WO2005012514A1 - Novel sphinogmyelinase, the antibody against it, the antisense and the preparation method thereof - Google Patents

Novel sphinogmyelinase, the antibody against it, the antisense and the preparation method thereof Download PDF

Info

Publication number
WO2005012514A1
WO2005012514A1 PCT/KR2003/001548 KR0301548W WO2005012514A1 WO 2005012514 A1 WO2005012514 A1 WO 2005012514A1 KR 0301548 W KR0301548 W KR 0301548W WO 2005012514 A1 WO2005012514 A1 WO 2005012514A1
Authority
WO
WIPO (PCT)
Prior art keywords
smase
antisense
ceramide
hsp60
activity
Prior art date
Application number
PCT/KR2003/001548
Other languages
French (fr)
Inventor
Dae-Kyong Kim
Sung-Yun Jung
Sang-Mi Jung
Kwang-Mook Jung
Eui-Man Jung
Original Assignee
Dae-Kyong Kim
Sung-Yun Jung
Sang-Mi Jung
Kwang-Mook Jung
Eui-Man Jung
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dae-Kyong Kim, Sung-Yun Jung, Sang-Mi Jung, Kwang-Mook Jung, Eui-Man Jung filed Critical Dae-Kyong Kim
Priority to AU2003247216A priority Critical patent/AU2003247216A1/en
Priority to PCT/KR2003/001548 priority patent/WO2005012514A1/en
Publication of WO2005012514A1 publication Critical patent/WO2005012514A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/04—Phosphoric diester hydrolases (3.1.4)
    • C12Y301/04012—Sphingomyelin phosphodiesterase (3.1.4.12)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)

Definitions

  • the present invention relates to a novel sphingomyelinase, the separation and purification method thereof, specifically relates to a novel sphingomyelinase isolated and purified by preparation method of the present invention and a composition
  • SM sphingomyelin
  • N-SMase Neutral-sphingomyelinase
  • N-SMasel was further identified as a lyso-platelet activating factor (Lyso-PAF) phospholipase C (PLC) rather than a SMase (Sawai, H., et al.; J. Biol. Chem. 274,
  • N-SMase2 activity was not inhibited by 10 mM glutathione (GSH), which has been known to inhibit most of the previously described N-SMases.
  • GSH glutathione
  • TNF- ⁇ is known as a candidate neurotoxin contributing to the brain pathogenesis (Robertson, J., et al.; J. Cell. Biol. 155, pp217-226, 2001; Talley, A. K., et al.; Mol. Cell. Biol. 15, pp2359-66, 1995; Sairanen, T. R., et al.; J. Neurol. Sci. 186, pp87-99, 2001), but the underlying mechanisms are not fully understood. Recent evidence is accumulating that N-SMase plays a crucial role in signaling cell death induction by
  • N-SMase ⁇ a 60 kDa membrane-associated, neutral and Mg 2+ - dependent SMase, termed N-SMase ⁇ , from mammalian brains, which was revealed as the heat shock protein 60 (HSP60) was identified and the antibody against it and the antisense was prepared. And the present invention has been completed by confirmimg that SMase mediates TNF- ⁇ -induced neuronal apoptosis through the production of ceramide.
  • HSP60 heat shock protein 60
  • the present invention provides a novel sphingomyelinase, antibody against it,
  • antisense thereof and anticancer agent or anti-inflammatory drug to control the production of ceramide related to apoptosis and inflammation.
  • SMase which is characterized in having 60 kDa of M.W. and membrane-associated, neutral and Mg 2+ -dependent activity originated from mammalian cell.
  • SMase acts on sphingomyelin (SM) to produce ceramide and a novel SMase of the present invention is designated as N-SMase ⁇ .
  • the inventive N-SMase ⁇ can be separated and purified by the preparation method comprising the step consisting of; (step 1) collecting "ammomum sulfate extract" using as enzyme source for the purification of N-SMase ⁇ by homogenizing bovine brain in homogenizing buffer, centrifuging and removing the cell debris and nuclear thereof, centrifuging again and obtaining pellet, resuspending and vortexing the pellet in ammonium sulfate buffer and centrifuging to obtain supernatant "ammonium sulfate extract”; (step 2) applying the ammonium sulfate extracts to a DEAE-cellulose column and eluting with buffer comprising ammonium sulfate and Triton X-100 to obtain the active fraction; (step 3) applying the active fractions of step 2 to Butyl-Toyopear
  • step 5 applying the active fractions of step 4 to phenyl-5PW HPLC and eluting with 3° distilled water to obtain the active fraction; (step 6) applying the active fractions of step 5 to Mono S cationic exchange HPLC and eluting with buffer comprising sodium chloride and Triton X-100 to obtain the active fraction.
  • step 5 applying the neutral SMase was intensively purified to ⁇ 38,000-fold purification with
  • Inventive SMase ⁇ prepared through mono S cationic exchange HPLC is separated into 4 spots in two-dimensional SDS-PAGE protein profile.
  • N-SMase ⁇ Lineweaver-Burk plot for purified N-SMase ⁇ was linear with an apparent K m of 47 ⁇ M and a V max of >4,800 nmol/min/mg.
  • the N-SMase ⁇ shows the higher substrate specificity for sphingomyelin by over 50-fold, the Mg 2+ -dependent activity and is highly
  • N-SMase ⁇ activity is increased at the glutathione concentration up to 3mM but gradually decreased with a complete inhibition at lOmM, whereas DTT and 2- mercaptoethanol as other reducing agents have no effect on the enzyme activity. It is another object of the present invention to provide a novel neutral SMase which is associated with the membrane and originated from mammalian cell. And further, it is another object of the present invention to provide an active fraction
  • membrane associated, neutral SMase activity which is purified by the method comprising steps of; homogenizing the mammalian brain cell, solublizing the homogenate with ammonium sulfate or triton X-100 and performing several
  • N-SMase ⁇ is increased and thereby increased
  • N-SMase ⁇ mediates the TNF- ⁇ induced neuronal apoptosis through the ceramide
  • N-SMase ⁇ N-SMase ⁇ . It is another object of the present invention to provide a pharmaceutical composition comprising N-SMase ⁇ as an active ingredient for preventing and treating cancer diseases caused by abnormal cell proliferation, together with a pharmaceutically acceptable carrier. It is still another object of the present invention to provide the use of N-SMase ⁇ for
  • cancer disease comprises lung cancer, non-small cell lung cancer, colon cancer, bone cancer, pancreatic cancer, skin cancer, head cancer or neck cancer, skin or endophthal melanoma, uterine carcinoma, ovarian cancer, rectal cancer, stomach
  • cancer peri-anal cancer
  • breast cancer tubal(fallopian) cancer
  • endometrial cancer endometrial cancer
  • cervical cancer virginal cancer, vulva cancer, Hodgkin's disease, esophageal cancer, small intestinal cancer, endocrine gland cancer, tyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcomas, urethral cancer, penile cancer, prostate cancer, chronic and acute leukemia, lymphoma, bladder cancer, kidney cancer or hydroureter
  • N-SMase ⁇ antibody against inventive N-SMase ⁇ It is further another object of the present invention to provide an antisense having inhibiting activity of the expression of N-SMase ⁇ and N-SMase ⁇ antibody.
  • Inventive N-SMase ⁇ antibody can specifically bind to inventive N-SMase, HSP60 and it can be prepared by the method comprising the steps of; isolating the protein as an antigen from the gel of active fractions by phenyl-5PW HPLC during purification; mixing the protein with adjuvant; injecting the mixture into mice; and collecting serum from the blood.
  • mouse anti-serum against 60kDa protein can be prepared and two monoclonal antibodies, i.e., SMI A5 and SM1E1 can be prepared therefrom.
  • Antisense for N-SMase ⁇ is the sequences inhibiting the mRNA expression of hsp60 gene and it can be designed by the conventional method well known in the art.
  • Preferred antisense comprises at least one selected from the group consisting of A-ODN 5'-
  • si-HSP60 sense 5'-UGCUCACCGUAAGCCUUUGdTdT-
  • N-SMase ⁇ antibody, HSP60 antibody or hsp60 siRNA treatment can reduce the expression & activity of N-SMase ⁇ and ceramide production, finally they can be useful for the prevention and treatment of ceramide-causing diseases.
  • a pharmaceutical composition comprising N-SMase ⁇ antibody or N-SMase ⁇ antisense as an active ingredient for prevention and treatment of inflammatory disease caused by the disorder of ceramide reproduction, together with a pharmaceutically acceptable carrier.
  • N-SMase ⁇ antibody or N-SMase ⁇ antisense for the preparation of therapeutic agent for treatment and prevention of inflammatory disease caused by the disorder of ceramide reproduction.
  • Inventive N-SMase ⁇ , N-SMase ⁇ antibody or N-SMase ⁇ antisense shall be useful for the study to elucidate the mechanism of cancer disease and inflammatory disease.
  • the expression, function and control mechanism of inventive N-SMase ⁇ are revealed, the pathway of metabolites produced by N-SMase ⁇ and the pathogenesis thereby can be clearly found out.
  • N-SMase ⁇ activity is reduced or inactivated by generating the mutation in N-SMase ⁇ , the disease caused by N-SMase ⁇ can be diagnosed, prevented and treated.
  • Inventive N-SMase ⁇ shall be useful for the physiological study of said enzyme and ceramide.
  • the composition comprising inventive N-SMase ⁇ , N-SMase ⁇ antibody or N-SMase
  • inventive composition comprising inventive N-SMase ⁇ , N-SMase ⁇ antibody or N-SMase ⁇ antisense may additionally comprise conventional carrier, adjuvants or diluents in accordance with a using method. It is preferable that said carrier is used as appropriate substance according to the usage and application method, but it is not limited. Appropriate diluents are listed in the written text of Remington's Pharmaceutical Science (Mack Publishing co, Easton PA).
  • composition according to the present invention can be provided as a pharmaceutical composition containing pharmaceutically acceptable, carriers, adjuvants or diluents, e.g., lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starches, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate and mineral oil.
  • pharmaceutically acceptable, carriers, adjuvants or diluents e.g., lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starches, acacia rubber, alginate, gelatin, calcium phosphate, calcium si
  • the formulations may additionally include fillers, anti-agglutinating agents, lubricating agents, wetting agents, flavoring agents, emulsifiers, preservatives and the like.
  • the compositions of the invention may be formulated so as to provide quick, sustained or delayed release of the active ingredient after their administration to a patient by employing any of the procedures well known in the art.
  • the compositions of the present invention can be dissolved in oils, propylene glycol or other solvents, which are commonly used to produce an injection. Suitable examples of the carriers include physiological saline, polyethylene glycol, ethanol, vegetable oils, isopropyl myristate, etc., but are not limited to them.
  • the compounds of the present invention can be formulated in the form of ointments and creams. Pharmaceutical formulations containing composition may be prepared in any form,
  • oral dosage form such as oral dosage form (powder, tablet, capsule, soft capsule, aqueous medicine, syrup, elixirs pill, powder, sachet, granule), or topical preparation (cream, ointment, lotion, gel, balm, patch, paste, spray solution, aerosol and the like), or injectable preparation (solution, suspension, emulsion).
  • composition of the present invention in pharmaceutical dosage forms may be used in the form of their pharmaceutically acceptable salts, and also may be used alone or in appropriate association, as well as in combination with other pharmaceutically active compounds.
  • the desirable dose of the inventive enzyme or composition varies depending on the condition and the weight of the subject, severity, drug form, route and period of administration, and may be chosen by those skilled in the art. However, in order to obtain desirable effects, it is generally recommended to administer at the amount ranging 0.001-lOOmg/kg by weight/day of the inventive enzyme of the present invention.
  • the dose may be administered in a single or multiple doses per week.
  • the pharmaceutical composition of the present invention can be administered to a subject animal such as mammals (rat, mouse, domestic animals or human) via various routes. All modes of administration are contemplated, for example, administration can
  • intravenous, intramuscular, subcutaneous, intracutaneous, intrathecal, epidural or intracerebro ventricular injection may be made orally, rectally or by intravenous, intramuscular, subcutaneous, intracutaneous, intrathecal, epidural or intracerebro ventricular injection.
  • Fig. 1 shows a two-dimensional electrophoresis protein profile of the active fractions purified from bovine brain
  • Fig. 2 presents the effect of inventive N-SMase ⁇ on the sphingomyeline(SM) and ceramide of cortical neuron
  • Fig. 3 presents the inventive N-SMase ⁇ activity in the presence of GSH, DTT or 2- mercaptoethanol
  • Fig. 4 shows the cellular or tissue distribution of inventive N-SMase ⁇
  • Fig. 5 shows the distribution of inventive N-SMase ⁇ in neuronal and non-neuronal cell
  • Fig. 6 presents the inventive N-SMase ⁇ activity change by rat anti-HSP60 antibody;
  • Fig. 7 exhibits the immuno-precipitation analysis using rat HSP60 antibody and bead
  • Fig. 8 represents the two-dimensional electrophoresis and silver staining of the protein immunoprecipitated with HSP60 antibody
  • Fig. 9 shows the immunoblot analysis of the protein obtained from the immunoprecipitation and two-dimensional electrophoresis
  • Fig. 10 shows the HSP60 protein expression and the SMase activity in the pcDNA3-
  • Fig. 11 represents the HSP60 protein expression and the SMase activity in the pcDNA3-HSP60 transfected and sense/antisense treated cell
  • Fig. 12 represents the HSP60 protein expression and the SMase activity in the
  • Fig. 13 shows the normal cortical neuron cell and TNF- ⁇ treated cortical neuron cell
  • Fig. 14 shows the N-SMase ⁇ specific activity according to the time in the TNF- ⁇ treated cortical neuron cell
  • Fig. 15 presents the immunoblot analysis with the inventive N-SMase ⁇ antibody in the TNF- ⁇ treated cortical neuron cell
  • Fig. 16 represents the change of amount of ceramide and SM, and the effect of FBI on ceramide and SM in the TNF- ⁇ treated cortical neuron cell.
  • N-SMase activity analysis The substrate, [N-methyl- 14 C]SM (labeled with 14 C on the choline moiety), was dried under nitrogen stream and resupended in ethanol.
  • the standard incubation system (100 ⁇ l) for assay of N-SMase activity contained 10 mM MgSO 4 , 50 ⁇ M [N-methyl- 14 C]SM (approximately 60,000 cpm), 2 mM sodium deoxycholate (SDC) and 100 mM Tris-HCl, pH 7.0.
  • Reactions were carried out at 37 ° C for 30 min and stopped by adding 320 ⁇ l of chloroform/methanol (1:1, by volume) and 30 ⁇ l of 2 N-HC1 into the reaction mixture according to Bligh & Dyer's method (Bligh, E.G. & Dyer, W.A; J. Can. J. Biochem. Biophysiol, 37, pp680-685, 1970). After vortexing, the mixtures were micro- centrifuged to separate the two phases.
  • [ 3 H]ceramide produced from [ 3 H]SM of rat cortical neuronal cells labeled with [ 3 H]serine as substrates To label sphingolipid, the neuronal cells (1 x 10 6 cells) were labelled for 72 hrs in the presence of 1.0 ⁇ Ci/ml [ Hjserine and washed with Tris- buffered saline. Cells were lysed and lipids were extracted by the solvent mixture of CHC1 3 : MeOH : 2N-HC1 (100 : 100 : 1, by volume). Total lipids were dried and resuspended in ethanol. The lipids were used as a substrate for assay of SMase activity by analyzing SM degradation and ceramide production.
  • the assay system (100 ⁇ l) for the SMase activity contained the active fractions obtained from the final step of Mono S column chromatography, purified from bovine brain as below as the enzyme sources, 100 mM Tris-HCl, pH 7.0, 5 mM MgCl 2 , 2 mM sodium deoxycholate, and the substrate (18,520 cpm). After incubation for 1 hr at 37°C, according to Bligh & Dyer's method, the reaction was stopped by adding 320 ⁇ l of CHC1 3 : MeOH (1 : 1, by volume) and 30 ⁇ l of 2N-HC1. The mixture was vortexed and microcentrifuged to separate the two phases.
  • Example 1 Purification of N-SMase ⁇ a membrane-associated Mg 2+ -dependent N-SMase, from bovine brain
  • N-SMase ⁇ a salt-extractable form of the membrane-bound N-mSMase
  • a salt-extractable form of the membrane-bound N-mSMase was purified as follows.
  • fresh bovine brain (5 kg) kept at -70 ° C was homogenized with 5 volumes (25 liters) of homogenizing buffer V (50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 3 mM MgCl 2 , 50 mM KC1, and 10 mM 2-mercaptoethanol) with a Polytron homogenizer (Model PT-MR 6000, Kinematica, Switzerland).
  • homogenizing buffer V 50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 3 mM MgCl 2 , 50 mM KC1, and 10 mM 2-mercaptoethanol
  • the homogenate was centrifuged at 10,000 x g for 10 min to remove the cell debris and nuclei.
  • the resulting supematants were again centrifuged at 10,000 x g at 4 ° C for lhr.
  • the resulting 10,000 x g pellets were resuspended with 2.5 liters of buffer V and centrifuged at 40,000 x g at 4°C for lhr.
  • the resulting 40,000 x g pellets were again resuspended with 2.5 liters of buffer V, adjusted
  • ammonium sulfate extracts were collected and used as the enzyme source for the purification of N-SMase ⁇
  • Step 2 The ammonium sulfate extracts (2.5 liters) were applied to a DEAE-Cellulose column (bed volume of DE52 gel, 2.0 liters) pre-equilibrated with buffer D (25 mM Tris-HCl, pH 7.5, 1 mM EDTA, and 10 mM 2-mercaptoethanol). The protein bound to the column was eluted at a flow rate of 20 ml/min with a stepwise application of buffer D containing 0.5 M (NH 4 ) 2 SO 4 and 0.1% Triton X-100. An aliquot (10 ⁇ l) of each fraction (40 ml) was assayed for N-mSMase activity.
  • buffer D 25 mM Tris-HCl, pH 7.5, 1 mM EDTA, and 10 mM 2-mercaptoethanol.
  • the protein bound to the column was eluted at a flow rate of 20 ml/min with a stepwise application of buffer D containing 0.5 M (
  • Step 3 Butyl-Tovopearl column chromatography (Step 3) The active fractions were pooled, sonicated at 4°C with a cell disruptor (Sonics & Materials Inc., Danbury, CT, USA) six times for 3 sec with 5 sec intervals at an output setting of amplitude 70% and centrifuged at 100,000 x g at 4°C for lhr. An aliquot of
  • DEAE-5PW HPLC (Step 4) The active fractions were pooled and applied to a DEAE-5PW HPLC column (21.5 mm x 15 cm, Tosoh Co., Tokyo, Japan) previously equilibrated with buffer D. The protein bound to the column was eluted at a flow rate of 5 ml/min with a 200 ml-linear gradient of buffer D containing 0.5 M (NH 4 ) 2 SO 4 and 0.1% Triton X-100 as an elution buffer. An aliquot (3 ⁇ l) of each fraction (5 ml) was assayed for N-mSMase activity.
  • Phenyl-5PW HPLC (Step 5) The active fractions were pooled and applied to a Phenyl-5PW T HPLC column (21.5 mm x 15 cm, Tosoh Co., Tokyo, Japan) previously equilibrated with buffer D containing 0.2 M (NH ) 2 SO 4 . The protein bound to the column was eluted at a flow rate of 5 ml/min with a 200 ml-gradient elution of distilled water.
  • N-SMase ⁇ was intensively purified from a salt-extract of bovine brain membrane to near homogeneity with 1.3% yield and -38,000-fold purification with six cl romatographic steps
  • SDS-Polvacrylamide gel electrophoresis SDS-PAGE One-dimensional denaturing SDS-PAGE was performed on 10% polyacrylamide gels according to Laemmli's procedure (laemmli, U.K.; Nature, 227, pp680-685, 1970) in a Bio-Rad Protean II electrophoresis system. Two-dimensional gel electrophoresis was performed according to O'Farrell (O'Farrell, P. H.; J. Biol. Chem., 250, ⁇ p4007-4021, 1975) using the IPG-phor (Amersham Pharmacia Biotech, Uppsala, Sweden) system according to the instructions of the manufacturer. The separated proteins were stained
  • Protein peptide fingerprinting analysis was performed as described previously (Park, J.B. et al.; J. Biol. Chem., 275, pp21295-21301, 2000). Briefly, the 42 kDa spot was stained with Coomasie brilliant blue and excised from a two-dimensional electrophoresis gel and digested with trypsin. 1 ⁇ l aliquot of the total digest (total volume 30 ⁇ l) was used for peptide mass fingerprinting. The masses of the tryptic peptides were measured with a Bruker Reflex III mass spectrometer.
  • MALDI- TOF Mass-assisted laser desorption/ionization time-of-flight
  • Enzyme kinetics is a method for calculating K m , N max and the velocity in the reaction
  • the enzyme showed the higher specificity for SM by >50-fold for the substrates ⁇ -[methyl- 14 C]sphingomyelin (SM), l,2-dipalmitoyl-3-phosphatidyl[N- mehtyl- 3 H]choline (DPPC), l-stearoyl-2-arachidonoyl--s , n-glycero-3-phospho[2- 3 H]inositol (PI), l,2-dioleoyl-3- ⁇ hos ⁇ hatidyl[3- 14 C]serine (PS), l-stearoyl-2-[l- 14 C]arachidonoyl-GPC (2-AA-PC), l-acyl-2-[l- 14 C]arachidonoyl-GPE (2-AA-PE). Furthermore, the purified N-SMase ⁇ were incubated with the cortical neuronal membranes metabolically biosynthesized from [ 3 H]serine.
  • N-SMase ⁇ may be the most sensitive to the depletion of intracellular GSH.
  • N-SMase ⁇ absolutely required Mg 2+ ions in the assay and its activity stimulated by Mg 2+ were affected by various cations.
  • Ca 2+ had no effect at up to 0.5 mM, whereas Cu 2+ , Zn 2+ , and Fe 2+ potently inhibited the activity with an IC 50 of about 28 ⁇ M, 32 ⁇ M, and 47 ⁇ M, respectively, hi contrast, Fe 3+ increased the activity by ⁇ 1.8-fold.
  • N-SMase ⁇ activity was inhibited by scyphostatin, a known inhibitor of N-SMase
  • N-SMase ⁇ To examine the tissue and cellular distribution in brain of N-SMase ⁇ , we prepared rat tissues (liver, spleen, intestine, pancreas, heart, lung, brain and kidney) and neurons and glia as non-neuronal cells and analyzed them with immunoblot using anti-rHSP60 antibody. N-SMase ⁇ distributed as a majority in brain (Fig. A), localized in cortical neurons and exclusively existed in neurons rather than glia (Fig. 5), suggesting that N-SMase ⁇ may play a role in neuronal function. Recent evidence is accumulating that ceramide is implicated in a variety of cell functions including apoptosis for various types of neurons.
  • Example 3 Antibody preparation and confirmation 3-1. 60 kDa protein N-SMase ⁇ monoclonal antibody preparation To generate anti-60 kDa protein antiserum from mice, the 60 kDa protein as antigen was excised from the gels of the active fractions from the former step, Phenyl-5PW
  • rHSP60 antibody preparation cDNA encoding 60 kDa protein was cloned from rat brain ⁇ ZAP library by using this anti-60 kDa protein antiserum. We found that the 60 kDa protein is HSP60. To further verify whether HSP60 has N-SMase ⁇ activity, firstly we over-expressed human HSP60 in E. Coli and purified it from the inclusion body. Then polyclonal anti-recombinant HSP60 (rHSP60) antibody was generated in rat and purified by eluting
  • the human HSP60 cDNA was amplified by using a 5'- AGAGGGATTCATGCTTCGGTTACCCACAGTCT primer containing a BamHI site
  • HSP60 cDNA 1722 base pairs
  • Human hsp60 cDNA cloned into pcDNA3 was digested with Bam ⁇ I and Notl and ligated into the pET28a vector ( ⁇ ovagen).
  • a chimeric fusion protein consisting of 6X histidine linker protein plus the full 573 amino acids of human HSP60 was expressed in BL21(DE3) bacteria after induction with isopropyl ⁇ -D-thiogalactopyranoside.
  • the fusion protein was purified as inclusion bodies and used as an immunogen for the production and purification of rat polyclonal antisera. Immunization was performed by injecting 200 ⁇ g of recombinant protein in Freund's complete adjuvant (Gibco BRL Life Technologies, Inc., Grand Island, ⁇ Y, USA)
  • the supematants of the hybridomas were tested for production of antibodies using a Mono S-purified ⁇ -SMase ⁇ for screening (0.04 ⁇ g/well) according to Ausubel's method (Ausubel, F. M. in Current Protocols in Molecular Biology, Wiley-hiterscience, New York, 1987).
  • Antibodies against the human HSP60 were affinity-purified against a chimeric fusion protein of 6X his and HSP60.
  • Example 4 Cortical neuron and glia cell culture Pure rat cortical neuron cultures were prepared from fetal Sprague-Dawley rats at day
  • dissociated cells were isolated using flame-narrowed Pasteur pipette in Hank's balanced salt solution (HBSS; 1 mM sodium pyruvate, 10 mM HEPES, pH 7.4) without Ca 2+ and Mg 2+ .
  • HBSS Hank's balanced salt solution
  • Dissociated cells were plated in Dulbecco's modified Eagle's medium/F-12 into poly-D-lysine-coated culture plates. The growth of non-neuronal cells was prevented by adding 10 ⁇ M ⁇ -D-cytosine arabinofuranoside (AraC) 18 hr after plating. Cells were maintained under a humidified atmosphere of
  • Glial cultures were prepared from neocortices of postnatal (days 1-3) rats and plated at 0.25-0.5 hemispheres per 6-well vessel, in plating medium supplemented with 10% fetal bovine serum and 10%o horse serum. After 2 weeks in vitro, cultures were fed weekly with the same medium as for neuronal cultures. Glial cultures were used for
  • Lipids were resuspended in CHCl 3 :MeOH (1:1, v/v) and spotted on TLC Silica gel G plates. Plates were developed to the top of the plate in CHCl 3 /MeOH/H 2 O/Acetic acid (85/4.5/5/0.5, v/v), dried under nitrogen and rechromatographed to 50%> of the total length in CHCl 3 /MeOH/H 2 O/Acetic acid (65/25/8.8/4.5, v/v). Under these conditions, ceramide, glucosylceramide, sphingoid bases (sphinganine, sphingosine) and SM are well separated.
  • Antibodies against the human HSP60 were affinity-purified against a chimeric fusion protein of 6X his and HSP60. Above antibodies (200mg) were coupled with 40ml of protein G agarose bead and beads were blocked with 0.1M ethanolamine (pH 8.0) for 2 hours at room temperature and washed with 40ml PBS. Protein G agarose beads bound to the antibodies were reacted with the active fractions from SP 5PW cationic exchange HPLC column. Condition was 20mM Tris, pH 7.5, 10% glycerol, O.lmM EDTA and lOOmM NaCl. The reaction mixture was centrifuged to obtain the supernatant for N-SMase activity assay. The antibody also significantly immunoprepitated the N-SMase activity partially purified from bovine brain (Fig. 7), with parallel changes in the protein level of the supematants and beads of immunoprecipitation (Fig. 6).
  • HSP60 cDNA (1722base pairs) was then subcloned into the pcDNA3 (hivitrogen) expression vector and amplified.
  • Human HEK 293 cells were maintained in Dulbecco's modified Eagle's medium(DMEM) supplemented with 10% fetal bovine serum, 100 units/ml each of penicillin and streptomycin, and 2 mM glutamine in humidified 5%> CO 2 at 37 ° C.
  • DMEM Dulbecco's modified Eagle's medium
  • the cells were seeded in six- well cell culture plates to provide a final density of 50-70% confluence ( ⁇ 3 x 10 5 cells/well). Cells were transfected using the Suferfect (Qiagen Co.) according to the manufacturer's suggestions. After 3-4hrs of
  • the cells were added growth medium containing twice the normal concentration of serum without removing the transfection mixture. 48hrs after transfection cells were washed with phosphate-buffered saline and were homogenized by sonication with homogenization buffer (25mM Tris-HCl pH 7.0, lmM EDTA,
  • cell pcDNA3-HSP60 transfected HEK 293 cells were transfected again with 4 ⁇ M of ODN (A-ODN or S-ODN) in DMEM without fetal bovine serum and antibiotics.
  • ODN A-ODN or S-ODN
  • the cells were added to growth medium containing twice the normal concentration of serum without removing the transfection mixture.
  • 48 hrs after transfection cells were washed with phosphate-buffered saline and were homogenized by sonication with homogenization buffer (25mM Tris-HCl pH 7.0, lmM EDTA, lOmM ⁇ -mercaptoethanol). After removal of cell debris by centrifugation at 1,000 X g for 10 minutes lysates, were assayed.
  • Thiophosphate-modified A-ODNs and control sense-ODNs (S-ODNs) specific for eukaryotic hsp60 were synthesized according to the Steinhoff's method (Steinhoff, U.,
  • FIG. 11 shows the HSP60 protein expression and SMase activity analysis in antisense A-ODN treated cell. The results indicated that N-SMase ⁇ expression and its activity was nearly inhibited becauses synthetic oligomers were specifically complement to
  • siRNA preparation and transfection siRNAs corresponding to hsp60 mRNA was designed as recommened with 5' phosphate, 3' hydroxyl, and two base overhangs on strand; it was chemically synthesized by Xeragon.
  • the following gene-specific sequence was used successfully: Si-HSP60 sense 5'-UGCUCACCGUAAGCCUUUGdTdT-3' and antisense 5'-
  • siRNA for hsp60 targeting was carried out with TransMessenger transfection reagent (Qiagen).
  • siRNA (0.8 ⁇ g) was condensed with Enhancer R and formulated with 4 ⁇ l of TransMessenger reagent according to the manufacturer's instructions.
  • the transfection complex was diluted in 300 ⁇ l cell growth medium (without serum or antibiotics) and was added directly to the cells; it was replaced with nonnal growth
  • SMase activity (110 ⁇ g) was measured using 14 C-sphingomyelin as substrate. All data are representative of 3 - 4 independent experiments. As can be seen in Fig. 12, it was confirmed that the SMase activity of hsp60 siRNA treated group was lower than that of untreated group (control) and was decreased with
  • the neuronal cells (three 6-well vessels/condition) were washed once with PBS and
  • N-SMase ⁇ activity was stably enhanced by TNF- ⁇ in time- dependent manner and up-regulated up to ⁇ 2-fold in 30 mins after treatment. Based on the above results, we confirmed that the N-SMase ⁇ activity was related to the apoptosis by TNF- ⁇ . Also, to examine the mechanism of increasing N-SMase ⁇ activity, the immunoblot analysis was performed with N-SMase ⁇ antibody prepared in Example 3.
  • N-SMase ⁇ activity after TNF- ⁇ treatment to cortical neuronal cell was caused by the increase of enzyme in quantity.
  • Fumonisin Bl (3 ⁇ M) was added 10 min before TNF- ⁇ .
  • the ceramide produced were separated on a TLC as follows: The lipids were ⁇ irst separated by using chloroform methanol/acetic acid/water (170:9:10:1; vol/vol/vol/vol) followed by drying out the plates and then further separated by chloroform/methanol/acetic acid/water
  • the ceramide was increased according to TNF- ⁇ treatment at various time whereas sphingomyeline, a substrate of N-SMase ⁇ , was decreased. And when the inhibitor of ceramide synthesis, FBI was treated to cell, the change of ceramide in quantity was not detected. Therefore, it is confirmed that the increase of ceramide by TNF- ⁇ was due to the
  • ceramide which is important in cellular signal transduction associated with apoptosis, inflammation etc. and as an anti-cancer agent or anti-inflammatory agent by inhibiting the apoptosis or the inflammation.

Abstract

The present invention relates to a novel neutral sphingomyelinase, its antibody, its antisense and the preparation method therof. The purified neutral sphingomyelinase enzyme, designated as N-SMase ¥åderived from mammalian brain, is HSP60 protein which has 60kDa of M.W. determined by SDS-PAGE analysis and has Mg+-dependent enzyme activity. The N-SMase ¥åenzyme which produces ceramide can induce apoptosis therefore a composition comprising the same can be useful for preventing and treating cancer caused by abnormal cell proliferation. Also, the antibody against inventive N-SMase ¥å enzyme inhibits the enzyme activity and the antisense against inventive N-SMase ¥åenzyme suppress the enzyme expression and activation, thereby they can be used for the manufacture of therapeutics for treating apoptosis, aging and inflammation-related diseases caused by ceramide.

Description

NOVEL SPHINGOMYELINASE, THE ANTIBODY AGAINST IT, THE ANTISENSE AND THE PREPARATION METHOD THEREOF
TECHNICAL FIELD The present invention relates to a novel sphingomyelinase, the separation and purification method thereof, specifically relates to a novel sphingomyelinase isolated and purified by preparation method of the present invention and a composition
comprising antibody against it or the antisense thereof for the prevention and treatment of ceramide-causing diseases.
BACKGROUND ART
The hydrolysis of sphingomyelin (SM) known as the SM pathway, is induced by the activation of sphingomyelinase (SMase) to generate the second messenger ceramide, which plays a key role in cellular responses such as apoptosis, differentiation, senescence, and inflammation. Recent studies are paying a great attention to N-SMase (Neutral-sphingomyelinase; N-SMase) enzymes responsible for the signal-coupled
production of ceramide (Haimun, Y.A.; Science 274, ppl855-1859, 1996). However, little is known about their biochemical characteristics as well as the primary structures of the enzyme. Therefore, at present, the identification and characterization of such SMases are essential foundation in finding out the mechanism by which ceramide is produced and its precise role in cellular function. Several N-SMase activities have been described in mammalian brain (Maruyama, E. N. & Arima, M.; J. Neurochem. 52, pp611-618, 1989; Liu, B., et al; J. Biol. Chem. 273, pp34472-34479, 1998; Bernardo, K., et al.; J. Biol. Chem. 275, pp7641-7647, 2000; Jung, S. Y, et al; J. Neurochem. 75, ppl004-1014, 2000) and 47.5 kDa N-SMasel
(Tomiuk, S., et al.; Proc. Natl. Acad. Sci. USA 95, pp3638-3643, 1998) and 71 kDa N- SMase2 (Hofinann, K., et al.; Proc. Natl. Acad. Sci. USA 91, pp5895-5900, 2000) have been cloned by using a bioinformatics-based gene discovery approach and characterized. N-SMasel was further identified as a lyso-platelet activating factor (Lyso-PAF) phospholipase C (PLC) rather than a SMase (Sawai, H., et al.; J. Biol. Chem. 274,
pp38131-38139, 1999) and N-SMase2 activity was not inhibited by 10 mM glutathione (GSH), which has been known to inhibit most of the previously described N-SMases. Thus, any of N-SMase has been not identified as a signal-coupled effector to produce
ceramide. TNF-α is known as a candidate neurotoxin contributing to the brain pathogenesis (Robertson, J., et al.; J. Cell. Biol. 155, pp217-226, 2001; Talley, A. K., et al.; Mol. Cell. Biol. 15, pp2359-66, 1995; Sairanen, T. R., et al.; J. Neurol. Sci. 186, pp87-99, 2001), but the underlying mechanisms are not fully understood. Recent evidence is accumulating that N-SMase plays a crucial role in signaling cell death induction by
TNF-α. It was also noted that an inhibitor of N-SMase efficiently blocked TNF-α- induced apoptotic death in MCF cells (Luberto, C; J. Biol. Chem. 277, pp41128-41139, 2002), further suggesting that there may exist an N-SMase mediating TNF-α-signaling. We have previously described multiple forms of membrane-associated N-SMase from bovine and human brain (Jung, S. Y., et al.; Identification of multiple forms of
membrane-associated neutral sphingomyelinase in bovine brain. J. Neurochem. 75, ppl004-1014, 2000).
Finally, the present inventors have endeavored to separate a novel Smase producing
ceramide related to various diseases, a 60 kDa membrane-associated, neutral and Mg2+- dependent SMase, termed N-SMase ε, from mammalian brains, which was revealed as the heat shock protein 60 (HSP60) was identified and the antibody against it and the antisense was prepared. And the present invention has been completed by confirmimg that SMase mediates TNF-α-induced neuronal apoptosis through the production of ceramide.
SUMMARY OF THE INVENTION The present invention provides a novel sphingomyelinase, antibody against it,
antisense thereof and anticancer agent or anti-inflammatory drug to control the production of ceramide related to apoptosis and inflammation.
DISCLOSURE OF THE INVENTION Accordingly, it is the object of the present invention is to provide a novel SMase which is characterized in having 60 kDa of M.W. and membrane-associated, neutral and Mg2+-dependent activity originated from mammalian cell. SMase acts on sphingomyelin (SM) to produce ceramide and a novel SMase of the present invention is designated as N-SMase ε.
And, it is another object of the present invention is to provide a preparation method of N-SMase ε from mammalian cell. For example, the inventive N-SMase ε can be separated and purified by the preparation method comprising the step consisting of; (step 1) collecting "ammomum sulfate extract" using as enzyme source for the purification of N-SMase ε by homogenizing bovine brain in homogenizing buffer, centrifuging and removing the cell debris and nuclear thereof, centrifuging again and obtaining pellet, resuspending and vortexing the pellet in ammonium sulfate buffer and centrifuging to obtain supernatant "ammonium sulfate extract"; (step 2) applying the ammonium sulfate extracts to a DEAE-cellulose column and eluting with buffer comprising ammonium sulfate and Triton X-100 to obtain the active fraction; (step 3) applying the active fractions of step 2 to Butyl-Toyopearl column and eluting with 3° distilled water to obtain the active fraction; (step 4) applying the active fractions of step 3 to DEAE-5PW HPLC and
eluting with buffer comprising ammonium sulfate and Triton X-100 to obtain the active
fraction; (step 5) applying the active fractions of step 4 to phenyl-5PW HPLC and eluting with 3° distilled water to obtain the active fraction; (step 6) applying the active fractions of step 5 to Mono S cationic exchange HPLC and eluting with buffer comprising sodium chloride and Triton X-100 to obtain the active fraction. Finally, the neutral SMase was intensively purified to ~38,000-fold purification with
six chromatographic steps. Inventive SMase ε prepared through mono S cationic exchange HPLC is separated into 4 spots in two-dimensional SDS-PAGE protein profile. Matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometrical analysis and
Swiss Prot database search showed that all of the four spots having molecular mass of 60 kDa in the immunoprecipitate as well as the four spots of the 60 kDa protein purified through the six purification steps were identified as HSP60 and reconfirmed as HSP60 by observing SMase activity increased in HSP60 expressed cell.
Lineweaver-Burk plot for purified N-SMase ε was linear with an apparent Km of 47 μM and a Vmax of >4,800 nmol/min/mg. The N-SMase ε shows the higher substrate specificity for sphingomyelin by over 50-fold, the Mg2+-dependent activity and is highly
expressed in the brain neuronal cell. N-SMase ε activity is increased at the glutathione concentration up to 3mM but gradually decreased with a complete inhibition at lOmM, whereas DTT and 2- mercaptoethanol as other reducing agents have no effect on the enzyme activity. It is another object of the present invention to provide a novel neutral SMase which is associated with the membrane and originated from mammalian cell. And further, it is another object of the present invention to provide an active fraction
having membrane associated, neutral SMase activity, which is purified by the method comprising steps of; homogenizing the mammalian brain cell, solublizing the homogenate with ammonium sulfate or triton X-100 and performing several
chromatographies such as hydrophobic cliromatography, ion exchange chromatography
and the like. In the treatment of TNF-α, expressed N-SMase ε is increased and thereby increased
specific activity of the enzyme hydrolyses the sphingomyelin to produce ceramides. And the enzyme activity is not affected by the presence of Fumonisin Bl. N-SMase ε mediates the TNF-α induced neuronal apoptosis through the ceramide
production. It is another object of the present invention to provide an apoptosis activator
comprising N-SMase ε. It is another object of the present invention to provide a pharmaceutical composition comprising N-SMase ε as an active ingredient for preventing and treating cancer diseases caused by abnormal cell proliferation, together with a pharmaceutically acceptable carrier. It is still another object of the present invention to provide the use of N-SMase ε for
the preparation of therapeutic agent for treatment and prevention of cancer disease caused by abnormal cell proliferation in human or mammal. And also, the administration of DNA vaccine of N-SMase ε gene increases the ceramide production so that it can be used for treating, improving cancer diseases by way of inhibiting cancer cell proliferation. Above-described cancer disease comprises lung cancer, non-small cell lung cancer, colon cancer, bone cancer, pancreatic cancer, skin cancer, head cancer or neck cancer, skin or endophthal melanoma, uterine carcinoma, ovarian cancer, rectal cancer, stomach
cancer, peri-anal cancer, breast cancer, tubal(fallopian) cancer, endometrial cancer,
cervical cancer, virginal cancer, vulva cancer, Hodgkin's disease, esophageal cancer, small intestinal cancer, endocrine gland cancer, tyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcomas, urethral cancer, penile cancer, prostate cancer, chronic and acute leukemia, lymphoma, bladder cancer, kidney cancer or hydroureter
cancer, renal cell carcinoma, renal pelvic bone cancer, central nervous system(CNS) cancer, primary CNS lymphoma, myeloma, brain stem glioma, pituitary cancer and the like. It is further another object of the present invention to provide an N-SMase ε antibody against inventive N-SMase ε. It is further another object of the present invention to provide an antisense having inhibiting activity of the expression of N-SMase ε and N-SMase ε antibody. Inventive N-SMase ε antibody can specifically bind to inventive N-SMase, HSP60 and it can be prepared by the method comprising the steps of; isolating the protein as an antigen from the gel of active fractions by phenyl-5PW HPLC during purification; mixing the protein with adjuvant; injecting the mixture into mice; and collecting serum from the blood. Though above preparation method, mouse anti-serum against 60kDa protein can be prepared and two monoclonal antibodies, i.e., SMI A5 and SM1E1 can be prepared therefrom. Antisense for N-SMase ε is the sequences inhibiting the mRNA expression of hsp60 gene and it can be designed by the conventional method well known in the art. Preferred antisense comprises at least one selected from the group consisting of A-ODN 5'-
AGCATTTCTGCGGGG-3', si-HSP60 sense 5'-UGCUCACCGUAAGCCUUUGdTdT-
3' and si-HSP60 antisense 5'-dTdTACGAGUGGCAUUCGGAAAC-3'. N-SMase ε antibody, HSP60 antibody or hsp60 siRNA treatment can reduce the expression & activity of N-SMase ε and ceramide production, finally they can be useful for the prevention and treatment of ceramide-causing diseases. Additionally, it is another object of the present invention to provide a pharmaceutical composition comprising N-SMase ε antibody or N-SMase ε antisense as an active ingredient for prevention and treatment of inflammatory disease caused by the disorder of ceramide reproduction, together with a pharmaceutically acceptable carrier. It is still another object of the present invention to provide the use of N-SMase ε antibody or N-SMase ε antisense for the preparation of therapeutic agent for treatment and prevention of inflammatory disease caused by the disorder of ceramide reproduction.
Inventive N-SMase ε, N-SMase ε antibody or N-SMase ε antisense shall be useful for the study to elucidate the mechanism of cancer disease and inflammatory disease. In case that the expression, function and control mechanism of inventive N-SMase ε are revealed, the pathway of metabolites produced by N-SMase ε and the pathogenesis thereby can be clearly found out. Also, in case that N-SMase ε activity is reduced or inactivated by generating the mutation in N-SMase ε, the disease caused by N-SMase ε can be diagnosed, prevented and treated. Inventive N-SMase ε shall be useful for the physiological study of said enzyme and ceramide. The composition comprising inventive N-SMase ε, N-SMase ε antibody or N-SMase
ε antisense as an active ingredient can additionally comprise the substance or derivatives with similar function. If necessary, other active ingredient can be added thereto. The inventive composition comprising inventive N-SMase ε, N-SMase ε antibody or N-SMase ε antisense may additionally comprise conventional carrier, adjuvants or diluents in accordance with a using method. It is preferable that said carrier is used as appropriate substance according to the usage and application method, but it is not limited. Appropriate diluents are listed in the written text of Remington's Pharmaceutical Science (Mack Publishing co, Easton PA). The composition according to the present invention can be provided as a pharmaceutical composition containing pharmaceutically acceptable, carriers, adjuvants or diluents, e.g., lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starches, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate and mineral oil. The formulations may additionally include fillers, anti-agglutinating agents, lubricating agents, wetting agents, flavoring agents, emulsifiers, preservatives and the like. The compositions of the invention may be formulated so as to provide quick, sustained or delayed release of the active ingredient after their administration to a patient by employing any of the procedures well known in the art. For example, the compositions of the present invention can be dissolved in oils, propylene glycol or other solvents, which are commonly used to produce an injection. Suitable examples of the carriers include physiological saline, polyethylene glycol, ethanol, vegetable oils, isopropyl myristate, etc., but are not limited to them. For topical administration, the compounds of the present invention can be formulated in the form of ointments and creams. Pharmaceutical formulations containing composition may be prepared in any form,
such as oral dosage form (powder, tablet, capsule, soft capsule, aqueous medicine, syrup, elixirs pill, powder, sachet, granule), or topical preparation (cream, ointment, lotion, gel, balm, patch, paste, spray solution, aerosol and the like), or injectable preparation (solution, suspension, emulsion).
The composition of the present invention in pharmaceutical dosage forms may be used in the form of their pharmaceutically acceptable salts, and also may be used alone or in appropriate association, as well as in combination with other pharmaceutically active compounds. The desirable dose of the inventive enzyme or composition varies depending on the condition and the weight of the subject, severity, drug form, route and period of administration, and may be chosen by those skilled in the art. However, in order to obtain desirable effects, it is generally recommended to administer at the amount ranging 0.001-lOOmg/kg by weight/day of the inventive enzyme of the present invention. The dose may be administered in a single or multiple doses per week. The pharmaceutical composition of the present invention can be administered to a subject animal such as mammals (rat, mouse, domestic animals or human) via various routes. All modes of administration are contemplated, for example, administration can
be made orally, rectally or by intravenous, intramuscular, subcutaneous, intracutaneous, intrathecal, epidural or intracerebro ventricular injection.
BRIEF DESCRIPTION OF THE DRAWINGS The above and other objects, features and other advantages of the present invention will more clearly understood from the following detailed description taken in conjunction with the accompanying drawings, in which;
Fig. 1 shows a two-dimensional electrophoresis protein profile of the active fractions purified from bovine brain; Fig. 2 presents the effect of inventive N-SMase ε on the sphingomyeline(SM) and ceramide of cortical neuron; Fig. 3 presents the inventive N-SMase ε activity in the presence of GSH, DTT or 2- mercaptoethanol; Fig. 4 shows the cellular or tissue distribution of inventive N-SMase ε; Fig. 5 shows the distribution of inventive N-SMase ε in neuronal and non-neuronal cell; Fig. 6 presents the inventive N-SMase ε activity change by rat anti-HSP60 antibody;
Fig. 7 exhibits the immuno-precipitation analysis using rat HSP60 antibody and bead; Fig. 8 represents the two-dimensional electrophoresis and silver staining of the protein immunoprecipitated with HSP60 antibody; Fig. 9 shows the immunoblot analysis of the protein obtained from the immunoprecipitation and two-dimensional electrophoresis; Fig. 10 shows the HSP60 protein expression and the SMase activity in the pcDNA3-
HSP60 transfected cell; Fig. 11 represents the HSP60 protein expression and the SMase activity in the pcDNA3-HSP60 transfected and sense/antisense treated cell; Fig. 12 represents the HSP60 protein expression and the SMase activity in the
pcDNA3-HSP60 transfected and siRNA treated cell; Fig. 13 shows the normal cortical neuron cell and TNF-α treated cortical neuron cell; Fig. 14 shows the N-SMase ε specific activity according to the time in the TNF-α treated cortical neuron cell; Fig. 15 presents the immunoblot analysis with the inventive N-SMase ε antibody in the TNF-α treated cortical neuron cell; Fig. 16 represents the change of amount of ceramide and SM, and the effect of FBI on ceramide and SM in the TNF-α treated cortical neuron cell. It will be apparent to those skilled in the art that various modifications and variations can be made in the compositions, use and preparations of the present invention without departing from the spirit or scope of the invention.
BEST MODE FOR CARRING OUT THE INVENTION The present invention is more specifically explained by the following examples. However, it should be understood that the present invention is not limited to these examples in any manner.
EXAMPLES The following Examples and Experimental Examples are intended to further illustrate the present invention without limiting its scope.
Reference Example 1. N-SMase activity analysis The substrate, [N-methyl-14C]SM (labeled with 14C on the choline moiety), was dried under nitrogen stream and resupended in ethanol. The standard incubation system (100 μl) for assay of N-SMase activity contained 10 mM MgSO4, 50 μM [N-methyl- 14C]SM (approximately 60,000 cpm), 2 mM sodium deoxycholate (SDC) and 100 mM Tris-HCl, pH 7.0. Reactions were carried out at 37 °C for 30 min and stopped by adding 320 μl of chloroform/methanol (1:1, by volume) and 30 μl of 2 N-HC1 into the reaction mixture according to Bligh & Dyer's method (Bligh, E.G. & Dyer, W.A; J. Can. J. Biochem. Biophysiol, 37, pp680-685, 1970). After vortexing, the mixtures were micro- centrifuged to separate the two phases. 200 μl of clear aqueous phase was removed into 1.2 ml of scintillation solution (frista gel-XF, Packard Instrument Co., Meriden, CT, USA) and counted for radioactivity in Packard Tri-carb liquid β -scintillation counter. The active fractions were pooled for the next step. To further define the enzymatic activity of SMase, we measured the content of
[3H]ceramide produced from [3H]SM of rat cortical neuronal cells labeled with [3H]serine as substrates. To label sphingolipid, the neuronal cells (1 x 106 cells) were labelled for 72 hrs in the presence of 1.0 μCi/ml [ Hjserine and washed with Tris- buffered saline. Cells were lysed and lipids were extracted by the solvent mixture of CHC13 : MeOH : 2N-HC1 (100 : 100 : 1, by volume). Total lipids were dried and resuspended in ethanol. The lipids were used as a substrate for assay of SMase activity by analyzing SM degradation and ceramide production. The assay system (100 μl) for the SMase activity contained the active fractions obtained from the final step of Mono S column chromatography, purified from bovine brain as below as the enzyme sources, 100 mM Tris-HCl, pH 7.0, 5 mM MgCl2, 2 mM sodium deoxycholate, and the substrate (18,520 cpm). After incubation for 1 hr at 37°C, according to Bligh & Dyer's method, the reaction was stopped by adding 320 μl of CHC13 : MeOH (1 : 1, by volume) and 30 μl of 2N-HC1. The mixture was vortexed and microcentrifuged to separate the two phases. The organic phase was dried and glycerphospholipids were removed by mild alkaline hydrolysis in 0.1 M methanolic KOH at 37°C for 1 hr. The resulting lipid extracts were spotted on TLC silica plates and developed to the top of the plate in CHC13 : MeOH : CH3COOH : H2O (85.0 : 4.5 : 5.0 : 0.5, by volume) to favor the migration of ceramide. The plate were redeveloped to the halfway in CHC13 : MeOH : CH3COOH H2O (65.0 : 25.0 : 8.8 : 4.5, by volume). Individual lipids were visualized by iodine vapor staining. The radioactive spots corresponding to SM and ceramide were scrapped and determined by β-liquid scintillation counter.
Example 1. Purification of N-SMase ε a membrane-associated Mg2+-dependent N-SMase, from bovine brain
1-1. ammonium sulfate extract preparation (Step 1)
N-SMase ε, a salt-extractable form of the membrane-bound N-mSMase, was purified as follows. At first, to prepare the enzyme source for the purification of N-SMase, fresh bovine brain (5 kg) kept at -70 °C was homogenized with 5 volumes (25 liters) of homogenizing buffer V (50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 3 mM MgCl2, 50 mM KC1, and 10 mM 2-mercaptoethanol) with a Polytron homogenizer (Model PT-MR 6000, Kinematica, Switzerland). The homogenate was centrifuged at 10,000 x g for 10 min to remove the cell debris and nuclei. The resulting supematants were again centrifuged at 10,000 x g at 4°C for lhr. The resulting 10,000 x g pellets were resuspended with 2.5 liters of buffer V and centrifuged at 40,000 x g at 4°C for lhr. The resulting 40,000 x g pellets were again resuspended with 2.5 liters of buffer V, adjusted
to 0.5 M (NH4)2SO4; and stirred at 4°C for lhr followed by centrifugation at 40,000 x g at 4°C for lhr. The resulting supematants, termed as "ammonium sulfate extracts", were collected and used as the enzyme source for the purification of N-SMase ε
1-2. DEAE-Cellulose column chromatography (Step 2) The ammonium sulfate extracts (2.5 liters) were applied to a DEAE-Cellulose column (bed volume of DE52 gel, 2.0 liters) pre-equilibrated with buffer D (25 mM Tris-HCl, pH 7.5, 1 mM EDTA, and 10 mM 2-mercaptoethanol). The protein bound to the column was eluted at a flow rate of 20 ml/min with a stepwise application of buffer D containing 0.5 M (NH4)2SO4 and 0.1% Triton X-100. An aliquot (10 μl) of each fraction (40 ml) was assayed for N-mSMase activity.
1-3. Butyl-Tovopearl column chromatography (Step 3) The active fractions were pooled, sonicated at 4°C with a cell disruptor (Sonics & Materials Inc., Danbury, CT, USA) six times for 3 sec with 5 sec intervals at an output setting of amplitude 70% and centrifuged at 100,000 x g at 4°C for lhr. An aliquot of
stock solution of 4.0 M (NH4)2SO was added to the resulting supernatant to adjust to 0.5 M (NH4) SO4. The sample was applied to a Butyl-Toyopearl column (bed volume of 150 ml) pre-equilibrated with buffer D containing 0.5 M (NH4)2SO4. The protein bound to the column was eluted at a flow rate of 15 ml/min with a sequential stepwise elution of buffer D containing 0.2 M (NH )2SO4 followed by application of distilled water. An aliquot (10 μl) of each fraction (30 ml) was assayed for N-SMase activity.
1-4. DEAE-5PW HPLC (Step 4) The active fractions were pooled and applied to a DEAE-5PW HPLC column (21.5 mm x 15 cm, Tosoh Co., Tokyo, Japan) previously equilibrated with buffer D. The protein bound to the column was eluted at a flow rate of 5 ml/min with a 200 ml-linear gradient of buffer D containing 0.5 M (NH4)2SO4 and 0.1% Triton X-100 as an elution buffer. An aliquot (3 μl) of each fraction (5 ml) was assayed for N-mSMase activity.
1-5. Phenyl-5PW HPLC (Step 5) The active fractions were pooled and applied to a Phenyl-5PWT HPLC column (21.5 mm x 15 cm, Tosoh Co., Tokyo, Japan) previously equilibrated with buffer D containing 0.2 M (NH )2SO4. The protein bound to the column was eluted at a flow rate of 5 ml/min with a 200 ml-gradient elution of distilled water.
1-6. Mono S cationic exchange FPLC (Step 6) The active pool was mixed with the same volume of buffer S (25 mM sodium acetate, pH 6.5, 1 mM EDTA) and applied to a Mono S cationic exchange FPLC column (5.0
cm x 5.0 mm, Pharmacia LKB Co., Uppsala, Sweden) previously equilibrated with buffer S. The protein bound to the column was eluted at a flow rate of 1 ml/min with a
20 ml-linear gradient of 0.0-1.0 M NaCl followed by a stepwise gradient of buffer S containing 1.0 M NaCl and 0.1 % Triton X-100. An aliquot (3 μl) of each fraction (1 ml) was assayed for N-SMase activity. N-SMase ε was intensively purified from a salt-extract of bovine brain membrane to near homogeneity with 1.3% yield and -38,000-fold purification with six cl romatographic steps
Example 2. Characterization of purified N- SMase ε
2-1. SDS-Polvacrylamide gel electrophoresis (SDS-PAGE One-dimensional denaturing SDS-PAGE was performed on 10% polyacrylamide gels according to Laemmli's procedure (laemmli, U.K.; Nature, 227, pp680-685, 1970) in a Bio-Rad Protean II electrophoresis system. Two-dimensional gel electrophoresis was performed according to O'Farrell (O'Farrell, P. H.; J. Biol. Chem., 250, ρp4007-4021, 1975) using the IPG-phor (Amersham Pharmacia Biotech, Uppsala, Sweden) system according to the instructions of the manufacturer. The separated proteins were stained
with a PlusOne silver staining kit (Pharmacia Biotech Inc. Piscataway, NJ). Each aliquot (10 μl) of the active fractions from the Mono S column in above Example 1, was mixed with an aliquot of Laemmli's sample buffer to make 0.125 M
Tris-HCl, pH 6.8, 4% SDS, 20% glycerol, and 0.002% bromophenol blue. After boiling for 5 min, the samples were cooled to room temperature and subjected to 10% polyacrylamide gel electrophoresis. The separated proteins were stained with a PlusOne silver staining kit (Pharmacia LKB Co., Uppsala, Sweden). Although the most active fraction of the final step was separated into four spots in a two-dimensional electrophoresis protein profile, the amount of total protein was <1 μg
(Fig. 1).
2-2. Protein identification by peptide mass fingerprinting analysis
Protein peptide fingerprinting analysis was performed as described previously (Park, J.B. et al.; J. Biol. Chem., 275, pp21295-21301, 2000). Briefly, the 42 kDa spot was stained with Coomasie brilliant blue and excised from a two-dimensional electrophoresis gel and digested with trypsin. 1 μl aliquot of the total digest (total volume 30 μl) was used for peptide mass fingerprinting. The masses of the tryptic peptides were measured with a Bruker Reflex III mass spectrometer. MALDI- TOF (Matrix-assisted laser desorption/ionization time-of-flight) analysis was performed with α-cyano-4-hydroxycinnamic acid as the matrix. Trypsin autolysis products were used for internal calibration. Comparison of the mass value against the SWISS-PROT database was performed using Peptide Search. MALDI-TOF mass spectrometrical analysis and Swiss Prot database search showed that all of the four spots of the molecular mass of 60 kDa in the immunoprecipitate as well as the four spots of the 60 kDa protein purified through the six purification steps were identified as HSP60.
2-3. Enzyme kinetics Enzyme kinetics is a method for calculating Km, Nmax and the velocity in the reaction
based on Michaelis Menton equation. Lineweaver-Burk plot for purified Ν-SMase ε was linear with an apparent Km of 47 μM and a Nmax of >4,800 nmol/min/mg.
2-4. Enzyme-substrate specificity The substrate specificity of the enzyme was determined using various phospholipids
as substrates. The enzyme showed the higher specificity for SM by >50-fold for the substrates Ν-[methyl-14C]sphingomyelin (SM), l,2-dipalmitoyl-3-phosphatidyl[N- mehtyl-3H]choline (DPPC), l-stearoyl-2-arachidonoyl--s,n-glycero-3-phospho[2- 3H]inositol (PI), l,2-dioleoyl-3-ρhosρhatidyl[3-14C]serine (PS), l-stearoyl-2-[l- 14C]arachidonoyl-GPC (2-AA-PC), l-acyl-2-[l-14C]arachidonoyl-GPE (2-AA-PE). Furthermore, the purified N-SMase ε were incubated with the cortical neuronal membranes metabolically biosynthesized from [3H]serine. Whereas SM was decreased, ceramide was increased (Fig. 2).
2-5. Effect of Glutathion. DTT and β-mercaptoethanol GSH is known to serve as a possible regulator of N-SMase in a variety of cells in the process of cell injury and apoptosis irrespective of the reducing activity by its sulfhydryl moiety. That is, the cellular depletion of GSH is suggested to activate the N-SMase activity. When N-SMase ε activity was examined for effects by GSH, a bimodal profile
was observed. The enzyme activity was increased at up to 3 mM, but gradually decreased with a complete inhibition at 10 mM, whereas DTT and 2-mercaptoethanol as other reducing agents had no effect (Fig. 3). These results suggest that among N- SMase enzymes tested for the effects of GSH, N-SMase ε may be the most sensitive to the depletion of intracellular GSH.
2-6. Effect of various cations N-SMase ε absolutely required Mg2+ ions in the assay and its activity stimulated by Mg2+ were affected by various cations. Ca2+ had no effect at up to 0.5 mM, whereas Cu2+, Zn2+, and Fe2+ potently inhibited the activity with an IC50 of about 28 μM, 32 μM, and 47 μM, respectively, hi contrast, Fe3+ increased the activity by ~1.8-fold. In particular, this regulation of the enzymatic activity by iron was suggested to be important for production of ceramide and other subsequent metabolites under a variety of oxidative stresses because the conversion from Fe2+ to Fe3+ in such circumstances may render N-SMase ε to be more activated in concert with the depletion of GSH. 2-7. Effect of scypostatin N-SMase active fraction was pre-reacted with scypostatin (Dr. T. Ogita, Safrkyo Ltd.,
Tokyo, Japan) at 37 °C for 10 min. 50 μM [N-methyl-14C]SM (approximately 60,000 cpm) was added thereto and further incubated at at 37 °C for 30 min for assay of N-
SMase activity. According to Bligh & Dyer's method, [N-methyl-14C]phosphocholine produced by SMase was extracted. The reaction was stopped by adding 320 μl of chloroform/methanol (1 : 1, by volume)
and 30 μl of 2 N-HC1 into the reaction mixture. After vortex, the mixtures were micro-centrifuged to separate the two phases. 200 μl of clear aqueous phase was removed into 2.5 ml of scintillation solution (frista gel-XF, Packard Instrument Co.,
Meriden, CT, USA) and counted for radioactivity in Packard Tri-carb liquid β- scintillation counter. The active fractions were pooled for the next step. N-SMase ε activity was inhibited by scyphostatin, a known inhibitor of N-SMase
with a Kz of 50 μM.
2-8. The distribution of N-SMase ε
To examine the tissue and cellular distribution in brain of N-SMase ε, we prepared rat tissues (liver, spleen, intestine, pancreas, heart, lung, brain and kidney) and neurons and glia as non-neuronal cells and analyzed them with immunoblot using anti-rHSP60 antibody. N-SMase ε distributed as a majority in brain (Fig. A), localized in cortical neurons and exclusively existed in neurons rather than glia (Fig. 5), suggesting that N-SMase ε may play a role in neuronal function. Recent evidence is accumulating that ceramide is implicated in a variety of cell functions including apoptosis for various types of neurons.
Example 3. Antibody preparation and confirmation 3-1. 60 kDa protein N-SMase ε monoclonal antibody preparation To generate anti-60 kDa protein antiserum from mice, the 60 kDa protein as antigen was excised from the gels of the active fractions from the former step, Phenyl-5PW
HPLC in the step 1-5 of Example 1. And then the gel mixed with adjuvant was injected intraperitoneally into BALB/c mice. We collected and prepared mouse anti-60 kDa protein antiserum and two monoclonal antibodies, termed SMI A5 and SM1E1.
3-2. rHSP60 antibody preparation cDNA encoding 60 kDa protein was cloned from rat brain λ ZAP library by using this anti-60 kDa protein antiserum. We found that the 60 kDa protein is HSP60. To further verify whether HSP60 has N-SMase ε activity, firstly we over-expressed human HSP60 in E. Coli and purified it from the inclusion body. Then polyclonal anti-recombinant HSP60 (rHSP60) antibody was generated in rat and purified by eluting
the antibody from an rHSP60-immobilized protein G affinity column.
The human HSP60 cDNA was amplified by using a 5'- AGAGGGATTCATGCTTCGGTTACCCACAGTCT primer containing a BamHI site
and a 3'-GGAAAATTTTGCGGCCGCTTAGAACATGCCACCTCCCA primer containing a Notl site. The full length HSP60 cDNA (1722 base pairs) was then subcloned into the pcDNA3 (hivitrogen Co.) expression vector and amplified. Human hsp60 cDNA cloned into pcDNA3 was digested with BamΗI and Notl and ligated into the pET28a vector (Νovagen). A chimeric fusion protein consisting of 6X histidine linker protein plus the full 573 amino acids of human HSP60 was expressed in BL21(DE3) bacteria after induction with isopropyl β-D-thiogalactopyranoside. The fusion protein was purified as inclusion bodies and used as an immunogen for the production and purification of rat polyclonal antisera. Immunization was performed by injecting 200 μg of recombinant protein in Freund's complete adjuvant (Gibco BRL Life Technologies, Inc., Grand Island, ΝY, USA)
intraperitoneally into BALB/c mice. Two additional injections with 200 μg of antigen and a third with 200 μg (all emulsified in Freund's incomplete adjuvant) were given at an interval of 3 weeks. A final injection of 200 μg (without adjuvant) was administered 3 days prior to the fusion followed by collecting blood. Antiserum was obtained by centrifuging the blood at 10,000 x g for 30 min. To fuse spleen cells with mouse myeloma cells, splenocytes (2 x 108) were fused with SP2/0 mouse myeloma cells using 43%o poly (ethylene glycol) 50 (Sigma Co., St. Louis, MO, USA). Cells were then plated into 96 wells and grown in hypoxanthine/aminopterin/thymidine medium (Sigma Co., St. Louis, MO, USA) containing 10%) hybridoma enhancing media (Sigma Co., St.
Louis, MO, USA), 20% fetal bovine serum (Hyclone), 35% SP2/0, and 35% RPMI- 1640 with HEPES (GIBCO). After 2 weeks, the supematants of the hybridomas were tested for production of antibodies using a Mono S-purified Ν-SMase ε for screening (0.04 μg/well) according to Ausubel's method (Ausubel, F. M. in Current Protocols in Molecular Biology, Wiley-hiterscience, New York, 1987). Antibodies against the human HSP60 were affinity-purified against a chimeric fusion protein of 6X his and HSP60.
Example 4. Cortical neuron and glia cell culture Pure rat cortical neuron cultures were prepared from fetal Sprague-Dawley rats at day
16 of gestation. Briefly, the dissociated cells were isolated using flame-narrowed Pasteur pipette in Hank's balanced salt solution (HBSS; 1 mM sodium pyruvate, 10 mM HEPES, pH 7.4) without Ca2+ and Mg2+. Dissociated cells were plated in Dulbecco's modified Eagle's medium/F-12 into poly-D-lysine-coated culture plates. The growth of non-neuronal cells was prevented by adding 10 μM β-D-cytosine arabinofuranoside (AraC) 18 hr after plating. Cells were maintained under a humidified atmosphere of
95% air and 5% CO2 at 37 °C. Glial cultures were prepared from neocortices of postnatal (days 1-3) rats and plated at 0.25-0.5 hemispheres per 6-well vessel, in plating medium supplemented with 10% fetal bovine serum and 10%o horse serum. After 2 weeks in vitro, cultures were fed weekly with the same medium as for neuronal cultures. Glial cultures were used for
plating at 14-28 days in vitro.
Example 5. Lipids quantification using [3H]serine or [3]palmitate labeling Cells were prelabeled with [3H]serine (3 μCi/ml) for 48 hrs or [3H]palmitate (1
μCi/ml) for 24 hrs. To measure the increase of ceramide by de novo pathway, Cells were exposed to hypoxia in the presence of [ H]serine or [ HJpalmitate as a precursor of ceramide. Cells were washed with PBS twice and exposed to hypoxia. Ice cold Methanol: 0.5 N-HC1 (1:1) solution was added, and cells were scraped from the plate. Lipids were extracted by Bligh & Dyer methods and aliquots were counted for normalization. Lipids were incubated in 0.1 N-methanolic KOH at 37°C for 1 h to hydrolize the phospholipids. Resulting lipids were evaporated to dryness under a stream of nitrogen. Lipids were resuspended in CHCl3:MeOH (1:1, v/v) and spotted on TLC Silica gel G plates. Plates were developed to the top of the plate in CHCl3/MeOH/H2O/Acetic acid (85/4.5/5/0.5, v/v), dried under nitrogen and rechromatographed to 50%> of the total length in CHCl3/MeOH/H2O/Acetic acid (65/25/8.8/4.5, v/v). Under these conditions, ceramide, glucosylceramide, sphingoid bases (sphinganine, sphingosine) and SM are well separated. Commercial lipid
standards were cochromatographed. After drying, lipids were visualized by iodine vapor
staining. Spots were scraped and mixed with 2.5 ml of scintillation solution (Insta gel- XF, Packard instrument Co., Meriden, CT). Radioactivity was determined by Packard Tri-carb liquid β -scintillation counter.
Experimental Example 1. Immunoassay 1-1. Immunoprecipitation
Antibodies against the human HSP60 were affinity-purified against a chimeric fusion protein of 6X his and HSP60. Above antibodies (200mg) were coupled with 40ml of protein G agarose bead and beads were blocked with 0.1M ethanolamine (pH 8.0) for 2 hours at room temperature and washed with 40ml PBS. Protein G agarose beads bound to the antibodies were reacted with the active fractions from SP 5PW cationic exchange HPLC column. Condition was 20mM Tris, pH 7.5, 10% glycerol, O.lmM EDTA and lOOmM NaCl. The reaction mixture was centrifuged to obtain the supernatant for N-SMase activity assay. The antibody also significantly immunoprepitated the N-SMase activity partially purified from bovine brain (Fig. 7), with parallel changes in the protein level of the supematants and beads of immunoprecipitation (Fig. 6).
1-2. hnmunoblotting analysis To investigate the presence of HSP60 in the beads and the possibility that the enzyme may be a component co-immunoprecipitated with HSP60, the proteins in the immunoprecipitates were examined by silver staining and western blotting analysis.
Whereas several spots of molecular masses of 62-, 60-, 58-, and 57-kDa were seen in the immunoprecipitates by silver staining (Fig. 8), only 57-kDa spot was not detected in immunoblotting analysis (Fig. 9), suggesting that the 57-kDa spot seems to be a protein associated with HSP60.
Experimental Example 2. SMase activity analysis in HSP60 transfected cell The human HSP60 cDNA was amplified by using a 5'-
AGAGGGATTCATGCTTCGGTTACCCACAGTCT primer containing a BamHI site
and a 3'-GGAAAATTTTGCGGCCGCTTAGAACATGCCACCTCCCA primer containing a Notl site. The full length HSP60 cDNA (1722base pairs) was then subcloned into the pcDNA3 (hivitrogen) expression vector and amplified.
Human HEK 293 cells were maintained in Dulbecco's modified Eagle's medium(DMEM) supplemented with 10% fetal bovine serum, 100 units/ml each of penicillin and streptomycin, and 2 mM glutamine in humidified 5%> CO2 at 37 °C. One day prior to transfection, the cells were seeded in six- well cell culture plates to provide a final density of 50-70% confluence (~3 x 105 cells/well). Cells were transfected using the Suferfect (Qiagen Co.) according to the manufacturer's suggestions. After 3-4hrs of
incubation with the mixture, the cells were added growth medium containing twice the normal concentration of serum without removing the transfection mixture. 48hrs after transfection cells were washed with phosphate-buffered saline and were homogenized by sonication with homogenization buffer (25mM Tris-HCl pH 7.0, lmM EDTA,
lOmM β-mercaptoethanol). After removal of cell debris by centrifugation at 1,000 X g
for 10 minutes, lysates were assayed. Above transfected cell was subjected to western blot analysis with HSP60 antibody and SMase activity analysis. As can be seen in Fig. 10, it was confirmed that HSP60 protein expressed cell showed
the high SMase activity.
Experimental Example 3. SMase activity in antisense treated and HSP60-expressed
cell pcDNA3-HSP60 transfected HEK 293 cells were transfected again with 4 μM of ODN (A-ODN or S-ODN) in DMEM without fetal bovine serum and antibiotics.
After 3-4 hrs of incubation with the mixture, the cells were added to growth medium containing twice the normal concentration of serum without removing the transfection mixture. 48 hrs after transfection cells were washed with phosphate-buffered saline and were homogenized by sonication with homogenization buffer (25mM Tris-HCl pH 7.0, lmM EDTA, lOmM β-mercaptoethanol). After removal of cell debris by centrifugation at 1,000 X g for 10 minutes lysates, were assayed. Thiophosphate-modified A-ODNs and control sense-ODNs (S-ODNs) specific for eukaryotic hsp60 were synthesized according to the Steinhoff's method (Steinhoff, U.,
Zugel, U., et al.; Proc. Natl. Acad. Sci. USA. 91, pp5085-8, 1994). The following sequences were used: A-ODNs, 5'-AGCATTTCTGCGGGG-3'; S-ODNs, 5'-
CCCCGCAGAAATGCT-3 ' . Fig. 11 shows the HSP60 protein expression and SMase activity analysis in antisense A-ODN treated cell. The results indicated that N-SMase ε expression and its activity was nearly inhibited becauses synthetic oligomers were specifically complement to
mRNA of N-SMase ε.
Experimental Example 4. siRNA preparation and transfection siRNAs corresponding to hsp60 mRNA was designed as recommened with 5' phosphate, 3' hydroxyl, and two base overhangs on strand; it was chemically synthesized by Xeragon. The following gene-specific sequence was used successfully: Si-HSP60 sense 5'-UGCUCACCGUAAGCCUUUGdTdT-3' and antisense 5'-
dTdTACGAGUGGCAUUCGGAAAC-3'. Annealing for duplex siRNA formation was
performed as described. Transfection of siRNA for hsp60 targeting was carried out with TransMessenger transfection reagent (Qiagen). siRNA (0.8 μg) was condensed with Enhancer R and formulated with 4 μl of TransMessenger reagent according to the manufacturer's instructions. The transfection complex was diluted in 300 μl cell growth medium (without serum or antibiotics) and was added directly to the cells; it was replaced with nonnal growth
medium after 4 hrs. Cells were analyzed 48 hrs after transfections. Cells were lysed and centrifuged. Hsp60 protein levels (18 μg) were determined by Western blot. SMase activity (110 μg) was measured using 14C-sphingomyelin as substrate. All data are representative of 3 - 4 independent experiments. As can be seen in Fig. 12, it was confirmed that the SMase activity of hsp60 siRNA treated group was lower than that of untreated group (control) and was decreased with
parallel reduction of its protein level in western blot analysis.
Experimental Example 5. N-SMase ε activity assay by TNF-α treatment
To observe the activity change according to the increase of N-SMase ε in cortical neuronal cell of brain, enzyme activity and the amount of ceramide, the hydrolytic product of N-SMase ε were detennined.
5-1. TNF-α treatment and N-SMase ε specific activity assay
The neuronal cells (three 6-well vessels/condition) were washed once with PBS and
incubated in DMEM supplemented with 1%> FBS and 1 μCi/ml [3H]serine. After 3 days, cells were washed three times with 10 ml PBS and incubated in DMEM containing 10% FCS for 1 day. Cell incubations with TNF-α (Genzyme Co., Cambridge, MA) of various concentrations were carried out and then rapidly transferred and incubated at
37°C. The cell morphology was observed under the light microscope. Comparing with the control, the significant cells were died by TNF-α treatment for
24 hours (Fign.3). As shown in Fig. 14, N-SMase ε activity was stably enhanced by TNF-α in time- dependent manner and up-regulated up to ~2-fold in 30 mins after treatment. Based on the above results, we confirmed that the N-SMase ε activity was related to the apoptosis by TNF-α. Also, to examine the mechanism of increasing N-SMase ε activity, the immunoblot analysis was performed with N-SMase ε antibody prepared in Example 3.
In the result, when cortical neuron cell was treated with TNF-α for 30 mins, the amount of N-SMase ε protein therein was increased comparing with the control (Fig. 15).
Accordingly, increased N-SMase ε activity after TNF-α treatment to cortical neuronal cell was caused by the increase of enzyme in quantity.
5-2. Ceramide assay by N-SMase ε activation After confirmation of the N-SMase ε activity increase by TNF-α in above experiment, the amount of ceramide, the hydrolytic product of N-SMase ε was determined.
Fumonisin Bl (3 μM) was added 10 min before TNF-α. The ceramide produced were separated on a TLC as follows: The lipids were ^irst separated by using chloroform methanol/acetic acid/water (170:9:10:1; vol/vol/vol/vol) followed by drying out the plates and then further separated by chloroform/methanol/acetic acid/water
(39:15:5.3:2.7; vol/vol/vol/vol) as the second solvent. Individual lipids were visualized by iodine vapor staining. The radioactive spots corresponding to SM and ceramide were
scrapped and determined by β-liquid scintillation counter. As shown in Fig. 16, the ceramide was increased according to TNF-α treatment at various time whereas sphingomyeline, a substrate of N-SMase ε, was decreased. And when the inhibitor of ceramide synthesis, FBI was treated to cell, the change of ceramide in quantity was not detected. Therefore, it is confirmed that the increase of ceramide by TNF-α was due to the
increased N-SMase activity.
INDUSTRIAL APPLICABILITY The inventive neutral SMase ε, the antibody against it and the antisense thereof can
be useful to control the synthesis of ceramide, which is important in cellular signal transduction associated with apoptosis, inflammation etc. and as an anti-cancer agent or anti-inflammatory agent by inhibiting the apoptosis or the inflammation.

Claims

Claims
1. A novel SMase which is characterized in having 60 kDa of M.W. and membrane-associated, neutral and Mg2+-dependent activity originated from mammalian cell.
2. An apoptosis activator comprising N-SMase ε as set forth in claim 1.
3. A pharmaceutical composition comprising N-SMase ε as set forth in claim 1 as an active ingredient for preventing and treating cancer diseases caused by abnormal cell proliferation, together with a pharmaceutically acceptable carrier.
4. Use of N-SMase ε as set forth in claim 1 for the preparation of therapeutic agent for treatment and prevention of cancer disease caused by abnormal cell proliferation in human or mammal.
5. An antibody against N-SMase ε set forth in claim 1.
6. An antisense having inhibiting activity of the expression of N-SMase ε.
7. The antisense according to claim 6 wherein antisense comprises at least one selected from the group consisting of A-ODN 5'-AGCATTTCTGCGGGG-3', si-HSP60 sense 5'-UGCUCACCGUAAGCCUUUGdTdT-3' and si-HSP60 antisense 5 '-dTdTACGAGUGGCAUUCGGAAAC-3 ' .
8. A pharmaceutical composition comprising N-SMase ε antibody or N-SMase ε antisense as an active ingredient for prevention and treatment of inflammatory disease caused by the disorder of ceramide reproduction, together with a pharmaceutically acceptable carrier.
9. Use of N-SMase ε antibody or N-SMase ε antisense for the preparation of therapeutic agent for treatment and prevention of inflammatory disease caused by the disorder of ceramide reproduction.
PCT/KR2003/001548 2003-07-31 2003-07-31 Novel sphinogmyelinase, the antibody against it, the antisense and the preparation method thereof WO2005012514A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU2003247216A AU2003247216A1 (en) 2003-07-31 2003-07-31 Novel sphinogmyelinase, the antibody against it, the antisense and the preparation method thereof
PCT/KR2003/001548 WO2005012514A1 (en) 2003-07-31 2003-07-31 Novel sphinogmyelinase, the antibody against it, the antisense and the preparation method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2003/001548 WO2005012514A1 (en) 2003-07-31 2003-07-31 Novel sphinogmyelinase, the antibody against it, the antisense and the preparation method thereof

Publications (1)

Publication Number Publication Date
WO2005012514A1 true WO2005012514A1 (en) 2005-02-10

Family

ID=34114178

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2003/001548 WO2005012514A1 (en) 2003-07-31 2003-07-31 Novel sphinogmyelinase, the antibody against it, the antisense and the preparation method thereof

Country Status (2)

Country Link
AU (1) AU2003247216A1 (en)
WO (1) WO2005012514A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012162211A2 (en) * 2011-05-20 2012-11-29 Rush University Medical Center Antisense oligonucleotides against neutral sphingomyelinase and neutral sphingomyelinase inhibitor gw4869 for degenerative neurological disorders
US20120308568A1 (en) * 2010-02-04 2012-12-06 Ewha University-Industry Collaboration Foundation Pharmaceutical composition for inhibiting abnormal proliferation of cells

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20010045120A (en) * 1999-11-03 2001-06-05 남창우 Membrane-associated neutral ph optimum sphingomyelinase derived from bovine brain, process for purifying same and monoclonal antibody against same
WO2001066709A2 (en) * 2000-03-06 2001-09-13 Cancer Research Ventures Limited Sphingomyelinase enzymes and uses relating thereto
EP1258527A1 (en) * 2001-05-02 2002-11-20 SK Corporation Membrane-associated shingomyelinase derived from bovine brain, isolation method therfor and anti-sphingomyelinase monocional antibody

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20010045120A (en) * 1999-11-03 2001-06-05 남창우 Membrane-associated neutral ph optimum sphingomyelinase derived from bovine brain, process for purifying same and monoclonal antibody against same
WO2001066709A2 (en) * 2000-03-06 2001-09-13 Cancer Research Ventures Limited Sphingomyelinase enzymes and uses relating thereto
EP1258527A1 (en) * 2001-05-02 2002-11-20 SK Corporation Membrane-associated shingomyelinase derived from bovine brain, isolation method therfor and anti-sphingomyelinase monocional antibody

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ERNARDO K. ET AL.: "Purification and characterization of a magnesium-dependent neutral sphingomyelinase from bovine brain", J. BIOL. CHEM., vol. 275, no. 11, 2000, pages 7641 - 7647, XP002177719, DOI: doi:10.1074/jbc.275.11.7641 *
JUNG S.Y. ET AL.: "Identification of multiple forms of membrane-associated neutral sphingomyelinase in bovine brain", J. NEUROCHEM., vol. 75, 2000, pages 1004 - 1014, XP002177718, DOI: doi:10.1046/j.1471-4159.2000.0751004.x *
WASCHOLOWSKI V.: "Neutral sphingomyelinase as a target for drug design", DRUG NEWS PERSPECT., vol. 14, no. 10, 2001, pages 581 - 590 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120308568A1 (en) * 2010-02-04 2012-12-06 Ewha University-Industry Collaboration Foundation Pharmaceutical composition for inhibiting abnormal proliferation of cells
US9102942B2 (en) * 2010-02-04 2015-08-11 EWHA University—Industry Collaboration Foundation Pharmaceutical composition for inhibiting abnormal proliferation of cells
WO2012162211A2 (en) * 2011-05-20 2012-11-29 Rush University Medical Center Antisense oligonucleotides against neutral sphingomyelinase and neutral sphingomyelinase inhibitor gw4869 for degenerative neurological disorders
WO2012162211A3 (en) * 2011-05-20 2013-03-14 Rush University Medical Center Antisense oligonucleotides against neutral sphingomyelinase and neutral sphingomyelinase inhibitor gw4869 for degenerative neurological disorders
US9006205B2 (en) 2011-05-20 2015-04-14 Rush University Medical Center Antisense oligonucleotides against neutral sphingomyelinase and neutral sphingomyelinase inhibitor GW4869 for degenerative neurological disorders

Also Published As

Publication number Publication date
AU2003247216A1 (en) 2005-02-15

Similar Documents

Publication Publication Date Title
Ariyannur et al. Nuclear‐cytoplasmic localization of acetyl coenzyme a synthetase‐1 in the rat brain
Mao et al. Cloning and characterization of a mouse endoplasmic reticulum alkaline ceramidase: an enzyme that preferentially regulates metabolism of very long chain ceramides
EP1560847A2 (en) Acetylated hmgb1 protein
Sridevi et al. Ceramide synthase 1 is regulated by proteasomal mediated turnover
Adamus et al. Anti-recoverin antibodies induce an increase in intracellular calcium, leading to apoptosis in retinal cells
US7018839B2 (en) Peptide from soluble form of acetylcholinesterase, active as a calcium channel modulator
Nakashima et al. Inhibition of deubiquitinating activity of USP14 decreases tyrosine hydroxylase phosphorylated at Ser19 in PC12D cells
KR101384642B1 (en) A pharmaceutical composition containing N-terminal Truncated Ubiquitin C-terminal hydrolase-L1 as a active ingredient for the prevention and treatment of parkinson&#39;s disease
US6235879B1 (en) Apoptosis modulators that interact with the Huntington&#39;s disease gene
Chang et al. Identification of a novel interaction between the Ca2+-binding protein S100A11 and the Ca2+-and phospholipid-binding protein annexin A6
Tillement et al. Phosphorylation of RhoB by CK1 impedes actin stress fiber organization and epidermal growth factor receptor stabilization
Smith et al. A direct correlation between nicotinamide N-methyltransferase activity and protein levels in human liver cytosol
Kalisz et al. Incorporation of nitrotyrosine into α-tubulin by recombinant mammalian tubulin-tyrosine ligase
US20070298029A1 (en) Treatment of Neurodegenerative Diseases by the Use of Degs Inhibitors
Kuramochi et al. Characterization of mouse homolog of brain acyl-CoA hydrolase: molecular cloning and neuronal localization
WO2005012514A1 (en) Novel sphinogmyelinase, the antibody against it, the antisense and the preparation method thereof
KR100565437B1 (en) Novel sphingomyelinase, the antibody against it, the antisense and the preparation method thereof
Katsura et al. Functional involvement of benzodiazepine receptors in ethanol-induced increases of diazepam binding inhibitor (DBI) and its mRNA in the mouse brain
Sedehizade et al. Cellular expression and subcellular localization of the human Ins (1, 3, 4, 5) P4-binding protein, p42IP4, in human brain and in neuronal cells
Lee et al. Role of protein kinase C and tyrosine kinase activity in IFN-gamma-induced expression of the class II MHC gene
Ueno Involvement of fatty acid synthase in axonal development in mouse embryos
Nagatsu et al. Specific localization of the guanosine triphosphate (GTP) cyclohydrolase I-immunoreactivity in the human brain
KR100379240B1 (en) Process for purifying membrane-associated neutral ph optimum sphingomyelinase derived from bovine brain
JP4995399B2 (en) Cleaved BARD1 protein and its diagnostic and therapeutic uses
Huang et al. Development of a sandwich ELISA test for arginase measurement based on monoclonal antibodies

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: RULE 69 1 EPC

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP