi ⁇ isoforms .
- Sodium ⁇ hannels are heteromers of a pore forming alpha subunit and a modulatory beta-1 subunit, with an additional beta-2 subunit in neuronal ⁇ hannels.
- Ten genes en ⁇ oding sodium ⁇ hannel alpha subunits and 3 genes en ⁇ oding different beta subunits have so far been identified.
- the beta subunits of the sodium ⁇ hannels do not asso ⁇ iate with the alpha subunits to form any part of the pore, they do however affe ⁇ t the way the alpha pore forming subunit fun ⁇ tions .
- calcium channels consist of a single pore forming alpha subunit, of which at least six types have been identified to date, and several a ⁇ essory subunits in ⁇ luding four beta, one gamma and one alpha2- delta gene. Many of these subunits also encode multiple splice variants adding to the diversity of receptor subunits of this family of ion channels .
- the ion channels in the nAChR/GABA super family show a theoretical pentameric ⁇ hannel .
- Gamma-Aminobutyri ⁇ a ⁇ id (GABA) is the most abundant inhibitory neurotransmitter in the ⁇ entral nervous system.
- GABA-ergi ⁇ inhibition is mediated by two major ⁇ lasses of re ⁇ eptors , type A (GABA- A) and type B (GABA-B) .
- GABA-B re ⁇ eptors are members of the class of receptors coupled to G-proteins and mediate a variety of inhibitory effe ⁇ ts via se ⁇ ondary messenger ⁇ as ⁇ ades .
- GABA-A re ⁇ eptors are ligand-gated chloride channels that mediate rapid inhibition.
- the GABA-A ⁇ hannel has 16 separate, but related, genes en ⁇ oding subunits .
- alpha subunits There are six alpha subunits ( ⁇ l- ⁇ 6) , three beta subunits ( ⁇ l- ⁇ 3) and three gamma subunits ( ⁇ l- ⁇ 3) .
- Each GABA-A receptor ⁇ omprises five subunits whi ⁇ h may, at least in theory, be sele ⁇ ted from any of these subunits .
- Neuronal ni ⁇ otini ⁇ a ⁇ etyl ⁇ holine re ⁇ eptors nAChRs
- nAChRs Neuronal ni ⁇ otini ⁇ a ⁇ etyl ⁇ holine re ⁇ eptors
- the alpha subunits are chara ⁇ terised by adja ⁇ ent ⁇ ysteine residues at amino a ⁇ id positions 192 and 193, and the beta subunits by the la ⁇ k of these ⁇ ysteine residues.
- nAChR subtype is ⁇ omposed of alpha-4 and beta-2 subunits .
- the transmembrane 2 (M2) segments of the subunits are arranged as alpha heli ⁇ es and ⁇ ontribute to the walls of the neurotransmitter-gated ion ⁇ hannel .
- the alpha heli ⁇ es appear to be kinked and orientated in su ⁇ h a way that the side ⁇ hains of the highly ⁇ onserved M2-leu ⁇ ine residues proje ⁇ t inwards when the ⁇ hannel is ⁇ losed.
- ACh is thought to cause a conformational change by altering the association of the amino acid residues of M2.
- the opening of the ⁇ hannel seems to be due to rotations of the gate forming side chains of the amino acid residues ; the conserved polar serines and threonines may form the ⁇ riti ⁇ al gate in the open ⁇ hannel.
- Example 1 Identification of mutations in ion channels Previous studies by reference (Wallace et al .
- voltage-gated e.g SCNlA, SCNlB, KCNQ2 , KCNQ3
- ligand-gated eg CHRNA4 , CHRNB2 , GABRG2 , GABRD
- Ea ⁇ h gene was subsequently s ⁇ reened for sequen ⁇ e ⁇ hanges using single strand conformation polymorphism (SSCP) analysis in a large sample of epileptics with common sporadi ⁇ IGE subtypes eg juvenile myo ⁇ loni ⁇ epilepsy (JME) , ⁇ hildhood absence epilepsy (CAE) , juvenile absence epilepsy (JAE) and epilepsy with generalized tonic-cloni ⁇ seizures (TCS) .
- SSCP single strand conformation polymorphism
- the coding sequen ⁇ e for each of the ion channel subunits was aligned with human genomic sequen ⁇ e present in available databases at the National Centre for Biote ⁇ hnology Information (NCBI) .
- NCBI National Centre for Biote ⁇ hnology Information
- the BLASTN algorithm was typically used for sequence alignment and resulted in the genomic organisation (intron-exon stru ⁇ ture) of each gene being determined. Where genomic sequence for an ion ⁇ hannel subunit was not available, BACs or PACs ⁇ ontaining the relevant ion ⁇ hannel subunit were identified through s ⁇ reening of high density filters ⁇ ontaining these ⁇ lones and were subsequently sequenced.
- Example 2 Sample preparation for SSCP screening A large ⁇ olle ⁇ tion of individuals affe ⁇ ted with epilepsy have undergone ⁇ areful ⁇ lini ⁇ al phenotyping and additional data regarding their family history has been ⁇ ollated. Informed ⁇ onsent was obtained from ea ⁇ h individual for blood ⁇ ollection and its use in subsequent experimental procedures . Clinical phenotypes incorporated classi ⁇ al IGE ⁇ ases as well as GEFS+ and febrile seizure cases . DNA was extracted from colle ⁇ ted blood using the QIAamp DNA Blood Maxi kit (Qiagen) a ⁇ ording to manufa ⁇ turers spe ⁇ ifi ⁇ ations or through pro ⁇ edures adapted from Wyman and White (1980) .
- Qiagen QIAamp DNA Blood Maxi kit
- Example 3 Identifi ⁇ ation of sequen ⁇ e alterations in ion ⁇ hannel genes SSCP analysis of spe ⁇ ifi ⁇ ion ⁇ hannel exons followed by sequen ⁇ ing of SSCP bandshifts was per ormed on ' individuals ⁇ onstituting the 96-well plates to identify sequen ⁇ e alterations. Primers used for SSCP were labelled at their 5' end with HEX and typi ⁇ al PCR rea ⁇ tions were performed in a total volume of 10 ⁇ l .
- PCR rea ⁇ tions were typi ⁇ ally performed using 10 ⁇ y ⁇ les of 94°C for 30 se ⁇ onds , 60°C for 30 se ⁇ onds , and 72°C for 30 se ⁇ onds followed by 25 ⁇ y ⁇ les of 94°C for 30 se ⁇ onds, 55°C for 30 se ⁇ onds, and 72°C for 30 se ⁇ onds. A final extension rea ⁇ tion for 10 minutes at 72°C followed.
- Identical twins have the same pair of mutated subunits and the same minor alleles so the sub-syndromes are identical.
- Affected sib-pairs, including dizygous twins, with the same sub-syndrome would also have the same pair of mutated subunits, but differences in minor alleles would lead to less similarity than with monozygous twins .
- Some sib-pairs and dizygous twins have quite different sub-syndromes ; this would be due to different combinations of mutated subunits , when the parents have more than two mutated alleles between them.
- the two mutated alleles of the digenic model are the same and thus result in a true autosomal recessive disorder. Because all affe ⁇ ted individuals have the same pair of mutated alleles, and a similar geneti ⁇ ba ⁇ kground, the phenotypes are very similar . In outbred communities approximately 1% of the population would have IGE genotypes (2 mutated alleles) and 0.3% would clini ⁇ ally express IGE. Most of these would have mutations in two different ⁇ hannel subunits . In su ⁇ h communities most cases would appear "sporadic" as the risk to first degree relatives would be less than 10% .
- the frequen ⁇ y of matings with no abnormal alleles (0 x 0) is .72 (.8485 2 ), for 1 x 0 and 0 x 1 matings .24 (2 x .8485 x .1413), for a 1 x 1 mating .020, and for 2 x 0 and 0 2 matings .0166 et ⁇ . From this distribution of matings the freguen ⁇ y of ⁇ hildren with 2 or more abnormal alleles ⁇ an be shown to be .01.
- the 0 x 2 and 2 x 0 matings ⁇ ontribute .0033 of this .01 frequen ⁇ y (.0166 [mating frequen ⁇ y] x .2 [ ⁇ han ⁇ e of that mating produ ⁇ ing a ⁇ hild with 2 or more abnormal alleles] ) .
- To determine parental risk it ⁇ an be shown that of ⁇ hildren with 2 abnormal alleles (IGE genotype), .49 derive from l x l matings where no parent is affe ⁇ ted, .33 derive from a 2 x 0 and 0 2 matings et ⁇ .
- the ⁇ riti ⁇ al postulate is that two mutations, usually, but not ex ⁇ lusively, in different subunit alleles ("digeni ⁇ model") , are required for ⁇ lini ⁇ al expression of IGE .
- subunit mutations with more severe functional consequences cause autosomal dominant generalized epilepsies with a penetrance of 60-90%.
- Su ⁇ h "severe" mutations are rare (allele frequen ⁇ y ⁇ 0.01%) and are infrequent ⁇ auses of GEFS + . They very rarely, or perhaps never, ⁇ ause ⁇ lassi ⁇ al IGE.
- the relative separate segregation of ⁇ lassi ⁇ al IGE and GEFS + phenotypes is an ane ⁇ dotal ⁇ lini ⁇ al observation of ours (Singh et al .
- Figure 3 provides results from some of these profiles.
- Figure 3A shows a 3 generation family in which individual III-l has myocloni ⁇ astatic epilepsy and contains a N43del mutation in the SCN3A gene as well as an A1067T mutation in the SCNlA gene.
- Individual 1-1 also has the SCN3A mutation but alone this mutation is not suffi ⁇ ient to ⁇ ause epilepsy in this individual .
- the SCN3A mutation has likely been inherited from the grandfather through the mother, while the SCNlA mutation is likely to arise from the father. Both parents are unaffe ⁇ ted but have yet to be s ⁇ reened for the presen ⁇ e of the mutations in these subunits. Individual II-l is likely to ⁇ ontain an as yet unidentified ion ⁇ hannel subunit mutation a ⁇ ting in ⁇ o-operation with the SCN3A mutation already identified in this individual .
- Figure 3B is another 3 generation family in whi ⁇ h individual III-l has myo ⁇ loni ⁇ astati ⁇ epilepsy due to a ⁇ ombination of the same SCN3A and SCNlA mutations as above.
- Example 5 Analysis of ion channels and ion channel subunits
- Procedures such as the yeast two-hybrid system ⁇ an be used to dis ⁇ over and identify su ⁇ h interacting proteins .
- the principle behind the yeast two-hybrid procedure is that many eukaryotic transcriptional activators , in ⁇ luding those in yeast, ⁇ onsist of two discrete modular domains . The first is a DNA-binding domain that binds to a specifi ⁇ promoter sequence and the second is an activation domain that directs the RNA polymerase II complex to transcribe the gene downstream of the DNA binding site . Both domains are required for transcriptional activation as neither domain ⁇ an activate trans ⁇ ription on its own.
- the gene of interest or parts thereof (BAIT)
- BAIT the gene of interest or parts thereof
- a se ⁇ ond gene, or number of genes , such as those from a cDNA library (TARGET) is ⁇ loned so that it is expressed as a fusion to an activation domain.
- Interaction of the protein of interest with its binding partner brings the DNA-binding peptide together with the activation domain and initiates transcription of the reporter genes .
- the first reporter gene will select for yeast cells that ⁇ ontain intera ⁇ ting proteins (this reporter is usually a nutritional gene required for growth on selective media) .
- the second reporter is used for ⁇ onfirmation and while being expressed in response to intera ⁇ ting proteins it is usually not required for growth .
- KCNQ2 intera ⁇ tors Despite the identifi ⁇ ation of a number of KCNQ2 mutations responsible for epilepsy, including those of the present study, the underlying biologi ⁇ al mechanisms responsible for the epilepsy remains largely uncharacterized. Towards identifying these me ⁇ hanisms, the large intra ⁇ ellular C-terminal region of KCNQ2 was s ⁇ reened for intera ⁇ tions with other proteins using the yeast-two hybrid procedure. The C-terminus ac ⁇ ounts for 63% of the KCNQ2 protein and, in common with other KCNQ subunits, contains a conserved ⁇ A domain' (Jentsch, 2000; Schwake et al .
- a yeast two-hybrid s ⁇ reen was ⁇ arried out using the ProQuestTM Two-Hybrid System with GatewayTM Te ⁇ hnology (InvitrogenTM) a ⁇ ording to manufacturer' s dire ⁇ tions .
- a KCNQ2 C-terminal entry (BAIT) ⁇ lone was generated using the pENTR Dire ⁇ tional TOPO ® Cloning Kit (InvitrogenTM) .
- KCNQ2F 5' -CACCAAGGTTCAGGAGCAGCACAGG-3'
- KCNQ2R 5' -TCACTTCCTGGGCCCGGCCCAGCC-3'
- the 1611 base pair cloned fragment included exon 10a (found in all our amplified clones) , corresponding to amino acid 373-382 of the KCNQ2 protein.
- the extra 30 base pairs (10 amino acids) were included in our numbering.
- the PCR-produ ⁇ t was cloned into the pENTR/D-TOPO ® vector (InvitrogenTM) via the TOP ⁇ " Cloning reaction ac ⁇ ording to the manufacturer's instructions. Following sequen ⁇ e verifi ⁇ ation, the KCNQ2 cDNA fragment was then subcloned into pDESTTM32, the DNA Binding domain (DB) GatewayTM Destination Ve ⁇ tor (InvitrogenTM) . The ProQuestTM Two-Hybrid human brain cDNA Library (TARGET) with GatewayTM technology (ResGenTM, InvitrogenTM Corporation) was amplified a ⁇ ording to the manufacturer' s instructions .
- Plasmid DNA was puri ied from the cell pellet using the HiSpeed Plasmid Maxi Kit (Qiagen) ac ⁇ ording to the manufacturer' s instructions. Both the DBLeu (empty bait vector) and DB-KCNQ2 wild- type (wt) C-term BAITS were transformed into the yeast strain Mav203 and plated onto minimal selective media lacking leu ⁇ ine. A dupli ⁇ ate was ⁇ arried out where the empty library TARGET (pAD) vector was co-transformed in addition to each BAIT and plated onto minimal sele ⁇ tive media la ⁇ king leu ⁇ ine (-leu) and tryptophan (-tryp) . Yeast ⁇ ontrol strains (InvitrogenTM) were in ⁇ luded on all plates.
- Control 1 used as a negative ⁇ ontrol , ⁇ ontained empty plasmids pPC97 and pPC86.
- Control 2 had pPC97-RB and pPC86-E2Fl, whi ⁇ h express a relatively weak interaction.
- Control 3 contained plasmids encoding the Drosophila DP (pPC97) and E2F (pPC86) domains that have a moderately strong interaction, and provide a ⁇ ontrol for plasmid shuffling.
- the ⁇ onstru ⁇ ts were tested for self-a ⁇ tivation of the his and ⁇ -gal reporter genes a ⁇ ording to InvitrogenTM instru ⁇ tions .
- ⁇ ompetent yeast ⁇ ells were prepared for ea ⁇ h BAIT (DB-KCNQ2 wt C-term ⁇ onstru ⁇ t) to be s ⁇ reened, transformed with 31 ⁇ g of ProQuestTM Two-Hybrid human brain AD (a ⁇ tivation domain) - ⁇ DNA Library and plated onto minimal sele ⁇ tive media la ⁇ king leu ⁇ ine (-leu) , tryptophan (-tryp) and histidine (-his) and ⁇ ontaining 3-aminotriazole (+3AT) .
- Positive ⁇ olonies from ea ⁇ h s ⁇ reen were PCR-amplified and re- introduced into fresh yeast cells containing the BAIT to re-test for two-hybrid intera ⁇ tion phenotypes. Those giving rise to more than one PCR produ ⁇ t or that failed to re-test positively were systemati ⁇ ally eliminated. Positives that re-tested were sequen ⁇ ed using the ABI PRISM® BigDyeTM Terminators v3.0 te ⁇ hnology. On ⁇ e identified, the sequen ⁇ e of the potential intera ⁇ tor was ⁇ he ⁇ ked to verify it was in the same translational frame as the Gal4p-AD en ⁇ oding sequen ⁇ e of the prey construct.
- the CaM protein is coded by a multigene family consisting of three bona fide members, CALM1 , CALM2 and CALM3. Within the non-coding regions of the CaM transcripts, no striking homology is observed, and ⁇ odon usage is maximally divergent amongst the three CaM mRNAs that en ⁇ ode an identi ⁇ al protein. It has been hypothesised that the existen ⁇ e of a multigene family provides a tight and ⁇ omplex level of regulatory ⁇ ontrol at the level of gene expression (Palfi et al . , 2002) .
- CaM genes are differentially expressed in the CNS during development and differential regulation of the CaM genes appears ne ⁇ essary to maintain the temporal and spatial fidelity of the CaM protein levels in all sub ⁇ ellular domains .
- it is also involved in spe ⁇ ialized neuronal fun ⁇ tions , su ⁇ h as the synthesis and release of neurotransmitters, neurite extension, long-term potentiation and axonal transport (Palfi et al . , 2002).
- R353G F 5'-CGCCACCAACCTCTCGGGCACAGACCTGCACTC-3' R353G R 5'-GAGTGCAGGTCTGTGCCCGAGAGGTTGGTGGCG-3'
- the DB- Q2C L619R mutant showed an even greater growth level on HIS3 sele ⁇ tive plate than the DB-Q2C wt and also appeared to stain faster and more intensely blue in the LacZ filter assay, suggesting a stronger intera ⁇ tion between CaM and this mutant.
- a se ⁇ ond assay was ⁇ arried out using the high sensitivity substrate Chlorophenol Red- ⁇ -D-Gala ⁇ topyranoside (CPRG) in liquid ⁇ ulture.
- CPRG Chlorophenol Red- ⁇ -D-Gala ⁇ topyranoside
- the affinity of the DB-Q2C/AD-CaM intera ⁇ tion was measured in terms of units of ⁇ -gal a ⁇ tivity, with a zero value indi ⁇ ating no expression of the LacZ reporter gene, and hen ⁇ e no intera ⁇ tion .
- a value of 0.05 units ⁇ -gal a ⁇ tivity ( Figure 5) was signifi ⁇ antly different from the empty bait vector replicate (P ⁇ 0.01, Student's £ test), confirming the intera ⁇ tion of the DB-Q2C wt with CaM.
- the CPRG assay showed a signifi ⁇ ant differen ⁇ e in the intera ⁇ tion between the Q2C R353G mutant and CaM as ⁇ ompared to the wt repli ⁇ ate (P ⁇ 0.01, Student's fc test, Figure 4).
- the CPRG assay for the L619R Q2C mutant showed a signifi ⁇ antly higher level of ⁇ -gal a ⁇ tivity units (0.26 units) than the wt repli ⁇ ate (P ⁇ 0.001, Student's t test, Figure 5) .
- This finding indi ⁇ ates that the L619R mutation alters the conformation of the protein in a manner that increases CaM binding affinity for the KCNQ2 C-terminal domain by approximately 5-fold.
- the increased affinity for CaM may affect the ability of the complex to ⁇ hange conformation normally in response to calcium signalling.
- the marked increase in binding of CaM to the KCNQ2 L619R mutant channel may be detrimental to the M- ⁇ hannel fun ⁇ tion via disruption of the normal neuronal inhibitory/ex ⁇ itatory balan ⁇ e, therefore ⁇ ausing the seizures asso ⁇ iated with epilepsy, parti ⁇ ularly BFNS .
- CaM is known to be involved in both the ex ⁇ itatory and inhibitory neurotransmission pathways (Ohya and Botstein, 1994) and it has been proposed that the temporal and spatial restri ⁇ tions on CaM itself ⁇ ould enable the tight ⁇ ontrol of these opposing rea ⁇ tions ( advocatenhoofd and Strehler, 2000) .
- the ⁇ almodulin gene (and other ion ⁇ hannel intera ⁇ ting genes) may therefore be a target for mutation in epilepsy as well as other disorders asso ⁇ iated with ion ⁇ hannel dysfun ⁇ tion.
- a mutation in an ion ⁇ hannel intera ⁇ ting gene when expressed alone, or when expressed in ⁇ ombination with one or more other ion ⁇ hannel mutations or ion ⁇ hannel intera ⁇ ting gene mutations (based on the digeni ⁇ model) may give rise to the disorder.
- the nature of the ion ⁇ hannel intera ⁇ ting genes and proteins ⁇ an be studied su ⁇ h that these partners ⁇ an also be targets for drug discovery.
- mutant ion ⁇ hannel receptor subunits of the invention are useful in the diagnosis and treatment of diseases such as epilepsy and disorders associated with ion channel dysfun ⁇ tion in ⁇ luding, but not limited to, hyper- or hypo-kalemi ⁇ periodi ⁇ paralysis, myotonias, malignant hyperthermia, myasthenia, ⁇ ardia ⁇ arrhythmias, episodi ⁇ ataxia, migraine, Alzheimer's disease, Parkinson's disease, s ⁇ hizophrenia, hyperekplexia, anxiety, depression, phobic obsessive symptoms, neuropathi ⁇ pain, inflammatory pain, ⁇ hroni ⁇ /a ⁇ ute pain, Bartter ' s syndrome, poly ⁇ ysti ⁇ kidney disease, Dent's disease, hyperinsulinemi ⁇ hypogly ⁇ emia of infan ⁇ y, ⁇ ysti ⁇ fibrosis, ⁇ ongenital stationary night blindness and total colour-blindness .
- diseases such as epilepsy and disorders associated with
- Non-coding variants SCN1N Intron 9 IVS9-1G ⁇ A _ 18 SCN1A C Intron 23 IVS23+33G ⁇ A - 19 SCN2A r Intron 7 IVS7+61T-»A - 20 SCN2A r Intron 19 IVS19-55A-»G - 21 SCN2A r Intron 22 IVS22-31A ⁇ G - 22 SCN2A C Intron 2 IVS2-28G-»A - 23 SCN2A C Intron 8 IVS8-3T ⁇ C - 24 SCN2A C Intron 11 IVS11+49A ⁇ G - 25 SCN2A C Intron 11 IVS11-16C ⁇ T - 26 SCN2A C Intron 17 IVS17-71C ⁇ T - 27 SCN2A C Intron 17 IVS17-74delG - 28 SCN2A C Intron 17 IVS17-74insG - 29
- Non-coding variants CHRNA2 C Intron 3 IVS3-16C->T 38 CHRNA3 0 Intron 3 IVS3-5T->C 39 CHRNA3 0 Intron 4 IVS4+8G ⁇ C 40
- Non-coding variants KCNQ2 r Intron 9 IVS9+(46-48)delCCT 48 KCNQ3 r Intron 11 IVS11+43G ⁇ A 49 KCNQ3 C Intron 12 • IVS12+29G ⁇ A 50
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Neurology (AREA)
- Biomedical Technology (AREA)
- Neurosurgery (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Pain & Pain Management (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Cell Biology (AREA)
- Diabetes (AREA)
- Psychiatry (AREA)
- Physical Education & Sports Medicine (AREA)
- General Engineering & Computer Science (AREA)
- Pathology (AREA)
- Hematology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Psychology (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| NZ545185A NZ545185A (en) | 2003-08-07 | 2004-08-06 | Mutations in ion channels |
| JP2006522183A JP2007501601A (ja) | 2003-08-07 | 2004-08-06 | イオンチャネルにおける変異 |
| EP04761088A EP1664324A4 (en) | 2003-08-07 | 2004-08-06 | MUTATIONS IN IONIC CHANNELS |
| US10/567,424 US8129142B2 (en) | 2003-08-07 | 2004-08-06 | Mutations in ion channels |
| CA002534812A CA2534812A1 (en) | 2003-08-07 | 2004-08-06 | Mutations in ion channels |
| AU2004263548A AU2004263548B2 (en) | 2003-08-07 | 2004-08-06 | Mutations in ion channels |
| US11/263,326 US7282336B2 (en) | 2001-07-18 | 2005-10-31 | Method of diagnosing epilepsy |
| US11/262,647 US7709225B2 (en) | 2001-07-18 | 2005-10-31 | Nucleic acids encoding mutations in sodium channels related to epilepsy |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2003904154A AU2003904154A0 (en) | 2003-08-07 | 2003-08-07 | Mutations in ion channels |
| AU2003904154 | 2003-08-07 |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US11/263,326 Continuation US7282336B2 (en) | 2001-07-18 | 2005-10-31 | Method of diagnosing epilepsy |
| US11/262,647 Continuation-In-Part US7709225B2 (en) | 2001-07-18 | 2005-10-31 | Nucleic acids encoding mutations in sodium channels related to epilepsy |
| US11/262,647 Continuation US7709225B2 (en) | 2001-07-18 | 2005-10-31 | Nucleic acids encoding mutations in sodium channels related to epilepsy |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2005014863A1 true WO2005014863A1 (en) | 2005-02-17 |
Family
ID=32476443
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU2004/001051 Ceased WO2005014863A1 (en) | 2001-07-18 | 2004-08-06 | Mutations in ion channels |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US8129142B2 (enExample) |
| EP (1) | EP1664324A4 (enExample) |
| JP (1) | JP2007501601A (enExample) |
| AU (1) | AU2003904154A0 (enExample) |
| CA (1) | CA2534812A1 (enExample) |
| NZ (1) | NZ545185A (enExample) |
| WO (1) | WO2005014863A1 (enExample) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006133508A1 (en) * | 2005-06-16 | 2006-12-21 | Bionomics Limited | Methods of treatment, and diagnosis of epilepsy by detecting mutations in the scn1a gene |
| WO2009006793A1 (en) * | 2007-07-06 | 2009-01-15 | The Chinese University Of Hong Kong | Polymorphisms of scn2a associated with resistance to antiepileptic drugs and use thereof |
| US7723027B2 (en) | 2003-03-27 | 2010-05-25 | Bionomics Limited | Methods for the diagnosis and treatment of epilepsy |
| US7989182B2 (en) | 2001-07-18 | 2011-08-02 | Bionomics Limited | Nucleic acid encoding SCN1A variant |
| US8129142B2 (en) | 2003-08-07 | 2012-03-06 | Bionomics Limited | Mutations in ion channels |
| CN110738599A (zh) * | 2019-10-14 | 2020-01-31 | 北京百度网讯科技有限公司 | 图像拼接方法、装置、电子设备及存储介质 |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2010059077A (ja) * | 2008-09-02 | 2010-03-18 | Osaka Univ | Dysbindin機能調節用組成物 |
| WO2013130808A1 (en) * | 2012-02-29 | 2013-09-06 | D.E. Shaw Research, Llc | Methods for screening voltage gated proteins |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002006521A1 (en) * | 2000-07-18 | 2002-01-24 | Bionomics Limited | Identification of two principal mutations in ion channels associated with idiopathic generalised epilepsies |
| WO2002050096A1 (en) * | 2000-12-20 | 2002-06-27 | Bionomics Limited | Sodium-channel alpha1-subunit and their polypeptides and their treatment of generalised epilepsy with febrile seizures plus |
| WO2003008574A1 (en) * | 2001-07-18 | 2003-01-30 | Bionomics Limited | Mutations in ion channels |
Family Cites Families (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4016043A (en) | 1975-09-04 | 1977-04-05 | Akzona Incorporated | Enzymatic immunological method for the determination of antigens and antibodies |
| US4172124A (en) | 1978-04-28 | 1979-10-23 | The Wistar Institute | Method of producing tumor antibodies |
| US4474893A (en) | 1981-07-01 | 1984-10-02 | The University of Texas System Cancer Center | Recombinant monoclonal antibodies |
| NZ207394A (en) | 1983-03-08 | 1987-03-06 | Commw Serum Lab Commission | Detecting or determining sequence of amino acids |
| US4971903A (en) | 1988-03-25 | 1990-11-20 | Edward Hyman | Pyrophosphate-based method and apparatus for sequencing nucleic acids |
| US5331573A (en) | 1990-12-14 | 1994-07-19 | Balaji Vitukudi N | Method of design of compounds that mimic conformational features of selected peptides |
| NO175199C (no) | 1991-12-05 | 1994-09-14 | Kvaerner Fjellstrand As | Flerskrogfartöy |
| US5646040A (en) | 1995-06-30 | 1997-07-08 | Millennium Pharmaceutical, Inc. | Mammalian tub gene |
| US6331614B1 (en) | 1998-12-23 | 2001-12-18 | Myriad Genetics, Inc. | Human CDC14A gene |
| AU1846501A (en) | 1999-11-26 | 2001-06-04 | Bionomics Limited | Loci for idiopathic generalized epilepsy, mutations thereof and method using same to assess, diagnose, prognose or treat epilepsy |
| AUPQ749100A0 (en) | 2000-05-12 | 2000-06-08 | Bionomics Limited | New epilespy gene |
| NZ522888A (en) | 2000-06-20 | 2005-01-28 | Bionomics Ltd | Mutations in the gamma aminobutyric acid type A receptor subunit ( GABA A ) associated with epilepsy |
| US7709225B2 (en) | 2001-07-18 | 2010-05-04 | Bionomics Limited | Nucleic acids encoding mutations in sodium channels related to epilepsy |
| US7282336B2 (en) | 2001-07-18 | 2007-10-16 | Bionomics Limited | Method of diagnosing epilepsy |
| AU2003904154A0 (en) | 2003-08-07 | 2003-08-21 | Bionomics Limited | Mutations in ion channels |
| EP1474176A4 (en) | 2001-11-26 | 2005-06-15 | Bristol Myers Squibb Co | HUMAN G PROTEIN-COUPLED RECEPTOR, HGPRBMY31, VARIANTS AND METHODS OF USING THE SAME |
| AU2003901425A0 (en) | 2003-03-27 | 2003-04-10 | Bionomics Limited | A diagnostic method for epilepsy |
| JP2008546376A (ja) | 2005-06-16 | 2008-12-25 | バイオノミックス リミテッド | Scn1a遺伝子における変異を検出することによっててんかんを診断および処置するための方法 |
-
2003
- 2003-08-07 AU AU2003904154A patent/AU2003904154A0/en not_active Abandoned
-
2004
- 2004-08-06 CA CA002534812A patent/CA2534812A1/en not_active Abandoned
- 2004-08-06 EP EP04761088A patent/EP1664324A4/en not_active Withdrawn
- 2004-08-06 NZ NZ545185A patent/NZ545185A/en not_active IP Right Cessation
- 2004-08-06 US US10/567,424 patent/US8129142B2/en not_active Expired - Fee Related
- 2004-08-06 WO PCT/AU2004/001051 patent/WO2005014863A1/en not_active Ceased
- 2004-08-06 JP JP2006522183A patent/JP2007501601A/ja active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002006521A1 (en) * | 2000-07-18 | 2002-01-24 | Bionomics Limited | Identification of two principal mutations in ion channels associated with idiopathic generalised epilepsies |
| WO2002050096A1 (en) * | 2000-12-20 | 2002-06-27 | Bionomics Limited | Sodium-channel alpha1-subunit and their polypeptides and their treatment of generalised epilepsy with febrile seizures plus |
| WO2003008574A1 (en) * | 2001-07-18 | 2003-01-30 | Bionomics Limited | Mutations in ion channels |
Non-Patent Citations (3)
| Title |
|---|
| FUJIWARA T. ET AL.: "Mutations of sodium channel alpha subunit type 1 (SCN1A) in intractable childhood epilepsies with frequent generalized tonic-clonic seizures", BRAIN, vol. 126, no. 3, 2003, pages 531 - 546, XP002999219 * |
| NABBOUT R. ET AL.: "Spectrum of SCN1A mutattions in severe myoclonic epilepsy of infancy", NEUROLOGY, vol. 60, no. 12, 24 June 2003 (2003-06-24), pages 1961 - 1967, XP008065999 * |
| See also references of EP1664324A4 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7989182B2 (en) | 2001-07-18 | 2011-08-02 | Bionomics Limited | Nucleic acid encoding SCN1A variant |
| US7723027B2 (en) | 2003-03-27 | 2010-05-25 | Bionomics Limited | Methods for the diagnosis and treatment of epilepsy |
| US8288096B2 (en) | 2003-03-27 | 2012-10-16 | Bionomics Limited | Diagnostic method for epilepsy |
| US8129142B2 (en) | 2003-08-07 | 2012-03-06 | Bionomics Limited | Mutations in ion channels |
| WO2006133508A1 (en) * | 2005-06-16 | 2006-12-21 | Bionomics Limited | Methods of treatment, and diagnosis of epilepsy by detecting mutations in the scn1a gene |
| EP1904630A4 (en) * | 2005-06-16 | 2009-10-21 | Bionomics Ltd | METHODS OF TREATING AND DIAGNOSING EPILEPSY BY DETECTING MUTATIONS OF THE SCN1A GENE |
| WO2009006793A1 (en) * | 2007-07-06 | 2009-01-15 | The Chinese University Of Hong Kong | Polymorphisms of scn2a associated with resistance to antiepileptic drugs and use thereof |
| CN110738599A (zh) * | 2019-10-14 | 2020-01-31 | 北京百度网讯科技有限公司 | 图像拼接方法、装置、电子设备及存储介质 |
| CN110738599B (zh) * | 2019-10-14 | 2023-04-25 | 北京百度网讯科技有限公司 | 图像拼接方法、装置、电子设备及存储介质 |
Also Published As
| Publication number | Publication date |
|---|---|
| US20090081724A1 (en) | 2009-03-26 |
| NZ545185A (en) | 2009-04-30 |
| EP1664324A4 (en) | 2007-07-18 |
| CA2534812A1 (en) | 2005-02-17 |
| AU2003904154A0 (en) | 2003-08-21 |
| EP1664324A1 (en) | 2006-06-07 |
| JP2007501601A (ja) | 2007-02-01 |
| US8129142B2 (en) | 2012-03-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7989182B2 (en) | Nucleic acid encoding SCN1A variant | |
| US8288096B2 (en) | Diagnostic method for epilepsy | |
| WO2006133508A1 (en) | Methods of treatment, and diagnosis of epilepsy by detecting mutations in the scn1a gene | |
| US8129142B2 (en) | Mutations in ion channels | |
| US7282336B2 (en) | Method of diagnosing epilepsy | |
| NZ522888A (en) | Mutations in the gamma aminobutyric acid type A receptor subunit ( GABA A ) associated with epilepsy | |
| US7709225B2 (en) | Nucleic acids encoding mutations in sodium channels related to epilepsy | |
| WO2002006521A1 (en) | Identification of two principal mutations in ion channels associated with idiopathic generalised epilepsies | |
| US20030157535A1 (en) | Identification of two principal mutations in ion channels associated with idiopathic generalised epilepsies | |
| AU2004263548B2 (en) | Mutations in ion channels | |
| AU2007202499B2 (en) | Mutations in ion channels | |
| WO2005024024A1 (en) | Mutations in the nedd4 gene family in epilepsy and other cns disorders | |
| AU2004200978B2 (en) | A diagnostic method for epilepsy | |
| AU2001272218A1 (en) | Identification of two principal mutations in ion channels associated with idiopathic generalised epilepsies | |
| AU2006257716B2 (en) | Methods of treatment, and diagnosis of epilepsy by detecting mutations in the SCN1A gene | |
| WO2004053128A1 (en) | Mutations in gaba-b receptor 1 associated with epilepsy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 11263326 Country of ref document: US Ref document number: 11262647 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2534812 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004263548 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 545185 Country of ref document: NZ Ref document number: 2006522183 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004761088 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2004263548 Country of ref document: AU Date of ref document: 20040806 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004263548 Country of ref document: AU |
|
| WWP | Wipo information: published in national office |
Ref document number: 11263326 Country of ref document: US |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004761088 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 11262647 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10567424 Country of ref document: US |