WO2005014612A1 - Novel splice variant of ctla-4 - Google Patents
Novel splice variant of ctla-4 Download PDFInfo
- Publication number
- WO2005014612A1 WO2005014612A1 PCT/US2003/021290 US0321290W WO2005014612A1 WO 2005014612 A1 WO2005014612 A1 WO 2005014612A1 US 0321290 W US0321290 W US 0321290W WO 2005014612 A1 WO2005014612 A1 WO 2005014612A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- lictla
- seq
- expression
- ctla
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70521—CD28, CD152
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
- C07H21/04—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
Definitions
- the invention pertains generally to the field of immunology. More specifically, the invention pertains to compositions and methods related to cytotoxic T lymphocyte-associated antigen-4 (CTLA-4), a costimulatory receptor expressed on T cells that plays a critical role in downregulating T cell responses.
- CTLA-4 cytotoxic T lymphocyte-associated antigen-4
- CTLA-4 and the structurally related CD28 molecule both bind to costimulatory B7 molecules, B7J and B7.2, with opposite effects.
- CD28 delivers an immunostimulatory signal
- CTLA-4 delivers an immunoinhibitory signal.
- Loss of CTLA-4 results in the development of multi-organ autoimmune disease with uncontrolled T-cell activation.
- a number of autoimmune diseases in humans and in mice have shown genetic linkage to the CTLA-4 locus. Copeman JB et al.
- CTLA-4 has attracted a great deal of attention in recent years. In addition to the natural molecule, soluble forms of CTLA-4 are known.
- CTLA-4 a naturally occurring alternative splice variant
- CTLA4Ig a fusion protein which includes an extracellular portion of CTLA-4 genetically fused to an immunoglobulin G Fc tail.
- the invention relates in part to a novel splice variant of CTLA-4, discovered by the inventors, that shows genetic linkage with autoimmune type 1 (insulin-dependent) diabetes mellitus in NOD mice, and that lacks exon 2 and thus lacks the extracellular IgV domain.
- This splice variant of CLTA-4 named ligand-independent CTLA-4 (liCTLA-4), lacks the MYPPPY (SEQ ID NO:5) motif essential for binding to B7 molecules.
- liCTLA-4 is expressed as a protein in primary T cells and strongly inhibits T cell responses when expressed in CTLA-4-/- T cells.
- the invention generally provides compositions and methods related to isolated liCTLA-4 nucleic acids and polypeptides that are useful for screening and treating T-cell-mediated immunity.
- the invention is an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2 (murine liCTLA-4).
- the isolated nucleic acid molecule includes a sequence provided by SEQ ID NOJ.
- the isolated nucleic acid molecule has a sequence provided by SEQ ID NOJ.
- the invention is an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4 (human liCTLA-4).
- the isolated nucleic acid molecule includes a sequence provided by SEQ ID NO:3.
- the isolated nucleic acid molecule has a sequence provided by SEQ ID NO:3.
- the invention is an expression vector that includes an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2 (murine liCTLA-4), operably linked to a promoter.
- the isolated nucleic acid molecule includes a sequence provided by SEQ ID NOJ .
- the isolated nucleic acid molecule has a sequence provided by SEQ ID NOJ.
- the invention is an expression vector that includes an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4 (human liCTLA-4), operably linlced to a promoter.
- the isolated nucleic acid molecule includes a sequence provided by SEQ ID NO:3. In one embodiment according to this aspect of the invention, the isolated nucleic acid molecule has a sequence provided by SEQ ID NO:3. In one aspect the invention is a host cell having an expression vector that includes an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2 (murine liCTLA-4), operably linlced to a promoter.
- the invention is a host cell having an expression vector that includes an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4 (human liCTLA-4), operably linked to a promoter.
- the invention is a pharmaceutical composition including an expression vector that includes an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2 (murine liCTLA-4), operably linked to a promoter, and a pharmaceutically acceptable carrier.
- the isolated nucleic acid molecule includes a sequence provided by SEQ ID NOJ.
- the isolated nucleic acid molecule has a sequence provided by SEQ ID NO: 1.
- the invention is a pharmaceutical composition including an expression vector that includes an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4 (human li CTLA-4), operably linked to a promoter, and a pharmaceutically acceptable carrier.
- the isolated nucleic acid molecule includes a sequence provided by SEQ ID NO:3.
- the isolated nucleic acid molecule has a sequence provided by SEQ ID NO:3.
- the invention is an isolated polypeptide including an amino acid sequence provided by SEQ ID NO:2.
- the isolated polypeptide has an amino acid sequence provided by SEQ ID NO:2. In one aspect the invention is an isolated polypeptide including an amino acid sequence provided by SEQ ID NO:4. In one embodiment according to this aspect of the invention, the isolated polypeptide has an amino acid sequence provided by SEQ ID NO:4. In one aspect the invention is a pharmaceutical composition including a polypeptide having an amino acid sequence provided by SEQ ID NO:2 and a pharmaceutically acceptable carrier. In one aspect the invention is a pharmaceutical composition including a polypeptide having an amino acid sequence provided by SEQ ID NO:4 and a pharmaceutically acceptable carrier. In a further aspect the invention provides a method for inhibiting an immune response.
- the method according to this aspect of the invention involves the step of contacting a T lymphocyte with an effective amount of an agent that increases expression of liCTLA-4 to inhibit an immune response.
- the invention provides a method for inhibiting an immune response in a subject.
- the method according to this aspect of the invention involves the step of administering to a subject an effective amount of an agent that increases expression of liCTLA-4 to inhibit an immune response in the subject.
- the subject has received or is about to receive an allo graft.
- the invention provides a method for treating an autoimmune disease.
- the method according to this aspect of the invention involves the step of administering to a subject that has or is at risk of having an autoimmune disease an effective amount of an agent that increases expression of liCTLA-4 to treat the autoimmune disease.
- the autoimmune disease is insulin-dependent diabetes mellitus.
- the autoimmune disease is multiple sclerosis.
- the invention provides a method for screening for immune reactivity. The method according to this aspect of the invention involves the steps of measuring expression of liCTLA-4 by a T cell and determining immune reactivity of the T cell is (a) high when liCTLA-4 expression is low, and (b) low when liCTLA-4 expression is high.
- the invention provides a method for screening a subject for risk of having or developing an autoimmune disease.
- the method according to this aspect of the invention involves the steps of measuring expression of liCTLA-4 by T cells of a subject and determining the subject's risk of having or developing an autoimmune disease is (a) high when liCTLA-4 expression is low, and (b) low when liCTLA-4 expression is high.
- Figure 1 A is an image of an agarose gel loaded with RT-PCR products showing the detection of CTLA-4 isoforms in C57BL/6 mice.
- Complementary DNA (cDNA) synthesized from unactivated (lane 1) or activated (lane 2) spleen cells were amplified using primers designed to amplify cDNA encoding full-length CTLA-4 (flCTLA-4).
- flCTLA-4 soluble CTLA-4
- liCTLA-4 novel splice variant ligand-independent CTLA-4
- Figure IB is a cartoon depicting comparative protein domains of flCTLA-4 and liCTLA-4.
- the protein structure of flCTLA-4 is compared to the predicted structure and protein domains of liCTLA-4.
- the predicted amino acid sequence of liCTLA-4 was found to lack the IgV domain (residues 38-161) and the B7 interacting motif MYPPPY (SEQ ID NO:5).
- Figure 1C depicts Western blot analysis of flCTLA-4 and liCTLA-4 expressed as recombinant proteins in HEK293T cells.
- HEK293T cells were transiently transfected with liCTLA-4 expressed in pCMV-TAG5C as a MYC-tagged protein and flCTLA-4 expressed in pCMV-HA.
- Cell lysates were loaded as follows: Lane 1, non-transfected; Lane 2, pCMN- Tag5C/liCTLA-4; Lane 3, non-transfected; Lane 4, pCMN-HA/flCTLA-4.
- Lanes 1 and 2 represent an immunoblot developed using an anti-MYC antibody and Lanes 3 and 4 represent an immunoblot developed using an anti-CTLA-4 antibody.
- Figure ID depicts flow cytometric analysis of surface expression of liCTLA-4 in HEK293T cells.
- Flow cytometric analysis for the detection of liCTLA-4 in HEK293T cells transfected with liCTLA-4 The cD ⁇ A of liCTLA-4 was modified to contain a 10 amino acid MYC insertion between the residues Asp 154 and Pro 155 in the amino-terminus of the extracellular domain of li CTLA-4. Transfectants were then stained for cell surface expression of HCTLA-4-MYC by using an anti-MYC antibody. Vector containing the liCTLA-4 without the MYC insertion was used as control (shaded histogram).
- Figure IE depicts Western blot analysis of CTLA-4 isoforms in in vitro activated spleen cells derived from C57BL/6 mice or C57BL/6 TKO (CTLA-4, B7.1, B7.2 -/-) mice
- Cell lysates were immunoblotted with an anti-CTLA-4 antibody which recognizes the cytoplasmic domain of both flCTLA-4 and liCTLA-4.
- Cell lysates were loaded as follows: Lane 1, recombinant flCTLA-4 expressed in HEK293 cell lysates; Lane 2, activated whole spleen cells lysates of C57BL/6 mice; and Lane 3, activated whole spleen cell lysates of C57BL/6 TKO mice.
- FIG. 2 A depicts flow cytometric analysis of retro virus-infected activated TKO T cells.
- Panels on the left show GFP expression in the TKO T cells infected with flCTLA-4 and liCTLA-4.
- GFP positive cells transfected with flCTLA-4 were stained with anti-CTLA-4 antibodies to confirm the expression of flCTLA-4 (right panel).
- Filled histogram indicates T cells infected with pGCIRES vector only, and the line histogram indicates flCTLA-4 expression in TKO T cells infected with pGCIRES expressing flCTLA-4.
- Figure 2B depicts Western blot analysis of cell lysates prepared from retro virus- infected activated TKO T cells for the expression of flCTLA-4 and liCTLA-4.
- CTLA-4 isoforms were detected by an anti-CTLA-4 antibody recognizing the cytoplasmic domain of flCTLA-4 and liCTLA-4.
- Lane l TKO/flCTLA-4;
- Lane 2 TKO/liCTLA-4;
- Lane 3 TKO/RV (empty retroviral vector).
- Lower panel shows the detection of GFP in the same lysates using an anti-GFP antibody.
- Figure 2C is a graph depicting mean dCPM (difference in CPM obtained by subtracting CPM values of cells treated with media alone from that of CPM values of cells activated with anti-CD3) in a proliferation assay as detected by 3 [H] -thymidine incorporation.
- TKO-RN activated TKO cells transfected with empty retrovirus vector
- DKO-RN activated DKO cells transfected with empty retrovirus vector
- TKO-flCTLA-4 activated TKO cells transfected with flCTLA-4 retrovirus expression vector
- TKO-liCTLA-4 activated TKO cells transfected with liCTLA-4 retrovirus expression vector.
- Data represent pooled values from two independent experiments. Error bars indicate standard error of the mean.
- Figure 2D is a graph depicting IF ⁇ - ⁇ production (pg/ml) in the supernatants of the cells from Figure 2C as detected by cytokine ELIS A. Data represent pooled values from two independent experiments. Error bars indicate standard error of the mean.
- Figure 3 is a pair of graphs depicting mR ⁇ A expression of (A) liCTLA-4 and (B) flCTLA-4 in fractionated CD4+CD45RB l0W and CD4+CD45RB high cells of autoimmune- susceptible (SJL, NOD) and autoimmune-resistant (B10.S, B6.H2 g7 ) strains of mice. Filled and open bars represent data for CD4+CD45RB low and CD4+CD45RB high cells, respectively.
- mRNA was examined by real-time RT-PCR and represented as ⁇ Ct values which were calculated by Ct values (threshold cycle of amplification) of triplicates normalized to a housekeeping gene.
- ⁇ Ct values which were calculated by Ct values (threshold cycle of amplification) of triplicates normalized to a housekeeping gene.
- Exon 2 single nucleotide polymorphism (SNP) shared between autoimmune-resistant mice and shared between autoimmune-susceptible mice is also shown. Mean data obtained from two separate experiments with 4-6 mice per group are indicated. Error bars indicate standard error of the mean of pooled ⁇ Ct values.
- Figure 4 depicts a sequence alignment of CD45 and Ctla-4 flanking the SNP at base 77 of exon 4 of CD45 and exon 2 of Ctla-4. Residues in bold are conserved between all sequences.
- an "allograft” refers generally to any cell, tissue, or organ transplanted from one individual to another, where the two individuals are members of the same species.
- allografts include, without limitation, bone marrow, heart, intestine, kidney, limb, liver, lung, muscle, muscle cells, pancreas, pancreatic islet cells, skin, and any combination thereof.
- xenografts i.e., any cell, tissue, or organ transplanted from one individual to another, where the two individuals are members of different species.
- autoimmune disease refers to any of a number of clinically recognized organ-specific or systemic diseases involving an immune response directed against normal host cells or tissue. Autoimmune diseases are widely viewed as diseases caused by a breakdown of self-tolerance such that the adaptive immune system responds to self antigens and mediates cell and tissue damage.
- Non-limiting examples of autoimmune diseases include autoimmune type 1 (insulin-dependent) diabetes mellitus, multiple sclerosis, experimental allergic encephalomyelitis, ankylosing spondylitis, anti-glomerular basement membrane disease (e.g., Goodpasture's syndrome), atherosclerosis, autoimmune hepatitis, Behcet's syndrome, Crohn's disease, Eaton-Lambert myasthenic syndrome, glomerulonephritis, gluten-sensitive enteropathy, Graves' disease, Guillain-Barre syndrome, Hashimoto's thyroiditis, hemolytic anemias, idiopathic thrombocytopenic purpura, myasthenia gravis, pernicious anemia, primary biliary cirrhosis, psoriasis, Reiter's syndrome, rheumatic fever, rheumatoid arthritis, sclerosing cholangitis, Sj ⁇ gren's syndrome, stiff-man syndrome, systemic l
- an "effective amount" of a compound refers generally to an amount of that compound necessary or sufficient to achieve a desired biologic effect. Administration of an effective amount can involve administering a single dose or more than one dose.
- expression refers to measurable elaboration of a gene product, at either the RNA or polypeptide level. Expression can be assessed using any suitable technique, including, without limitation, Northern blot hybridization, RNase protection assay, reverse transcriptase-polymerase chain reaction, immunoblotting, enzyme-linked immunosorbent assay (ELISA), flow cytometry, radioimmunoassay, and the like.
- the term "immune reactivity” as used herein refers to a propensity to develop an immune response.
- Immune reactivity can be general or it can be specific with respect to a particular antigen. In general immune reactivity will be reduced in the presence of liCTLA-4, relative to immune reactivity in the absence of liCTLA-4. Conversely, in general immune reactivity will be increased in the absence of liCTLA-4, relative to immune reactivity in the presence of liCTLA-4.
- factors can include, without limitation, priming, prior tolerization, drugs, antigen-nonspecific activation of antigen-presenting cells, etc.
- an "immune response” as used herein refers generally to any aspect of an isolated or a collective and coordinated response to contact with a foreign substance mediated by cells and molecules of the immune system.
- isolated as used herein with reference to a compound refers to a condition of being removed from other substances or conditions in which a compound occurs in nature.
- an isolated nucleic acid molecule can be a nucleic acid molecule removed from a cell.
- an isolated polypeptide can be a polypeptide removed from a cell.
- An isolated nucleic acid molecule or polypeptide can also be a molecule artificially synthesized outside of a cell.
- An isolated compound can but need not be pure.
- a "subject” as used herein refers to a mammal.
- a subject is a human.
- a subject is a non-human mammal, including laboratory, livestock, and domestic mammals.
- non-human mammals include, without limitation, mice, rats, hamsters, guinea pigs, rabbits, cats, dogs, pigs, goats, sheep, cattle, and horses.
- the term "treat” as used herein refers to preventing, slowing, reducing progression of, halting, or eliminating a measurable sign or symptom of a disease or disorder of a subject.
- the invention relates generally to a novel splice variant of CTLA-4 that is structurally and functionally distinct from previously described forms of CTLA-4. More specifically, the invention relates generally to a ligand-independent form of CTLA-4 (liCTLA-4) that is structurally and functionally distinct from full-length CTLA-4 (flCTLA-4) and from soluble CTLA-4 (sCTLA-4).
- Full-length CTLA-4 also known as CD 152
- CTLA-4 is a highly conserved, inducible inhibitory receptor expressed on the surface of activated T cells. Brunet JF et al. (1987) Nature 328:267-70.
- CTLA-4 is a member of the immunoglobulin superfamily and a member of the CD28 family of T-cell receptors.
- CTLA-4 and CD28 bind B7 molecules B7.1 (CD80) and B7.2 (CD86) as their ligands.
- CTLA-4 and CD28 share a sequence motif MYPPPY (SEQ ID NO:5) in the extracellular V domain that is thought to be essential for B7 binding.
- MYPPPY SEQ ID NO:5
- CTLA-4 serves as a negative regulator of T cell activation.
- CTLA-4-def ⁇ cient mice exhibit excessive T cell activation, proliferation, and systemic autoimmunity.
- Murine CTLA-4 is a 223-amino-acid glycoprotein that can exist as a disulfide-linked homodimer.
- the sequence of murine CTLA-4 protein is available from GenBank as, for example, Accession No. CAA29191 (SEQ ID NOJ4).
- the complementary DNA (cDNA) sequence of murine CTLA-4 is also available from GenBank as, for example, Accession No. X05719 (SEQ ID NOJ5).
- Human CTLA-4 is a 223-amino-acid glycoprotein that can exist as a disulfide-linked homodimer.
- a Icnown single nucleotide polymorphism (SNP) affecting amino acid sequence is +49G>A (Thrl7Ala).
- a sequence of human CTLA-4 protein is available from GenBank as, for example, Accession No. NP_005205 (SEQ ID NO: 16).
- a cDNA sequence of human CTLA-4 is also available from GenBank as, for example, Accession No. NM_005214 (SEQ ID NO: 17).
- a sequence of human CTLA-4 protein is available from GenBank as, for example, Accession No. AAB59385 (SEQ ID NOJ8).
- a cDNA sequence of human CTLA-4 is also available from GenBank as, for example, Accession No. L15006 (SEQ ID NOJ9).
- the exon structure of the Ctla-4 gene is known to include four exons. See, for example, GenBank Accession No. AF142145.
- Exon 1 includes nucleotides 1-109, corresponding to amino acids 1-36.
- Exon 2 includes nucleotides 110-457, corresponding to amino acids 37-152.
- Exon 3 includes nucleotides 458-567, corresponding to amino acids 153-189.
- Exon 4 includes nucleotides 568-672, corresponding to amino acids 190-223.
- the polypeptide encoded by exon 1 corresponds roughly to the signal peptide.
- the polypeptide encoded by exon 2 corresponds roughly to the remainder of the extracellular domain, including the B7-binding motif MYPPPY (SEQ ID NO:5).
- the polypeptide encoded by exon 3 corresponds roughly to the transmembrane domain.
- the polypeptide encoded by exon 4 corresponds roughly the cytoplasmic domain.
- Soluble CTLA-4 represents an alternative splice variant of CTLA-4 in which exon 3, encoding the transmembrane domain, is omitted.
- the sCTLA-4 polypeptide thus is a 186 amino acid polypeptide.
- the sCTLA-4 polypeptide is believed to bind to B7 molecules and to block immune stimulation without delivering a signal into the T cell, i.e., merely by acting as a sink for B7.
- the invention is based in part on the discovery by the inventors of a novel splice variant of CTLA-4, here designated as ligand-independent CTLA-4 or liCTLA-4.
- This novel splice variant has important structural and functional features which distinguish it from flCTLA-4 and from sCTLA-4.
- liCTLA-4 represents an alternative splice variant of CTLA-4 in which exon 2, encoding much of the extracellular domain, is omitted.
- liCTLA-4 lacks the B7-binding motif MYPPPY (SEQ ID NO:5) and thus is believed to be ligand-independent.
- liCTLA-4 is membrane-associated. Different from flCTLA-4, liCTLA-4 is constitutively expressed by T cells. As disclosed herein, liCTLA-4 appears to occur naturally in mice but has not yet been observed to occur naturally in humans. As disclosed herein, liCTLA-4 occurs as an alternatively spliced variant of CTLA-4 in which the extracellular IgV domain of fiCTLA-4 is omitted.
- SEQ ID NO:2 An amino acid sequence for murine liCTLA-4 is provided as SEQ ID NO:2, as follows:
- a cDNA sequence for murine liCTLA-4 is provided as SEQ ID NOJ, as follows:
- threonine shown underlined at position 17 in SEQ ID NOJ is replaced with alanine (“A”).
- a cDNA sequence for a human counterpart to murine liCTLA-4 is provided as SEQ ID NO:3, as follows:
- an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2 is provided.
- SEQ ID NO:2 provides an amino acid sequence for a murine liCTLA-4.
- the murine liCTLA-4 provided by SEQ ID NO:2 includes the cytoplasmic domain that is present in both full-length CTLA-4 and in soluble CTLA-4, and it lacks the CD80/CD86 binding motif MYPPPY (SEQ ID NO:5) that is present in both full-length CTLA-4 and in soluble CTLA-4. More specifically, the polypeptide having an amino acid sequence provided by SEQ ID NO:2 lacks amino acids 37-152 of full-length murine CTLA-4.
- SEQ ID NO:2 represents an expressed form of a transcriptional splice variant of the Ctla4 gene that is associated with a translationally silent G-to-A nucleotide substitution at position 77.
- This substitution appears to have the following two effects. First, at least a major portion (including a portion encoding the CD80/CD86 binding motif MYPPPY (SEQ ID NO:5)) or all of exon 2 is deleted from the transcript. In addition, the overall level of liCTLA-4 transcripts is increased four-fold in both activated and resting spleen cells from diabetes- resistant C57BL/6 and BIO mice as compared with diabetes-prone NOD and other autoimmune disease-prone strains of mice.
- the isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2 has a sequence provided by SEQ ID NO: 1.
- SEQ ID NO: 1 Those of skill in the art will recognize that an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2 is not a unique nucleic acid molecule, owing to the degeneracy of the genetic code.
- the isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO: 2 has a sequence that is related to SEQ ID NOJ by substitution of at least one alternative codon according to the degeneracy of the genetic code.
- an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4 is provided.
- SEQ ID NO:4 provides an amino acid sequence for a human counterpart to murine liCTLA-4.
- the human liCTLA-4 provided by SEQ ID NOJ includes the cytoplasmic domain that is present in both full-length CTLA-4 and in soluble CTLA-4, and it lacks the CD80/CD86 binding motif MYPPPY (SEQ ID NO:5) that is present in both full- length CTLA-4 and in soluble CTLA-4. More specifically, the polypeptide having an amino acid sequence provided by SEQ ID NO:4 lacks amino acids 37-152 of full-length human CTLA-4.
- the isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4 has a sequence provided by SEQ ID NO:3.
- an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4 is not a unique nucleic acid molecule, owing to the degeneracy of the genetic code.
- the isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4 has a sequence that is related to SEQ ID NO:3 by substitution of at least one alternative codon according to the degeneracy of the genetic code.
- codon usage may affect expression in a given species, and thus certain embodiments may be preferred for use in an application involving expression by a heterologous (i.e., non-human) cell.
- the invention in another aspect provides an expression vector including an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2, wherein said isolated coding nucleic acid is operably linked to a promoter.
- the isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2 includes a nucleic acid molecule having a sequence provided by SEQ ID NOJ .
- the isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2 is a nucleic acid molecule having a sequence provided by SEQ ID NO: 1.
- the liCTLA-4 nucleic acid in one embodiment, is operably linked to a gene expression sequence which directs the expression of the liCTLA-4 nucleic acid within a eukaryotic or prokaryotic cell.
- the "gene expression sequence” is any regulatory nucleotide sequence, such as a promoter sequence or promoter-enhancer combination, which facilitates the efficient transcription and translation of the coding nucleic acid to which it is operably linked.
- the gene expression sequence can be, for example, a mammalian or viral promoter, such as a constitutive or inducible promoter.
- Constitutive mammalian promoters include, but are not limited to, the promoters for the following genes: hypoxanthine phosphoribosyl transferase (HPRT), adenosine deaminase, pyruvate kinase, and ⁇ -actin.
- HPRT hypoxanthine phosphoribosyl transferase
- adenosine deaminase pyruvate kinase
- ⁇ -actin ⁇ -actin
- Exemplary viral promoters which function constitutively in cells include, for example, promoters from the simian virus, papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, cytomegalo virus, the long terminal repeats (LTR) of Moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus.
- Other constitutive promoters are known to those of ordinary skill in the art.
- the promoters useful as gene expression sequences of the invention also include inducible promoters. Inducible promoters are expressed in the presence of an inducing agent.
- the metallothionein promoter is induced to promote transcription and translation in the presence of certain metal ions.
- Other inducible promoters are known to those of ordinary skill in the art.
- the gene expression sequence shall include, as necessary, 5 ' non- transcribing and 5 ' non-translating sequences involved with the initiation of transcription and translation, respectively.
- Such 5 ' non-transcribing sequences will include a promoter region which includes a promoter sequence for transcriptional control of the operably joined coding nucleic acid.
- the gene expression sequences optionally include enhancer sequences or upstream activator sequences as desired.
- the liCTLA-4 nucleic acid sequence and the gene expression sequence are said to be "operably linked" when they are covalently linked in such a way as to place the transcription and/or translation of the liCTLA-4 coding sequence under the influence or control of the gene expression sequence.
- two DNA sequences are said to be operably linked if induction of a promoter in the 5' gene expression sequence results in the transcription of the liCTLA-4 sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the liCTLA-4 sequence, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein.
- a gene expression sequence would be operably linked to a liCTLA-4 nucleic acid sequence if the gene expression sequence were capable of effecting transcription of that liCTLA-4 nucleic acid sequence such that the resulting transcript might be translated into the desired protein or polypeptide.
- a liCTLA-4 molecule of the invention can be delivered to a host cell alone or in association with a vector.
- a "vector" is any vehicle capable of facilitating uptake of a nucleic acid molecule or of a polypeptide by a target cell, hi one embodiment a vector is any vehicle capable of facilitating uptake of a nucleic acid molecule encoding a liCTLA-4 polypeptide of the invention by a target cell.
- the vector is an expression vector, i.e., any vehicle capable of facilitating uptake and expression of a nucleic acid molecule encoding a liCTLA-4 polypeptide of the invention by a target cell.
- a vector is any vehicle capable of facilitating uptake of a liCTLA-4 polypeptide of the invention by a target cell.
- the vectors transport the liCTLA-4 molecule into the target cell with reduced degradation relative to the extent of degradation that would result in the absence of the vector.
- the vectors useful in the invention are divided into two classes: biological vectors and chemical/physical vectors.
- Bio vectors are useful for delivery/uptake of liCTLA-4 nucleic acids to/by a target cell.
- Chemical/physical vectors are useful for delivery/uptake of liCTLA-4 nucleic acids or liCTLA-4 polypeptides to/by a target cell.
- Biological vectors include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the nucleic acid sequences of the invention, and free nucleic acid fragments which can be attached to the nucleic acid sequences of the invention.
- Viral vectors are a type of biological vector and include, but are not limited to, nucleic acid sequences from the following viruses: retroviruses, such as: Moloney murine leukemia virus; Harvey murine sarcoma virus; murine mammary tumor virus; Rous sarcoma virus; adenovirus; adeno- associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes viruses; vaccinia viruses; polio viruses; and RNA viruses such as any retrovirus.
- retroviruses such as: Moloney murine leukemia virus; Harvey murine sarcoma virus; murine mammary tumor virus; Rous sarcoma virus; adenovirus; adeno- associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes viruses; vaccinia viruses; polio viruses; and RNA viruses such as
- Non-cytopathic viral vectors are based on non-cytopathic eukaryotic viruses in which non- essential genes have been replaced with the gene of interest.
- Non-cytopathic viruses include retroviruses, the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA.
- the retroviruses are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle).
- the adeno-associated virus can be engineered to be replication- deficient and is capable of infecting a wide range of cell types and species. It further has advantages, such as heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages; and lack of superinfection inhibition thus allowing multiple series of transductions. Reportedly, the adeno-associated virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression. In addition, wild-type adeno-associated virus infections have been followed in tissue culture for at least 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event.
- adeno-associated virus can also function in an extrachromosomal fashion.
- chemical/physical vectors may be used to deliver a liCTLA-4 molecule to a target cell and facilitate uptake thereby.
- a "chemical/physical vector” refers to a natural or synthetic molecule, other than those derived from bacteriological or viral sources, capable of delivering a molecule to a cell.
- a chemical/physical vector is a natural or synthetic molecule, other than those derived from bacteriological or viral sources, capable of delivering a liCTLA-4 molecule to a cell.
- a chemical/physical vector of the invention is a colloidal dispersion system.
- Colloidal dispersion systems include lipid-based systems including oil-in- water emulsions, micelles, mixed micelles, and liposomes.
- a colloidal system of the invention is, in one embodiiment, a liposome.
- Liposomes are artificial membrane vesicles which are useful as a delivery vector in vivo or in vitro. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2 - 4.0 ⁇ m can encapsulate large macromolecules. RNA, DNA, and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form. Fraley R et al. (1981) Biochemistry 20:6978-87.
- Liposomes are commercially available from Gibco BRL, for example, as LIPOFECTINTM and LIPOFECTACETM, which are formed of cationic lipids such as N-[l-(2, 3 dioleyloxy)-propyl]-N, N, N-trimethylammonium chloride (DOTMA) and dimethyl dioctadecylammonium bromide (DDAB).
- LIPOFECTINTM LIPOFECTINTM
- LIPOFECTACETM which are formed of cationic lipids such as N-[l-(2, 3 dioleyloxy)-propyl]-N, N, N-trimethylammonium chloride (DOTMA) and dimethyl dioctadecylammonium bromide (DDAB).
- reaction agents also can be used, alone or in combination with a biological or chemical/physical vector of the invention.
- a "compaction agent”, as used herein, refers to an agent, such as a histone, that neutralizes the negative charges on the nucleic acid and thereby permits compaction of the nucleic acid into a fine granule. Compaction of the nucleic acid facilitates uptake of the nucleic acid by the target cell.
- the compaction agents can be used alone, e.g., to deliver the liCTLA-4 molecule in a form that is more efficiently taken up by the cell or, in other embodiments, in combination with one or more of the above-described vectors.
- Other exemplary compositions that can be used to facilitate uptake by a target cell of the liCTLA-4 nucleic acids include calcium phosphate and other chemical mediators of intracellular transport, microinjection compositions, electroporation and homologous recombination compositions (e.g., for integrating a liCTLA-4 nucleic acid into a preselected location within the target cell chromosome).
- the expression vector is a retroviral expression vector.
- the retroviral expression vector includes a multiple cloning site useflil for insertion of a nucleic acid molecule encoding a liCTLA-4 gene product, an internal ribosome entry site (IRES) useful for initiating transcription, and a reporter gene useful for detecting the presence of and expression by the retroviral expression vector in a cell.
- the multiple cloning site includes at least one restriction endonuclease site (e.g., EcoR I) useful for cloning purposes using molecular biology techniques well Icnown in the art.
- the reporter gene can be any suitable gene that encodes a detectable marker. In one embodiment the reporter gene is conveniently chosen to be green fluorescent protein (GFP).
- GFP expression of GFP can be monitored by conventional techniques including, for example, fluorescence-activated cell sorting, fluorescence measurement in a luminometer, and immunoblotting using anti-GFP antibodies.
- the invention in another aspect provides an expression vector including an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4, wherein said isolated coding nucleic acid is operably linked to a promoter.
- the isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4 includes a nucleic acid molecule having a sequence provided by SEQ ID NO:3.
- the isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NOJ is a nucleic acid molecule having a sequence provided by SEQ ID NO:3.
- the invention provides a host cell containing an expression vector encoding a polypeptide having an amino acid sequence provided by SEQ ED NO:2.
- the expression vector includes a nucleic acid molecule having a sequence provided by SEQ ID NO: 1.
- a "host cell" refers to any suitable cell useful for expressing a product encoded by an expression vector introduced into said cell.
- the host cell is a eukaryotic cell.
- the host cell can be a prokaryotic cell.
- the host cell is a cell that is part of a subject. In certain embodiments the host cell is a cell that is removed from a subject, manipulated ex vivo, and then returned to the subject. In some embodiments the host cell is an immortalized cell, e.g., a cell that is part of a clone or part of a cell line. For example, in one embodiment the host cell is HEK293 (American Type Culture Collection (ATCC) CRL-1573, a human embryonal kidney cell line), hi certain specific embodiments the host cell is a cell that does not express CTLA-4, e.g., a T cell obtained from a Ctla4 knockout mouse.
- ATCC American Type Culture Collection
- the host cell is a cell that does not express CTLA-4 and does not express at least one of CD80 and CD86. In certain specific embodiments the host cell is a cell that does not express CTLA-4 and does not express either one of CD80 and CD86, e.g., a T cell obtained from a triple knockout mouse (TKO, lacking expression of CTLA-4 and B7J and B7.2). Mandelbrodt DA et al. (1999) JExp Med 189:435-40. In another embodiment the host cell is a cell that does express CTLA-4 but does not express either one of CD80 and CD86, e.g., a T cell obtained from a double knockout mouse (DKO, lacking expression of B7J and B7.2).
- DKO double knockout mouse
- the invention provides a host cell containing an expression vector encoding a polypeptide having an amino acid sequence provided by SEQ ID NO:4.
- the expression vector includes a nucleic acid molecule having a sequence provided by SEQ ID NO:3.
- the invention provides a pharmaceutical composition that includes one of the forgoing liCTLA-4 expression vectors and a pharmaceutically acceptable carrier. More specifically, in one embodiment the invention provides an expression vector including an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2, as previously described, and a pharmaceutically acceptable carrier.
- the invention provides an expression vector including an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4, as previously described, and a pharmaceutically acceptable carrier.
- a pharmaceutically acceptable carrier means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human or other animal.
- pharmaceutically acceptable means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients.
- Pharmaceutically acceptable further means a non-toxic material that is compatible with a biological system such as a cell, cell culture, tissue, or organism.
- carrier denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
- the characteristics of the carrier will depend on the route of administration.
- the components of the pharmaceutical compositions also are capable of being commingled with additional agents, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy.
- the pharmaceutically acceptable carrier is sterile for at least some forms of parenteral in vivo adminis -ration.
- Physiologically and pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials that are well known in the art.
- the invention provides a pharmaceutical composition that includes one of the forgoing liCTLA-4-encoding nucleic acid molecules and a pharmaceutically acceptable carrier. More specifically, in one embodiment the invention provides a nucleic acid molecule encoding an amino acid sequence provided by SEQ ID NO:2, as previously described, and a pharmaceutically acceptable carrier. In one embodiment the nucleic acid has a sequence that includes a sequence provided by SEQ ID NO: 1. In one embodiment the nucleic acid molecule has a sequence that is provided by SEQ ID NOJ .
- the invention provides a nucleic acid molecule encoding an amino acid sequence provided by SEQ ID NO:4, as previously described, and a pharmaceutically acceptable carrier, hi one embodiment the nucleic acid has a sequence that includes a sequence provided by SEQ ID NO:3. In one embodiment the nucleic acid molecule has a sequence that is provided by SEQ ID NO:3. Ln another aspect the invention provides an isolated polypeptide including an amino acid sequence provided by SEQ ID NO:2. In one embodiment the isolated polypeptide has an amino acid sequence provided by SEQ ID NO:2. As discussed above, SEQ ID NO:2 provides an amino acid sequence for a murine liCTLA-4. In another aspect the invention provides an isolated polypeptide comprising an amino acid sequence provided by SEQ ID NO:4.
- the isolated polypeptide has an amino acid sequence provided by SEQ ID NOJ.
- SEQ ID NO:4 provides an amino acid sequence for a human counterpart of murine liCTLA-4.
- the invention provides a pharmaceutical composition that includes one of the forgoing liCTLA-4 polypeptides and a pharmaceutically acceptable carrier. More specifically, in one embodiment the invention provides a polypeptide having an amino acid sequence provided by SEQ ID NO:2, as previously described, and a pharmaceutically acceptable carrier. In one embodiment the invention provides a polypeptide having an amino acid sequence provided by SEQ ID NO:4, as previously described, and a pharmaceutically acceptable carrier. The invention also provides, in another aspect, a method for inhibiting an immune response.
- the method according to this aspect of the invention involves contacting a T lymphocyte with an effective amount of an agent that increases expression of liCTLA-4 to inhibit an immune response.
- the contacting occurs in vitro.
- the contacting occurs in vivo.
- an agent that increases expression of liCTLA-4" refers to any agent that, when contacted with a cell, is effective for increasing expression of liCTLA-4 by the cell beyond the level of expression that would occur without the agent. In some instances the level of expression that would occur without the agent is a negligible amount.
- the cell is a cell that normally does not express CTLA-4.
- the cell is a wildtype human T cell.
- the cell is a cell that has previously been rendered incapable of expressing CTLA-4, e.g., a T cell from a CTLA-4 knockout mouse or a T cell from a TKO mouse (described above), hi some instances the level of expression that would occur without the agent is more than a negligible amount.
- the cell is a cell that normally does express CTLA-4.
- the agent that increases expression of liCTLA-4 is an expression vector containing a nucleic acid molecule that codes for a polypeptide that includes an amino acid sequence provided by SEQ ID NO:2.
- the agent that increases expression of liCTLA-4 is an expression vector containing a nucleic acid molecule that codes for a polypeptide that is an amino acid sequence provided by SEQ ID NO:2. In one embodiment the agent that increases expression of liCTLA-4 is an expression vector containing a nucleic acid molecule that codes for a polypeptide that includes an amino acid sequence provided by SEQ ID NO:4. In one embodiment the agent that increases expression of liCTLA-4 is an expression vector containing a nucleic acid molecule that codes for a polypeptide that is an amino acid sequence provided by SEQ ID NO:4. The method according to this aspect of the invention results in an inhibition of an immune response.
- the immune response is inhibited relative to an immune response that would occur in the absence of the contacting step.
- the inhibition of an immune response is an inhibition of T- cell proliferation.
- Those of skill in the art are familiar with techniques useful for measuring T-cell proliferation. Such methods include, without limitation, [ 3 H]-thymidine uptake, flow cytometry, and cytokine secretion, especially of interleukin 2 (IL-2).
- the inhibition of an immune response is an inhibition of cytokine production or cytokine secretion.
- Cytokines are protein and/or glycoprotein products secreted by a variety of cells, including both immune cells (e.g., professional antigen-presenting cells, T cells, B cells, monocytes, and macrophages) and non-immune cells (e.g., endothelial cells), that mediate inflammatory and immune reactions.
- immune cells e.g., professional antigen-presenting cells, T cells, B cells, monocytes, and macrophages
- non-immune cells e.g., endothelial cells
- Cytokines include, without limitation, interleukins (e.g., IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL- 22, IL-23, IL-24, IL-25); interferons (e.g., IFN- ⁇ , IFN- ⁇ , IFN- ⁇ ); tumor necrosis factor (e.g., TNF- ⁇ , TNF- ⁇ ); transforming growth factor (e.g., TGF- ⁇ ); and colony-stimulating factors (CSFs, e.g., granulocyte-monocyte CSF (GM-CSF), granulocyte CSF (G-CSF), monocyte CSF (M-CSF)).
- interleukins e.g., IL-1,
- the inhibition of an immune response is an inhibition of IFN- ⁇ secretion.
- Cytokine secretion is readily measured using standard techniques that include specific enzyme-linked immunosorbent assay (ELISA) and biological response assays. Standards and other reagents useful for such assays are commercially available.
- ELISA enzyme-linked immunosorbent assay
- Standards and other reagents useful for such assays are commercially available.
- TKO T cells infected with retrovirus containing flCTLA-4 showed lower proliferation and IFN- ⁇ production when compared to TKO T cells infected with empty retrovirus.
- TKO T cells infected with retrovirus containing liCTLA-4 was found equally capable of inhibiting T cell responses as flCTLA-4, both in terms of proliferation in IFN- ⁇ secretion.
- the invention in one aspect provides a method for inhibiting an immune response in a subject.
- the method according to this aspect of the invention involves administering to a subject an effective amount of an agent that increases expression of liCTLA-4 to inhibit an immune response in the subject.
- the method can be used to reduce or prevent an unwanted immune response in a subject.
- the subject has received or is about to receive an allograft.
- a subject that is about to receive an allograft is a subject that is scheduled to receive an allograft.
- the method thus can be used alone or in conjunction with other immunosuppressive or tolerizing therapies in order to reduce or eliminate the occurrence of allograft rejection.
- Additional immunosuppressive or tolerizing therapies can include the administration of immunosuppressive drugs, such as cyclosporine, tacrolimus (FK-506), sirolimus (also known as rapamycin), mycophenolate mofetil, azathioprine, corticosteroids (including methylprednisolone and prednisone), OKT-3 monoclonal antibody, anti-Tac antibody (e.g., daclizumab (ZENAPAX®, Roche)), statins, and any combination thereof.
- Additional immunosuppressive or tolerizing therapies can include irradiation, thymectomy, or oral administration of antigen. The forgoing lists are meant to be exemplary and not limiting in any way.
- the administering can take place any time prior to transplantation, but typically will take place between one month prior to transplantation and moments before transplantation.
- Prophylactic use can be extended to include pre-emptive use, e.g., administration following transplantation but prior to clinical evidence of rejection.
- the method can also be used to treat an established or ongoing rejection episode in a subject that has received a transplant.
- the rejection can be acute or chronic.
- diagnosis and monitoring can include the use of any one or combination of symptoms, signs, physical diagnosis, biopsy, imaging techniques, biochemical assays, hemodynamic monitoring, microscopy, hematologic measurements, and the like.
- the invention in another aspect provides a method for treating an autoimmune disease.
- the method according to this aspect of the invention involves administering to a subject that has or is at risk of having an autoimmune disease an effective amount of an agent that increases expression of liCTLA-4 to treat the autoimmune disease.
- the subject has an autoimmune disease.
- a subject that has an autoimmune disease is a subject with at least one objective clinical symptom, sign, or physical, laboratory, or tissue finding that is compatible with a diagnosis of a particular autoimmune disease. The skilled clinician will be able to discern which symptom, sign, or physical, laboratory, or tissue finding, or any combination thereof, is indicative of the presence of a particular autoimmune disease.
- the subject is at risk of developing an autoimmune disease.
- a subject at risk of developing an autoimmune disease is a subject without an established particular autoimmune disease but with at least one objectively measurable risk factor associated with the development of the particular autoimmune disease.
- HLA-B27 is reported to be associated with ankylosing spondylitis, Reiter's syndrome, psoriatic arthritis, and juvenile rheumatoid arthritis
- HLA-DR4 is reported to be associated with type 1 diabetes mellitus and systemic lupus erythematosus
- HLA- DR4/Dw4, HLA-DR4/Dwl4, HLA-DR4/Dwl5, and others are reported to be associated with rheumatoid arthritis.
- Subjects at risk of developing an autoimmune disease may also have a family history for development of an autoimmune disease, e.g., insulin-dependent diabetes mellitus.
- certain strains of mice are genetically predisposed to developing diabetes.
- the method can be used alone or in conjunction with other immunosuppressive or tolerizing therapies, described above, in order to reduce or eliminate the occurrence of autoimmune disease.
- the subject has or is at risk of developing a T-cell-mediated autoimmune disease.
- the subject has or is at risk of developing autoimmune type 1 (insulin-dependent) diabetes mellitus.
- the subject has or is at risk of developing multiple sclerosis.
- the subject has or is at risk of developing experimental allergic encephalomyelitis, a neurologic disease similar to multiple sclerosis that can be induced in experimental animals by immunization with myelin basic protein.
- the subject has or is at risk of developing viral hepatitis, e.g., hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E, and hepatitis G.
- the subject has or is at risk of developing viral myocarditis.
- the subject has or is at risk of developing myasthenia gravis.
- the subject has or is at risk of developing autoimmune thyroiditis, including Graves' disease.
- the subject has or is at risk of developing Crohn's disease.
- the invention in yet another aspect provides a method for screening for immune reactivity.
- the method according to this aspect of the invention involves the steps of measuring expression of liCTLA-4 by a T cell and determining immune reactivity of the T cell is (a) high when liCTLA-4 expression is low, and (b) low when liCTLA-4 expression is high.
- Measurement of liCTLA-4 expression can be accomplished using any method suitable for measuring a liCTLA-4 transcript or liCTLA-4 polypeptide in a cell or in a population of cells. The measurement can conveniently be made with reference to measurement of full length CTLA-4 or soluble CTLA-4.
- Transcripts of liCTLA-4 can be measured using any of a variety of techniques that may include, without limitation, quantitative reverse transcriptase- polymerase chain reaction (RT-PCR), Northern blotting, RNase protection assay, and the like. Such methods can include the use of labeled nucleic acid probe molecules that can hybridize under suitable conditions of temperature and salt with specific target sequence present in the transcript to be measured. Measurement of liCTLA-4 polypeptide can be accomplished using appropriate antibodies directed to an epitope expressed in liCTLA-4 or in a tag that is covalently or otherwise attached to liCTLA-4.
- a nucleic acid coding for liCTLA-4 can be altered to incorporate an in-frame coding sequence for a tag moiety that can be placed upstream, downstream, or within the coding sequence for liCTLA-4.
- Antibodies directed to the cytoplasmic domain of CTLA-4 should bind to flCTLA-4, sCTLA-4, and liCTLA-4; these entities can be distinguished by their different molecular sizes, e.g., by separating them using polyacrylamide gel electrophoresis (PAGE) followed by immunoblotting.
- Expression of liCTLA-4 is said to be low when the ratio between liCTLA-4 and flCTLA-4 is less than 0.6.
- Expression of liCTLA-4 is said to be high when the ratio between liCTLA-4 and flCTLA-4 is greater than or equal to 0.6.
- the invention in yet another aspect provides a method for screening a subject for risk of having or developing an autoimmune disease.
- the method according to this aspect of the invention involves the steps of measuring expression of liCTLA-4 by T cells of a subject and determining the subject's risk of having or developing an autoimmune disease is (a) high when liCTLA-4 expression is low, and (b) low when liCTLA-4 expression is high.
- the invention specifically includes, also, the compound for use in the treatment or prevention of that particular condition, as well as use of the compound for the manufacture of a medicament for the treatment or prevention of that particular condition.
- Administration of Therapeutic Agents of the Invention are administered to an individual using any available method and route suitable for drug delivery, including in vivo and ex vivo methods, as well as systemic, mucosal, and localized routes of administration.
- Conventional and pharmaceutically acceptable routes of administration include oral, intramuscular, intravenous, intranasal, intratracheal, intrapulmonary, subcutaneous, intradermal, topical application, rectal, and other parenteral routes of administration.
- routes of administration can be combined, if desired, or adjusted depending upon the particular agent and/or the desired effect.
- the therapeutic agents of the invention can be administered in a single dose or in multiple doses, and may encompass administration of booster doses, to elicit and/or maintain the desired effect on the immune response.
- Therapeutic agents of the invention can be administered to a subject using any available conventional methods and routes suitable for delivery of conventional drugs, including systemic or localized routes.
- routes of administration contemplated by the invention include, but are not necessarily limited to, enteral, parenteral, or inhalational routes.
- Inhalational routes of administration include inhalation of aerosol suspensions or insufflation of the polynucleotide and polypeptide compositions of the invention.
- Nebulizer devices, metered dose inhalers, and the like suitable for delivery of polynucleotide and polypeptide compositions to the nasal mucosa, trachea and bronchioli are well-known in the art and will therefore not be described in detail here.
- Parenteral routes of administration other than inhalation administration include, but are not necessarily limited to, topical, mucosal, intradermal, subcutaneous, intramuscular, intravenous, intraperitoneal, intraorbital, and intracapsular routes, i.e., any route of administration other than through the alimentary canal.
- Parenteral administration can be carried out to effect systemic or local delivery of therapeutic agents of the invention. Where systemic delivery is desired, administration typically involves invasive or systemically absorbed topical or mucosal administration of pharmaceutical preparations.
- Therapeutic agents of the invention can also be delivered to the subject by enteral administration.
- Enteral routes of administration include, but are not necessarily limited to, oral and rectal (e.g., using a suppository) delivery.
- Methods of administration of therapeutic agents of the invention through the skin or mucosa include, but are not necessarily limited to, topical application of a suitable pharmaceutical preparation, transdermal transmission, injection, and epidermal administration.
- a suitable pharmaceutical preparation for transdermal transmission, absorption promoters or iontophoresis are suitable methods, lontophoretic transmission may be accomplished using commercially available "patches" which deliver their product continuously via electric pulses through unbroken skin for periods of several days or more.
- An exemplary patch product for use in this method is the lONTOPATCH® (Birch Point Medical, St. Paul, MN) which electronically maintains reservoir electrodes at neutral pH and can be adapted to provide dosages of differing concentrations, to dose continuously and/or to dose periodically.
- Epidermal administration can be accomplished by mechanically or chemically irritating the outermost layer of the epidermis sufficiently to provoke an immune response to the irritant.
- An exemplary device for use in epidermal administration employs a multiplicity of very narrow diameter, short tynes which can be used to scratch ISS coated onto the tynes into the skin.
- the device included in the MONO-VACCTM tuberculin test (manufactured by Pasteur Merieux, Lyon, France) is suitable for use in epidermal administration of therapeutic agents of the invention.
- the invention also contemplates opthalmic administration of therapeutic agents of the invention, which generally involves invasive or topical application of a pharmaceutical preparation to the eye. Eye drops, topical creams and injectable liquids are all examples of suitable formulations for delivering drugs to the eye.
- Therapeutic agents of the invention can be administered to a subject prior to exposure to antigen, after exposure to antigen but prior to onset of disease symptoms associated with an unwanted immune response, or after onset of disease symptoms.
- therapeutic agents of the invention can be administered at any time after exposure to antigen, but a first dose is usually administered about 8 hours, about 12 hours, about 24 hours, about 2 days, about 4 days, about 7 days, about 14 days, about 1 month, about 2 months, about 4 months, about 8 months, or about 1 year after exposure to antigen.
- the invention also provides for administration of subsequent doses of therapeutic agents of the invention.
- Exposure to an antigen includes both deliberate administration of antigen to a subject, e.g., as in vaccination or in transplantation, as well as passive encounter with or environmental exposure to an antigen.
- therapeutic agents of the invention are administered in combination with a conventional therapeutic agent or therapy to provide for an increased effect in treatment of an immune response.
- the additional therapeutic agent may be any agent (e.g., immunosuppressive agent) identified as having activity against the immune response of interest (e.g., in inhibition of autoimmune disease or in inhibition of allograft rejection, etc.).
- Exemplary conventional therapeutic agents include, but are not necessarily limited to, antibiotics, including antimicrobial agents, (e.g., bacteriostatic and bacteriocidal agents (e.g., aminoglycosides, ⁇ -lactam antibiotics, cephalosporins, macrolides, penicillins, tetracyclines, qumolones, and the like), antivirals (e.g., amprenavirs, acyclovirs, amantadines, virus penciclovirs, and the like), antifungals, (e.g., imidazoles, triazoles, allylamines, polyenes, and the like), as well as anti-parasitic agents (e.g., atovaquones, chloroquines, pyrimethamines, ivermectins, mefloquines, pentamidines, primaquines, and the like), and combinations thereof.
- antimicrobial agents e.g., bacteriostatic and bacterio
- Exemplary conventional therapeutic agents also include, but are not limited to, immunosuprressive agents and therapies, (e.g., cyclosporine, tacrolimus (FK-506), sirolimus (also known as rapamycin), mycophenolate mofetil, azathioprine, corticosteroids (including methylprednisolone and prednisone), OKT-3 monoclonal antibody, anti-Tac antibody (e.g., daclizumab (ZENAPAX®, Roche)), statins, irradiation, thymectomy, oral administration of antigen, and any combination thereof).
- immunosuprressive agents and therapies e.g., cyclosporine, tacrolimus (FK-506), sirolimus (also known as rapamycin), mycophenolate mofetil, azathioprine, corticosteroids (including methylprednisolone and prednisone), OKT-3 monoclonal antibody, anti-T
- the therapeutic agent of the invention and the conventional therapeutic agent or therapy can be administered within the same or different formulation; by the same or different routes; or concurrently, simultaneously, or consecutively.
- the therapeutic agent of the invention can be delivered according to a regimen (e.g., frequency during a selected interval (e.g., number of times per day), delivery route, etc.) that is the same as, similar to, or different from that of the conventional therapeutic agent.
- a regimen e.g., frequency during a selected interval (e.g., number of times per day), delivery route, etc.
- therapeutic agent of the invention and conventional therapeutic agent or therapy are generally administered within about 96 hours, about 72 hours, about 48 hours, about 24 hours, about 12 hours, about 8 hours, about 4 hours, about 2 hours, about 1 hour, or about 30 minutes or less, of each other.
- a therapeutic agent of the invention and a conventional therapeutic agent or therapy be delivered simultaneously. Dosages. Although the dosage used will vary depending on the clinical goals to be achieved, as well as characteristics of the subject to be treated, a suitable dosage range is one which provides up to about 1 ⁇ g, to about 1,000 ⁇ g, to about 10,000 ⁇ g, to about 25,000 ⁇ g or about 50,000 ⁇ g of therapeutic agent of the invention. Therapeutic agents of the invention can be administered in a single dosage or several dosages over time.
- the invention contemplates administration of "booster" doses to provide and maintain an immune response effective to protect the subject from unwanted immune system activation and to reduce the risk of the onset of disease or the severity of disease symptoms that may occur as a result of immune activation.
- subsequent doses are administered within about 16 weeks, about 12 weeks, about 8 weeks, about 6 weeks, about 4 weeks, about 2 weeks, about 1 week, about 5 days, about 72 hours, about 48 hours, about 24 hours, about 12 hours, about 8 hours, about 4 hours, or about 2 hours or less of the previous dose.
- therapeutic agents of the invention are administered at intervals ranging from at least every two weeks to every four weeks (e.g., monthly intervals) in order to maintain the desired immune suppression.
- therapeutic agents of the invention are prepared in a pharmaceutically acceptable composition for delivery to a host.
- Pharmaceutically acceptable carriers preferred for use with the therapeutic agents of the invention may include sterile aqueous of non- aqueous solutions, suspensions, and emulsions.
- non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
- Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
- Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
- Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like.
- a composition of therapeutic agent of the invention may also be lyophilized using means well known in the art, for subsequent reconstitution and use according to the invention. Also of interest are formulations for liposomal delivery, and formulations comprising microencapsulated therapeutic agents of the invention.
- the phannaceutical compositions can be prepared in various forms, such as granules, tablets, pills, suppositories, capsules, suspensions, salves, lotions and the like.
- Pharmaceutical grade organic or inorganic carriers and/or diluents suitable for oral and topical use can be used to make up compositions comprising the therapeutically active compounds.
- Diluents known in the art include aqueous media, vegetable and animal oils, and fats.
- Stabilizing agents, wetting and emulsifying agents, salts for varying the osmotic pressure or buffers for securing an adequate pH value, and skin penetration enhancers can be used as auxiliary agents.
- Preservatives and other additives may also be present, such as, for example, anti-pathogenic agents (e.g., antimicrobials, antibacterials, antivirals, antifungals, etc.), antioxidants, chelating agents, and inert gases and the like.
- therapeutic agents of the invention can be administered in the absence of agents or compounds that might facilitate uptake by target cells (e.g., as a "naked" polynucleotide, e.g., a polynucleotide that is not encapsulated by a viral particle).
- Therapeutic agents of the invention can also be administered with compounds that facilitate uptake of therapeutic agents of the invention by target cells (e.g., by T lymphocytes) or otherwise enhance transport of the therapeutic agents of the invention to a treatment site for action.
- Absorption promoters, detergents, and chemical irritants e.g., keratinolytic agents
- a colloidal dispersion system may be used for targeted delivery of therapeutic agents of the invention to specific tissue.
- Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in- water emulsions, micelles, mixed micelles, and liposomes.
- Liposomes are artificial membrane vesicles which are useful as delivery vehicles in vitro and in vivo. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2-4.0 ⁇ m, can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules. RNA and DNA can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form. Fraley R et al. (1981) Trends Biochem Sci 6:77-80.
- the composition of the liposome is usually a combination of phospholipids, particularly high-phase-transition-temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used.
- lipids useful in liposome production include phosphatidyl compounds, such as phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides.
- phosphatidyl compounds such as phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides.
- Particularly useful are diacylphosphatidylglycerols, where the lipid moiety contains from 14- 18 carbon atoms, particularly from 16-18 carbon atoms, and is saturated.
- Illustrative phospholipids include egg phosphatidylcholine, dipalmitoylphosphatidylcholine, and distearoylphosphatidylcholine.
- targeting of liposomes can be classified based on anatomical and mechanistic factors. Anatomical classification is based on the level of selectivity, for example, organ-specific, cell-specific, and organelle-specif ⁇ c. Mechanistic targeting can be distinguished based upon whether it is passive or active. Passive targeting utilizes the natural tendency of liposomes to distribute to cells of the reticulo-endothelial system (RES) in organs which contain sinusoidal capillaries.
- RES reticulo-endothelial system
- Active targeting involves alteration of the liposome by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein, or by changing the composition or size of the liposome in order to achieve targeting to particular organs and cell types other than the naturally occurring sites of localization.
- a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein
- the surface of the targeted delivery system may be modified in a variety of ways.
- lipid groups can be incorporated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable association with the liposomal bilayer.
- Various well known linking groups can be used for joining the lipid chains to the targeting ligand. See, e.g., Yanagawa H et al.
- Targeted delivery of therapeutic agents of the invention can also be achieved by conjugation of the therapeutic agent of the invention to the surface of viral and non- viral recombinant expression vectors, to an antigen or other ligand, to a monoclonal antibody, or to any molecule which has the desired binding specificity. Additional Formulation Components.
- the pharmaceutical compositions also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above.
- the pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of present methods for drug delivery, see Langer R (1990) Science 249:1527-33, which is incorporated herein by reference.
- the pharmaceutical compositions are in one embodiment prepared and administered in dose units.
- Liquid dose units are vials or ampoules for injection or other parenteral administration. Solid dose units include tablets, capsules and suppositories. For treatment of a patient, depending on activity of the compound, manner of administration, purpose of the immunization (i.e., prophylactic or therapeutic), nature and severity of the disorder, age and body weight of the patient, different doses may be necessary.
- the therapeutic agents of the invention may be administered per se (neat) or in the form of a pharmaceutically acceptable salt. When used in medicine the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof.
- Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, fonnic, malonic, succimc, naphthalene-2-sulphonic, and benzene sulphonic.
- such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group.
- the therapeutic agents of the invention an include suitable buffering agents and preservative agents.
- Suitable buffering agents include: acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v).
- Suitable preservatives include benzalkonium chloride (0.003-0.03% w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% w/v).
- the compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well Icnown in the art of pharmacy.
- All methods include the step of bringing the compounds into association with a carrier which constitutes one or more accessory ingredients.
- the compositions are prepared by uniformly and intimately bringing the compounds into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
- Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the compounds, increasing convenience to the subject and the physician.
- Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer- based systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides.
- Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Pat. No. 5,075,109.
- Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-di-and tri-glycerides; hydrogel release systems; silastic systems; peptide-based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like.
- Specific examples include, but are not limited to: (a) erosional systems in which an agent of the invention is contained in a form within a matrix such as those described in U.S. Pat. Nos.
- Example 1 Three Different Isoforms of CTLA-4 in C57BL/6 Mice.
- three different forms of CTLA-4 (CD 152) were detected from unactivated and activated spleen cells of C57BL/6 mice: 1) a full-length form of CTLA-4, (flCTLA-4); 2) a soluble CTLA-4, (sCTLA-4); and 3) a novel splice variant of approximately 300 bp (FIG. 1A, lane 1 and 2).
- Mice. 6-8 week old female SJL, B10.S and NOD/LtJ mice were procured from the Jackson Laboratory (Bar Harbor, ME).
- BALB/c DO11.10 TCR transgenic mice were bred on the RAG-/- background and maintained at our facility.
- BALB/c TKO (CTLA-4, B7.1, B7.2 -/-) and BALB/c DKO (B7.1, B7.2 -/-) mice were generated by Arlene Sharpe (Harvard Medical School, Boston, MA). Mandelbrodt DA et al. (1999) JExp Med 189:435-40.
- C57BL/6.H2 g7 mice were a kind gift from Diane Mathis and Christophe Benoist (Joslin Diabetes Center, Boston, MA). mRNA isolation and RT-PCR.
- Total mRNA was isolated from spleen cells of C57BL/6 mice, B10, NOD and SJL/J mice activated with 1 ⁇ g/ml anti-CD3 (Pharmingen) using the Qiagen mRNA EAsy kit (Qiagen).
- cDNA from 5 ⁇ g total mRNA was prepared by Oligo dT priming using the Superscript reverse transcriptase kit (Invitrogen Life Technologies).
- RT-PCR amplification of CTLA-4 isoforms was done using the 5 ' primer CCGCTCGAGTTGGGTTTTACTCTACTCCCTGA (SEQ ID NO:20) and 3 'primer ACGCGTCGACTCCTTCTTCTTCATAAACGGC (SEQ ID NO:21).
- liCTLA-4 the novel variant (liCTLA-4) was found to lack exon 2 which encodes for the extracellular IgV domain of flCTLA-4.
- the predicted amino acid sequence of the liCTLA (108 residues) contained a signal sequence, a transmembrane domain and cytoplasmic domain similar to the flCTLA-4 (FIG. IB), but it lacked the IgV exon containing the MYPPPY (SEQ ID NO: 5) motif essential for binding to B7 molecules.
- the mature liCTLA-4 isoform is predicted to be of a smaller size (above 8 kD) than the flCTLA-4 isoform because of the loss of residues 37-153 including glycosylation sites (FIG. IB).
- liCTLA-4 Is Expressed as a Protein and Targeted to the Cell Surface.
- the cDNA of liCTLA-4 was directionally cloned into the Not I/Sal 1 site within the multiple cloning site of mammalian expression vector pCMV-Tag5C.
- the stop codon in liCTLA-4 was mutated using: 5 'primer TTTATTCCCATCAACGGAAAGGCCGTTTATGAAGAAGAAGGA (SEQ ID NO:22) and a complementary 3 ' primer using the Quickchange site directed mutagenesis kit (Strategene).
- Insertion of a 10 amino acid MYC site between the signal sequence and the extracellular domain was achieved by first cloning the cDNA encoding the liCTLA-4 in the Xhol site of pCMV Tag2C vector. Then using the primers 5 '
- AACCATGCCCG (SEQ ID NO:23) and a 3 ' complimentary reverse primer, a MYC site was inserted in a site-directed mutagenesis reaction using the Quickchange site-directed mutagenesis kit (Stratagene). Sequence in italics indicates the MYC site.
- cDNA of flCTLA-4 and liCTLA-4 were cloned into the Xhol restriction site of the pGCIRES retroviral vector developed by Garry Nolan. Costa GL et al. (2000) J Immunol 164:3581-90. Cloned products were confirmed for presence and orientation of inserts by sequencing at the Brigham and Women's Hospital sequencing core.
- HEK293T cells transfected with the vector encoding liCTLA-4 expressed a protein species of approximately 8 kDa on a reducing gel which was detected by Western blot (FIG. 1C), suggesting that liCTLA-4 can be expressed as a protein and is not degraded at the mRNA level.
- liCTLA-4 lacks the extracellular IgV domain, it was not clear whether the protein is targeted to the cell membrane or is trapped and retained in the cytosol. To address this issue, liCTLA-4 cDNA was modified to include a ten amino acid MYC tag after the putative signal cleavage site.
- FIG. ID shows that HCTLA-4/MYC expression was detected on the HEK293T cell surface following transfection. This suggests that even though the liCTLA-4 lacks a major portion of the extracellular domain, it can still be targeted to the cell surface in mammalian cells.
- liCTLA-4 Is Expressed as a Protein in Normal T Cells.
- Western blotting analysis using an antibody directed to the cytoplasmic domain of CTLA-4 which can recognize both flCTLA-4 and liCTLA-4, was employed.
- Cell lysates from 2xl0 7 spleen cells from C57BL/6 mice activated with anti-CD3 (2 ⁇ g) were prepared using lysis buffer containing 1% NP40 and supplemented with protease inhibitors. Cell extracts were run on a 15%) denaturing gel.
- Fractionated proteins were transfened onto a PVDF membrane (BioRad) and probed with specific antibodies to MYC (mouse anti-MYC antibody, Santa Cruz), CTLA-4 (hamster anti-CTLA-4, Pharmingen) or with goat anti-CTLA-4 antibody recognizing the cytoplasmic domain of CTLA-4 (C19, Santa Cruz).
- Western blots were developed using an ECL kit (Amersham) and exposed to XAR film (Kodak).
- the anti-CTLA-4 antibody was able to detect a doublet band of flCTLA-4 migrating at ⁇ 34 kDa, and a single band at 8 kDa consistent with it being the liCTLA-4 (FIG. IE).
- the flCTLA-4 protein which appears as a doublet migrating at 34 kDa represents differentially glycosylated protein species.
- Lee KM et al. (1998) Science 282:2263-6.
- the flCTLA-4 molecule has three potential N-linked glycosylation sites, while liCTLA-4 has no predicted N-linked glycosylation sites.
- liCTLA-4 is expressed in activated normal T cells at levels comparable to flCTLA-4.
- liCTLA-4 Functions as an Attenuator ofT Cells, Similar toflCTLA-4. fiCTLA-4 signaling has been shown to prevent cell cycle entry at the Gl phase and subsequently to inhibit IL-2 production. Krummel MF et al. (1996) JExp Med 183:2533-40; Walunas TL et al. (1994) Immunity 1 :405-13. To investigate whether liCTLA-4 functions like the flCTLA-4 in T cells, flCTLA-4 or liCTLA-4 were expressed by retroviral infection in T cells of triple knock out (TKO) mice that lack CTLA-4, B7J and B7.2.
- TKO triple knock out
- the vector had a multiple cloning site allowing incorporation of genes expressing the test protein and a downstream selectable marker, green fluorescent protein (GFP).
- GFP green fluorescent protein
- Viral supernatants expressing liCTLA-4, flCTLA-4, or empty vector were titrated for infectivity based on their ability to infect NIH3T3 cells. Titrated supernatants were then used to infect activated CD3 + T cells from TKO mice in the presence of IL-2. Using this approach, 10-20%) of activated T cells could be routinely transduced with the retroviral vector. Proliferation and cytokine production. Proliferative responses were measured by culturing 3xl0 4 sorted GFP + T cells in the presence of mitomycin C treated, CD4 and CD8 depleted APCs (ATCC, Rockville, MD) with anti-CD3 for 48hrs in DMEM media.
- MYC on HEK293T cells transfected with MYC-tagged liCTLA-4 was monitored by staining transfected cells with FITC-conjugated goat anti-MYC antibody (Santa Cruz).
- flCTLA-4 expression in T cells infected with retrovirus was detected using PE-anti-CTLA-4 antibody (4F10, Pharmingen).
- CD4+ cells were enriched using an R&D T cell column (R&D Systems, Minneapolis, MN). Na ⁇ ve and memory T cells within the CD4-enriched T-cell population of e vivo harvested spleen cells were stained with FITC-anti-CD4 (Pharmingen) and PE-anti-CD45RB (Phanningen).
- TKO mice FACS analysis and sorting was performed on a Becton Dickinson FACScaliber flow cytometer.
- Use of T cells from TKO mice was considered crucial for analysis of these experiments, since the TKO mice lack endogenous isoforms of either flCTLA-4, sCTLA-4 or liCTLA-4 which may otherwise interfere with the functional activity of exogenously introduced liCTLA-4 or flCTLA-4.
- both B7 molecules are absent in TKO cells, TKO mice provide a source of na ⁇ ve T cells as compared to those in CTLA-4 " " mice which have an activated phenotype.
- CD28 is constitutively expressed in TKO T cells, so this allowed dissection of the interplay of CTLA-4 isoforms with CD28/T-cell receptor (TCR) signals.
- T cells from double knockout (DKO) mice which lack B7.1 and B7.2 but express CTLA-4, were infected with empty retrovirus and used as positive controls for endogenous CTLA-4 expression and function.
- Infected CD3 + T cells were monitored for GFP expression (used as a surrogate marker for expression levels of either flCTLA-4 or liCTLA-4 protein) by flow cytometry as shown in FIG. 2A and sorted based on GFP expression.
- flCTLA-4 Surface expression of flCTLA-4 could be confirmed with an anti-CTLA-4 antibody by surface staining of TKO T cells infected with retrovirus expressing flCTLA-4 (FIG. 2A, right panel). However, surface expression of liCTLA-4 could not be confirmed by flow cytometry because of the lack of an appropriate antibody which can detect only liCTLA-4. Therefore, expression of liCTLA-4 and flCTLA-4 protein in the GFP-positive cells was confirmed by Western blot analysis (FIG. 2B).
- the GFP -positive sorted T cells expressing flCTLA-4 of liCTLA-4 were tested for functional activity by in vitro activation with varying concentrations of soluble anti-CD3 in presence of antigen-presenting cells from wild type BALB/c mice.
- DKO T cells infected with empty retrovirus or the TKO T cells infected with retrovirus containing flCTLA-4 showed lower proliferation and IFN- ⁇ production when compared to TKO T cells infected with empty retrovirus.
- the liCTLA-4 that completely lacks an extracellular IgV domain required for interaction with B7 molecules was found equally capable of inhibiting T cell responses as flCTLA-4, both in terms of proliferation in IFN- ⁇ secretion (FIG. 2C and D).
- liCTLA-4 or flCTLA-4 infected T cells were shown not to be due to cell death of the retro virally infected calls.
- liCTLA-4 lacks a B7 ligand binding domain, it can still function as an attenuator of T cells similar to flCTLA-4.
- Example 5 Enhanced Expression ofliCTLA-4 Transcripts in the Effector or Antigen- Experienced CD4+ T Cells of Autoimmune-Resistant Mice.
- mRNA expression of flCTLA-4 is low in na ⁇ ve T cells and increased in activated and memory/regulatory T cells.
- Alegre ML et al. (1996) J Immunol 157:4762-70; Lindsten T et al. (1993) J Immunol 151 :3489-99; Read S et al. (2000) JExp Med 192:295-302.
- mice we wanted to determine whether the expression differs between autoimmune-susceptible and resistant strains of mice. For this purpose, we compared the expression of flCTLA-4 and liCTLA-4 in na ⁇ ve and memory/regulatory T cells of two autoimmune-susceptible (NOD and SJL) and resistant (B6.H2 g7 and B10.S) strains of mice. We used real-time (TaqMan) RT-PCR to determine mRNA levels for flCTLA-4 and li CTLA-4 in the na ⁇ ve and memory/regulatory T cells of these four strains of mice.
- Quantitative real-time polymerase chain reaction was performed on an ABI Prism 7700 Sequence Detection System (Perlcin Elmer, Foster City, CA) using cDNA as template.
- Amplification of GAPDH was used for sample normalization in a multiplex RT- PCR approach (TaqMan Rodent GAPDH Control Reagents, Applied Biosystems). The amplification followed the protocol of the TaqMan Gold RT-PCR kit.
- oligonucleotides were used at final concentrations of 300 nM for forward and reverse primers and 200 nM for the fluorogenic probes as follows:
- flCTLA-4 Forward: ACTCATGTACCCACCGCCATA (SEQ ID NO:24) Reverse: GGGCATGGTTCTGGATCAAT (SEQ ID NO:25) Probe: CATGGGCAACGGGACGCAGATTTAT (SEQ ID NO:26) liCTLA-4: Forward: GCCTTTTGTAGCCCTGCTCA (SEQ ID NO:27) Reverse: TCAGAATCCGGGCATGGTT (SEQ ID NO:28) Probe: TTCTTTTCATCCCAGTCTTCTCTGAAGATCCA (SEQ ID NO:29)
- ⁇ Ct values were obtained by calculating a difference in threshold cycle of amplification (Ct) values of liCTLA-4 versus GAPDH for each well ( t TLA Xct GAPOH ).
- Q yalue _ were determined by normalization of average ⁇ Ct values of triplicates to average ⁇ Ct values of no template control (NTC) triplicates ( ⁇ Ct- ⁇ Ct NTC ).
- Relative levels were calculated from the ratio of the liCTLA-4 and flCTLA-4 values normalized to GAPDH mRNA using the fonnula
- 3 A shows that the relative amplification of the liCTLA-4 mRNA with respect to glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a housekeeping gene, proceeded earlier in the autoimmune-resistant strains than the susceptible strains.
- GAPDH glyceraldehyde-3-phosphate dehydrogenase
- liCTLA-4 The differential expression of liCTLA-4 between the autoimmune-susceptible and resistant strains has been suggested to be regulated by the SNP in exon 2 of CTLA-4 gene which shows genetic linkage to diabetes susceptibility in the NOD mice. It is possible that the higher level of liCTLA-4 expressed in memory/effector CD4+ T cells of autoimmune- resistant strains prevents clonal expansion of autoreactive memory/effector CD4+ T cells to signals delivered by self antigens. Memory T cells, which by virtue of having low threshold requirements for activation, have been shown to respond to weak TCR signals even in the absence of essential costimulatory signals. Metz DP et al. (1998) J Immunol 161:5855-61.
- liCTLA-4 may limit reactivation of autoreactive memory/effector CD4+ T in vivo.
- CD4+CD45RB low population is known to contain CD4+CD45RB low CD25 high T regulatory cells (Read S et al. (2000) JExp Med 192:295-302)
- genetically controlled levels of liCTLA-4 in CD4+CD45RB low T cells could influence the development or activity of these cells.
- increased expression of liCTLA-4 in the CD4+CD45RB low cells in autoimmune disease resistant mice may result in enhanced regulatory T cell function.
- Example 6 Exon 2 SNP Appears to Regulate Susceptibility to Autoimmune Disease.
- EAE experimental autoimmune encephalomyelitis
- the nucleotide sequence of CTLA-4 in the EAE- susceptible SJL/J strain and diabetes-susceptible NOD strain had a G allele at position 186, while the EAE- and diabetes-resistant B10.S and C57BL/6 strain carried an A allele at position 186.
- the presence of a G allele at position 186 in the diabetes-susceptible NOD strain has been shown to result in the inclusion of exon 2 forming flCTLA-4 mRNA and a reduction of the exon 2 negative transcript that encodes liCTLA-4.
- the exon 2 SNP which shows linkage to diabetes susceptibility in the NOD mice may also determine susceptibility to EAE in the SJL/J and B10.S mouse strains by regulating levels of liCTLA-4.
- Example 7 Exon 2 SNP Appears to Regulate Level of Expression ofliCTLA-4.
- substitution of the wild-type C allele with a mutant G allele by a SNP at base 77 of exon 4 reduced the function of an exonic splicing silencer (ESS) embedded in the exon 4 DNA sequence, resulting in alteration of the relative levels of functionally distinct isoforms of this important T-cell differentiation molecule.
- ESS exonic splicing silencer
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Toxicology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
Methods and compositions related to a novel, naturally occurring alternative splice variant of CTLA-4, termed ligand-independent CTLA-4(liCTLA-4) are provided. The liCTLA-4 molecule lacks the extracellular IgV domain that is involved in interaction with B7 ligands. Expression of liCTLA-4 is associated with downregulation of immune reactivity and, significantly, resistance to autoimmune disease.
Description
NOVEL SPLICE VARIANT OF CTLA-4
Background of the Invention The invention pertains generally to the field of immunology. More specifically, the invention pertains to compositions and methods related to cytotoxic T lymphocyte-associated antigen-4 (CTLA-4), a costimulatory receptor expressed on T cells that plays a critical role in downregulating T cell responses. Brunet JF et al. (1987) Nature 328:267-70; Walunas TL et al. (1994) Immunity 1:405-13; Kru el MF et al. (1996) JExp Med 183:2533-40; Brunner MC et al. (1999) J Immunol 162:5813-20; Greenwald RJ et al. (2001) Immunity 14:145-55. CTLA-4 and the structurally related CD28 molecule both bind to costimulatory B7 molecules, B7J and B7.2, with opposite effects. CD28 delivers an immunostimulatory signal, while CTLA-4 delivers an immunoinhibitory signal. Loss of CTLA-4 results in the development of multi-organ autoimmune disease with uncontrolled T-cell activation. Tivol EA et al. (1995) Immunity 3:541-7; Waterhouse P et al. (1995) Science 270:985-8; Chambers CA et al. (1997) Immunity 7:885-95. A number of autoimmune diseases in humans and in mice have shown genetic linkage to the CTLA-4 locus. Copeman JB et al. (1995) Nat Genet 9:80-5; Kotsa K et al. (1997) Clin Endocrinol (Oxf) 46:551-4; Hill NJ et al. (2000) Diabetes 49:1744-7; Lamhamedi-Cherradi SE et al. (2001) Diabetes 50:2874-8; Hudson LL et al. (2002) Hum Genet 111:452-5; Kouki T et al. (2002) J Endocrinol Invest 25:208-13. Because of its potential role as a therapeutic immunoinhibitor, CTLA-4 has attracted a great deal of attention in recent years. In addition to the natural molecule, soluble forms of CTLA-4 are known. These include a naturally occurring alternative splice variant, sCTLA-4, which lacks a transmembrane domain. Magistrelli G et al. (1999) Eur J Immunol 29:3596- 602; Oaks MK et al. (2000) J Immunol 164:5015-8; Oaks MK et al. (2000) Cell Immunol 201 J44-53. Another soluble form of CTLA-4 that has been described is CTLA4Ig, a fusion protein which includes an extracellular portion of CTLA-4 genetically fused to an immunoglobulin G Fc tail. U.S. Pat. No. 5,885,796, to Linsley et al.
Summary of the Invention The invention relates in part to a novel splice variant of CTLA-4, discovered by the inventors, that shows genetic linkage with autoimmune type 1 (insulin-dependent) diabetes mellitus in NOD mice, and that lacks exon 2 and thus lacks the extracellular IgV domain.
This splice variant of CLTA-4, named ligand-independent CTLA-4 (liCTLA-4), lacks the MYPPPY (SEQ ID NO:5) motif essential for binding to B7 molecules. Peach RJ et al. (1994) JExp Med 180:2049-58. As disclosed herein, liCTLA-4 is expressed as a protein in primary T cells and strongly inhibits T cell responses when expressed in CTLA-4-/- T cells. Expression of liCTLA-4 and not full length CTLA-4 (ftCTLA-4) was higher in T cells of autoimmune-resistant strains compared to susceptible strains of mice. Increased negative signaling delivered by liCTLA-4 may regulate T-cell-mediated autoimmune diseases. The invention generally provides compositions and methods related to isolated liCTLA-4 nucleic acids and polypeptides that are useful for screening and treating T-cell- mediated immunity. In one aspect the invention is an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2 (murine liCTLA-4). In one embodiment according to this aspect of the invention, the isolated nucleic acid molecule includes a sequence provided by SEQ ID NOJ. In one embodiment according to this aspect of the invention, the isolated nucleic acid molecule has a sequence provided by SEQ ID NOJ. In one aspect the invention is an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4 (human liCTLA-4). In one embodiment according to this aspect of the invention, the isolated nucleic acid molecule includes a sequence provided by SEQ ID NO:3. In one embodiment according to this aspect of the invention, the isolated nucleic acid molecule has a sequence provided by SEQ ID NO:3. In one aspect the invention is an expression vector that includes an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2 (murine liCTLA-4), operably linked to a promoter. In one embodiment according to this aspect of the invention, the isolated nucleic acid molecule includes a sequence provided by SEQ ID NOJ . In one embodiment according to this aspect of the invention, the isolated nucleic acid molecule has a sequence provided by SEQ ID NOJ. In one aspect the invention is an expression vector that includes an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4 (human liCTLA-4), operably linlced to a promoter. In one embodiment according to this aspect of the invention, the isolated nucleic acid molecule includes a sequence provided
by SEQ ID NO:3. In one embodiment according to this aspect of the invention, the isolated nucleic acid molecule has a sequence provided by SEQ ID NO:3. In one aspect the invention is a host cell having an expression vector that includes an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2 (murine liCTLA-4), operably linlced to a promoter. In one aspect the invention is a host cell having an expression vector that includes an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4 (human liCTLA-4), operably linked to a promoter.. In one aspect the invention is a pharmaceutical composition including an expression vector that includes an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2 (murine liCTLA-4), operably linked to a promoter, and a pharmaceutically acceptable carrier. In one embodiment according to this aspect of the invention, the isolated nucleic acid molecule includes a sequence provided by SEQ ID NOJ. In one embodiment according to this aspect of the invention, the isolated nucleic acid molecule has a sequence provided by SEQ ID NO: 1. In one aspect the invention is a pharmaceutical composition including an expression vector that includes an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4 (human li CTLA-4), operably linked to a promoter, and a pharmaceutically acceptable carrier. In one embodiment according to this aspect of the invention, the isolated nucleic acid molecule includes a sequence provided by SEQ ID NO:3. In one embodiment according to this aspect of the invention, the isolated nucleic acid molecule has a sequence provided by SEQ ID NO:3. hi one aspect the invention is an isolated polypeptide including an amino acid sequence provided by SEQ ID NO:2. In one embodiment according to this aspect of the invention, the isolated polypeptide has an amino acid sequence provided by SEQ ID NO:2. In one aspect the invention is an isolated polypeptide including an amino acid sequence provided by SEQ ID NO:4. In one embodiment according to this aspect of the invention, the isolated polypeptide has an amino acid sequence provided by SEQ ID NO:4. In one aspect the invention is a pharmaceutical composition including a polypeptide having an amino acid sequence provided by SEQ ID NO:2 and a pharmaceutically acceptable carrier.
In one aspect the invention is a pharmaceutical composition including a polypeptide having an amino acid sequence provided by SEQ ID NO:4 and a pharmaceutically acceptable carrier. In a further aspect the invention provides a method for inhibiting an immune response. The method according to this aspect of the invention involves the step of contacting a T lymphocyte with an effective amount of an agent that increases expression of liCTLA-4 to inhibit an immune response. In one aspect the invention provides a method for inhibiting an immune response in a subject. The method according to this aspect of the invention involves the step of administering to a subject an effective amount of an agent that increases expression of liCTLA-4 to inhibit an immune response in the subject. In one embodiment of this aspect of the invention, the subject has received or is about to receive an allo graft. In one aspect the invention provides a method for treating an autoimmune disease. The method according to this aspect of the invention involves the step of administering to a subject that has or is at risk of having an autoimmune disease an effective amount of an agent that increases expression of liCTLA-4 to treat the autoimmune disease. In one embodiment of this aspect of the invention, the autoimmune disease is insulin-dependent diabetes mellitus. hi one embodiment of this aspect of the invention, the autoimmune disease is multiple sclerosis. In one aspect the invention provides a method for screening for immune reactivity. The method according to this aspect of the invention involves the steps of measuring expression of liCTLA-4 by a T cell and determining immune reactivity of the T cell is (a) high when liCTLA-4 expression is low, and (b) low when liCTLA-4 expression is high. In one aspect the invention provides a method for screening a subject for risk of having or developing an autoimmune disease. The method according to this aspect of the invention involves the steps of measuring expression of liCTLA-4 by T cells of a subject and determining the subject's risk of having or developing an autoimmune disease is (a) high when liCTLA-4 expression is low, and (b) low when liCTLA-4 expression is high.
Brief Description of the Figures The following figures are provided for illustrative purposes only and are not required for understanding or practicing the invention.
Figure 1 A is an image of an agarose gel loaded with RT-PCR products showing the detection of CTLA-4 isoforms in C57BL/6 mice. Complementary DNA (cDNA) synthesized from unactivated (lane 1) or activated (lane 2) spleen cells were amplified using primers designed to amplify cDNA encoding full-length CTLA-4 (flCTLA-4). The image demonstrates products corresponding to flCTLA-4, soluble CTLA-4 (sCTLA-4), and the novel splice variant ligand-independent CTLA-4 (liCTLA-4) of the invention. Lane 3 indicates a water control. Figure IB is a cartoon depicting comparative protein domains of flCTLA-4 and liCTLA-4. The protein structure of flCTLA-4 is compared to the predicted structure and protein domains of liCTLA-4. The predicted amino acid sequence of liCTLA-4 was found to lack the IgV domain (residues 38-161) and the B7 interacting motif MYPPPY (SEQ ID NO:5). Figure 1C depicts Western blot analysis of flCTLA-4 and liCTLA-4 expressed as recombinant proteins in HEK293T cells. HEK293T cells were transiently transfected with liCTLA-4 expressed in pCMV-TAG5C as a MYC-tagged protein and flCTLA-4 expressed in pCMV-HA. Cell lysates were loaded as follows: Lane 1, non-transfected; Lane 2, pCMN- Tag5C/liCTLA-4; Lane 3, non-transfected; Lane 4, pCMN-HA/flCTLA-4. Lanes 1 and 2 represent an immunoblot developed using an anti-MYC antibody and Lanes 3 and 4 represent an immunoblot developed using an anti-CTLA-4 antibody. Figure ID depicts flow cytometric analysis of surface expression of liCTLA-4 in HEK293T cells. Flow cytometric analysis for the detection of liCTLA-4 in HEK293T cells transfected with liCTLA-4. The cDΝA of liCTLA-4 was modified to contain a 10 amino acid MYC insertion between the residues Asp 154 and Pro 155 in the amino-terminus of the extracellular domain of li CTLA-4. Transfectants were then stained for cell surface expression of HCTLA-4-MYC by using an anti-MYC antibody. Vector containing the liCTLA-4 without the MYC insertion was used as control (shaded histogram). Figure IE depicts Western blot analysis of CTLA-4 isoforms in in vitro activated spleen cells derived from C57BL/6 mice or C57BL/6 TKO (CTLA-4, B7.1, B7.2 -/-) mice Cell lysates were immunoblotted with an anti-CTLA-4 antibody which recognizes the cytoplasmic domain of both flCTLA-4 and liCTLA-4. Cell lysates were loaded as follows: Lane 1, recombinant flCTLA-4 expressed in HEK293 cell lysates; Lane 2, activated whole
spleen cells lysates of C57BL/6 mice; and Lane 3, activated whole spleen cell lysates of C57BL/6 TKO mice. Figure 2 A depicts flow cytometric analysis of retro virus-infected activated TKO T cells. Panels on the left show GFP expression in the TKO T cells infected with flCTLA-4 and liCTLA-4. GFP positive cells transfected with flCTLA-4 were stained with anti-CTLA-4 antibodies to confirm the expression of flCTLA-4 (right panel). Filled histogram indicates T cells infected with pGCIRES vector only, and the line histogram indicates flCTLA-4 expression in TKO T cells infected with pGCIRES expressing flCTLA-4. Figure 2B depicts Western blot analysis of cell lysates prepared from retro virus- infected activated TKO T cells for the expression of flCTLA-4 and liCTLA-4. CTLA-4 isoforms were detected by an anti-CTLA-4 antibody recognizing the cytoplasmic domain of flCTLA-4 and liCTLA-4. Lane l: TKO/flCTLA-4; Lane 2: TKO/liCTLA-4; Lane 3: TKO/RV (empty retroviral vector). Lower panel shows the detection of GFP in the same lysates using an anti-GFP antibody. Figure 2C is a graph depicting mean dCPM (difference in CPM obtained by subtracting CPM values of cells treated with media alone from that of CPM values of cells activated with anti-CD3) in a proliferation assay as detected by 3[H] -thymidine incorporation. TKO-RN, activated TKO cells transfected with empty retrovirus vector; DKO-RN, activated DKO cells transfected with empty retrovirus vector; TKO-flCTLA-4, activated TKO cells transfected with flCTLA-4 retrovirus expression vector; TKO-liCTLA-4, activated TKO cells transfected with liCTLA-4 retrovirus expression vector. Data represent pooled values from two independent experiments. Error bars indicate standard error of the mean. Figure 2D is a graph depicting IFΝ-γ production (pg/ml) in the supernatants of the cells from Figure 2C as detected by cytokine ELIS A. Data represent pooled values from two independent experiments. Error bars indicate standard error of the mean. Figure 3 is a pair of graphs depicting mRΝA expression of (A) liCTLA-4 and (B) flCTLA-4 in fractionated CD4+CD45RBl0W and CD4+CD45RBhigh cells of autoimmune- susceptible (SJL, NOD) and autoimmune-resistant (B10.S, B6.H2g7) strains of mice. Filled and open bars represent data for CD4+CD45RBlow and CD4+CD45RBhigh cells, respectively. mRNA was examined by real-time RT-PCR and represented as ΔΔCt values which were calculated by Ct values (threshold cycle of amplification) of triplicates normalized to a housekeeping gene. Exon 2 single nucleotide polymorphism (SNP) shared between
autoimmune-resistant mice and shared between autoimmune-susceptible mice is also shown. Mean data obtained from two separate experiments with 4-6 mice per group are indicated. Error bars indicate standard error of the mean of pooled ΔΔCt values. Figure 4 depicts a sequence alignment of CD45 and Ctla-4 flanking the SNP at base 77 of exon 4 of CD45 and exon 2 of Ctla-4. Residues in bold are conserved between all sequences. Residues in bold and italicized are conserved between all except those in which splicing is not observed (human and rat Ctla-4). Position 77 within the exon (corresponding to position 186 overall) is underlined. Sequences shown are assigned as follows: Human CTLA-4, SEQ ID NO:6; Rat CTLA-4, SEQ ID NO:7, Mouse CTLA-4 NOD, SEQ ID NO:8; Mouse CTLA-4 BIO, SEQ ID NO:9; Human CD45 WT, SEQ ID NO: 10; Human CD45 MUT (G), SEQ ID NOJ 1; Rat CD45, SEQ ID NOJ2; Mouse CD45, SEQ ID NOJ3.
Detailed Description of the Invention
Definitions An "allograft" refers generally to any cell, tissue, or organ transplanted from one individual to another, where the two individuals are members of the same species. As used herein, examples of allografts include, without limitation, bone marrow, heart, intestine, kidney, limb, liver, lung, muscle, muscle cells, pancreas, pancreatic islet cells, skin, and any combination thereof. Although most clinical transplants involve allografts, the invention is also meant to encompass xenografts, i.e., any cell, tissue, or organ transplanted from one individual to another, where the two individuals are members of different species. An "autoimmune disease" as used herein refers to any of a number of clinically recognized organ-specific or systemic diseases involving an immune response directed against normal host cells or tissue. Autoimmune diseases are widely viewed as diseases caused by a breakdown of self-tolerance such that the adaptive immune system responds to self antigens and mediates cell and tissue damage. Non-limiting examples of autoimmune diseases include autoimmune type 1 (insulin-dependent) diabetes mellitus, multiple sclerosis, experimental allergic encephalomyelitis, ankylosing spondylitis, anti-glomerular basement membrane disease (e.g., Goodpasture's syndrome), atherosclerosis, autoimmune hepatitis, Behcet's syndrome, Crohn's disease, Eaton-Lambert myasthenic syndrome, glomerulonephritis, gluten-sensitive enteropathy, Graves' disease, Guillain-Barre syndrome, Hashimoto's thyroiditis, hemolytic anemias, idiopathic thrombocytopenic purpura,
myasthenia gravis, pernicious anemia, primary biliary cirrhosis, psoriasis, Reiter's syndrome, rheumatic fever, rheumatoid arthritis, sclerosing cholangitis, Sjδgren's syndrome, stiff-man syndrome, systemic lupus erythematosus, systemic sclerosis (scleroderma), Type I and Type II autoimmune polyglandular syndromes, uveitis, and Wegener's granulomatosis. As used herein, an "effective amount" of a compound refers generally to an amount of that compound necessary or sufficient to achieve a desired biologic effect. Administration of an effective amount can involve administering a single dose or more than one dose. As used herein, "expression" refers to measurable elaboration of a gene product, at either the RNA or polypeptide level. Expression can be assessed using any suitable technique, including, without limitation, Northern blot hybridization, RNase protection assay, reverse transcriptase-polymerase chain reaction, immunoblotting, enzyme-linked immunosorbent assay (ELISA), flow cytometry, radioimmunoassay, and the like. The term "immune reactivity" as used herein refers to a propensity to develop an immune response. Immune reactivity can be general or it can be specific with respect to a particular antigen. In general immune reactivity will be reduced in the presence of liCTLA-4, relative to immune reactivity in the absence of liCTLA-4. Conversely, in general immune reactivity will be increased in the absence of liCTLA-4, relative to immune reactivity in the presence of liCTLA-4. Those of skill in the art will recognize that there are a number of other factors that can affect immune reactivity. Such factors can include, without limitation, priming, prior tolerization, drugs, antigen-nonspecific activation of antigen-presenting cells, etc. An "immune response" as used herein refers generally to any aspect of an isolated or a collective and coordinated response to contact with a foreign substance mediated by cells and molecules of the immune system. The term "isolated" as used herein with reference to a compound refers to a condition of being removed from other substances or conditions in which a compound occurs in nature. For example, an isolated nucleic acid molecule can be a nucleic acid molecule removed from a cell. As another example, an isolated polypeptide can be a polypeptide removed from a cell. An isolated nucleic acid molecule or polypeptide can also be a molecule artificially synthesized outside of a cell. An isolated compound can but need not be pure. A "subject" as used herein refers to a mammal. In one embodiment a subject is a human. In certain other embodiments a subject is a non-human mammal, including
laboratory, livestock, and domestic mammals. Examples of non-human mammals include, without limitation, mice, rats, hamsters, guinea pigs, rabbits, cats, dogs, pigs, goats, sheep, cattle, and horses. The term "treat" as used herein refers to preventing, slowing, reducing progression of, halting, or eliminating a measurable sign or symptom of a disease or disorder of a subject.
The invention relates generally to a novel splice variant of CTLA-4 that is structurally and functionally distinct from previously described forms of CTLA-4. More specifically, the invention relates generally to a ligand-independent form of CTLA-4 (liCTLA-4) that is structurally and functionally distinct from full-length CTLA-4 (flCTLA-4) and from soluble CTLA-4 (sCTLA-4). Full-length CTLA-4 (also known as CD 152) is a highly conserved, inducible inhibitory receptor expressed on the surface of activated T cells. Brunet JF et al. (1987) Nature 328:267-70. CTLA-4 is a member of the immunoglobulin superfamily and a member of the CD28 family of T-cell receptors. Both CTLA-4 and CD28 bind B7 molecules B7.1 (CD80) and B7.2 (CD86) as their ligands. CTLA-4 and CD28 share a sequence motif MYPPPY (SEQ ID NO:5) in the extracellular V domain that is thought to be essential for B7 binding. Although structurally related to CD28, which serves as a positive regulator of T cell activation, CTLA-4 serves as a negative regulator of T cell activation. CTLA-4-defϊcient mice exhibit excessive T cell activation, proliferation, and systemic autoimmunity. Tivol EA et al. (1995) Immunity 3:541-6; Waterhouse P et al. (1995) Science 270:985-8. Murine CTLA-4 is a 223-amino-acid glycoprotein that can exist as a disulfide-linked homodimer. The sequence of murine CTLA-4 protein is available from GenBank as, for example, Accession No. CAA29191 (SEQ ID NOJ4).
MAC GLRRYK AQLQLPSRTW PFVALLTLLF IPVFSEAIQV TQPSWLASS HGVASFPCEY 60
SPSHNTDEVR VTVLRQTNDQ MTEVCATTFT EKNTVGFLDY PFCSGTFNES RW TIQGLR 120
AVDTGLY CK VΞLMYPPPYF VGMGNGTQIY VIDPEPCPDS DFLLWILVAV S GLFFYSFL 180
VSAVSLSKML KKRSP TTGV YVKMPPTEPE CEKQFQPYFI PIN 223
The complementary DNA (cDNA) sequence of murine CTLA-4 is also available from GenBank as, for example, Accession No. X05719 (SEQ ID NOJ5).
atggcttgtc ttggactccg gaggtacaaa gctcaactgc agctgccttc taggacttgg 60 ccttttgtag ccctgctcac tcttcttttc atcccagtct tctctgaagc catacaggtg 120 acccaacctt cagtggtgtt ggctagcagc catggtgtcg ccagctttcc atgtgaatat 180 tcaccatcac acaacactga tgaggtccgg gtgactgtgc tgcggcagac aaatgaccaa 240 atgactgagg tctgtgccac gacattcaca gagaagaata cagtgggctt cctagattac 300 cccttctgca gtggtacctt taatgaaagc agagtgaacc tcaccatcca aggactgaga 360 gctgttgaca cgggactgta cctctgcaag gtggaactca tgtacccacc gccatacttt 420 gtgggcatgg gcaacgggac gcagatttat gtcattgatc cagaaccatg cccggattct 480 gacttcctcc tttggatcct tgtcgcagtt agcttggggt tgttttttta cagtttcctg 540 gtctctgctg tttctttgag caagatgcta aagaaaagaa gtcctcttac aacaggggtc 600 tatgtgaaaa tgcccccaac agagccagaa tgtgaaaagc aatttcagcc ttattttatt 660 cccatcaact ga 672
Human CTLA-4 is a 223-amino-acid glycoprotein that can exist as a disulfide-linked homodimer. A Icnown single nucleotide polymorphism (SNP) affecting amino acid sequence is +49G>A (Thrl7Ala). A sequence of human CTLA-4 protein is available from GenBank as, for example, Accession No. NP_005205 (SEQ ID NO: 16). AC GFQRHK AQLNLATRTW PCTLLFFLLF IPVFCKAMHV AQPAWLASS RGIASFVCEY 60
ASPGKATEVR VTVLRQADSQ VTEVCAATYM MGNELTFLDD SICTGTSSGN QVNLTIQGLR 120
AMDTGLYICK VELMYPPPYY LGIGNGTQIY VIDPΞPCPDS DFLL ILAAV SSGLFFYSFL 180
LTAVSLSKML KKRSPLTTGV YVKMPPTEPE CEKQFQPYFI PIN 223
A cDNA sequence of human CTLA-4 is also available from GenBank as, for example, Accession No. NM_005214 (SEQ ID NO: 17).
atggcttgcc ttggatttca gcggcacaag gctcagctga acctggctac caggacctgg 60 ccctgcactc tcctgttttt tcttctcttc atccctgtct tctgcaaagc aatgcacgtg 120 gcccagcctg ctgtggtact ggccagcagc cgaggcatcg ccagctttgt gtgtgagtat 180 gcatctccag gcaaagccac tgaggtccgg gtgacagtgc ttcggcaggc tgacagccag 240 gtgactgaag tctgtgcggc aacctacatg atggggaatg agttgacctt cctagatgat 300 tccatctgca cgggcacctc cagtggaaat caagtgaacc tcactatcca aggactgagg 360 gccatggaca cgggactcta catctgcaag gtggagctca tgtacccacc gccatactac 420 ctgggcatag gcaacggaac ccagatttat gtaattgatc cagaaccgtg cccagattct 480 gacttcctcc tctggatcct tgcagcagtt agttcggggt tgttttttta tagctttctc 540 ctcacagctg tttctttgag caaaatgcta aagaaaagaa gccctcttac aacaggggtc 600 tatgtgaaaa tgcccccaac agagccagaa tgtgaaaagc aatttcagcc ttattttatt 660
cccatcaatt ga 672
A sequence of human CTLA-4 protein is available from GenBank as, for example, Accession No. AAB59385 (SEQ ID NOJ8).
MACLGFQRHK AQLNLAARTW PCTLLFFLLF IPVFCKAMHV AQPAWLASS RGIASFVCEY 60
ASPGKATEVR VTVLRQADSQ VTEVCAATYM TGNELTFLDD SICTGTSSGN QVNLTIQGLR 120
AMDTGLYICK VΞLMYPPPYY LGIGNGTQIY VIDPΞPCPDS DFLLWILAAV SSGLFFYSFL 180
LTAVSLSKML KKRSPLTTGV YVKMPPTEPE CEKQFQPYFI PIN 223
A cDNA sequence of human CTLA-4 is also available from GenBank as, for example, Accession No. L15006 (SEQ ID NOJ9).
atggcttgcc ttggatttca gcggcacaag gctcagctga acctggctgc caggacctgg 60 ccctgcactc tcctgttttt tcttctcttc atccctgtct tctgcaaagc aatgcacgtg 120 gcccagcctg ctgtggtact ggccagcagc cgaggcatcg ccagctttgt gtgtgagtat 180 gcatctccag gcaaagccac tgaggtccgg gtgacagtgc ttcggcaggc tgacagccag 240 gtgactgaag tctgtgcggc aacctacatg acggggaatg agttgacctt cctagatgat 300 tccatctgca cgggcacctc cagtggaaat caagtgaacc tcactatcca aggactgagg 360 gccatggaca cgggactcta catctgcaag gtggagctca tgtacccacc gccatactac 420 ctgggcatag gcaacggaac ccagatttat gtaattgatc cagaaccgtg cccagattct 480 gacttcctcc tctggatcct tgcagcagtt agttcggggt tgttttttta tagctttctc 540 ctcacagctg tttctttgag caaaatgcta aagaaaagaa gccctcttac aacaggggtc 600 tatgtgaaaa tgcccccaac agagccagaa tgtgaaaagc aatttcagcc ttattttatt 660 cccatcaatt ga 672
The exon structure of the Ctla-4 gene is known to include four exons. See, for example, GenBank Accession No. AF142145. Exon 1 includes nucleotides 1-109, corresponding to amino acids 1-36. Exon 2 includes nucleotides 110-457, corresponding to amino acids 37-152. Exon 3 includes nucleotides 458-567, corresponding to amino acids 153-189. Exon 4 includes nucleotides 568-672, corresponding to amino acids 190-223. The polypeptide encoded by exon 1 corresponds roughly to the signal peptide. The polypeptide encoded by exon 2 corresponds roughly to the remainder of the extracellular domain, including the B7-binding motif MYPPPY (SEQ ID NO:5). The polypeptide encoded by exon 3 corresponds roughly to the transmembrane domain. The polypeptide encoded by exon 4 corresponds roughly the cytoplasmic domain.
Soluble CTLA-4 represents an alternative splice variant of CTLA-4 in which exon 3, encoding the transmembrane domain, is omitted. Magistrelli G et al. (1999) Eur J Immunol 29:3596-602; Oaks MK et al. (2000) J Immunol 164:5015-8; Oaks MK et al. (2000) Cell Immunol 201:144-53. The sCTLA-4 polypeptide thus is a 186 amino acid polypeptide. The sCTLA-4 polypeptide is believed to bind to B7 molecules and to block immune stimulation without delivering a signal into the T cell, i.e., merely by acting as a sink for B7.
The invention is based in part on the discovery by the inventors of a novel splice variant of CTLA-4, here designated as ligand-independent CTLA-4 or liCTLA-4. This novel splice variant has important structural and functional features which distinguish it from flCTLA-4 and from sCTLA-4. Structurally, liCTLA-4 represents an alternative splice variant of CTLA-4 in which exon 2, encoding much of the extracellular domain, is omitted. Unlike flCTLA-4 or sCTLA-4, liCTLA-4 lacks the B7-binding motif MYPPPY (SEQ ID NO:5) and thus is believed to be ligand-independent. Similar to flCTLA-4, and as distinguished from sCTLA-4, liCTLA-4 is membrane-associated. Different from flCTLA-4, liCTLA-4 is constitutively expressed by T cells. As disclosed herein, liCTLA-4 appears to occur naturally in mice but has not yet been observed to occur naturally in humans. As disclosed herein, liCTLA-4 occurs as an alternatively spliced variant of CTLA-4 in which the extracellular IgV domain of fiCTLA-4 is omitted. An amino acid sequence for murine liCTLA-4 is provided as SEQ ID NO:2, as follows:
MACLGLRRYK AQLQLPSRT PFVALLTLLF IPVFSEDPEP CPDSDFLL I LVAVSLGLFF 60 YSFLVSAVSL SKMLKKRSPL TTGVYVKMPP TEPECEKQFQ PYFIPIN 107
A cDNA sequence for murine liCTLA-4 is provided as SEQ ID NOJ, as follows:
atggcttgtc ttggactccg gaggtacaaa gctcaactgc agctgccttc taggacttgg 60 ccttttgtag ccctgctcac tcttcttttc atcccagtct tctctgaaga tccagaacca 120 tgcccggatt ctgacttcct cctttggatc cttgtcgcag ttagcttggg gttgtttttt 180 tacagtttcc tggtctctgc tgtttctttg agcaagatgc taaagaaaag aagtcctctt 240 acaacagggg tctatgtgaa aatgccccca acagagccag aatgtgaaaa gcaatttcag 300 ccttatttta ttcccatcaa ctga 324
An amino acid sequence for a human counterpart to murine liCTLA-4 is provided as SEQ ID NO:4, as follows:
MACLGFQRHK AQLNLATRTW PCTLLFFLLF IPVFCKDPEP CPDSDFLLWI LAAVSSGLFF 60 YSFLLTAVSL SKMLKKRSPL TTGVYVKMPP TEPECEKQFQ PYFIPIN 107
In an alternative embodiment, threonine ("T") shown underlined at position 17 in SEQ ID NOJ is replaced with alanine ("A"). A cDNA sequence for a human counterpart to murine liCTLA-4 is provided as SEQ ID NO:3, as follows:
atggcttgcc ttggatttca gcggcacaag gctcagctga acctggctac caggacctgg 60 ccctgcactc tcctgttttt tcttctcttc atccctgtct tctgcaaaga tccagaaccg 120 tgcccagatt ctgacttcct cctctggatc cttgcagcag ttagttcggg gttgtttttt 180 tatagctttc tcctcacagc tgtttctttg agcaaaatgc taaagaaaag aagccctctt 240 acaacagggg tctatgtgaa aatgccccca acagagccag aatgtgaaaa gcaatttcag 300 ccttatttta ttcccatcaa ttga 324
In an alternative embodiment, "a" shown underlined at position 49 in SEQ ID NO:3 is replaced with "g", thus encoding alanine in place of threonine at position 17 in the polypeptide product.
In one aspect of the invention, an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2 is provided. As disclosed herein, SEQ ID NO:2 provides an amino acid sequence for a murine liCTLA-4. The murine liCTLA-4 provided by SEQ ID NO:2 includes the cytoplasmic domain that is present in both full-length CTLA-4 and in soluble CTLA-4, and it lacks the CD80/CD86 binding motif MYPPPY (SEQ ID NO:5) that is present in both full-length CTLA-4 and in soluble CTLA-4. More specifically, the polypeptide having an amino acid sequence provided by SEQ ID NO:2 lacks amino acids 37-152 of full-length murine CTLA-4. It is believed that SEQ ID NO:2 represents an expressed form of a transcriptional splice variant of the Ctla4 gene that is associated with a translationally silent G-to-A nucleotide substitution at position 77. This substitution appears to have the following two effects. First, at least a major portion (including a portion encoding the CD80/CD86 binding motif MYPPPY (SEQ ID NO:5)) or
all of exon 2 is deleted from the transcript. In addition, the overall level of liCTLA-4 transcripts is increased four-fold in both activated and resting spleen cells from diabetes- resistant C57BL/6 and BIO mice as compared with diabetes-prone NOD and other autoimmune disease-prone strains of mice. In one embodiment, the isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2 has a sequence provided by SEQ ID NO: 1. Those of skill in the art will recognize that an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2 is not a unique nucleic acid molecule, owing to the degeneracy of the genetic code. Thus in other embodiments, the isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO: 2 has a sequence that is related to SEQ ID NOJ by substitution of at least one alternative codon according to the degeneracy of the genetic code. Those of skill in the art will also recognize that codon usage may affect expression in a given species, and thus certain embodiments may be preferred for use in an application involving expression by a heterologous (i.e., non-murine) cell. In another aspect of the invention an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4 is provided. As disclosed herein, SEQ ID NO:4 provides an amino acid sequence for a human counterpart to murine liCTLA-4. The human liCTLA-4 provided by SEQ ID NOJ includes the cytoplasmic domain that is present in both full-length CTLA-4 and in soluble CTLA-4, and it lacks the CD80/CD86 binding motif MYPPPY (SEQ ID NO:5) that is present in both full- length CTLA-4 and in soluble CTLA-4. More specifically, the polypeptide having an amino acid sequence provided by SEQ ID NO:4 lacks amino acids 37-152 of full-length human CTLA-4. In one embodiment, the isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4 has a sequence provided by SEQ ID NO:3. Those of skill in the art will recognize that an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4 is not a unique nucleic acid molecule, owing to the degeneracy of the genetic code. Thus in other embodiments, the isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4 has a sequence that is related to SEQ ID NO:3 by substitution of at least one alternative codon according to the degeneracy of the
genetic code. Those of skill in the art will also recognize that codon usage may affect expression in a given species, and thus certain embodiments may be preferred for use in an application involving expression by a heterologous (i.e., non-human) cell. The invention in another aspect provides an expression vector including an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2, wherein said isolated coding nucleic acid is operably linked to a promoter. In one embodiment the isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2 includes a nucleic acid molecule having a sequence provided by SEQ ID NOJ . In one embodiment the isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:2 is a nucleic acid molecule having a sequence provided by SEQ ID NO: 1. The liCTLA-4 nucleic acid, in one embodiment, is operably linked to a gene expression sequence which directs the expression of the liCTLA-4 nucleic acid within a eukaryotic or prokaryotic cell. The "gene expression sequence" is any regulatory nucleotide sequence, such as a promoter sequence or promoter-enhancer combination, which facilitates the efficient transcription and translation of the coding nucleic acid to which it is operably linked. The gene expression sequence can be, for example, a mammalian or viral promoter, such as a constitutive or inducible promoter. Constitutive mammalian promoters include, but are not limited to, the promoters for the following genes: hypoxanthine phosphoribosyl transferase (HPRT), adenosine deaminase, pyruvate kinase, and β-actin. Exemplary viral promoters which function constitutively in cells include, for example, promoters from the simian virus, papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, cytomegalo virus, the long terminal repeats (LTR) of Moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus. Other constitutive promoters are known to those of ordinary skill in the art. The promoters useful as gene expression sequences of the invention also include inducible promoters. Inducible promoters are expressed in the presence of an inducing agent. For example, the metallothionein promoter is induced to promote transcription and translation in the presence of certain metal ions. Other inducible promoters are known to those of ordinary skill in the art. In general, the gene expression sequence shall include, as necessary, 5 ' non- transcribing and 5 ' non-translating sequences involved with the initiation of transcription and
translation, respectively. Such 5 ' non-transcribing sequences will include a promoter region which includes a promoter sequence for transcriptional control of the operably joined coding nucleic acid. The gene expression sequences optionally include enhancer sequences or upstream activator sequences as desired. The liCTLA-4 nucleic acid sequence and the gene expression sequence are said to be "operably linked" when they are covalently linked in such a way as to place the transcription and/or translation of the liCTLA-4 coding sequence under the influence or control of the gene expression sequence. If it is desired that the liCTLA-4 sequence be translated into a functional protein, two DNA sequences are said to be operably linked if induction of a promoter in the 5' gene expression sequence results in the transcription of the liCTLA-4 sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the liCTLA-4 sequence, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a gene expression sequence would be operably linked to a liCTLA-4 nucleic acid sequence if the gene expression sequence were capable of effecting transcription of that liCTLA-4 nucleic acid sequence such that the resulting transcript might be translated into the desired protein or polypeptide. A liCTLA-4 molecule of the invention can be delivered to a host cell alone or in association with a vector. In its broadest sense, a "vector" is any vehicle capable of facilitating uptake of a nucleic acid molecule or of a polypeptide by a target cell, hi one embodiment a vector is any vehicle capable of facilitating uptake of a nucleic acid molecule encoding a liCTLA-4 polypeptide of the invention by a target cell. In a specific embodiment, the vector is an expression vector, i.e., any vehicle capable of facilitating uptake and expression of a nucleic acid molecule encoding a liCTLA-4 polypeptide of the invention by a target cell. In one embodiment a vector is any vehicle capable of facilitating uptake of a liCTLA-4 polypeptide of the invention by a target cell. Preferably, the vectors transport the liCTLA-4 molecule into the target cell with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In general, the vectors useful in the invention are divided into two classes: biological vectors and chemical/physical vectors. Biological vectors are useful for delivery/uptake of liCTLA-4 nucleic acids to/by a target cell.
Chemical/physical vectors are useful for delivery/uptake of liCTLA-4 nucleic acids or liCTLA-4 polypeptides to/by a target cell. Biological vectors include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the nucleic acid sequences of the invention, and free nucleic acid fragments which can be attached to the nucleic acid sequences of the invention. Viral vectors are a type of biological vector and include, but are not limited to, nucleic acid sequences from the following viruses: retroviruses, such as: Moloney murine leukemia virus; Harvey murine sarcoma virus; murine mammary tumor virus; Rous sarcoma virus; adenovirus; adeno- associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes viruses; vaccinia viruses; polio viruses; and RNA viruses such as any retrovirus. One can readily employ other vectors not named but known in the art. Certain viral vectors are based on non-cytopathic eukaryotic viruses in which non- essential genes have been replaced with the gene of interest. Non-cytopathic viruses include retroviruses, the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA. In general, the retroviruses are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle). Standard protocols for producing replication-deficient retroviruses (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles) are provided in Kriegler, M., "Gene Transfer and Expression, A Laboratory Manual," W.H. Freeman Co., New York (1990) and Murry, E.J. Ed. "Methods in Molecular Biology," vol. 7, Humana Press, Inc., Cliffton, New Jersey (1991). Another virus useful for certain applications is the adeno-associated virus, a double- stranded DNA virus. The adeno-associated virus can be engineered to be replication- deficient and is capable of infecting a wide range of cell types and species. It further has advantages, such as heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages; and lack of superinfection inhibition thus allowing multiple series of transductions. Reportedly, the adeno-associated virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing the possibility of insertional mutagenesis and
variability of inserted gene expression. In addition, wild-type adeno-associated virus infections have been followed in tissue culture for at least 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event. The adeno-associated virus can also function in an extrachromosomal fashion. In addition to the biological vectors, chemical/physical vectors may be used to deliver a liCTLA-4 molecule to a target cell and facilitate uptake thereby. As used herein, a "chemical/physical vector" refers to a natural or synthetic molecule, other than those derived from bacteriological or viral sources, capable of delivering a molecule to a cell. In one embodiment a chemical/physical vector is a natural or synthetic molecule, other than those derived from bacteriological or viral sources, capable of delivering a liCTLA-4 molecule to a cell. In one embodiment a chemical/physical vector of the invention is a colloidal dispersion system. Colloidal dispersion systems include lipid-based systems including oil-in- water emulsions, micelles, mixed micelles, and liposomes. A colloidal system of the invention is, in one embodiiment, a liposome. Liposomes are artificial membrane vesicles which are useful as a delivery vector in vivo or in vitro. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2 - 4.0 μm can encapsulate large macromolecules. RNA, DNA, and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form. Fraley R et al. (1981) Biochemistry 20:6978-87. In order for a liposome to be an efficient gene transfer vector, one or more of the following characteristics should be present: (1) encapsulation of the gene of interest at high efficiency with retention of biological activity; (2) delivery of the aqueous contents of the vesicle to the target cell cytoplasm at high efficiency; and (3) accurate and effective expression of genetic information. Liposomes are commercially available from Gibco BRL, for example, as LIPOFECTIN™ and LIPOFECTACE™, which are formed of cationic lipids such as N-[l-(2, 3 dioleyloxy)-propyl]-N, N, N-trimethylammonium chloride (DOTMA) and dimethyl dioctadecylammonium bromide (DDAB). Methods for making liposomes are well known in the art and have been described in many publications. Liposomes also have been reviewed by Gregoriadis G (1985) Trends Biotechnol 3:235-41.
Compaction agents also can be used, alone or in combination with a biological or chemical/physical vector of the invention. A "compaction agent", as used herein, refers to an agent, such as a histone, that neutralizes the negative charges on the nucleic acid and thereby permits compaction of the nucleic acid into a fine granule. Compaction of the nucleic acid facilitates uptake of the nucleic acid by the target cell. The compaction agents can be used alone, e.g., to deliver the liCTLA-4 molecule in a form that is more efficiently taken up by the cell or, in other embodiments, in combination with one or more of the above-described vectors. Other exemplary compositions that can be used to facilitate uptake by a target cell of the liCTLA-4 nucleic acids include calcium phosphate and other chemical mediators of intracellular transport, microinjection compositions, electroporation and homologous recombination compositions (e.g., for integrating a liCTLA-4 nucleic acid into a preselected location within the target cell chromosome). In one embodiment the expression vector is a retroviral expression vector. In one embodiment the retroviral expression vector includes a multiple cloning site useflil for insertion of a nucleic acid molecule encoding a liCTLA-4 gene product, an internal ribosome entry site (IRES) useful for initiating transcription, and a reporter gene useful for detecting the presence of and expression by the retroviral expression vector in a cell. The multiple cloning site includes at least one restriction endonuclease site (e.g., EcoR I) useful for cloning purposes using molecular biology techniques well Icnown in the art. The reporter gene can be any suitable gene that encodes a detectable marker. In one embodiment the reporter gene is conveniently chosen to be green fluorescent protein (GFP). Expression of GFP can be monitored by conventional techniques including, for example, fluorescence-activated cell sorting, fluorescence measurement in a luminometer, and immunoblotting using anti-GFP antibodies. The invention in another aspect provides an expression vector including an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4, wherein said isolated coding nucleic acid is operably linked to a promoter. In one embodiment the isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4 includes a nucleic acid molecule having a sequence provided by SEQ ID NO:3. In one embodiment the isolated nucleic acid molecule
that codes for a polypeptide having an amino acid sequence provided by SEQ ID NOJ is a nucleic acid molecule having a sequence provided by SEQ ID NO:3. In another aspect the invention provides a host cell containing an expression vector encoding a polypeptide having an amino acid sequence provided by SEQ ED NO:2. In one embodiment the expression vector includes a nucleic acid molecule having a sequence provided by SEQ ID NO: 1. As used herein, a "host cell" refers to any suitable cell useful for expressing a product encoded by an expression vector introduced into said cell. In some embodiments the host cell is a eukaryotic cell. In other embodiments the host cell can be a prokaryotic cell. In certain embodiments the host cell is a cell that is part of a subject. In certain embodiments the host cell is a cell that is removed from a subject, manipulated ex vivo, and then returned to the subject. In some embodiments the host cell is an immortalized cell, e.g., a cell that is part of a clone or part of a cell line. For example, in one embodiment the host cell is HEK293 (American Type Culture Collection (ATCC) CRL-1573, a human embryonal kidney cell line), hi certain specific embodiments the host cell is a cell that does not express CTLA-4, e.g., a T cell obtained from a Ctla4 knockout mouse. In certain specific embodiments the host cell is a cell that does not express CTLA-4 and does not express at least one of CD80 and CD86. In certain specific embodiments the host cell is a cell that does not express CTLA-4 and does not express either one of CD80 and CD86, e.g., a T cell obtained from a triple knockout mouse (TKO, lacking expression of CTLA-4 and B7J and B7.2). Mandelbrodt DA et al. (1999) JExp Med 189:435-40. In another embodiment the host cell is a cell that does express CTLA-4 but does not express either one of CD80 and CD86, e.g., a T cell obtained from a double knockout mouse (DKO, lacking expression of B7J and B7.2). Mandelbrodt DA et al. (1999) JExp Med 189:435-40. In another aspect the invention provides a host cell containing an expression vector encoding a polypeptide having an amino acid sequence provided by SEQ ID NO:4. In one embodiment the expression vector includes a nucleic acid molecule having a sequence provided by SEQ ID NO:3. In a further aspect the invention provides a pharmaceutical composition that includes one of the forgoing liCTLA-4 expression vectors and a pharmaceutically acceptable carrier. More specifically, in one embodiment the invention provides an expression vector including an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence
provided by SEQ ID NO:2, as previously described, and a pharmaceutically acceptable carrier. In one embodiment the invention provides an expression vector including an isolated nucleic acid molecule that codes for a polypeptide having an amino acid sequence provided by SEQ ID NO:4, as previously described, and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically-acceptable carrier" means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human or other animal. The term "pharmaceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. Pharmaceutically acceptable further means a non-toxic material that is compatible with a biological system such as a cell, cell culture, tissue, or organism. The term "carrier" denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The characteristics of the carrier will depend on the route of administration. The components of the pharmaceutical compositions also are capable of being commingled with additional agents, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy. The pharmaceutically acceptable carrier is sterile for at least some forms of parenteral in vivo adminis -ration. Physiologically and pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials that are well known in the art. In a further aspect the invention provides a pharmaceutical composition that includes one of the forgoing liCTLA-4-encoding nucleic acid molecules and a pharmaceutically acceptable carrier. More specifically, in one embodiment the invention provides a nucleic acid molecule encoding an amino acid sequence provided by SEQ ID NO:2, as previously described, and a pharmaceutically acceptable carrier. In one embodiment the nucleic acid has a sequence that includes a sequence provided by SEQ ID NO: 1. In one embodiment the nucleic acid molecule has a sequence that is provided by SEQ ID NOJ . In one embodiment the invention provides a nucleic acid molecule encoding an amino acid sequence provided by SEQ ID NO:4, as previously described, and a pharmaceutically acceptable carrier, hi one embodiment the nucleic acid has a sequence that includes a sequence provided by SEQ ID NO:3. In one embodiment the nucleic acid molecule has a sequence that is provided by SEQ ID NO:3.
Ln another aspect the invention provides an isolated polypeptide including an amino acid sequence provided by SEQ ID NO:2. In one embodiment the isolated polypeptide has an amino acid sequence provided by SEQ ID NO:2. As discussed above, SEQ ID NO:2 provides an amino acid sequence for a murine liCTLA-4. In another aspect the invention provides an isolated polypeptide comprising an amino acid sequence provided by SEQ ID NO:4. In one embodiment the isolated polypeptide has an amino acid sequence provided by SEQ ID NOJ. As discussed above, SEQ ID NO:4 provides an amino acid sequence for a human counterpart of murine liCTLA-4. In a further aspect the invention provides a pharmaceutical composition that includes one of the forgoing liCTLA-4 polypeptides and a pharmaceutically acceptable carrier. More specifically, in one embodiment the invention provides a polypeptide having an amino acid sequence provided by SEQ ID NO:2, as previously described, and a pharmaceutically acceptable carrier. In one embodiment the invention provides a polypeptide having an amino acid sequence provided by SEQ ID NO:4, as previously described, and a pharmaceutically acceptable carrier. The invention also provides, in another aspect, a method for inhibiting an immune response. The method according to this aspect of the invention involves contacting a T lymphocyte with an effective amount of an agent that increases expression of liCTLA-4 to inhibit an immune response. In one embodiment the contacting occurs in vitro. In another embodiment the contacting occurs in vivo. As used herein, "an agent that increases expression of liCTLA-4" refers to any agent that, when contacted with a cell, is effective for increasing expression of liCTLA-4 by the cell beyond the level of expression that would occur without the agent. In some instances the level of expression that would occur without the agent is a negligible amount. For example, in one embodiment the cell is a cell that normally does not express CTLA-4. In one embodiment the cell is a wildtype human T cell. In one embodiment the cell is a cell that has previously been rendered incapable of expressing CTLA-4, e.g., a T cell from a CTLA-4 knockout mouse or a T cell from a TKO mouse (described above), hi some instances the level of expression that would occur without the agent is more than a negligible amount. For example, in one embodiment the cell is a cell that normally does express CTLA-4. In one embodiment the agent that increases expression of liCTLA-4 is an expression vector containing a nucleic acid molecule that codes for a polypeptide that includes an amino
acid sequence provided by SEQ ID NO:2. In one embodiment the agent that increases expression of liCTLA-4 is an expression vector containing a nucleic acid molecule that codes for a polypeptide that is an amino acid sequence provided by SEQ ID NO:2. In one embodiment the agent that increases expression of liCTLA-4 is an expression vector containing a nucleic acid molecule that codes for a polypeptide that includes an amino acid sequence provided by SEQ ID NO:4. In one embodiment the agent that increases expression of liCTLA-4 is an expression vector containing a nucleic acid molecule that codes for a polypeptide that is an amino acid sequence provided by SEQ ID NO:4. The method according to this aspect of the invention results in an inhibition of an immune response. With reference to this aspect of the invention, the immune response is inhibited relative to an immune response that would occur in the absence of the contacting step. In one specific embodiment the inhibition of an immune response is an inhibition of T- cell proliferation. Those of skill in the art are familiar with techniques useful for measuring T-cell proliferation. Such methods include, without limitation, [3H]-thymidine uptake, flow cytometry, and cytokine secretion, especially of interleukin 2 (IL-2). In certain specific embodiments the inhibition of an immune response is an inhibition of cytokine production or cytokine secretion. Cytokines are protein and/or glycoprotein products secreted by a variety of cells, including both immune cells (e.g., professional antigen-presenting cells, T cells, B cells, monocytes, and macrophages) and non-immune cells (e.g., endothelial cells), that mediate inflammatory and immune reactions. Cytokines include, without limitation, interleukins (e.g., IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL- 22, IL-23, IL-24, IL-25); interferons (e.g., IFN-α, IFN-β, IFN-γ); tumor necrosis factor (e.g., TNF-α, TNF-β); transforming growth factor (e.g., TGF-β); and colony-stimulating factors (CSFs, e.g., granulocyte-monocyte CSF (GM-CSF), granulocyte CSF (G-CSF), monocyte CSF (M-CSF)). In one embodiment the inhibition of an immune response is an inhibition of IFN-γ secretion. Cytokine secretion is readily measured using standard techniques that include specific enzyme-linked immunosorbent assay (ELISA) and biological response assays. Standards and other reagents useful for such assays are commercially available. As described in greater detail in Example 4 below, TKO T cells infected with retrovirus containing flCTLA-4 showed lower proliferation and IFN-γ production when compared to TKO T cells infected with empty retrovirus. Surprisingly, TKO T cells infected
with retrovirus containing liCTLA-4 was found equally capable of inhibiting T cell responses as flCTLA-4, both in terms of proliferation in IFN-γ secretion. The invention in one aspect provides a method for inhibiting an immune response in a subject. The method according to this aspect of the invention involves administering to a subject an effective amount of an agent that increases expression of liCTLA-4 to inhibit an immune response in the subject. The method can be used to reduce or prevent an unwanted immune response in a subject. In one embodiment the subject has received or is about to receive an allograft. A subject that is about to receive an allograft is a subject that is scheduled to receive an allograft. The method thus can be used alone or in conjunction with other immunosuppressive or tolerizing therapies in order to reduce or eliminate the occurrence of allograft rejection. Additional immunosuppressive or tolerizing therapies can include the administration of immunosuppressive drugs, such as cyclosporine, tacrolimus (FK-506), sirolimus (also known as rapamycin), mycophenolate mofetil, azathioprine, corticosteroids (including methylprednisolone and prednisone), OKT-3 monoclonal antibody, anti-Tac antibody (e.g., daclizumab (ZENAPAX®, Roche)), statins, and any combination thereof. Additional immunosuppressive or tolerizing therapies can include irradiation, thymectomy, or oral administration of antigen. The forgoing lists are meant to be exemplary and not limiting in any way. When the method is used prophylactically, for example prior to the subject receiving the allograft, the administering can take place any time prior to transplantation, but typically will take place between one month prior to transplantation and moments before transplantation. Prophylactic use can be extended to include pre-emptive use, e.g., administration following transplantation but prior to clinical evidence of rejection. The method can also be used to treat an established or ongoing rejection episode in a subject that has received a transplant. The rejection can be acute or chronic. Those of skill in the art recognize how to diagnose and monitor allograft rejection. Such diagnosis and monitoring can include the use of any one or combination of symptoms, signs, physical diagnosis, biopsy, imaging techniques, biochemical assays, hemodynamic monitoring, microscopy, hematologic measurements, and the like. The invention in another aspect provides a method for treating an autoimmune disease. The method according to this aspect of the invention involves administering to a subject that has or is at risk of having an autoimmune disease an effective amount of an agent that increases expression of liCTLA-4 to treat the autoimmune disease. In one embodiment
the subject has an autoimmune disease. A subject that has an autoimmune disease is a subject with at least one objective clinical symptom, sign, or physical, laboratory, or tissue finding that is compatible with a diagnosis of a particular autoimmune disease. The skilled clinician will be able to discern which symptom, sign, or physical, laboratory, or tissue finding, or any combination thereof, is indicative of the presence of a particular autoimmune disease. Likewise, the skilled clinician will recognize how to assess the status of a particular autoimmune disease, including its response to therapy, by following and assessing appropriate combination of clinical signs, symptoms, or physical, laboratory, or tissue findings. In one embodiment the subject is at risk of developing an autoimmune disease. A subject at risk of developing an autoimmune disease is a subject without an established particular autoimmune disease but with at least one objectively measurable risk factor associated with the development of the particular autoimmune disease. For example, in humans, HLA-B27 is reported to be associated with ankylosing spondylitis, Reiter's syndrome, psoriatic arthritis, and juvenile rheumatoid arthritis; HLA-DR4 is reported to be associated with type 1 diabetes mellitus and systemic lupus erythematosus; and HLA- DR4/Dw4, HLA-DR4/Dwl4, HLA-DR4/Dwl5, and others are reported to be associated with rheumatoid arthritis. Subjects at risk of developing an autoimmune disease may also have a family history for development of an autoimmune disease, e.g., insulin-dependent diabetes mellitus. As another example, certain strains of mice, such as NOD, are genetically predisposed to developing diabetes. The method can be used alone or in conjunction with other immunosuppressive or tolerizing therapies, described above, in order to reduce or eliminate the occurrence of autoimmune disease. In one embodiment the subject has or is at risk of developing a T-cell-mediated autoimmune disease. In one embodiment the subject has or is at risk of developing autoimmune type 1 (insulin-dependent) diabetes mellitus. In another embodiment the subject has or is at risk of developing multiple sclerosis. In another embodiment the subject has or is at risk of developing experimental allergic encephalomyelitis, a neurologic disease similar to multiple sclerosis that can be induced in experimental animals by immunization with myelin basic protein. In another embodiment the subject has or is at risk of developing viral hepatitis, e.g., hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E, and hepatitis G. hi another embodiment the subject has or is at risk of developing viral myocarditis. In another embodiment the subject has or is at risk of developing myasthenia gravis. In yet another
embodiment the subject has or is at risk of developing autoimmune thyroiditis, including Graves' disease. In yet another embodiment the subject has or is at risk of developing Crohn's disease. The invention in yet another aspect provides a method for screening for immune reactivity. The method according to this aspect of the invention involves the steps of measuring expression of liCTLA-4 by a T cell and determining immune reactivity of the T cell is (a) high when liCTLA-4 expression is low, and (b) low when liCTLA-4 expression is high. Measurement of liCTLA-4 expression can be accomplished using any method suitable for measuring a liCTLA-4 transcript or liCTLA-4 polypeptide in a cell or in a population of cells. The measurement can conveniently be made with reference to measurement of full length CTLA-4 or soluble CTLA-4. Transcripts of liCTLA-4 can be measured using any of a variety of techniques that may include, without limitation, quantitative reverse transcriptase- polymerase chain reaction (RT-PCR), Northern blotting, RNase protection assay, and the like. Such methods can include the use of labeled nucleic acid probe molecules that can hybridize under suitable conditions of temperature and salt with specific target sequence present in the transcript to be measured. Measurement of liCTLA-4 polypeptide can be accomplished using appropriate antibodies directed to an epitope expressed in liCTLA-4 or in a tag that is covalently or otherwise attached to liCTLA-4. For example, a nucleic acid coding for liCTLA-4 can be altered to incorporate an in-frame coding sequence for a tag moiety that can be placed upstream, downstream, or within the coding sequence for liCTLA-4. Antibodies directed to the cytoplasmic domain of CTLA-4 should bind to flCTLA-4, sCTLA-4, and liCTLA-4; these entities can be distinguished by their different molecular sizes, e.g., by separating them using polyacrylamide gel electrophoresis (PAGE) followed by immunoblotting. Expression of liCTLA-4 is said to be low when the ratio between liCTLA-4 and flCTLA-4 is less than 0.6. Expression of liCTLA-4 is said to be high when the ratio between liCTLA-4 and flCTLA-4 is greater than or equal to 0.6. The invention in yet another aspect provides a method for screening a subject for risk of having or developing an autoimmune disease. The method according to this aspect of the invention involves the steps of measuring expression of liCTLA-4 by T cells of a subject and determining the subject's risk of having or developing an autoimmune disease is (a) high when liCTLA-4 expression is low, and (b) low when liCTLA-4 expression is high.
Several methods are disclosed herein of administering to a subject a compound for prevention or treatment of a particular condition. It is to be understood that in each such aspect of the invention, the invention specifically includes, also, the compound for use in the treatment or prevention of that particular condition, as well as use of the compound for the manufacture of a medicament for the treatment or prevention of that particular condition. Administration of Therapeutic Agents of the Invention. Therapeutic agents of the invention are administered to an individual using any available method and route suitable for drug delivery, including in vivo and ex vivo methods, as well as systemic, mucosal, and localized routes of administration. Conventional and pharmaceutically acceptable routes of administration include oral, intramuscular, intravenous, intranasal, intratracheal, intrapulmonary, subcutaneous, intradermal, topical application, rectal, and other parenteral routes of administration. Routes of administration can be combined, if desired, or adjusted depending upon the particular agent and/or the desired effect. The therapeutic agents of the invention can be administered in a single dose or in multiple doses, and may encompass administration of booster doses, to elicit and/or maintain the desired effect on the immune response. Therapeutic agents of the invention can be administered to a subject using any available conventional methods and routes suitable for delivery of conventional drugs, including systemic or localized routes. In general, routes of administration contemplated by the invention include, but are not necessarily limited to, enteral, parenteral, or inhalational routes. Inhalational routes of administration (e.g., intranasal, intratracheal, intrapulmonary, and the like) include inhalation of aerosol suspensions or insufflation of the polynucleotide and polypeptide compositions of the invention. Nebulizer devices, metered dose inhalers, and the like suitable for delivery of polynucleotide and polypeptide compositions to the nasal mucosa, trachea and bronchioli are well-known in the art and will therefore not be described in detail here. Parenteral routes of administration other than inhalation administration include, but are not necessarily limited to, topical, mucosal, intradermal, subcutaneous, intramuscular, intravenous, intraperitoneal, intraorbital, and intracapsular routes, i.e., any route of administration other than through the alimentary canal. Parenteral administration can be carried out to effect systemic or local delivery of therapeutic agents of the invention. Where
systemic delivery is desired, administration typically involves invasive or systemically absorbed topical or mucosal administration of pharmaceutical preparations. Therapeutic agents of the invention can also be delivered to the subject by enteral administration. Enteral routes of administration include, but are not necessarily limited to, oral and rectal (e.g., using a suppository) delivery. Methods of administration of therapeutic agents of the invention through the skin or mucosa include, but are not necessarily limited to, topical application of a suitable pharmaceutical preparation, transdermal transmission, injection, and epidermal administration. For transdermal transmission, absorption promoters or iontophoresis are suitable methods, lontophoretic transmission may be accomplished using commercially available "patches" which deliver their product continuously via electric pulses through unbroken skin for periods of several days or more. An exemplary patch product for use in this method is the lONTOPATCH® (Birch Point Medical, St. Paul, MN) which electronically maintains reservoir electrodes at neutral pH and can be adapted to provide dosages of differing concentrations, to dose continuously and/or to dose periodically. Epidermal administration can be accomplished by mechanically or chemically irritating the outermost layer of the epidermis sufficiently to provoke an immune response to the irritant. An exemplary device for use in epidermal administration employs a multiplicity of very narrow diameter, short tynes which can be used to scratch ISS coated onto the tynes into the skin. The device included in the MONO-VACC™ tuberculin test (manufactured by Pasteur Merieux, Lyon, France) is suitable for use in epidermal administration of therapeutic agents of the invention. The invention also contemplates opthalmic administration of therapeutic agents of the invention, which generally involves invasive or topical application of a pharmaceutical preparation to the eye. Eye drops, topical creams and injectable liquids are all examples of suitable formulations for delivering drugs to the eye. Therapeutic agents of the invention can be administered to a subject prior to exposure to antigen, after exposure to antigen but prior to onset of disease symptoms associated with an unwanted immune response, or after onset of disease symptoms. As such, therapeutic agents of the invention can be administered at any time after exposure to antigen, but a first dose is usually administered about 8 hours, about 12 hours, about 24 hours, about 2 days, about 4 days, about 7 days, about 14 days, about 1 month, about 2 months, about 4 months,
about 8 months, or about 1 year after exposure to antigen. The invention also provides for administration of subsequent doses of therapeutic agents of the invention. Exposure to an antigen includes both deliberate administration of antigen to a subject, e.g., as in vaccination or in transplantation, as well as passive encounter with or environmental exposure to an antigen. Administration with Additional Therapeutic Agents and Therapies. In one embodiment, therapeutic agents of the invention are administered in combination with a conventional therapeutic agent or therapy to provide for an increased effect in treatment of an immune response. The additional therapeutic agent may be any agent (e.g., immunosuppressive agent) identified as having activity against the immune response of interest (e.g., in inhibition of autoimmune disease or in inhibition of allograft rejection, etc.). Exemplary conventional therapeutic agents include, but are not necessarily limited to, antibiotics, including antimicrobial agents, (e.g., bacteriostatic and bacteriocidal agents (e.g., aminoglycosides, β-lactam antibiotics, cephalosporins, macrolides, penicillins, tetracyclines, qumolones, and the like), antivirals (e.g., amprenavirs, acyclovirs, amantadines, virus penciclovirs, and the like), antifungals, (e.g., imidazoles, triazoles, allylamines, polyenes, and the like), as well as anti-parasitic agents (e.g., atovaquones, chloroquines, pyrimethamines, ivermectins, mefloquines, pentamidines, primaquines, and the like), and combinations thereof. Exemplary conventional therapeutic agents also include, but are not limited to, immunosuprressive agents and therapies, (e.g., cyclosporine, tacrolimus (FK-506), sirolimus (also known as rapamycin), mycophenolate mofetil, azathioprine, corticosteroids (including methylprednisolone and prednisone), OKT-3 monoclonal antibody, anti-Tac antibody (e.g., daclizumab (ZENAPAX®, Roche)), statins, irradiation, thymectomy, oral administration of antigen, and any combination thereof). The therapeutic agent of the invention and the conventional therapeutic agent or therapy can be administered within the same or different formulation; by the same or different routes; or concurrently, simultaneously, or consecutively. The therapeutic agent of the invention can be delivered according to a regimen (e.g., frequency during a selected interval (e.g., number of times per day), delivery route, etc.) that is the same as, similar to, or different from that of the conventional therapeutic agent. When administered in combination, therapeutic agent of the invention and conventional therapeutic agent or therapy are generally administered within about 96 hours, about 72 hours, about 48 hours, about 24 hours, about 12
hours, about 8 hours, about 4 hours, about 2 hours, about 1 hour, or about 30 minutes or less, of each other. Thus, although it may be desirable to do so in some situations, it is not necessarily required that a therapeutic agent of the invention and a conventional therapeutic agent or therapy be delivered simultaneously. Dosages. Although the dosage used will vary depending on the clinical goals to be achieved, as well as characteristics of the subject to be treated, a suitable dosage range is one which provides up to about 1 μg, to about 1,000 μg, to about 10,000 μg, to about 25,000 μg or about 50,000 μg of therapeutic agent of the invention. Therapeutic agents of the invention can be administered in a single dosage or several dosages over time. The invention contemplates administration of "booster" doses to provide and maintain an immune response effective to protect the subject from unwanted immune system activation and to reduce the risk of the onset of disease or the severity of disease symptoms that may occur as a result of immune activation. When multiple doses are administered, subsequent doses are administered within about 16 weeks, about 12 weeks, about 8 weeks, about 6 weeks, about 4 weeks, about 2 weeks, about 1 week, about 5 days, about 72 hours, about 48 hours, about 24 hours, about 12 hours, about 8 hours, about 4 hours, or about 2 hours or less of the previous dose. In one embodiment, therapeutic agents of the invention are administered at intervals ranging from at least every two weeks to every four weeks (e.g., monthly intervals) in order to maintain the desired immune suppression. In view of the teaching provided by this disclosure, those of ordinary skill in the clinical arts will be familiar with, or can readily ascertain, suitable parameters for administration of therapeutic agents of the invention according to the invention. Formulations. In general, therapeutic agents of the invention are prepared in a pharmaceutically acceptable composition for delivery to a host. Pharmaceutically acceptable carriers preferred for use with the therapeutic agents of the invention may include sterile aqueous of non- aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's,
or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. A composition of therapeutic agent of the invention may also be lyophilized using means well known in the art, for subsequent reconstitution and use according to the invention. Also of interest are formulations for liposomal delivery, and formulations comprising microencapsulated therapeutic agents of the invention. In general, the phannaceutical compositions can be prepared in various forms, such as granules, tablets, pills, suppositories, capsules, suspensions, salves, lotions and the like. Pharmaceutical grade organic or inorganic carriers and/or diluents suitable for oral and topical use can be used to make up compositions comprising the therapeutically active compounds. Diluents known in the art include aqueous media, vegetable and animal oils, and fats. Stabilizing agents, wetting and emulsifying agents, salts for varying the osmotic pressure or buffers for securing an adequate pH value, and skin penetration enhancers can be used as auxiliary agents. Preservatives and other additives may also be present, such as, for example, anti-pathogenic agents (e.g., antimicrobials, antibacterials, antivirals, antifungals, etc.), antioxidants, chelating agents, and inert gases and the like. Therapeutic agents of the invention can be administered in the absence of agents or compounds that might facilitate uptake by target cells (e.g., as a "naked" polynucleotide, e.g., a polynucleotide that is not encapsulated by a viral particle). Therapeutic agents of the invention can also be administered with compounds that facilitate uptake of therapeutic agents of the invention by target cells (e.g., by T lymphocytes) or otherwise enhance transport of the therapeutic agents of the invention to a treatment site for action. Absorption promoters, detergents, and chemical irritants (e.g., keratinolytic agents) can enhance transmission of a nucleic acid molecule composition into a target tissue (e.g., through the skin). A colloidal dispersion system may be used for targeted delivery of therapeutic agents of the invention to specific tissue. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in- water emulsions, micelles, mixed micelles, and liposomes. Liposomes are artificial membrane vesicles which are useful as delivery vehicles in vitro and in vivo. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2-4.0 μm, can encapsulate a substantial percentage of an aqueous buffer
containing large macromolecules. RNA and DNA can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form. Fraley R et al. (1981) Trends Biochem Sci 6:77-80. The composition of the liposome is usually a combination of phospholipids, particularly high-phase-transition-temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations. Examples of lipids useful in liposome production include phosphatidyl compounds, such as phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides. Particularly useful are diacylphosphatidylglycerols, where the lipid moiety contains from 14- 18 carbon atoms, particularly from 16-18 carbon atoms, and is saturated. Illustrative phospholipids include egg phosphatidylcholine, dipalmitoylphosphatidylcholine, and distearoylphosphatidylcholine. Where desired, targeting of liposomes can be classified based on anatomical and mechanistic factors. Anatomical classification is based on the level of selectivity, for example, organ-specific, cell-specific, and organelle-specifϊc. Mechanistic targeting can be distinguished based upon whether it is passive or active. Passive targeting utilizes the natural tendency of liposomes to distribute to cells of the reticulo-endothelial system (RES) in organs which contain sinusoidal capillaries. Active targeting, on the other hand, involves alteration of the liposome by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein, or by changing the composition or size of the liposome in order to achieve targeting to particular organs and cell types other than the naturally occurring sites of localization. The surface of the targeted delivery system may be modified in a variety of ways. In the case of a liposomal targeted delivery system, lipid groups can be incorporated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable association with the liposomal bilayer. Various well known linking groups can be used for joining the lipid chains to the targeting ligand. See, e.g., Yanagawa H et al. (1988) Nucleic Acids Symp Ser 19:189-92; Grabarek Z et al. (1990) Anal Biochem 185:131-5; Staros JV et al. (1986) Anal Biochem 156:220-2; and Boujrad N et al. (1993) Proc Natl Acad Sci USA 90:5728-31. Targeted delivery of therapeutic agents of the invention can also be achieved by conjugation of the therapeutic agent of the invention to the surface of viral and non- viral recombinant
expression vectors, to an antigen or other ligand, to a monoclonal antibody, or to any molecule which has the desired binding specificity. Additional Formulation Components. The pharmaceutical compositions also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above. The pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of present methods for drug delivery, see Langer R (1990) Science 249:1527-33, which is incorporated herein by reference. The pharmaceutical compositions are in one embodiment prepared and administered in dose units. Liquid dose units are vials or ampoules for injection or other parenteral administration. Solid dose units include tablets, capsules and suppositories. For treatment of a patient, depending on activity of the compound, manner of administration, purpose of the immunization (i.e., prophylactic or therapeutic), nature and severity of the disorder, age and body weight of the patient, different doses may be necessary. The therapeutic agents of the invention may be administered per se (neat) or in the form of a pharmaceutically acceptable salt. When used in medicine the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof. Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, fonnic, malonic, succimc, naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group. The therapeutic agents of the invention an include suitable buffering agents and preservative agents. Suitable buffering agents include: acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v). Suitable preservatives include benzalkonium chloride (0.003-0.03% w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% w/v).
The compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well Icnown in the art of pharmacy. All methods include the step of bringing the compounds into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the compounds into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product. Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the compounds, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer- based systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Pat. No. 5,075,109. Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-di-and tri-glycerides; hydrogel release systems; silastic systems; peptide-based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which an agent of the invention is contained in a form within a matrix such as those described in U.S. Pat. Nos. 4,452,775, 4,675,189, and 5,736,152, and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.
Examples The following examples are illustrative only and are not intended to limit the cope of the invention in any way. Example 1. Three Different Isoforms of CTLA-4 in C57BL/6 Mice. By using RT-PCR, three different forms of CTLA-4 (CD 152) were detected from unactivated and activated spleen cells of C57BL/6 mice: 1) a full-length form of CTLA-4,
(flCTLA-4); 2) a soluble CTLA-4, (sCTLA-4); and 3) a novel splice variant of approximately 300 bp (FIG. 1A, lane 1 and 2). Mice. 6-8 week old female SJL, B10.S and NOD/LtJ mice were procured from the Jackson Laboratory (Bar Harbor, ME). BALB/c DO11.10 TCR transgenic mice were bred on the RAG-/- background and maintained at our facility. BALB/c TKO (CTLA-4, B7.1, B7.2 -/-) and BALB/c DKO (B7.1, B7.2 -/-) mice were generated by Arlene Sharpe (Harvard Medical School, Boston, MA). Mandelbrodt DA et al. (1999) JExp Med 189:435-40. C57BL/6.H2g7 mice were a kind gift from Diane Mathis and Christophe Benoist (Joslin Diabetes Center, Boston, MA). mRNA isolation and RT-PCR. Total mRNA was isolated from spleen cells of C57BL/6 mice, B10, NOD and SJL/J mice activated with 1 μg/ml anti-CD3 (Pharmingen) using the Qiagen mRNA EAsy kit (Qiagen). cDNA from 5 μg total mRNA was prepared by Oligo dT priming using the Superscript reverse transcriptase kit (Invitrogen Life Technologies). RT-PCR amplification of CTLA-4 isoforms was done using the 5 ' primer CCGCTCGAGTTGGGTTTTACTCTACTCCCTGA (SEQ ID NO:20) and 3 'primer ACGCGTCGACTCCTTCTTCTTCATAAACGGC (SEQ ID NO:21). Amplified products were cloned into TOPO 2.1 vector. Cloned products were sequenced to determine the sequence of flCtla-4 and liCtla-4. Unlike the flCTLA-4 and the sCTLA-4, the novel variant (liCTLA-4) was found to lack exon 2 which encodes for the extracellular IgV domain of flCTLA-4. The predicted amino acid sequence of the liCTLA (108 residues) contained a signal sequence, a transmembrane domain and cytoplasmic domain similar to the flCTLA-4 (FIG. IB), but it lacked the IgV exon containing the MYPPPY (SEQ ID NO: 5) motif essential for binding to B7 molecules. The mature liCTLA-4 isoform is predicted to be of a smaller size (above 8 kD) than the flCTLA-4 isoform because of the loss of residues 37-153 including glycosylation sites (FIG. IB).
Example 2. liCTLA-4 Is Expressed as a Protein and Targeted to the Cell Surface. To determine if the novel liCTLA-4 is expressed as a protein and targeted to the cell surface, the cDNA of liCTLA-4 was directionally cloned into the Not I/Sal 1 site within the multiple cloning site of mammalian expression vector pCMV-Tag5C. The stop codon in liCTLA-4 was mutated using: 5 'primer
TTTATTCCCATCAACGGAAAGGCCGTTTATGAAGAAGAAGGA (SEQ ID NO:22) and a complementary 3 ' primer using the Quickchange site directed mutagenesis kit (Strategene). Insertion of a 10 amino acid MYC site between the signal sequence and the extracellular domain was achieved by first cloning the cDNA encoding the liCTLA-4 in the Xhol site of pCMV Tag2C vector. Then using the primers 5 '
GΎCΎTCGAAGAΎGCCGCCATGGAGCAGAAACTCATCTCTGAAGAGGATCTGCCAG
AACCATGCCCG (SEQ ID NO:23) and a 3 ' complimentary reverse primer, a MYC site was inserted in a site-directed mutagenesis reaction using the Quickchange site-directed mutagenesis kit (Stratagene). Sequence in italics indicates the MYC site. For retroviral expression, cDNA of flCTLA-4 and liCTLA-4 were cloned into the Xhol restriction site of the pGCIRES retroviral vector developed by Garry Nolan. Costa GL et al. (2000) J Immunol 164:3581-90. Cloned products were confirmed for presence and orientation of inserts by sequencing at the Brigham and Women's Hospital sequencing core. HEK293T cells transfected with the vector encoding liCTLA-4 expressed a protein species of approximately 8 kDa on a reducing gel which was detected by Western blot (FIG. 1C), suggesting that liCTLA-4 can be expressed as a protein and is not degraded at the mRNA level. Secondly, since liCTLA-4 lacks the extracellular IgV domain, it was not clear whether the protein is targeted to the cell membrane or is trapped and retained in the cytosol. To address this issue, liCTLA-4 cDNA was modified to include a ten amino acid MYC tag after the putative signal cleavage site. HEK293T cells were transfected with the construct and the transfectants were cell surface stained with anti-MYC antibody and analyzed by flow cytometry for surface expression of liCTLA-4/MYC. FIG. ID shows that HCTLA-4/MYC expression was detected on the HEK293T cell surface following transfection. This suggests that even though the liCTLA-4 lacks a major portion of the extracellular domain, it can still be targeted to the cell surface in mammalian cells.
Example 3. liCTLA-4 Is Expressed as a Protein in Normal T Cells. To determine whether liCTLA-4 is expressed as a protein in normal T cells, Western blotting analysis, using an antibody directed to the cytoplasmic domain of CTLA-4 which can recognize both flCTLA-4 and liCTLA-4, was employed. Cell lysates from 2xl07 spleen cells from C57BL/6 mice activated with anti-CD3 (2 μg) were prepared using lysis buffer containing 1% NP40 and supplemented with protease inhibitors. Cell extracts were run on a
15%) denaturing gel. Fractionated proteins were transfened onto a PVDF membrane (BioRad) and probed with specific antibodies to MYC (mouse anti-MYC antibody, Santa Cruz), CTLA-4 (hamster anti-CTLA-4, Pharmingen) or with goat anti-CTLA-4 antibody recognizing the cytoplasmic domain of CTLA-4 (C19, Santa Cruz). Western blots were developed using an ECL kit (Amersham) and exposed to XAR film (Kodak). With whole cell lysates from activated C57BL/6 splenocytes, the anti-CTLA-4 antibody was able to detect a doublet band of flCTLA-4 migrating at ~34 kDa, and a single band at 8 kDa consistent with it being the liCTLA-4 (FIG. IE). As described previously in a 2D gel analysis, the flCTLA-4 protein which appears as a doublet migrating at 34 kDa represents differentially glycosylated protein species. Lee KM et al. (1998) Science 282:2263-6. The flCTLA-4 molecule has three potential N-linked glycosylation sites, while liCTLA-4 has no predicted N-linked glycosylation sites. Thus liCTLA-4 is expressed in activated normal T cells at levels comparable to flCTLA-4.
Example 4. liCTLA-4 Functions as an Attenuator ofT Cells, Similar toflCTLA-4. fiCTLA-4 signaling has been shown to prevent cell cycle entry at the Gl phase and subsequently to inhibit IL-2 production. Krummel MF et al. (1996) JExp Med 183:2533-40; Walunas TL et al. (1994) Immunity 1 :405-13. To investigate whether liCTLA-4 functions like the flCTLA-4 in T cells, flCTLA-4 or liCTLA-4 were expressed by retroviral infection in T cells of triple knock out (TKO) mice that lack CTLA-4, B7J and B7.2. The vector had a multiple cloning site allowing incorporation of genes expressing the test protein and a downstream selectable marker, green fluorescent protein (GFP). Cell preparation and retroviral infections. Ecotropic packaging cells (Phoenix-E) were cultured in DMEM complete medium (DMEM-10% Fetal Bovine Serum, GIBCO- BRL) and transfected with retroviral constructs using Lipofectamine (Life Technologies). Retrovirus-containing cell supernatant was collected 48 and 72 hr after transfection and used to spin infect in vztrø-activated TKO and DKO T cells as described previously. Costa GL et al. (2000) J Immunol 164:3581-90. Viral supernatants expressing liCTLA-4, flCTLA-4, or empty vector were titrated for infectivity based on their ability to infect NIH3T3 cells. Titrated supernatants were then used to infect activated CD3+ T cells from TKO mice in the presence of IL-2. Using this approach, 10-20%) of activated T cells could be routinely transduced with the retroviral vector.
Proliferation and cytokine production. Proliferative responses were measured by culturing 3xl04 sorted GFP+ T cells in the presence of mitomycin C treated, CD4 and CD8 depleted APCs (ATCC, Rockville, MD) with anti-CD3 for 48hrs in DMEM media. Each concentration was set up in triplicate wells. After 48 hr cells were pulsed with 1 μCi of 3[H]- thymidine for 16 hr and then harvested for counting on a Beta plate scintillation counter (WALLAC). Data were represented as mean CPM in triplicate wells. Culture supernatants were collected after 48 hr and analyzed for IFN-γ by standard ELISA as described previously. Nicholson LB et al. (1995) Immunity 3:397-405. Flow cytometric analysis and Western blotting. Surface expression of MYC on HEK293T cells transfected with MYC-tagged liCTLA-4 was monitored by staining transfected cells with FITC-conjugated goat anti-MYC antibody (Santa Cruz). flCTLA-4 expression in T cells infected with retrovirus was detected using PE-anti-CTLA-4 antibody (4F10, Pharmingen). CD4+ cells were enriched using an R&D T cell column (R&D Systems, Minneapolis, MN). Naϊve and memory T cells within the CD4-enriched T-cell population of e vivo harvested spleen cells were stained with FITC-anti-CD4 (Pharmingen) and PE-anti-CD45RB (Phanningen). FACS analysis and sorting was performed on a Becton Dickinson FACScaliber flow cytometer. Use of T cells from TKO mice was considered crucial for analysis of these experiments, since the TKO mice lack endogenous isoforms of either flCTLA-4, sCTLA-4 or liCTLA-4 which may otherwise interfere with the functional activity of exogenously introduced liCTLA-4 or flCTLA-4. Furthermore, because both B7 molecules are absent in TKO cells, TKO mice provide a source of naϊve T cells as compared to those in CTLA-4" " mice which have an activated phenotype. CD28 is constitutively expressed in TKO T cells, so this allowed dissection of the interplay of CTLA-4 isoforms with CD28/T-cell receptor (TCR) signals. T cells from double knockout (DKO) mice, which lack B7.1 and B7.2 but express CTLA-4, were infected with empty retrovirus and used as positive controls for endogenous CTLA-4 expression and function. Infected CD3+ T cells were monitored for GFP expression (used as a surrogate marker for expression levels of either flCTLA-4 or liCTLA-4 protein) by flow cytometry as shown in FIG. 2A and sorted based on GFP expression. Surface expression of flCTLA-4 could be confirmed with an anti-CTLA-4 antibody by surface staining of TKO T cells infected with retrovirus expressing flCTLA-4 (FIG. 2A, right panel). However, surface expression of
liCTLA-4 could not be confirmed by flow cytometry because of the lack of an appropriate antibody which can detect only liCTLA-4. Therefore, expression of liCTLA-4 and flCTLA-4 protein in the GFP-positive cells was confirmed by Western blot analysis (FIG. 2B). The GFP -positive sorted T cells expressing flCTLA-4 of liCTLA-4 were tested for functional activity by in vitro activation with varying concentrations of soluble anti-CD3 in presence of antigen-presenting cells from wild type BALB/c mice. As expected, DKO T cells infected with empty retrovirus or the TKO T cells infected with retrovirus containing flCTLA-4 showed lower proliferation and IFN-γ production when compared to TKO T cells infected with empty retrovirus. The liCTLA-4 that completely lacks an extracellular IgV domain required for interaction with B7 molecules was found equally capable of inhibiting T cell responses as flCTLA-4, both in terms of proliferation in IFN-γ secretion (FIG. 2C and D). The decrease in proliferation in liCTLA-4 or flCTLA-4 infected T cells was shown not to be due to cell death of the retro virally infected calls. Thus even though liCTLA-4 lacks a B7 ligand binding domain, it can still function as an attenuator of T cells similar to flCTLA-4.
Example 5. Enhanced Expression ofliCTLA-4 Transcripts in the Effector or Antigen- Experienced CD4+ T Cells of Autoimmune-Resistant Mice. mRNA expression of flCTLA-4 is low in naϊve T cells and increased in activated and memory/regulatory T cells. Alegre ML et al. (1996) J Immunol 157:4762-70; Lindsten T et al. (1993) J Immunol 151 :3489-99; Read S et al. (2000) JExp Med 192:295-302. We wanted to determine relative expression of mRNA transcripts for flCTLA-4 vs. liCTLA-4 in naϊve vs. memory/regulatory T cells. Furthermore, we wanted to determine whether the expression differs between autoimmune-susceptible and resistant strains of mice. For this purpose, we compared the expression of flCTLA-4 and liCTLA-4 in naϊve and memory/regulatory T cells of two autoimmune-susceptible (NOD and SJL) and resistant (B6.H2g7 and B10.S) strains of mice. We used real-time (TaqMan) RT-PCR to determine mRNA levels for flCTLA-4 and li CTLA-4 in the naϊve and memory/regulatory T cells of these four strains of mice. We sorted peripheral T cells from these mice into naϊve (CD4+CD45RBhlgh) and memory/regulatory (CD4+CD45RBlow) T cells based on the CD45RB phenotype. Real-time (TaqMan) RT-PCR. Total mRNA was isolated from cells using the RNeasy Mini Kit (Qiagen, Santa Clarita, CA). mRNA (2-3 μg) were digested with DNase I (Gibco- Invitrogen) and transcribed to cDNA with oligo d(T)16 primers and random hexamers using
the TaqMan Reverse Transcription Reagents according to manufacturer's instructions (Applied Biosystems). Quantitative real-time polymerase chain reaction was performed on an ABI Prism 7700 Sequence Detection System (Perlcin Elmer, Foster City, CA) using cDNA as template. Amplification of GAPDH was used for sample normalization in a multiplex RT- PCR approach (TaqMan Rodent GAPDH Control Reagents, Applied Biosystems). The amplification followed the protocol of the TaqMan Gold RT-PCR kit. For detection of liCTLA-4 and full-length CTLA-4, as well as GAPDH transcripts, oligonucleotides were used at final concentrations of 300 nM for forward and reverse primers and 200 nM for the fluorogenic probes as follows:
flCTLA-4: Forward: ACTCATGTACCCACCGCCATA (SEQ ID NO:24) Reverse: GGGCATGGTTCTGGATCAAT (SEQ ID NO:25) Probe: CATGGGCAACGGGACGCAGATTTAT (SEQ ID NO:26) liCTLA-4: Forward: GCCTTTTGTAGCCCTGCTCA (SEQ ID NO:27) Reverse: TCAGAATCCGGGCATGGTT (SEQ ID NO:28) Probe: TTCTTTTCATCCCAGTCTTCTCTGAAGATCCA (SEQ ID NO:29)
ΔCt values were obtained by calculating a difference in threshold cycle of amplification (Ct) values of liCTLA-4 versus GAPDH for each well ( t TLAXctGAPOH). Q yalue_ were determined by normalization of average ΔCt values of triplicates to average ΔCt values of no template control (NTC) triplicates (ΔCt-ΔCtNTC). Relative levels were calculated from the ratio of the liCTLA-4 and flCTLA-4 values normalized to GAPDH mRNA using the fonnula
As expected, expression of both CTLA-4 isoforms was very low in the naϊve CD4+CD45RBhlgh T cells (FIG. 3). However, there was a significantly higher expression of both flCtla-4 and liCTLA-4 in the CD4+CD45RBlow cells. On comparing the mRNA transcript levels of liCTLA-4 in the CD4+CD45RBlow cells between the autoimmune- resistant strains and autoimmune-susceptible strains, it was evident that the autoimmune- resistant strains expressed a much higher level of liCTLA-4 than the autoimmune-susceptible strains. FIG. 3 A shows that the relative amplification of the liCTLA-4 mRNA with respect
to glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a housekeeping gene, proceeded earlier in the autoimmune-resistant strains than the susceptible strains. This data, when expressed as a ratio of mRNA transcript levels of liCTLA-4 to that of GAPDH, showed that the level of liCTLA-4 mRNA transcripts in the CD4+CD45RBlow cells of autoimmune- resistant strains was approximately four times higher than that expressed in autoimmune- susceptible strains. No significant difference in the level of mRNA transcript for flCTLA-4 was observed among the four different strains of mice, in either the CD45RBlow or CD45RBWgh T cell populations (FIG. 3B). It is possible that there is a difference in the mRNA expression levels of CTLA-4 isoforms in the CD4+CD45RBh,gl7naϊve cells as well, but the current assay system was not sensitive enough to detect this. These data show that there is enhanced expression of li CTLA-4 transcripts in the effector or antigen-experienced CD4+ T cells of autoimmune-resistant B10.S and B6.H2g7 mice. The differential expression of liCTLA-4 between the autoimmune-susceptible and resistant strains has been suggested to be regulated by the SNP in exon 2 of CTLA-4 gene which shows genetic linkage to diabetes susceptibility in the NOD mice. It is possible that the higher level of liCTLA-4 expressed in memory/effector CD4+ T cells of autoimmune- resistant strains prevents clonal expansion of autoreactive memory/effector CD4+ T cells to signals delivered by self antigens. Memory T cells, which by virtue of having low threshold requirements for activation, have been shown to respond to weak TCR signals even in the absence of essential costimulatory signals. Metz DP et al. (1998) J Immunol 161:5855-61. Thus enhanced expression of liCTLA-4 may limit reactivation of autoreactive memory/effector CD4+ T in vivo. Alternatively, since the CD4+CD45RBlow population is known to contain CD4+CD45RBlowCD25high T regulatory cells (Read S et al. (2000) JExp Med 192:295-302), genetically controlled levels of liCTLA-4 in CD4+CD45RBlow T cells could influence the development or activity of these cells. Thus, increased expression of liCTLA-4 in the CD4+CD45RBlow cells in autoimmune disease resistant mice may result in enhanced regulatory T cell function.
Example 6. Exon 2 SNP Appears to Regulate Susceptibility to Autoimmune Disease. The Idd5 locus on mouse chromosome 1, which includes the CTLA-4 and ICOS costimulatory molecules, has previously been shown to have linkage with diabetes susceptibility in NOD mice. Hill NJ et al. (2000) Diabetes 49:1744-7; Lamhamedi-Cherradi
SE et al. (2001) Diabetes 50:2874-8. Recent evidence shows that this linkage maybe due to a SNP in exon 2 that regulates expression of liCTLA-4. Since many of the Idd loci overlap with the susceptibility loci of another autoimmune disease, experimental autoimmune encephalomyelitis (EAE; Encinas JA et al. (1996) J Immunol 157:2186-92), we explored the possibility that both EAE and diabetes are influenced by the genetically-controlled novel li CTLA-4 isoform. We compared the nucleotide sequence of the coding domain of CTLA-4 between the H2S matched, EAE-susceptible SJL/J and resistant B10.S mouse strains with that of diabetes-susceptible NOD and resistant C57BL/6 strain. We found that the exon 2 SNP which showed linkage to diabetes susceptibility also differed between the EAE-susceptible SJL/J and resistant B10.S mouse strains. The nucleotide sequence of CTLA-4 in the EAE- susceptible SJL/J strain and diabetes-susceptible NOD strain had a G allele at position 186, while the EAE- and diabetes-resistant B10.S and C57BL/6 strain carried an A allele at position 186. The presence of a G allele at position 186 in the diabetes-susceptible NOD strain has been shown to result in the inclusion of exon 2 forming flCTLA-4 mRNA and a reduction of the exon 2 negative transcript that encodes liCTLA-4. Hence it is possible that the exon 2 SNP which shows linkage to diabetes susceptibility in the NOD mice may also determine susceptibility to EAE in the SJL/J and B10.S mouse strains by regulating levels of liCTLA-4.
Example 7. Exon 2 SNP Appears to Regulate Level of Expression ofliCTLA-4. A literature survey and DNA sequence comparison indicated that the mouse CTLA-4 exon 2 SNP is the probable genetic cause of the variation in li CTLA-4 mRNA levels (FIG. 4). In the human CD45 gene, substitution of the wild-type C allele with a mutant G allele by a SNP at base 77 of exon 4 reduced the function of an exonic splicing silencer (ESS) embedded in the exon 4 DNA sequence, resulting in alteration of the relative levels of functionally distinct isoforms of this important T-cell differentiation molecule. Lynch KW et al. (2001) JBiol Chem 276:24341-7. Comparison of the human CD45 gene exon 4 sequence and CTLA-4 gene exon 2 sequence, and their mouse and rat orthologues, identified the conserved wild-type sequence CNNNTGNATNNNCACC(A/C)NCANNCANCNNTGA (SEQ ID NO:30) (see FIG. 4). marked similarity to the human CD45 exon 4 SNP, the mouse Ctla-4 exon 2 SNP has an A at position 77 in the diabetes-resistant strains B10 and B6, whereas the NOD strain carries the mutant G allele. The G allele would lead to an
increase in the inclusion of exon 2, forming flCTLA-4 mRNA, and therefore a reduction of the exon 2-negative transcript that encodes li CTLA-4. Eight of the conserved 18 nucleotides in this 31 -base pair (bp) region differed in human Ctla-4, which probably accounts for our inability to detect the liCTLA-4 transcript in human T cells. The rat Ctla-4 exon 2 sequence differed only by two nucleotides among the conserved 18 compared to the mouse sequence, at positions 75 and 77: both are T nucleotides versus C and A or C in ESS wild-type sequences (FIG. 4). Rat spleen was not observed to express detectable levels of the liCTLA-4 isoform, supporting a critical role for position 77 for the splicing efficiency of liCTLA-4. Mutational studies of an ESS in the late pre-mRNA or bovine papillomavirus type 1 and also sequence comparisons with the few other known ESSs have demonstrated the importance of this central CCCCC nucleotide sequence.
Equivalents All of the references, patents and patent publications identified or cited herein are incorporated in their entirety by reference. Although this invention has been described with respect to specific embodiments, the details of these embodiments are not to be construed as limitations. Various equivalents, changes and modifications may be made without departing from the spirit and scope of this invention, and it is understood that such equivalent embodiments are part of this invention. We claim:
Claims
1. An isolated nucleic acid molecule that codes for a polypeptide comprising an amino acid sequence provided by SEQ ID NO:2 (murine liCTLA-4).
2. The isolated nucleic acid molecule of claim 1, wherein the isolated nucleic acid molecule has a sequence provided by SEQ ID NO: 1.
3. An isolated nucleic acid molecule that codes for a polypeptide comprising an amino acid sequence provided by SEQ ID NO:4 (human liCTLA-4).
4. The isolated nucleic acid molecule of claim 3, wherein the isolated nucleic acid molecule has a sequence provided by SEQ ID NO:3.
5. An expression vector comprising the isolated nucleic acid molecule of either one of claim 1 or claim 3, operably linked to a promoter.
6. A host cell comprising the expression vector of claim 5.
7. A pharmaceutical composition comprising the expression vector of claim 5 and a pharmaceutically acceptable carrier.
8. An isolated polypeptide comprising an amino acid sequence provided by SEQ ID NO:2.
9. An isolated polypeptide comprising an amino acid sequence provided by SEQ ID NO:4.
10. A method for inhibiting an immune response, comprising contacting a T lymphocyte with an effective amount of an agent that increases expression of liCTLA-4 to inhibit an immune response.
11. A method for inhibiting an immune response in a subject, comprising administering to a subject an effective amount of an agent that increases expression of liCTLA-4 to inhibit an immune response in the subject.
12. The method of claim 11 , wherein the subj ect has received or is about to receive an allograft.
13. A method for treating an autoimmune disease, comprising administering to a subject that has or is at risk of having an autoimmune disease an effective amount of an agent that increases expression of liCTLA-4 to treat the autoimmune disease.
14. The method of claim 13, wherein the autoimmune disease is chosen from diabetes mellitus and multiple sclerosis.
15. A method for screening for immune reactivity, comprising measuring expression of liCTLA-4 by a T cell; and determining immune reactivity of the T cell is (a) high when liCTLA-4 expression is low, and (b) low when liCTLA-4 expression is high.
16. A method for screening a subject for risk of having or developing an autoimmune disease, comprising measuring expression of liCTLA-4 by T cells of a subject; and determining the subject's risk of having or developing an autoimmune disease is (a) high when liCTLA-4 expression is low, and (b) low when liCTLA-4 expression is high.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/US2003/021290 WO2005014612A1 (en) | 2003-07-09 | 2003-07-09 | Novel splice variant of ctla-4 |
| AU2003259093A AU2003259093A1 (en) | 2003-07-09 | 2003-07-09 | Novel splice variant of ctla-4 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/US2003/021290 WO2005014612A1 (en) | 2003-07-09 | 2003-07-09 | Novel splice variant of ctla-4 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2005014612A1 true WO2005014612A1 (en) | 2005-02-17 |
Family
ID=34134588
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2003/021290 Ceased WO2005014612A1 (en) | 2003-07-09 | 2003-07-09 | Novel splice variant of ctla-4 |
Country Status (2)
| Country | Link |
|---|---|
| AU (1) | AU2003259093A1 (en) |
| WO (1) | WO2005014612A1 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1954836A4 (en) * | 2005-11-08 | 2010-09-22 | Avi Biopharma Inc | COMPOUND FOR IMMUNODEPRESSION AND PROCESSING METHOD |
| US8501704B2 (en) | 2005-11-08 | 2013-08-06 | Sarepta Therapeutics, Inc. | Immunosuppression compound and treatment method |
| US8642557B2 (en) | 2010-03-12 | 2014-02-04 | Abbvie Biotherapeutics Inc. | CTLA4 proteins and their uses |
| US20140242049A1 (en) * | 2011-10-26 | 2014-08-28 | National Cancer Center | Mutant ctla4 gene transfected t cell and composition including same for anticancer immunotherapy |
| WO2014179491A2 (en) | 2013-04-30 | 2014-11-06 | La Jolla Institute For Allergy And Immunology | MODULATION OF REGULATORY T CELL FUNCTION VIA PROTEIN KINASE C-η |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5773253A (en) * | 1993-01-22 | 1998-06-30 | Bristol-Myers Squibb Company | MYPPPY variants of CTL A4 and uses thereof |
| WO2001090122A2 (en) * | 2000-05-23 | 2001-11-29 | Genaissance Pharmaceuticals, Inc. | Haplotypes of the ctla4 gene |
-
2003
- 2003-07-09 WO PCT/US2003/021290 patent/WO2005014612A1/en not_active Ceased
- 2003-07-09 AU AU2003259093A patent/AU2003259093A1/en not_active Abandoned
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5773253A (en) * | 1993-01-22 | 1998-06-30 | Bristol-Myers Squibb Company | MYPPPY variants of CTL A4 and uses thereof |
| WO2001090122A2 (en) * | 2000-05-23 | 2001-11-29 | Genaissance Pharmaceuticals, Inc. | Haplotypes of the ctla4 gene |
Non-Patent Citations (2)
| Title |
|---|
| UEDA H. ET AL.: "Association of the T-cell regulatory gene CTLA4 with susceptibility to autoimmune disease", NATURE, vol. 423, 29 May 2003 (2003-05-29), pages 506 - 511, XP002681205, DOI: doi:10.1038/nature01621 * |
| VIJAYAKRISHNAN L. ET AL.: "Functional characterization of a novel splice variant of CTLA-4", FASEB, vol. 17, no. 7, April 2003 (2003-04-01), pages C179 * |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1954836A4 (en) * | 2005-11-08 | 2010-09-22 | Avi Biopharma Inc | COMPOUND FOR IMMUNODEPRESSION AND PROCESSING METHOD |
| US8501704B2 (en) | 2005-11-08 | 2013-08-06 | Sarepta Therapeutics, Inc. | Immunosuppression compound and treatment method |
| US8933216B2 (en) | 2005-11-08 | 2015-01-13 | Sarepta Therapeutics, Inc. | Immunosuppression compound and treatment method |
| US9487786B2 (en) | 2005-11-08 | 2016-11-08 | Sarepta Therapeutics, Inc. | Immunosuppression compound and treatment method |
| US8642557B2 (en) | 2010-03-12 | 2014-02-04 | Abbvie Biotherapeutics Inc. | CTLA4 proteins and their uses |
| US9587007B2 (en) | 2010-03-12 | 2017-03-07 | Abbvie Biotherapeutics Inc. | CTLA4 proteins and their uses |
| US20140242049A1 (en) * | 2011-10-26 | 2014-08-28 | National Cancer Center | Mutant ctla4 gene transfected t cell and composition including same for anticancer immunotherapy |
| US9688740B2 (en) * | 2011-10-26 | 2017-06-27 | National Cancer Center | Mutant CTLA4 gene transfected T cell and composition including same for anticancer immunotherapy |
| WO2014179491A2 (en) | 2013-04-30 | 2014-11-06 | La Jolla Institute For Allergy And Immunology | MODULATION OF REGULATORY T CELL FUNCTION VIA PROTEIN KINASE C-η |
| WO2014179491A3 (en) * | 2013-04-30 | 2015-06-04 | La Jolla Institute For Allergy And Immunology | MODULATION OF REGULATORY T CELL FUNCTION VIA PROTEIN KINASE C-η |
| EP2992086A4 (en) * | 2013-04-30 | 2016-12-07 | La Jolla Inst Allergy & Immunology | MODULATION OF THE REGULATORY FUNCTION OF T CELLS THROUGH A C-ETA PROTEIN KINASE |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2003259093A1 (en) | 2005-02-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2017268399B2 (en) | mRNA combination therapy for the treatment of cancer | |
| US20210189342A1 (en) | Compositions and methods for modulating monocyte and macrophage inflammatory phenotypes and immunotherapy uses thereof | |
| Vijayakrishnan et al. | An autoimmune disease-associated CTLA-4 splice variant lacking the B7 binding domain signals negatively in T cells | |
| KR102301464B1 (en) | Methods and compositions for reducing immunosupression by tumor cells | |
| KR101600225B1 (en) | Methods and compositions for the treatment of persistent infections and cancer by inhibiting the programmed cell death 1 (pd-1) pathway | |
| EP1351702B1 (en) | Trem-1 splice variant for use in modifying immune responses | |
| US6242427B1 (en) | Methods of inhibiting phagocytosis | |
| US20030148445A1 (en) | TALL-1 nucleic acid molecules, proteins, receptors and methods of use thereof | |
| JP2007191489A (en) | Use of b7-h3 as immune regulator | |
| US20080199467A1 (en) | Immunoglobulin fusion proteins and methods of making | |
| JP2002517977A (en) | NTN-2 member of the TNF ligand family | |
| Chang et al. | Role of the B7-CD28/CTLA-4 pathway in autoimmune disease | |
| KR20220139926A (en) | artificial synapse | |
| US20090297563A1 (en) | Diagnosis And Treatment of Immune-Related Diseases | |
| US20040072259A1 (en) | Methods and products for manipulating hematopoietic stem cells | |
| US20160115218A1 (en) | Anti-Sense Oligonucleotides Targeted Against Exon 9 of IL-23R-alpha Gene and Method of Using Same to Induce Exon Skipping and to Treat Inflammatory Bowel Diseases | |
| WO2005014612A1 (en) | Novel splice variant of ctla-4 | |
| WO2022234063A9 (en) | Method for constitutive malt1 protease activation | |
| JP2006290848A (en) | Composition for regulating T cell receptor function and screening method thereof | |
| US20190240327A9 (en) | Manipulation of regulatory t cell and dc function by targeting neuritin gene using antibodies, agonists and antagonists | |
| AU2026202687A1 (en) | Compositions and methods for modulating monocyte and macrophage inflammatory phenotypes and immunotherapy uses thereof | |
| Shiraishi et al. | This information is current as Lupus Erythematosus T Cells | |
| Wu | T cell deficiencies resulting from aberrant pre-mRNA alternative splicing caused by a novel splicing silencer hnRNP LL in an ENU mutant mouse strain thunder | |
| Wong | Regulatory mechanisms of immune function: Class II transactivator expression in T lymphocytes and the role of plexin-A1 in dendritic cells | |
| WO2001021816A1 (en) | MODULATION OF IgE RECEPTOR CELL SURFACE EXPRESSION |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AU CA JP |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| 122 | Ep: pct application non-entry in european phase | ||
| NENP | Non-entry into the national phase |
Ref country code: JP |