WO2005014837A1 - Novel active nucleic acid complexes for rna interference and the use thereof for inhibiting protein expression - Google Patents

Novel active nucleic acid complexes for rna interference and the use thereof for inhibiting protein expression Download PDF

Info

Publication number
WO2005014837A1
WO2005014837A1 PCT/FR2004/002086 FR2004002086W WO2005014837A1 WO 2005014837 A1 WO2005014837 A1 WO 2005014837A1 FR 2004002086 W FR2004002086 W FR 2004002086W WO 2005014837 A1 WO2005014837 A1 WO 2005014837A1
Authority
WO
WIPO (PCT)
Prior art keywords
use according
transfection
nucleic acids
rna
cells
Prior art date
Application number
PCT/FR2004/002086
Other languages
French (fr)
Inventor
Patrick Erbacher
Abdemaji Adib
Original Assignee
Polyplus Transfection S.A.S.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Polyplus Transfection S.A.S. filed Critical Polyplus Transfection S.A.S.
Publication of WO2005014837A1 publication Critical patent/WO2005014837A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A61K48/0025—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
    • A61K48/0033—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid the non-active part being non-polymeric
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/88—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific

Definitions

  • the subject of the invention is the vectorization of interfering RNA (RNAi for short) and more specifically aims at new complexes of active nucleic acids for interference RNA, vectors for the transfection of RNAi in eukaryotic cells and their use in a method of inhibiting protein expression. It has recently been shown that a duplex formed of two short sequences of complementary oligonucleotides (preferably 20-22 nucleotides) is capable of specifically recognizing a targeted messenger RNA and of inducing the degradation of the messenger in a cellular context.
  • interference RNA was introduced after the discovery showing that the injection of double-stranded RNA into the nematode C. elegans led to an absence of specific expression of the messenger RNA carrying the homologous sequence recognized by the RNA double strand (Fire et al., 1998). Interfering RNA duplexes have become very promising tools for studying protein function. In fact, suppressing the expression of a protein by this technique no longer requires invalidating the gene.
  • this technique requires the introduction of the interfering RNA duplexes into the cell and into the compartments where their molecular target, the messenger RNA, ie in the cytosol, are found.
  • transfection vectors are used to introduce the RNAi into the cell in the form of RNA / vector complexes.
  • Oligofectamine as a transfection vector (Elbashir et al., 2001b).
  • the target protein was lamin A / C which is expressed in the cell nucleus (Elbashir et al., 2001b).
  • the work of the inventors has shown that it is possible to specifically inhibit the expression of proteins with only RNAi concentrations of the order of nanomolar by using a composition based on a lipopolyamine, compound hitherto known as a nucleic acid transfer vector.
  • the object of the invention is therefore to use such a composition as vectors for transfection of double-stranded RNA with interference properties. It also aims to provide new vectors for these nucleic acids.
  • the invention also relates to a method for in vitro transfection of nucleic acids into cultured eukaryotic cells.
  • a vector for the transfection of active nucleic acids for interference RNA is characterized in that said vector is a composition based on dioctadecylamidoglycylspermine (DOGS for short).
  • DOGS dioctadecylamidoglycylspermine
  • the cationic lipid vector DOGS is a nucleic acid transfer vector (oligonucleotide, plasmid) described by Behr et al., 1989.
  • the synthesis of the product and its application to the field of transfer of nucleic acids (genes and oligonucleotides) into cells are the subject of patents EP 0394 111 B1 and US 5,476,962. This molecule is currently marketed by Promega under the brand Transfectam TM, for the application of gene transfer.
  • the vector consists of DOGS.
  • DOGS is used in combination with at least one compound chosen from the group comprising: cationic or neutral lipids, such as cholesterol, participating in the complexation and formulation of interfering RNAs, cationic or neutral detergents participating in the formulation of interfering RNAs and in the transfection process, neutral or charged phospholipids, such as dioleolylphosphatidylethanolamine (DOPE, participating in the formulation of interfering RNAs and in the transfection process, fusiogenic peptides participating in the transfection process, proteins, such as histones, participating in the intracellular transport of transfection complexes, hydrophilic polymers, such as PEGs, participating in the formulation of interfering RNAs and in the transfection process, cationic polymers, such as poly
  • Vectorized nucleic acids are active nucleic acids for RNA interference. It's about advantageously interfering RNAi duplexes as defined in patents EP 0 985 833 and WO 0 244 321. These nucleic acids can be chemically modified.
  • each strand of RNAi comprises from 18 to 24 nucleotides.
  • the strands are more specifically paired on a homologous region of at least 18 nucleotides. They advantageously have unpaired 3 ′ ends over a length of 2 to 4 nucleotides.
  • the targeted protein is an endogenous protein or a heterologously expressed protein. In another embodiment of the invention, the targeted protein is an exogenous protein.
  • an exogenous protein can be obtained simultaneously in the cell by co-transfection of the gene of the targeted protein and of the interfering RNAs.
  • the expression exogenous protein in the cell can be obtained by transfection of the corresponding gene before or after the introduction of the interfering RNAs.
  • interfering vectors / nucleic acids additionally containing at least one compound of the group defined above and a buffered and saline medium for the transfection of cells in culture in vi tro.
  • the formulations are as indicated above but include an iso-osmotic, or slightly saline, or hypotonic, buffered medium.
  • compositions of interfering vector / nucleic acids induce a regulatory effect on the expression of one or more proteins.
  • the invention aims. also a method for transfection of active nucleic acids by RNA interference, characterized in that it comprises: - the incubation of a transfection complex comprising a vector, and a lipid composition with cells in culture.
  • the vectors for transfection of nucleic acids active for interference RNA also fall within the scope of the invention.
  • vectors are characterized in that they are complexes comprising a vector and a lipid composition as defined above, with cells in culture.
  • FIG. 2 the analysis of the results obtained by flow cytometry to evaluate the amount of lamin A / C in HeLa cells transfected or not by the interfering RNA (RNAi) anti-lamin A / C complexed with DOGS after labeling by immunofluorescence ;
  • FIG. 3 the analysis by fluorescence microscopy of the labeling of lamin A / C in HeLa cells transfected (B, 100 nm duplex) or not (A, 100% expression of lamin A / C) by Interfering anti-laminar A / C RNA complexed with DOGS 72 h after transfection;
  • FIG. 3 the analysis by fluorescence microscopy of the labeling of lamin A / C in HeLa cells transfected (B, 100 nm duplex) or not (A, 100% expression of lamin A / C) by Interfering anti-laminar A / C RNA complexed with DOGS 72 h after transfection;
  • FIG. 4 the analysis by flow cytometry of the amount of lamin A / C in the transfected HeLa cells or not by the anti-lamin A / C interfering RNA complexed with DOGS after labeling by immunofluorescence (48 h after transfection);
  • FIG. 5 the analysis by flow cytometry of the quantity of lamin A / C in HeLa cells transfected or not by the interfering anti-lamin A / C RNA complexed with DOGS after labeling by immunofluorescence (72 h after transfection) ;
  • FIG. 6 the analysis by flow cytometry of the quantity of lamin A / C in HeLa cells transfected or not by the interfering anti-lamin A / C RNA complexed with DOGS after labeling by immunofluorescence: A) effect of the concentration , B) effect of the N / P ratio; FIG. 7, the expression of the luciferase gene 24 h after the cotransfection of the cells with the plasmid pCMVLuc or anti-luciferase interfering RNAs or control RNAs (mutated luciferase); and FIG.
  • the expression of the protein is monitored by immunofluorescence coupled with analysis by flow cytometry, which gives access to the percentage of cells affected in the expression of the targeted protein and to the intensity of the interference phenomenon.
  • a - Description of the Lamin A / C model and protocols The A / C laminates are structural proteins of the nucleus. The duplex sequence targeting the messenger RNA, as well as the border nucleic part of each RNA interfere in the duplex, are given below.
  • Target region on the messenger RNA Lamin A / C (SEQ ID No.1): 5 'AACTGGACTTCCAGAAGAACATC RNAi duplex used: Sense sequence (SEQ ID No.2): 5' CUGGACUUCCAGAAGAACAdTdT Antisense sequence (SEQ ID No.3) : 5 'UGUUCUUCUGGAAGUCCAGdTdT Principle of cell testing
  • Test protocol 1 Immunofluorescence test for analysis by flow cytometry
  • Cell culture Human HeLa cells epidermal carcinoma, ATCC CCL 2
  • Dulbeco MEM medium containing Earle salts, glutamine, antibiotics (penicillin / streptomycin) and 10% fetal calf serum, at the rate of 80,000 cells / well (12-well plate format).
  • Preparation of the complexes Solution A: X nmoles of duplex interfering RNA (stock solution 20 ⁇ M) qs 50 ⁇ l of MEM medium.
  • Solution B Y nmoles of DOGS (stock solution at 6 mM amino in ethanol) qs 50 ⁇ l of MEM medium.
  • the cells are detached after an incubation at 37 ° C for 3 min in 0.25 ml of 0.5% Trypsin / 0.2% EDTA solution.
  • the cells are collected in 5 ml tubes and 4 ml of PBS containing 1% BSA (PBS 10m phosphate buffer pH 7.4; BSA: bovine serum albumin) are added.
  • the cells are collected by centrifugation (5 min 200 g).
  • the cells are then fixed, permeabilized for 10 min at 4 ° C. with 1 ml of a methanol solution previously cooled to -20 ° C.
  • the cells are then washed with 4 ml of 1% PBS-SAB and collected by centrifugation. This washing procedure is carried out twice.
  • the cells are then incubated at 4 ° C.
  • the plate is then incubated at 37 ° C in the presence of 5% C0 2 . After 4 h of incubation, 0.5 ml of MEM medium containing 20% of serum is added. The plate is incubated at 37 ° C. Immunofluorescence test: 48-72 hours after transfection, the culture medium is eliminated. The cells are washed with 1 ml of PBS containing 1% BSA. The cells are then fixed permeabilized for 10 min at 4 ° C with 1 ml of a methanol solution previously cooled to -20 ° C. The cells are then washed with 1 ml of PBS-SAB 1%. This washing procedure is carried out twice. The cells are then incubated at 4 ° C.
  • a decrease in the cellular quantity of lamin A / C is quantifiable by immunofluorescence analyzed by cytometry in flux (see figure) where we see a population with a lower fluorescence intensity compared to non-transfected cells (100% lamin A / C expression).
  • the amount of lamin A / C which is extinguished in the cell is dependent on the concentration of interfering RNA used (from 10 to 200 nM) and on the observation time. Analysis 24 h after transfection does not show a significant change in the amount of lamin A / C in the cells, regardless of the concentration of interfering RNA used.
  • the vector DOGS is effective for vectorizing interfering RNA in living cells and makes it possible to obtain high efficiency of interfering RNA without affecting the selectivity of the RNA / target recognition mechanism.
  • EXAMPLE 2 Model of Exogenous Protein Luciferase A - Model of Co-transfection of the Target Gene and Interfering RNAs
  • the model of cell co-transfection consists in sending into the cell simultaneously a plasmid expressing the exogenous gene of the protein studied and the interfering RNA duplexes. This technique has the advantage of making it possible to quickly measure the effectiveness of interfering RNAs in inhibiting the expression of a protein studied.
  • the DOGS molecule was used as a vector for co-transfection of DNA and interfering RNA (double strand) in the tests reported below.
  • the reporter gene for luciferase has been used as an exogenous gene because it allows the amount of protein produced by a chemiluminescence reaction to be quantified. Plasmid and double-stranded RNA co-transfection protocol.
  • the protocol is given for 24-well plate transfections, for 200 ng of plasmid and for 7-70 ng of interfering RNA duplexes (ie a transfection step with 1-10 nM of interfering RNA).
  • Etapel Dilute 7-70 ng (1-10 nM) of interfering RNA and 200 ng of plasmid pCMVLuc (luciferase gene under the control of the cytomegalovirus promoter, CMV) in a final volume of 50 ⁇ l of culture medium without serum. Vortex slightly.
  • Step 2 Dilute 0.6-0.8 ⁇ l of DOGS solution (2 mM) in 50 ⁇ l of culture medium without serum. Vortex strongly to form the cationic liposomes and wait 15 min.
  • Luciferase test Prepare lysis buffer IX by diluting the stock solution (5X) in water. Remove the culture medium from the wells, wash with 0.5 ml of PBS and add 100 ⁇ l of lysis buffer per well, incubate for 30 minutes at room temperature. Recover the lysates in 1.5 ml Eppendorf and centrifuge for 5 minutes at 14000 rpm / min. Add 20 ⁇ l of supernatant per well of an opaque 96-well plate for luminometer and measure luminescence with an integration time of 10 seconds (luminometer, PhL Mediators, Vienna) after addition of 100 ⁇ l of luciferin per well (lyophilized hydrated substrate with buffer and bring to room temperature).
  • BCA-Pearce kit Add 15D1 of the supernatants to 4ml tubes + 1ml of BCA reagent (1 volume of blue reagent for 50 volumes of white reagent), vortex (5s, 1500t / min) and incubate 30 minutes at 60 ° C, measure the absorbance at 562 nm.
  • BSA standard range 15 ⁇ l of IX lysis buffer + ⁇ l BSA + lml BCA / tube. Results of the efficiency of the co-transfection of the luciferase gene and of the luciferase interfering RNAs with DOGS.
  • the efficacy of DOGS to simultaneously transfect a plasmid expressing the target luciferase gene (firefly pyralis) and the interfering RNAs has been shown on several cell lines.
  • the specific RNA luciferase duplex chosen is that used by Elbashir et al. (Elbashir et al., 2001b) in eukaryotic cells in culture and which have optimized positioning on the luciferase messenger RNA target.
  • the measurement of the efficacy is determined by assaying the luciferase activity (RLU / mg of protein) by chemiluminescence 24 h after co-transfection.
  • RNAi Double-stranded RNA direct the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervenes. Cell 101, 25-33.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The aim of the invention is to use a composition based on lipopolyamine cationic lipids in the form of a vector for transfecting active nucleic acids for RNA interference. Said invention can be used, in particular for inducing a regulating effect on the expression of one or several target proteins responsible or involved in hereditary genetic diseases and complex diseases like cancer or viral infections.

Description

« Nouveaux complexes d'acides nucléiques actifs pour l'ARN interférence et leur utilisation pour inhiber l'expression de protéines » "New active nucleic acid complexes for RNA interference and their use to inhibit protein expression"
L'invention a pour objet la vectorisation d'ARN interférents (ARNi en abrégé) et vise plus spécialement de nouveaux complexes d'acides nucléiques actifs pour l'ARN interférence, des vecteurs pour la transfection d'ARNi dans des cellules eucaryotes et leur utilisation dans une méthode d'inhibition de l'expression de protéines. Il a été montré récemment qu'un duplexe formé de deux courtes séquences d' oligonucléotides complémentaires (20-22 nucléotides de préférence) est capable de reconnaître spécifiquement un ARN messager ciblé et d'induire dans un contexte cellulaire la dégradation du messager. Une coupure unique de l'ARN messager empêche alors la traduction du messager en protéine (Tuschl et al., 1999 ; Zamore et al., 2000 ; Elbashir et al., 2001a ; Elbashir et al., 2001b). Le terme d'ARN interférence a été introduit après la découverte montrant que l'injection d'ARN double brin dans le nematode C. elegans conduisait à une absence d'expression spécifique de l'ARN messager portant la séquence homologue reconnue par l'ARN double brin (Fire et al., 1998). Les duplexes d'ARN interférents sont devenus des outils très prometteurs pour l'étude de la fonction des protéines. En effet, la suppression de l'expression d'une protéine par cette technique ne nécessite plus d'invalider le gène. Par contre, cette technique nécessite l'introduction des duplexes d'ARN interférents dans la cellule et dans les compartiments où se trouvent leur cible moléculaire, l'ARN messager, c'est-à-dire dans le cytosol. Pour cela des vecteurs de transfection sont utilisés pour introduire les ARNi dans la cellule sous forme de complexes ARN/vecteur. Les premiers travaux d'interférence de l'expression des protéines dans des cellules eucaryotes ont été réalisés en utilisant l' Oligofectamine comme vecteur de transfection (Elbashir et al., 2001b). La protéine ciblée était la lamine A/C qui s'exprime dans le noyau cellulaire (Elbashir et al., 2001b). Les travaux des inventeurs ont montré qu' il était possible d'inhiber de manière spécifique l'expression de protéines avec seulement des concentrations en ARNi de l'ordre du nanomolaire en utilisant comme vecteur de transfection une composition à base d'une lipopolyamine, composé connu jusqu'à présent comme vecteur de transfert d'acides nucléiques. L'invention a donc pour but l'utilisation d'une telle composition comme vecteurs de transfection d'ARN double brin à propriétés d'interférence. Elle a également pour but de fournir de nouveaux vecteurs pour ces acides nucléiques. L' invention vise également une méthode pour transfecter in vi tro des acides nucléiques dans des cellules eucaryotes en culture . L'utilisation selon l'invention d'un vecteur pour la transfection d'acides nucléiques actifs pour l'ARN interférence est caractérisée en ce que ledit vecteur est une composition à base de dioctadécylamidoglycylspermine (DOGS en abrégé) . Le vecteur lipidique cationique DOGS est un vecteur de transfert d'acide nucléique (oligonucléotide, plasmide) décrit par Behr et al., 1989. La synthèse du produit et son application au domaine du transfert d'acides nucléiques (gènes et oligonucléotides) dans des cellules font l'objet des brevets EP 0394 111 Bl et US 5,476,962. Cette molécule est actuellement commercialisée par Promega sous la marque Transfectam™, pour l'application transfert de gènes. De manière surprenante, les inventeurs ont constaté que cette molécule était efficace pour induire le mécanisme d'ARN interférence et vectoriser des acides nucléiques interférents dans des cellules eucaryotes. Dans une disposition de l'invention, le vecteur est constitué par DOGS. Dans une autre disposition, DOGS est utilisé en combinaison avec au moins un composé choisi dans le groupe comprenant : les lipides cationiques ou neutres, comme le cholestérol, participant à la complexation et à la formulation des ARN interférents, les détergents cationiques ou neutres participant à la formulation des ARN interférents et au processus de transfection, les phospholipides neutres ou chargés, comme la dioléolylphosphatidyléthanolamine (DOPE, participant à la formulation des ARN interférents et au processus de transfection, des peptides fusiogènes participant au processus de transfection, des protéines, comme les histones, participant au transport intracellulaire des complexes de transfection, des polymères hydrophiles, tels que des PEGs, participant à la formulation des ARN interférents et au processus de transfection, des polymères cationiques, tels que les polyéthylènimines et ces dérivés, participant à la complexation et à la formulation des ARN interférents et au processus de transfection, des molécules de reconnaissance de récepteurs tels que des ligands de différente nature (protéines, peptides, anticorps, métabolites, oses, vitamines) . Les acides nucléiques vectorisés sont des acides nucléiques actifs pour l'ARN interférence. Il s'agit avantageusement de duplexes d'ARNi interférents tels qu'ils sont définis dans les brevets EP 0 985 833 et WO 0 244 321. Ces acides nucléiques peuvent être chimiquement modifiés. De préférence, chaque brin d'ARNi comporte de 18 à 24 nucléotides . Les brins sont plus spécialement appariés sur une région homologue d'au moins 18 nucléotides. Ils présentent avantageusement des extrémités 3' non appariées sur une longueur de 2 à 4 nucléotides. Dans un mode de réalisation de l' invention, la protéine ciblée est une protéine endogène ou une protéine hétérologue exprimée de façon stable. Dans un autre mode de réalisation de l'invention, la protéine ciblée est une protéine exogène. L'expression de a protéine exogène peut être obtenue de façon simultanée dans la cellule par co-transfection du gène de la protéine ciblée et des ARN interférents. En variante, l'expression protéine exogène dans la cellule peut être obtenue par transfection du gène correspondant avant ou après l'introduction des ARN interférents . Pour la transfection de cellules in vi tro, on a avantageusement recours à des vecteurs/acides nucléiques interférents contenant en outre au moins un composé du groupe défini ci-dessus et un milieu tamponné et salin pour la transfection de cellules en culture in vi tro . Pour la transfection de cellules in vivo, les formulations sont telles qu' indiquées ci-dessus mais comprennent un milieu tamponné iso-osmotique, ou faiblement salin, ou hypotonique. Lesdites formulations sont avantageusement administrables par voie injectable ou topique, sur la peau ou les muqueuses, et contiennent un véhicule pharmaceutiquement acceptable. On notera également avec intérêt que les compositions de vecteurs/acides nucléiques interférents induisent un effet régulateur sur l'expression d'une ou de plusieurs protéines cibles responsables ou impliqués dans des maladies génétiques héréditaires, des maladies génétiques complexes, comme le cancer, ou des infections virales. L' invention vise . également une méthode de transfection d'acides nucléiques actifs par l'ARN interférence, caractérisée en ce qu'elle comprend : - l'incubation d'un complexe de transfection comprenant un vecteur, et une composition lipidique avec des cellules en culture . Les vecteurs de transfection d'acides nucléiques actifs pour l'ARN interférence entrent également dans le champ de l'invention. Ces vecteurs sont caractérisés en ce qu'il s'agit de complexes comprenant un vecteur et une composition lipidique tels que définis ci-dessus, avec des cellules en culture . D'autres caractéristiques et avantages de l'invention seront donnés dans les exemples qui suivent et en se référant aux figures 1 à 8, qui représentent respectivement, la figure 1, les résultats de l'analyse par cytométrie en flux de la quantité de lamine A/C dans les cellules HeLa transfectées ou non par les ARNi anti-lamine A/C complexés au DOGS après marquage par immunofluorescence ; la figure 2, l'analyse des résultats obtenus par cytométrie en flux pour évaluer la quantité de lamine A/C dans les cellules HeLa transfectées ou non par les ARN interférents (ARNi) anti-lamine A/C complexés au DOGS après marquage par immunofluorescence ; la figure 3, l'analyse par microscopie de fluorescence du marquage de la lamine A/C dans les cellules HeLa transfectées (B, 100 nm duplexes) ou non (A, 100 % d'expression de la lamine A/C) par les ARN interférents anti- lamine A/C complexés au DOGS 72 h après la transfection ; la figure 4, l'analyse par cytométrie en flux de la quantité de lamine A/C dans les cellules HeLa transfectées ou non par les ARN interférents anti-lamine A/C complexés au DOGS après marquage par immunofluorescence (48 h après la transfection) ; la figure 5, l'analyse par cytométrie en flux de la quantité de lamine A/C dans les cellules HeLa transfectées ou non par les ARN interférents anti-lamine A/C complexés au DOGS après marquage par immunofluorescence (72 h après la transfection) ; la figure 6, l' analyse par cytométrie en flux de la quantité de lamine A/C dans les cellules HeLa transfectées ou non par les ARN interférents anti-lamine A/C complexés au DOGS après marquage par immunofluorescence : A) effet de la concentration, B) effet du rapport N/P ; la figure 7, l'expression du gène luciférase 24 h après la cotransfection des cellules avec le plasmide pCMVLuc ou des ARN interférents anti-luciférase ou des ARN contrôles (luciférase mutés) ; et la figure 8, l'efficacité de l'extinction (en %) de la luciférase après co-transfection avec du DOGS et le mélange plasmide pCMVLuc (200 ng) et ARN interférents (10 n , barre rouge) ou des ARN contrôles (barre bleue) dans différentes cellules . Exemple 1 : Vectorisation d'ARN interférents par le DOGS et interférence de l'expression d'une protéine endogène : la lamine A/C On rapporte ci-après les résultats obtenus avec le test d'interférence de la -lamine A/C. Deux approches sont décrites : Dans la première, on suit l'expression de la lamine A/C par un test d' immunofluorescence et on analyse le marquage obtenu par microscopie de fluorescence pour vérifier les marquages nucléaires et l'absence d'expression dans les cellules in vi tro . Dans la deuxième approche, on effectue le suivi de l'expression de la protéine par immunofluorescence couplée à une analyse par cytométrie en flux, ce qui permet d'accéder au pourcentage de cellules affectées dans l'expression de la protéine ciblée et à l'intensité du phénomène d'interférence. A - Description du modèle Lamine A/C et protocoles Les lamines A/C sont des protéines de structure du noyau. La séquence du duplexe ciblant l'ARN messager, ainsi que la partie nucléique bordante de chaque ARN interfèrent dans le duplexe, sont données ci-après. Région ciblée sur l'ARN messager Lamine A/C (SEQ ID N°l) : 5 ' AACTGGACTTCCAGAAGAACATC Duplexe d'ARNi utilisé : Séquence sens (SEQ ID N°2) : 5' CUGGACUUCCAGAAGAACAdTdT Séquence antisens (SEQ ID N°3) :5' UGUUCUUCUGGAAGUCCAGdTdT Principe du test cellulaireThe subject of the invention is the vectorization of interfering RNA (RNAi for short) and more specifically aims at new complexes of active nucleic acids for interference RNA, vectors for the transfection of RNAi in eukaryotic cells and their use in a method of inhibiting protein expression. It has recently been shown that a duplex formed of two short sequences of complementary oligonucleotides (preferably 20-22 nucleotides) is capable of specifically recognizing a targeted messenger RNA and of inducing the degradation of the messenger in a cellular context. A single cut of the messenger RNA then prevents the translation of the messenger into protein (Tuschl et al., 1999; Zamore et al., 2000; Elbashir et al., 2001a; Elbashir et al., 2001b). The term interference RNA was introduced after the discovery showing that the injection of double-stranded RNA into the nematode C. elegans led to an absence of specific expression of the messenger RNA carrying the homologous sequence recognized by the RNA double strand (Fire et al., 1998). Interfering RNA duplexes have become very promising tools for studying protein function. In fact, suppressing the expression of a protein by this technique no longer requires invalidating the gene. On the other hand, this technique requires the introduction of the interfering RNA duplexes into the cell and into the compartments where their molecular target, the messenger RNA, ie in the cytosol, are found. For this, transfection vectors are used to introduce the RNAi into the cell in the form of RNA / vector complexes. Early work on protein expression interference in eukaryotic cells has were carried out using Oligofectamine as a transfection vector (Elbashir et al., 2001b). The target protein was lamin A / C which is expressed in the cell nucleus (Elbashir et al., 2001b). The work of the inventors has shown that it is possible to specifically inhibit the expression of proteins with only RNAi concentrations of the order of nanomolar by using a composition based on a lipopolyamine, compound hitherto known as a nucleic acid transfer vector. The object of the invention is therefore to use such a composition as vectors for transfection of double-stranded RNA with interference properties. It also aims to provide new vectors for these nucleic acids. The invention also relates to a method for in vitro transfection of nucleic acids into cultured eukaryotic cells. The use according to the invention of a vector for the transfection of active nucleic acids for interference RNA is characterized in that said vector is a composition based on dioctadecylamidoglycylspermine (DOGS for short). The cationic lipid vector DOGS is a nucleic acid transfer vector (oligonucleotide, plasmid) described by Behr et al., 1989. The synthesis of the product and its application to the field of transfer of nucleic acids (genes and oligonucleotides) into cells are the subject of patents EP 0394 111 B1 and US 5,476,962. This molecule is currently marketed by Promega under the brand Transfectam ™, for the application of gene transfer. Surprisingly, the inventors have found that this molecule is effective in inducing mechanism of RNA interference and vectorizing interfering nucleic acids in eukaryotic cells. In a provision of the invention, the vector consists of DOGS. In another arrangement, DOGS is used in combination with at least one compound chosen from the group comprising: cationic or neutral lipids, such as cholesterol, participating in the complexation and formulation of interfering RNAs, cationic or neutral detergents participating in the formulation of interfering RNAs and in the transfection process, neutral or charged phospholipids, such as dioleolylphosphatidylethanolamine (DOPE, participating in the formulation of interfering RNAs and in the transfection process, fusiogenic peptides participating in the transfection process, proteins, such as histones, participating in the intracellular transport of transfection complexes, hydrophilic polymers, such as PEGs, participating in the formulation of interfering RNAs and in the transfection process, cationic polymers, such as polyethylenimines and these derivatives, participating in complexation and to the formulation of A RN interfering and in the transfection process, receptor recognition molecules such as ligands of different nature (proteins, peptides, antibodies, metabolites, oses, vitamins). Vectorized nucleic acids are active nucleic acids for RNA interference. It's about advantageously interfering RNAi duplexes as defined in patents EP 0 985 833 and WO 0 244 321. These nucleic acids can be chemically modified. Preferably, each strand of RNAi comprises from 18 to 24 nucleotides. The strands are more specifically paired on a homologous region of at least 18 nucleotides. They advantageously have unpaired 3 ′ ends over a length of 2 to 4 nucleotides. In one embodiment of the invention, the targeted protein is an endogenous protein or a heterologously expressed protein. In another embodiment of the invention, the targeted protein is an exogenous protein. The expression of an exogenous protein can be obtained simultaneously in the cell by co-transfection of the gene of the targeted protein and of the interfering RNAs. Alternatively, the expression exogenous protein in the cell can be obtained by transfection of the corresponding gene before or after the introduction of the interfering RNAs. For transfection of cells in vi tro, use is advantageously made of interfering vectors / nucleic acids additionally containing at least one compound of the group defined above and a buffered and saline medium for the transfection of cells in culture in vi tro. For the transfection of cells in vivo, the formulations are as indicated above but include an iso-osmotic, or slightly saline, or hypotonic, buffered medium. Said formulations can advantageously be administered by injectable or topical route, on the skin or the mucous membranes, and contain a pharmaceutically acceptable vehicle. It will also be noted with interest that the compositions of interfering vector / nucleic acids induce a regulatory effect on the expression of one or more proteins. targets responsible for or involved in inherited genetic diseases, complex genetic diseases, such as cancer, or viral infections. The invention aims. also a method for transfection of active nucleic acids by RNA interference, characterized in that it comprises: - the incubation of a transfection complex comprising a vector, and a lipid composition with cells in culture. The vectors for transfection of nucleic acids active for interference RNA also fall within the scope of the invention. These vectors are characterized in that they are complexes comprising a vector and a lipid composition as defined above, with cells in culture. Other characteristics and advantages of the invention will be given in the examples which follow and with reference to FIGS. 1 to 8, which respectively represent, in FIG. 1, the results of the analysis by flow cytometry of the quantity of lamin A / C in HeLa cells transfected or not with anti-lamin A / C RNAi complexed with DOGS after labeling by immunofluorescence; FIG. 2, the analysis of the results obtained by flow cytometry to evaluate the amount of lamin A / C in HeLa cells transfected or not by the interfering RNA (RNAi) anti-lamin A / C complexed with DOGS after labeling by immunofluorescence ; FIG. 3, the analysis by fluorescence microscopy of the labeling of lamin A / C in HeLa cells transfected (B, 100 nm duplex) or not (A, 100% expression of lamin A / C) by Interfering anti-laminar A / C RNA complexed with DOGS 72 h after transfection; FIG. 4, the analysis by flow cytometry of the amount of lamin A / C in the transfected HeLa cells or not by the anti-lamin A / C interfering RNA complexed with DOGS after labeling by immunofluorescence (48 h after transfection); FIG. 5, the analysis by flow cytometry of the quantity of lamin A / C in HeLa cells transfected or not by the interfering anti-lamin A / C RNA complexed with DOGS after labeling by immunofluorescence (72 h after transfection) ; FIG. 6, the analysis by flow cytometry of the quantity of lamin A / C in HeLa cells transfected or not by the interfering anti-lamin A / C RNA complexed with DOGS after labeling by immunofluorescence: A) effect of the concentration , B) effect of the N / P ratio; FIG. 7, the expression of the luciferase gene 24 h after the cotransfection of the cells with the plasmid pCMVLuc or anti-luciferase interfering RNAs or control RNAs (mutated luciferase); and FIG. 8, the efficiency of extinction (in%) of luciferase after co-transfection with DOGS and the mixture of plasmid pCMVLuc (200 ng) and interfering RNA (10 n, red bar) or control RNA ( blue bar) in different cells. EXAMPLE 1 Vectorization of Interfering RNAs by DOGS and Interference of the Expression of an Endogenous Protein: Lamin A / C The results obtained with the interference test of -lamine A / C are reported below. Two approaches are described: In the first, the expression of lamin A / C is monitored by an immunofluorescence test and the labeling obtained is analyzed by fluorescence microscopy to verify the nuclear labeling and the absence of expression in the cells in vi tro. In the second approach, the expression of the protein is monitored by immunofluorescence coupled with analysis by flow cytometry, which gives access to the percentage of cells affected in the expression of the targeted protein and to the intensity of the interference phenomenon. A - Description of the Lamin A / C model and protocols The A / C laminates are structural proteins of the nucleus. The duplex sequence targeting the messenger RNA, as well as the border nucleic part of each RNA interfere in the duplex, are given below. Target region on the messenger RNA Lamin A / C (SEQ ID No.1): 5 'AACTGGACTTCCAGAAGAACATC RNAi duplex used: Sense sequence (SEQ ID No.2): 5' CUGGACUUCCAGAAGAACAdTdT Antisense sequence (SEQ ID No.3) : 5 'UGUUCUUCUGGAAGUCCAGdTdT Principle of cell testing
JO Mise en culture des cellules adhérentesJO Cultivation of adherent cells
Jl Préparation des complexes ARNsi/DOGS, puis transfection cellulaireJl Preparation of siRNA / DOGS complexes, then cell transfection
J3-4 Réalisation du test d' immunofluorescence suivi d'une analyse de la fluorescence par cytométrie en flux ou microscopie de fluorescenceJ3-4 Performing the immunofluorescence test followed by a fluorescence analysis by flow cytometry or fluorescence microscopy
Protocole du test 1) Test d' immunofluorescence pour l'analyse par cytométrie en flux Culture cellulaire Les cellules humaines HeLa (carcinome épithélial, ATCC CCL 2) sont mises en culture dans 2 ml de milieu MEM de Dulbeco contenant des sels de Earle, de la glutamine, des antibiotiques (pénicilline/streptomycine) et 10 % sérum de veau foetal, à raison de 80 000 cellules/puits (format plaque 12 puits) . Préparation des complexes Solution A: X nmoles de duplexe ARN interférents (solution stock 20 μM) qsp 50 μl de milieu MEM. Solution B: Y nmoles de DOGS (solution stock à 6 mM aminés dans l'ethanol) qsp 50 μl de milieu MEM. Le rapport de charges +/- (N/P= aminé DOGS/phosphate ARN) est fixé à 6. Les solutions A et B sont préparées, mélangées avec un vortex, et laissées 5 min à T° ambiante. Puis la solution B est ajoutée sur la solution A, le mélange est vortexé, puis on attend 30 min à température ambiante. Transfection 100 μl de complexes ARNi/DOGS sont ajoutés par puits contenant 1 ml de milieu MEM sans sérum. La plaque est alors incubée à 37 °C en présence de 5 % de C02. Après 4h d'incubation, 1 ml de milieu MEM contenant 20 % de sérum est ajoutée. La plaque est incubée à 37°C. Test d' immunofluorescence 48-72h après la transfection, le milieu de culture est éliminé. Les cellules sont détachées après une incubation à 37°C de 3 min dans 0,25 ml de solution de Trypsine 0,5 % /EDTA0,2 %. Les cellules sont collectées dans des tubes de 5 ml et 4 ml de PBS contenant 1 % SAB (PBS tampon phosphate à lOmM pH7,4 ; SAB : sérum albumine bovine) sont ajoutés. Les cellules sont collectées par centrifugation (5 min 200 g) . Les cellules sont ensuite fixées, perméabilisées pendant 10 min à 4°C avecl ml d'une solution de méthanol préalablement refroidie à -20°C. Les cellules sont ensuite lavées avec 4 ml de PBS-SAB 1 % et collectées par centrifugation. Cette procédure de lavage est réalisée deux fois. Les cellules sont ensuite incubées à 4°C avec 1 ml de PBS contenant 1 % de sérum de chèvre (sérum bloquant les sites non spécifiques de fixation d'anticorps sur les cellules). Les cellules sont ensuite lavées avec 4 ml de PBS-SAB 1 % et collectées par centrifugation. Les cellules sont collectées dans 50 μl et incubées à 4°C pendant lh en présence de 50 μl d'anticorps de souris anti- Lamine A/C humaine (classe Ig G 1, Research Diagnostic Inc, Flanders, NJ) . Les cellules sont ensuite lavées avec 4 ml de PBS-SAB 1 % et collectées par centrifugation. Cette procédure de lavage est réalisée deux fois. Les cellules sont collectées dans 50 μl et incubées à 4°C pendant lh en présence de 50 μl d' anticorps de chèvre anti-Ig G de souris et conjugués à la fluorescéine (Calbiochem, La Jolla, CA) . Les cellules sont ensuite lavées avec 4 ml de PBS- SAB 1 % et collectées par centrifugation. Les cellules sont finalement reprises dans 1 ml de PBS-SAB 1 % pour être analysée par cytométrie en flux.Test protocol 1) Immunofluorescence test for analysis by flow cytometry Cell culture Human HeLa cells (epithelial carcinoma, ATCC CCL 2) are cultured in 2 ml of Dulbeco MEM medium containing Earle salts, glutamine, antibiotics (penicillin / streptomycin) and 10% fetal calf serum, at the rate of 80,000 cells / well (12-well plate format). Preparation of the complexes Solution A: X nmoles of duplex interfering RNA (stock solution 20 μM) qs 50 μl of MEM medium. Solution B: Y nmoles of DOGS (stock solution at 6 mM amino in ethanol) qs 50 μl of MEM medium. The charge ratio +/- (N / P = DOGS amine / RNA phosphate) is fixed at 6. Solutions A and B are prepared, mixed with a vortex, and left for 5 min at room temperature. Then solution B is added to solution A, the mixture is vortexed, then waiting 30 min at room temperature. Transfection 100 μl of RNAi / DOGS complexes are added per well containing 1 ml of MEM medium without serum. The plate is then incubated at 37 ° C in the presence of 5% C0 2 . After 4 hours of incubation, 1 ml of MEM medium containing 20% serum is added. The plate is incubated at 37 ° C. Immunofluorescence test 48-72 hours after transfection, the culture medium is eliminated. The cells are detached after an incubation at 37 ° C for 3 min in 0.25 ml of 0.5% Trypsin / 0.2% EDTA solution. The cells are collected in 5 ml tubes and 4 ml of PBS containing 1% BSA (PBS 10m phosphate buffer pH 7.4; BSA: bovine serum albumin) are added. The cells are collected by centrifugation (5 min 200 g). The cells are then fixed, permeabilized for 10 min at 4 ° C. with 1 ml of a methanol solution previously cooled to -20 ° C. The cells are then washed with 4 ml of 1% PBS-SAB and collected by centrifugation. This washing procedure is carried out twice. The cells are then incubated at 4 ° C. with 1 ml of PBS containing 1% goat serum (serum blocking non-specific sites for the attachment of antibodies to the cells). The cells are then washed with 4 ml of 1% PBS-SAB and collected by centrifugation. The cells are collected in 50 μl and incubated at 4 ° C. for 1 h in the presence of 50 μl of anti-human Lamine A / C antibody (class Ig G 1, Research Diagnostic Inc, Flanders, NJ). The cells are then washed with 4 ml of 1% PBS-SAB and collected by centrifugation. This washing procedure is carried out twice. The cells are collected in 50 μl and incubated at 4 ° C. for 1 h in the presence of 50 μl of goat anti-mouse Ig G antibodies and conjugated with fluorescein (Calbiochem, La Jolla, CA). The cells are then washed with 4 ml of 1% PBS-SAB and collected by centrifugation. The cells are finally taken up in 1 ml of PBS-SAB 1% to be analyzed by flow cytometry.
2) Test d' immunofluorescence pour l'analyse par microscopie confocale Culture cellulaire Les cellules humaines HeLa (carcinome épithélial, ATCC CCL 2) sont mises en culture dans 1 ml de milieu MEM de Dulbeco contenant des sels de Earle, de la glutamine, des antibiotiques (pénicilline/streptomycine) et 10 % sérum de veau foetal, à raison de 50 000 cellules/puits (format plaque 4 puits, LAB-TEK, Nalge Nundc International, Naperville, IL) . Préparation des complexes (idem protocole cytométrie) Transfection 100 μl de complexes ARNi/DOGS sont ajoutés par puits contenant 0,5 ml de milieu MEM sans sérum. La plaque est alors incubée à 37 °C en présence de 5 % de C02. Après 4h d'incubation, 0,5 ml de milieu MEM contenant 20 % de sérum est ajouté. La plaque est incubée à 37°C. Test d' immunofluorescence : 48-72h après la transfection, le milieu de culture est éliminé. Les cellules sont lavées avec 1 ml de PBS contenant 1 % SAB. Les cellules sont ensuite fixées perméabilisée pendant 10 min à 4°C avecl ml d'une solution de méthanol préalablement refroidie à -20°C. Les cellules sont ensuite lavées avec 1 ml de PBS-SAB 1 % . Cette procédure de lavage est réalisée deux fois . Les cellules sont ensuite incubées à 4°C avec 1 ml de PBS contenant 1 % de sérum de chèvre (sérum bloquant les sites non spécifiques) . Les cellules sont ensuite lavées avec 1 ml de PBS-SAB 1 %. Les cellules sont incubées à 4°C pendant lh avec 50 μl de PBS et 50 μl d'anticorps de souris anti-Lamine A/C humaine (classe Ig G 1, Research Diagnostic Inc, Flanders, NJ) . Les cellules sont ensuite lavées avec 1 ml de PBS-SAB 1 % . Cette procédure de lavage est réalisée deux fois. Les cellules sont incubées à 4°C pendant lh en présence de50 μl de PBS et 50 μl d'anticorps de chèvre anti-Ig G de souris et conjugués à la fluorescéine (Calbiochem, La Jolla, CA) . Les cellules sont ensuite lavées avec 1 ml de PBS-SAB 1 % . Les cellules sont finalement reprises dans 1 ml de PBS-SAB 1 % pour être analysées par microscopie confocale. B- Inhibition de l'expression d'une protéine endogène après transfection de duplexes d'ARNi avec du DOGS B-l Efficacité Les résultats de l'analyse par cytométrie en flux de la quantité de lamine A/C dans les cellules HeLa transfectées ou non par les ARNi anti-lamine A/C complexés au DOGS après marquage par immunofluorescence son t rapportés sur la figure 1(F11 : intensité de fluorescence). La transfection des ARN interférents anti-lamine A/C complexés avec du DOGS (N/P=6, rapport de charge aminé du vecteur sur phosphate de l'ARN), selon un protocole de transfection de 4h des cellules en absence de sérum, permet d'observer une diminution de l'expression de la lamine A/C. Une diminution de la quantité cellulaire de lamine A/C est quantifiable par immunofluorescence analysée par cytométrie en flux (voire figurel) où l'on voit apparaître une population de plus faible intensité de fluorescence par rapport aux cellules non-transfectées (100 % expression lamine A/C). La quantité de lamine A/C que l'on éteint dans la cellule est dépendante de la concentration d'ARN interférents utilisée (de 10 à 200 nM) et du temps d'observation. L'analyse 24 h après la transfection ne montre pas de changement significatif de la quantité de lamine A/C dans les cellules, quelle que soit la concentration d'ARN interférents utilisée. 48 h après la transfection, 80 % de lamine A/C ont été supprimés mais dans seulement environ 20 % des cellules pour les conditions à 100 et 200 nM d'ARN interférents (Figure 2) . Par contre, 60 % des cellules ont une diminution de leur quantité de lamine A/C de 80% pour la condition 200 nM d'ARN interférents 72 h après la transfection, ce qui est un très bon résultat. L'effet est observable déjà très nettement à partir d'une concentration de 50 nM en ARN interférents. La spécificité du marquage par immunofluorescence a été contrôlée et montre bien un marquage nucléaire définissant une couronne autour de la membrane nucléaire et intranucléaire avec quelques points fluorescents distribués dans le nucléoplasme (voir Figure 3 : 100 % expression lamine A/C) . Les résultats obtenus par l'analyse en cytométrie en flux ont été confirmés en observant les cellules transfectées avec les complexes ARNi/DOGS à 100 nM 72 h après la transfection (Figure 3) . On voit très nettement que le marquage fluorescent révélant la lamine A/C dans le noyau a disparu dans un grand nombre de cellules. Il reste néanmoins quelques cellules positives au marquage comme l'a montré l'analyse quantitative par cytométrie. B-2 : Effet des conditions de transfection : concentration en ARNi et rapport DOGS/ARNsi L'effet ARN interférence sur l'expression de la lamine A/C par les cellules HeLa est dépendant de la concentration en ARN interférents comme le montrent les figures 4 et 5 (analyse par cytométrie 48 et 72 h après la transfection) . Les résultats sont regroupés dans la figure 6A démontrant la reproductibilité des résultats présentés figure 1 et 2. Il est également reconfirmé que dans ce modèle d' interférence de la Lamine A/C il faut quantifier l'expression après 72 h pour observer des effets d'interférence très significatifs. La concentration la plus efficace est obtenue à partir de 100 nM en duplexe. Un effet d'interférence est également obtenu pour une concentration de 10 nM en duplexe (40 % de cellules éteintes pour la lamine A/C), ce qui souligne l'efficacité de l'approche ARN interférence. Pour obtenir une même efficacité dans la stratégie conventionnelle des oligonucléotides antisens, il faudrait utiliser environ des concentrations proche du micromolaire. La gamme de concentration donnant les meilleurs résultats d'interférence se situe de 50 à 100 nM en ARN interférents. Pour les rapports DOGS/ARN (figure 6 B) , exprimés en aminé sur phosphate (N/P) , une gamme optimale de 4 à 8 donne, dans les conditions d' expérience, les meilleurs résultats. Un rapport N/P de 2 montre un peu moins d'efficacité et le rapport 10, bien qu'efficace, a montré quelques signes de toxicité sur les cellules. B-3 : Détermination de la sélectivité après transfection avec les complexes DOGS/ARNi La sélectivité du mécanisme d'ARN interférence a été étudiée en choisissant une séquence contrôle (CTROl, séquence non spécifique de la cible 'mismatch' , Mm) dans laquelle 3 bases de la séquence ciblée de la lamine A/C ont été changées pour abolir la reconnaissance de l'ARN messager Lamine A/C. CTROl : cible (SEQ ID N°4) : 5' AACAGGACUGCCAGUAGAACAU LaminA/C (SEQ ID N°5) : 5' AACUGGACUUCCAGAAGAACAU La transfection des duplexes d'ARN correspondant à la séquence control Mm montre qu'il n'y a pas d'inhibition de l'expression de la lamine A/C que l'on regarde l'expression à 48 ou 72 h après la transfection (Figure 7). Il n'y a aucun effet sur l'expression de la lamine A/C avec ce duplexe d'ARN Mm pour des concentrations d'ARN utilisée de 50 à 200 nM , alors que les ARN interférents anti-lamine A/C spécifiques ont un effet d'interférence sur l'expression. Un autre contrôle de séquence a été réalisé en utilisant un duplexe d'ARN interfèrent actif sur l'ARN messager de la protéine luciférase Photinus Pyralis . Celui-ci n'a aussi montré aucun effet sur l'expression de la lamine A/C (Figure 7) 48 et 72 h après la transfection dans la même gamme de concentration d'ARN testée (50 à 200 nM) . Luc : cible ARNm (SEQ ID N° 6) : 5' AAAUGUCCGUUCGGUUGGCAG Ces résultats prouvent que le mécanisme d' interférence de l'expression de la lamine A/C en utilisant un duplexe d'ARN ciblant spécifiquement une région de l'ARN messager de la lamine A/C est efficace et sélectif. Le vecteur DOGS est efficace pour vectoriser des ARN interférents dans des cellules vivantes et permet d'obtenir une grande efficacité d'ARN interférence sans affecter la sélectivité du mécanisme de reconnaissance ARN/cible. Exemple 2 : Modèle de protéine exogène : la luciférase A - Modèle de co-transfection du gène cible et des ARN interférents Le modèle de la co-transfection cellulaire consiste à envoyer dans la cellule de façon simultanée un plasmide exprimant le gène exogène de la protéine étudiée et les duplexes d'ARN interférents. Cette technique présente l'avantage de permettre de mesurer rapidement l'efficacité des ARN interférents à inhiber l'expression d'une protéine étudiée. Plusieurs paramètres peuvent être obtenus comme la séquence des oligonucléotides les plus actifs (choix de la séquence reconnue sur la cible ARN messager) , la concentration efficace, la durée d'inhibition de l'expression de la protéine ciblée ou le choix du type cellulaire utilisé. La molécule DOGS a été utilisée en tant que vecteur de co-transfection ADN et d'ARN interférents (double brin) dans les essais rapportés ci-après. Le gène rapporteur de la luciférase a été utilisé comme gène exogène, car il permet de quantifier la quantité de protéine produite par une réaction de chimioluminescence . Protocole de co-transfection plasmide et ARN double brin. Le protocole est donné pour des transfections en plaque 24-puits, pour 200 ng de plasmide et pour 7-70 ng de duplexes d'ARN interfèrent (soit une étape de transfection avec 1-10 nM d'ARN interférents) . • Etapel : Diluer 7-70 ng (1-10 nM) d'ARN interférents et 200 ng de plasmide pCMVLuc (gène de la luciférase sous le contrôle du promoteur du cytomégalovirus, CMV) dans un volume final de 50 μl de milieu de culture sans sérum. Vortexer légèrement . • Etape 2 : Diluer 0,6-0,8 μl de solution de DOGS (2 mM) dans 50 μl de milieu de culture sans sérum. Vortexer fortement pour former les liposomes cationiques et attendre 15 min. • Ajouter les 50 μl de la solution de DOGS sur la solution contenant les acides nucléiques. Vortexer fortement et laisser 30 minutes à température ambiante. Pendant l'incubation nécessaire à la formation des complexes de transfection, retirer le milieu de culture des cellules pour le remplacer par 0,5 ml de milieu sans sérum. • Ajouter ensuite 100 μl par puits de complexes de transfection et remettre les cellules à 37 °C pendant 4 h. Ajouter ensuite 0,5 ml de milieu contenant 20 % de sérum (au final 10%) . Tableau 1 . Conditions de co-transfection avec 200 ng de plasmide (recommandées pour l cellules adhérentes) .2) Immunofluorescence test for analysis by confocal microscopy Cell culture Human HeLa cells (epithelial carcinoma, ATCC CCL 2) are cultured in 1 ml of MEM medium from Dulbeco containing Earle salts, glutamine, antibiotics (penicillin / streptomycin) and 10% fetal calf serum, at a rate of 50,000 cells / well (4-well plate format, LAB-TEK, Nalge Nundc International, Naperville, IL). Preparation of the complexes (same as the cytometry protocol) Transfection 100 μl of RNAi / DOGS complexes are added per well containing 0.5 ml of MEM medium without serum. The plate is then incubated at 37 ° C in the presence of 5% C0 2 . After 4 h of incubation, 0.5 ml of MEM medium containing 20% of serum is added. The plate is incubated at 37 ° C. Immunofluorescence test: 48-72 hours after transfection, the culture medium is eliminated. The cells are washed with 1 ml of PBS containing 1% BSA. The cells are then fixed permeabilized for 10 min at 4 ° C with 1 ml of a methanol solution previously cooled to -20 ° C. The cells are then washed with 1 ml of PBS-SAB 1%. This washing procedure is carried out twice. The cells are then incubated at 4 ° C. with 1 ml of PBS containing 1% goat serum (serum blocking non-specific sites). The cells are then washed with 1 ml of PBS-SAB 1%. The cells are incubated at 4 ° C. for 1 h with 50 μl of PBS and 50 μl of anti-human Lamin A / C mouse antibodies (class Ig G 1, Research Diagnostic Inc, Flanders, NJ). The cells are then washed with 1 ml of PBS-SAB 1%. This washing procedure is carried out twice. The cells are incubated at 4 ° C. for 1 h in the presence of 50 μl of PBS and 50 μl of goat anti-mouse IgG antibody and conjugated to fluorescein (Calbiochem, La Jolla, CA). The cells are then washed with 1 ml of PBS-SAB 1%. The cells are finally taken up in 1 ml of PBS-SAB 1% to be analyzed by confocal microscopy. B- Inhibition of the expression of an endogenous protein after transfection of RNAi duplexes with DOGS Bl Efficiency The results of the analysis by flow cytometry of the amount of lamin A / C in the HeLa cells transfected or not by the anti-lamin A / C RNAi complexed with DOGS after labeling by immunofluorescence is reported in FIG. 1 (F11: fluorescence intensity). The transfection of the anti-lamin A / C interfering RNA complexed with DOGS (N / P = 6, ratio of amino charge of the vector to RNA phosphate), according to a 4h transfection protocol of the cells in the absence of serum, allows a decrease in the expression of lamin A / C to be observed. A decrease in the cellular quantity of lamin A / C is quantifiable by immunofluorescence analyzed by cytometry in flux (see figure) where we see a population with a lower fluorescence intensity compared to non-transfected cells (100% lamin A / C expression). The amount of lamin A / C which is extinguished in the cell is dependent on the concentration of interfering RNA used (from 10 to 200 nM) and on the observation time. Analysis 24 h after transfection does not show a significant change in the amount of lamin A / C in the cells, regardless of the concentration of interfering RNA used. 48 h after transfection, 80% of lamin A / C were deleted but in only about 20% of the cells for the conditions at 100 and 200 nM of interfering RNA (FIG. 2). On the other hand, 60% of the cells have an 80% decrease in their amount of lamin A / C for the 200 nM condition of interfering RNA 72 h after transfection, which is a very good result. The effect is already very clearly observable from a concentration of 50 nM in interfering RNA. The specificity of the labeling by immunofluorescence has been checked and clearly shows a nuclear labeling defining a crown around the nuclear and intranuclear membrane with a few fluorescent points distributed in the nucleoplasm (see Figure 3: 100% lamin A / C expression). The results obtained by the flow cytometry analysis were confirmed by observing the cells transfected with the RNAi / DOGS complexes at 100 nM 72 h after the transfection (FIG. 3). It is very clearly seen that the fluorescent labeling revealing the lamin A / C in the nucleus has disappeared in a large number of cells. However, some labeling-positive cells remain, as shown by the quantitative analysis by cytometry. B-2: Effect of transfection conditions: RNAi concentration and DOGS / siRNA ratio The RNA effect interferes with the expression of lamin A / C by HeLa cells is dependent on the RNA concentration interfering as shown in Figures 4 and 5 (analysis by cytometry 48 and 72 h after transfection). The results are grouped in FIG. 6A demonstrating the reproducibility of the results presented in FIGS. 1 and 2. It is also confirmed that in this Lamine A / C interference model, expression must be quantified after 72 h to observe effects of 'very significant interference. The most effective concentration is obtained from 100 nM duplex. An interference effect is also obtained for a 10 nM duplex concentration (40% of cells quenched for lamin A / C), which underlines the effectiveness of the RNA interference approach. To obtain the same effectiveness in the conventional strategy of antisense oligonucleotides, it would be necessary to use approximately concentrations close to the micromolar. The concentration range giving the best interference results is 50 to 100 nM in interfering RNAs. For the DOGS / RNA ratios (FIG. 6 B), expressed as amine on phosphate (N / P), an optimal range of 4 to 8 gives, under the conditions of the experiment, the best results. An N / P ratio of 2 shows slightly less effectiveness and the 10 ratio, although effective, has shown some signs of toxicity on the cells. B-3: Determination of the selectivity after transfection with the DOGS / RNAi complexes The selectivity of the RNA interference mechanism was studied by choosing a control sequence (CTROl, non-specific sequence of the target 'mismatch', Mm) in which 3 Bases of the targeted Lamine A / C sequence have been changed to abolish recognition of the Lamine A / C messenger RNA. CTROl: target (SEQ ID N ° 4): 5 'AACAGGACUGCCAGUAGAACAU LaminA / C (SEQ ID N ° 5): 5' AACUGGACUUCCAGAAGAACAU The transfection of RNA duplexes corresponding to the Mm control sequence shows that there is no inhibition of the expression of lamin A / C which is looked at at 48 or 72 h after transfection (FIG. 7). There is no effect on the expression of lamin A / C with this Mm RNA duplex for concentrations of RNA used from 50 to 200 nM, whereas the specific anti-lamin A / C interfering RNAs have an interference effect on the expression. Another sequence control was carried out using an active RNA duplex active on the messenger RNA of the photinus Pyralis protein luciferase. This also showed no effect on the expression of lamin A / C (FIG. 7) 48 and 72 h after transfection in the same range of RNA concentration tested (50 to 200 nM). Luc: mRNA target (SEQ ID N ° 6): 5 'AAAUGUCCGUUCGGUUGGCAG These results prove that the mechanism of interference of expression of lamin A / C using an RNA duplexe specifically targeting a region of messenger RNA lamin A / C is effective and selective. The vector DOGS is effective for vectorizing interfering RNA in living cells and makes it possible to obtain high efficiency of interfering RNA without affecting the selectivity of the RNA / target recognition mechanism. EXAMPLE 2 Model of Exogenous Protein: Luciferase A - Model of Co-transfection of the Target Gene and Interfering RNAs The model of cell co-transfection consists in sending into the cell simultaneously a plasmid expressing the exogenous gene of the protein studied and the interfering RNA duplexes. This technique has the advantage of making it possible to quickly measure the effectiveness of interfering RNAs in inhibiting the expression of a protein studied. Several parameters can be obtained such as the sequence of the most active oligonucleotides (choice of the sequence recognized on the messenger RNA target), the concentration effective, the duration of inhibition of the expression of the targeted protein or the choice of the cell type used. The DOGS molecule was used as a vector for co-transfection of DNA and interfering RNA (double strand) in the tests reported below. The reporter gene for luciferase has been used as an exogenous gene because it allows the amount of protein produced by a chemiluminescence reaction to be quantified. Plasmid and double-stranded RNA co-transfection protocol. The protocol is given for 24-well plate transfections, for 200 ng of plasmid and for 7-70 ng of interfering RNA duplexes (ie a transfection step with 1-10 nM of interfering RNA). • Etapel: Dilute 7-70 ng (1-10 nM) of interfering RNA and 200 ng of plasmid pCMVLuc (luciferase gene under the control of the cytomegalovirus promoter, CMV) in a final volume of 50 μl of culture medium without serum. Vortex slightly. • Step 2: Dilute 0.6-0.8 μl of DOGS solution (2 mM) in 50 μl of culture medium without serum. Vortex strongly to form the cationic liposomes and wait 15 min. • Add the 50 μl of the DOGS solution to the solution containing the nucleic acids. Vortex strongly and leave for 30 minutes at room temperature. During the incubation necessary for the formation of the transfection complexes, remove the culture medium from the cells to replace it with 0.5 ml of medium without serum. • Then add 100 μl per well of transfection complexes and return the cells to 37 ° C for 4 h. Then add 0.5 ml of medium containing 20% serum (ultimately 10%). Table 1. Co-transfection conditions with 200 ng of plasmid (recommended for adherent cells).
Figure imgf000017_0002
d'ARN de 21 nucléotides
Figure imgf000017_0002
RNA of 21 nucleotides
Calcul de la quantité de DOGS nécessaireCalculation of the amount of DOGS required
Figure imgf000017_0003
Figure imgf000017_0001
Figure imgf000017_0003
Figure imgf000017_0001
Test luciférase Préparer du tampon de lyse IX en diluant la solution stock (5X) dans l'eau. Enlever le milieu de culture des puits, laver avec 0,5ml de PBS et ajouter lOOμl de tampon de lyse par puits, incuber 30 minutes à température ambiante. Récupérer les lysats dans des Eppendorf 1,5ml et centrifuger 5 minutes à 14000rpm/min. Ajouter 20μl de surnageant par puits d'une plaque 96 puits opaques pour luminomètre et mesurer la luminescence avec un temps d'intégration de 10 secondes (luminomètre, PhL Mediators, Vienne) après addition de lOOμl de luciférine par puits (substrat lyophilisé hydraté avec tampon et amener à température ambiante) . Dosage protéines (kit BCA-Pearce) Ajouter 15D1 des surnageants dans des tubes 4ml + 1ml de réactif BCA (1 volume de réactif bleu pour 50 volumes de réactif blanc), vortexer (5s, 1500t/min) et incuber 30 minutes à 60°C, mesurer l'absorbance à 562 nm. Gamme étalon de BSA : 15μl de tampon de lyse IX + μl BSA + lml BCA/tube. Résultats de l'efficacité de la co-transfection du gène luciférase et des ARN interférents luciférase avec du DOGS. L'efficacité du DOGS à transfecter simultanément un plasmide exprimant le gène cible de la luciférase ( firefly pyralis) et les ARN interférents a été montrée sur plusieurs lignées cellulaires. Le duplexe d' ARN-luciférase spécifique choisi est celui utilisé par Elbashir et collaborateurs (Elbashir et al., 2001b) dans des cellules eucaryotes en culture et qui ont optimisé le positionnement sur la cible ARN messager luciférase. La mesure de l'efficacité est déterminée par dosage de l'activité luciférase (RLU/mg de protéine) par chimioluminescence 24 h après la co-transfection. Une inhibition de l'expression de la luciférase par les ARN interférents la luciférase par rapport aux ARN contrôles mutés est clairement démontrée dans l'exemple détaillé de la co- transfection des cellules A549 (Fig 9) . Les résultats montrent qu'une inhibition de l'expression de la protéine est supérieure à 90 % dès 10 nM d'ARN interférents, alors que la séquence d'ARN mutée est inefficace jusqu'à 100 nM. Des effets non spécifiques semblent diminuer l'efficacité générale de l'interférence quand des concentrations élevées en ARN sont utilisées, de l'ordre de 200 nM et au-dessus. Plusieurs types cellulaires ont été co-transfectés avec le DOGS et montrent que celui-ci est efficace pour induire l'inhibition de l'expression de la luciférase. Des cellules adhérentes (HeLa, BNL Cl.2, A 549, HEK 293, BHK, CHO) et des cellules non-adhérentes (K562, Jurkat) ont été testées et les résultats sont présentés dans la figure 10. Luciferase test Prepare lysis buffer IX by diluting the stock solution (5X) in water. Remove the culture medium from the wells, wash with 0.5 ml of PBS and add 100 μl of lysis buffer per well, incubate for 30 minutes at room temperature. Recover the lysates in 1.5 ml Eppendorf and centrifuge for 5 minutes at 14000 rpm / min. Add 20 μl of supernatant per well of an opaque 96-well plate for luminometer and measure luminescence with an integration time of 10 seconds (luminometer, PhL Mediators, Vienna) after addition of 100 μl of luciferin per well (lyophilized hydrated substrate with buffer and bring to room temperature). Protein assay (BCA-Pearce kit) Add 15D1 of the supernatants to 4ml tubes + 1ml of BCA reagent (1 volume of blue reagent for 50 volumes of white reagent), vortex (5s, 1500t / min) and incubate 30 minutes at 60 ° C, measure the absorbance at 562 nm. BSA standard range: 15 μl of IX lysis buffer + μl BSA + lml BCA / tube. Results of the efficiency of the co-transfection of the luciferase gene and of the luciferase interfering RNAs with DOGS. The efficacy of DOGS to simultaneously transfect a plasmid expressing the target luciferase gene (firefly pyralis) and the interfering RNAs has been shown on several cell lines. The specific RNA luciferase duplex chosen is that used by Elbashir et al. (Elbashir et al., 2001b) in eukaryotic cells in culture and which have optimized positioning on the luciferase messenger RNA target. The measurement of the efficacy is determined by assaying the luciferase activity (RLU / mg of protein) by chemiluminescence 24 h after co-transfection. Inhibition of luciferase expression by RNA Luciferase interferences with respect to mutated control RNAs is clearly demonstrated in the detailed example of the co-transfection of A549 cells (FIG. 9). The results show that an inhibition of the expression of the protein is greater than 90% from 10 nM of interfering RNA, while the mutated RNA sequence is ineffective up to 100 nM. Nonspecific effects appear to decrease the overall effectiveness of the interference when high concentrations of RNA are used, on the order of 200 nM and above. Several cell types have been co-transfected with DOGS and show that it is effective in inducing the inhibition of the expression of luciferase. Adherent cells (HeLa, BNL Cl.2, A 549, HEK 293, BHK, CHO) and non-adherent cells (K562, Jurkat) were tested and the results are presented in FIG. 10.
Références : Behr,J.P., Demeneix,B., Loeff1er, J. P. , Perez-Mutul, J. (1989) Efficient gène transfert into mammalian primary endocrine cells with lipopolyamine-coated DNA. PNAS 86, 6982- 6986. Elbashir, SM et al. (2001) Duplexes of 21-nucleotide RNAs médiate RNA interférence in mammalian cell culture. Nature 411: 494-498. Elbashir, SM et al. (2001) RNA interférence is ediated by 21 and 22 nt RNAs. Gènes & Dev. 15: 188-200. Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., and Mello, C.C. (1998) Potent and spécifie genetic interfernce by double stranded RNA in Caenorhabditis elegans. Nature 391, 806-811. Tuschl, T. et al. (1999) Targeted mRNA dégradation by double-stranded RNA in vitro. Gènes & Dev. 13, 3191-3197. Zamore, P.D., Tuschl, T., Sharp, P.A., and Bartel, D.P. (2000) . RNAi: Double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervais. Cell 101, 25-33. References: Behr, J.P., Demeneix, B., Loeff1er, J. P., Perez-Mutul, J. (1989) Efficient gene transfer into mammalian primary endocrine cells with lipopolyamine-coated DNA. PNAS 86, 6982-6986. Elbashir, SM et al. (2001) Duplexes of 21-nucleotide RNAs mediate RNA interference in mammalian cell culture. Nature 411: 494-498. Elbashir, SM et al. (2001) RNA interference is ediated by 21 and 22 nt RNAs. Genes & Dev. 15: 188-200. Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., and Mello, C.C. (1998) Potent and specifies genetic interfernce by double stranded RNA in Caenorhabditis elegans. Nature 391, 806-811. Tuschl, T. et al. (1999) Targeted mRNA degradation by double-stranded RNA in vitro. Genes & Dev. 13, 3191-3197. Zamore, P.D., Tuschl, T., Sharp, P.A., and Bartel, D.P. (2000). RNAi: Double-stranded RNA direct the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervenes. Cell 101, 25-33.

Claims

R E V E N D I C A T I O N S
1. Utilisation comme vecteur pour la transfection d'acides nucléiques actifs pour l'ARN interférence d'une composition à base de lipides cationiques du type lipopolyamine. 1. Use as a vector for the transfection of nucleic acids active for RNA interference of a composition based on cationic lipids of the lipopolyamine type.
2. Utilisation selon la revendication 1, caractérisée en ce que la lipopolyamine est la dioctadécylamidoglycylspermine (DOGS en abrégé) . 2. Use according to claim 1, characterized in that the lipopolyamine is dioctadecylamidoglycylspermine (DOGS for short).
3. Utilisation selon la revendication 2, caractérisée en ce que le vecteur est constitué par DOGS. 3. Use according to claim 2, characterized in that the vector consists of DOGS.
4. Utilisation selon la revendication 2, caractérisée en ce que DOGS est utilisée en combinaison avec au moins un composé choisi dans le groupe comprenant : les lipides cationiques ou neutres, comme le cholestérol, participant à la complexation et à la formulation des ARN interférents, les détergents cationiques ou neutres participant à la formulation - des ARN interférents et au processus de transfection, - les phospholipides neutres ou chargés, comme la dioléolylphosphatidyléthanolamine, participant à la formulation des ARN interférents et au- processus de trans ection, des peptides fusiogènes participant au processus de transfection, des protéines, comme les histones, participant au transport intracellulaire des complexes de transfection, des polymères hydrophiles, tels que des PEGs, participant à la formulation des ARN interférents et au processus de transfection, des polymères cationiques, tels que les polyéthylènimines et ces dérivés, participant à la complexation et à la formulation des ARN interférents et au processus de transfection, des molécules de reconnaissance de récepteurs tels que des ligands de différente nature (protéines, peptides, anticorps, métabolites, oses, vitamines) . 4. Use according to claim 2, characterized in that DOGS is used in combination with at least one compound chosen from the group comprising: cationic or neutral lipids, such as cholesterol, participating in the complexation and in the formulation of interfering RNAs, cationic or neutral detergents participating in the formulation of - interfering RNAs and in the transfection process, - neutral or charged phospholipids, such as dioleolylphosphatidylethanolamine, participating in the formulation of interfering RNAs and in the transection process, fusiogenic peptides participating in the transfection process, proteins, such as histones, participating in the intracellular transport of transfection complexes, hydrophilic polymers, such as PEGs, participating in the formulation of interfering RNAs and in the transfection process, cationic polymers, such as polyethylenimines and these derivatives, participating in the complexation and formulation of interfering RNAs and the transfection process, receptor recognition molecules such as ligands of different nature (proteins, peptides, antibodies, metabolites, oses, vitamins).
5. Utilisation selon l'une quelconque des revendications 1 à 4, caractérisée en ce que les acides nucléiques vectorisés sont des acides nucléiques actifs pour l'ARN interférence. 5. Use according to any one of claims 1 to 4, characterized in that the vectorized nucleic acids are nucleic acids active for RNA interference.
6. Utilisation selon la revendication 5, caractérisée en ce que les acides nucléiques sont des duplexes d'ARNi. 6. Use according to claim 5, characterized in that the nucleic acids are RNAi duplexes.
7. Utilisation selon la revendication 5 ou 6, caractérisée en ce que les acides nucléiques à activité d'ARNi sont modifiés chimiquement. 7. Use according to claim 5 or 6, characterized in that the nucleic acids with RNAi activity are chemically modified.
8. Utilisation selon la revendication 7, caractérisée en ce que chaque brin d'ARNi comporte de 18 à 24 nucléotides. 8. Use according to claim 7, characterized in that each strand of RNAi comprises from 18 to 24 nucleotides.
9. Utilisation selon la revendication 8, caractérisée en ce que les brins sont appariés sur une région homologue d' au moins 18 nucléotides. 9. Use according to claim 8, characterized in that the strands are paired on a homologous region of at least 18 nucleotides.
10. Utilisation selon la revendication 8 ou 9, caractérisée en ce que les acides nucléiques présentent des extrémités 3' non appariées sur une longueur de 2 à 4 nucléotides . 10. Use according to claim 8 or 9, characterized in that the nucleic acids have unpaired 3 'ends over a length of 2 to 4 nucleotides.
11. Utilisation selon l'une quelconque des revendications précédentes, caractérisée en ce que la protéine ciblée est une protéine endogène ou une protéine hétérologue exprimée de façon stable. 11. Use according to any one of the preceding claims, characterized in that the targeted protein is an endogenous protein or a heterologous protein expressed in a stable manner.
12. Utilisation selon l'une quelconque des revendications précédentes, caractérisée en ce que la protéine ciblée est une protéine exogène. 12. Use according to any one of the preceding claims, characterized in that the targeted protein is an exogenous protein.
13. Utilisation selon la revendication 12, caractérisée en ce que l'expression de la protéine exogène peut être obtenue de façon simultanée dans la cellule par co- transfection du gène de la protéine ciblée et des ARN interférents . 13. Use according to claim 12, characterized in that the expression of the exogenous protein can be obtained simultaneously in the cell by cotransfection of the gene of the targeted protein and of the interfering RNAs.
14. Utilisation selon la revendication 12, caractérisée en ce que l'expression de la protéine exogène dans la cellule peut être obtenue par transfection du gène correspondant avant ou après l'introduction des ARN interférents. 14. Use according to claim 12, characterized in that the expression of the exogenous protein in the cell can be obtained by transfection of the corresponding gene before or after the introduction of the interfering RNAs.
15. Utilisation selon l'une quelconque des revendications précédentes, caractérisée par la mise en œuvre d'une formulation vecteurs/acides nucléiques interférents contenant en outre au moins un composé selon la revendication 4 et un milieu tamponné et salin pour fabriquer un médicament pour le traitement de maladies génétiques. 15. Use according to any one of the preceding claims, characterized by the implementation of a vector / interfering nucleic acid formulation further containing at least one compound according to claim 4 and a buffered and saline medium for manufacturing a medicament for the treatment of genetic diseases.
16. Utilisation selon l'une quelconque des revendications l à 14, caractérisée par la mise en œuvre d'une formulation vecteurs/acides nucléiques interférents contenant en outre au moins un composé selon la revendication 4 et un milieu tamponné iso-osmotique, ou faiblement salin, ou hypotonique, pour le traitement de maladies génétiques. 16. Use according to any one of claims l to 14, characterized by the use of a formulation / vectors / interfering nucleic acids further containing at least one compound according to claim 4 and an iso-osmotic buffered medium, or weakly saline, or hypotonic, for the treatment of genetic diseases.
17. Utilisation selon la revendication 16, caractérisée en ce que les formulations sont administrables par voie injectable et comprennent un véhicule pharmaceutiquement acceptable. 17. Use according to claim 16, characterized in that the formulations can be administered by injectable route and comprise a pharmaceutically acceptable vehicle.
18. Utilisation selon la revendication 16 ou 17, caractérisée en ce que les formulations sont administrables par voie topique sur la peau et/ou les muqueuses et contenant un véhicule pharmaceutiquement acceptable. 18. Use according to claim 16 or 17, characterized in that the formulations can be administered topically to the skin and / or the mucous membranes and containing a pharmaceutically acceptable vehicle.
19. Utilisation selon l'une quelconque des revendications précédentes, caractérisée par l'induction d'un effet régulateur sur l'expression d'une ou de plusieurs protéines cibles responsables ou impliqués dans des maladies génétiques héréditaires, des maladies génétiques complexes, comme le cancer, ou des infections virales. 19. Use according to any one of the preceding claims, characterized by the induction of a regulatory effect on the expression of one or more target proteins responsible for or involved in hereditary genetic diseases, complex genetic diseases, such as cancer, or viral infections.
20. Méthode de transfection d'acides nucléiques actifs pour l'ARN interférence, caractérisée en ce qu'elle comprend : l'incubation d'un complexe de transfection comprenant un vecteur selon l'une quelconque des revendications 1 à 10, et une composition lipidique selon l'une des revendications 1 à 3, avec des cellules en culture. 20. Method for transfection of active nucleic acids for interference RNA, characterized in that it comprises: incubating a transfection complex comprising a vector according to any one of claims 1 to 10, and a lipid composition according to any of claims 1 to 3, with cells in culture.
21. Vecteurs de transfection d'acides nucléiques actifs pour l'ARN interférence, caractérisés en ce qu'il s'agit de complexes comprenant une composition lipidique telle que définie dans l'une quelconque des revendications 1 à 10, avec un vecteur selon l'une quelconque des revendications 1 à 3, et des cellules en culture. 21. Transfection vectors of active nucleic acids for interference RNA, characterized in that they are complexes comprising a lipid composition as defined in any one of claims 1 to 10, with a vector according to l 'any of claims 1 to 3, and cells in culture.
PCT/FR2004/002086 2003-08-04 2004-08-04 Novel active nucleic acid complexes for rna interference and the use thereof for inhibiting protein expression WO2005014837A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR0309612A FR2858628B1 (en) 2003-08-04 2003-08-04 NOVEL NUCLEIC ACID COMPLEXES FOR RNA INTERFERENCE AND THEIR USE FOR INHIBITING PROTEIN EXPRESSION
FR0309612 2003-08-04

Publications (1)

Publication Number Publication Date
WO2005014837A1 true WO2005014837A1 (en) 2005-02-17

Family

ID=34073010

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR2004/002086 WO2005014837A1 (en) 2003-08-04 2004-08-04 Novel active nucleic acid complexes for rna interference and the use thereof for inhibiting protein expression

Country Status (2)

Country Link
FR (1) FR2858628B1 (en)
WO (1) WO2005014837A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006023491A2 (en) 2004-08-16 2006-03-02 The Cbr Institute For Biomedical Research, Inc. Method of delivering rna interference and uses thereof
WO2008040792A2 (en) 2006-10-04 2008-04-10 Centre National De La Recherche Scientifique (Cnrs) Compositions comprising a sirna and lipidic 4,5-disubstituted 2-deoxystreptamine ring aminoglycoside derivatives and uses thereof
WO2012075337A2 (en) 2010-12-01 2012-06-07 Spinal Modulation, Inc. Directed delivery of agents to neural anatomy
US9700622B2 (en) 2006-07-11 2017-07-11 Pci Biotech As Method for introducing siRNA into cells by photochemical internalisation

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2941152B1 (en) 2009-01-20 2013-10-18 Centre Nat Rech Scient VECTORS COMPRISING ANIONIC MACROMOLECULE AND CATIONIC LIPID FOR THE ADMINISTRATION OF SMALL NUCLEIC ACIDS

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5334761A (en) * 1992-08-28 1994-08-02 Life Technologies, Inc. Cationic lipids
US5476962A (en) * 1989-04-17 1995-12-19 Centre National De La Recherche Scientifique New lipopolyamines, their preparation and their use
US5744335A (en) * 1995-09-19 1998-04-28 Mirus Corporation Process of transfecting a cell with a polynucleotide mixed with an amphipathic compound and a DNA-binding protein
WO1999009045A1 (en) * 1997-08-20 1999-02-25 Somagenics, Inc. Antisense and antigene therapeutics with improved binding properties and methods for their use
US6060456A (en) * 1993-11-16 2000-05-09 Genta Incorporated Chimeric oligonucleoside compounds
WO2001072280A2 (en) * 2000-03-24 2001-10-04 Biosphere Medical Inc. Microspheres for gene therapy
WO2003056012A1 (en) * 2001-12-24 2003-07-10 Cancer Research Technology Limited A system for stable expression of sirnas in mammalian cells

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5476962A (en) * 1989-04-17 1995-12-19 Centre National De La Recherche Scientifique New lipopolyamines, their preparation and their use
US5334761A (en) * 1992-08-28 1994-08-02 Life Technologies, Inc. Cationic lipids
US6060456A (en) * 1993-11-16 2000-05-09 Genta Incorporated Chimeric oligonucleoside compounds
US5744335A (en) * 1995-09-19 1998-04-28 Mirus Corporation Process of transfecting a cell with a polynucleotide mixed with an amphipathic compound and a DNA-binding protein
WO1999009045A1 (en) * 1997-08-20 1999-02-25 Somagenics, Inc. Antisense and antigene therapeutics with improved binding properties and methods for their use
WO2001072280A2 (en) * 2000-03-24 2001-10-04 Biosphere Medical Inc. Microspheres for gene therapy
WO2003056012A1 (en) * 2001-12-24 2003-07-10 Cancer Research Technology Limited A system for stable expression of sirnas in mammalian cells

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ELBASHIR S M ET AL: "Analysis of gene function in somatic mammalian cells using small interfering RNAs", METHODS: A COMPANION TO METHODS IN ENZYMOLOGY, ACADEMIC PRESS INC., NEW YORK, NY, US, vol. 26, no. 2, February 2002 (2002-02-01), pages 199 - 213, XP002251055, ISSN: 1046-2023 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006023491A2 (en) 2004-08-16 2006-03-02 The Cbr Institute For Biomedical Research, Inc. Method of delivering rna interference and uses thereof
US9700622B2 (en) 2006-07-11 2017-07-11 Pci Biotech As Method for introducing siRNA into cells by photochemical internalisation
WO2008040792A2 (en) 2006-10-04 2008-04-10 Centre National De La Recherche Scientifique (Cnrs) Compositions comprising a sirna and lipidic 4,5-disubstituted 2-deoxystreptamine ring aminoglycoside derivatives and uses thereof
WO2008040792A3 (en) * 2006-10-04 2008-08-28 Centre Nat Rech Scient Compositions comprising a sirna and lipidic 4,5-disubstituted 2-deoxystreptamine ring aminoglycoside derivatives and uses thereof
JP2010505406A (en) * 2006-10-04 2010-02-25 サントル・ナシオナル・ドゥ・ラ・ルシェルシュ・シアンティフィーク（セーエヌエールエス） Composition comprising siRNA and lipidic 4,5-disubstituted 2-deoxystreptamine ring aminoglycoside derivative and use thereof
WO2012075337A2 (en) 2010-12-01 2012-06-07 Spinal Modulation, Inc. Directed delivery of agents to neural anatomy

Also Published As

Publication number Publication date
FR2858628A1 (en) 2005-02-11
FR2858628B1 (en) 2008-01-04

Similar Documents

Publication Publication Date Title
Shah et al. Extracellular vesicle-mediated long-range communication in stressed retinal pigment epithelial cell monolayers
Marcusson et al. Phosphorothioate oligodeoxyribonucleotides dissociate from cationic lipids before entering the nucleus
JP5766900B2 (en) Treatment of eye diseases characterized by elevated intraocular pressure with siRNA
JP5622254B2 (en) Double-stranded ribonucleic acid polyion complex
CN101631553B (en) Compositions for transfection of oligonucleotides active for gene silencing and their biological and therapeutical applications
US11220686B2 (en) Therapeutic alteration of transplantable tissues through in situ or ex vivo exposure to RNA interference molecules
EP2925882B1 (en) High-throughput screening method for the identification of biomarkers, therapeutic targets or therapeutic agents
ITRM20120480A1 (en) MULTICOMPONENT LIPID NANOPARTICLES AND PROCEDURES FOR THEIR PREPARATION.
CA2222197A1 (en) Anti sense oligonucleotides for blocking ige receptor synthesis
KR20100131509A (en) Double-stranded lipid-modified rna having high rna interference effect
CN113166783A (en) Compositions and systems comprising transfection-active vesicles free of organic solvents and detergents and methods related thereto
JP2022529579A (en) Delivery system containing silicon nanoparticles
Dass Liposome-mediated delivery of oligodeoxynucleotides in vivo
US20210163933A1 (en) Arc protein extracellular vesicle nucleic acid delivery platform
Hughes et al. In vitro transport and delivery of antisense oligonucleotides
WO2005014837A1 (en) Novel active nucleic acid complexes for rna interference and the use thereof for inhibiting protein expression
WO2005005632A2 (en) SMALL INTERFERING RNA SPECIFIC TO SUB-UNITS $G(A), $G(A)' AND $G(B) OF THE KINASE PROTEIN CK2, AND THE APPLICATIONS OF THE SAME
JP2008511302A (en) Methods and compositions for inhibiting P2X7 receptor expression
De Rosa et al. Novel cationic liposome formulation for the delivery of an oligonucleotide decoy to NF-κB into activated macrophages
EP2166095A2 (en) Antisense oligonucleotides capable of inhibiting the formation of capillary tubes in endothelial cells
EP3999075A1 (en) Sirna sequences targeting the expression of human genes jak1 or jak3 for a therapeutic use
EP2389158B1 (en) Vectors including an anionic macromolecule and a cationic lipid for delivering small nucleic acids
FR2814370A1 (en) USE OF A NUCLEIC ACID / PEI COMPLEX FOR TARGETING STEM CELLS OF THE BRAIN
CN116940324A (en) Lipid nanoparticle spherical nucleic acids
YANG THE INFLUENCE OF OXIDATION OF MULTIFUNCTIONAL ECO IN

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase