WO2005003785A2 - Anti-inflammatory assay and compounds - Google Patents

Abstract

A method of identifying new lead anti-inflammatory agents based on the use of MNK and its action on AREBP(s) and subsequent effect on TNFcc expression is provided. The invention also relates to novel anti-inflammatory agents which disrupt MNK activity.

Description

ANTI-INFLAMMATORY ASSAY AND COMPOUNDS

BACKGROUND TO THE INVENTION

The present invention relates to a method of identifying new lead anti-inflammatory agents based on the use of MNK and its action on AREBP(s) and subsequent effect on TNF expression. The invention also relates to novel anti-inflammatory agents which disrupt MNK activity.

INTRODUCTION

Tumor necrosis factor (TNF) is crucial in controling inflammatory phenomena, and its expression is therefore tightly regulated. The synthesis and release of the secreted form of TNFα are regulated at several distinct levels. The 3 '-untranslated region (UTR) of the TNFα mRNA has been defined as playing the major role in the post-transcriptional control of TNFα expression in macrophages and in non-macrophage cell lines, [1]. Its AU-rich elements (ARE) can control the transport of the TNFα mRNA from the nucleus to the cytoplasm [2], decrease the stability of the message [3] and decrease the translatability of an associated chloramphenicol acetyltransferase reporter cistron [4]. Additional 3' -UTR elements present in the TNFα mRNA have been uncovered during reporter gene studies [4] and seem to be necessary for translational repression of TNFα [5]. Derepression of the translation of the TNFα mRNA is induced by lipopolysaccharide (LPS) stimulation in macrophages and this can be inhibited by dexamethasone [6], probably through inhibition of the JNK (c-Jun N- terminal kinase) signaling pathway [7] that targets the ARE [3]. Translational derepression of TNFα mRNA during induction by LPS has also been linked to its 3'-poly(A) processing [8]. Translation of TNF in monocytes-macrophages is also sensitive to the action of p38 MAP kinase (MAPK) inhibitors such as SB203580 [9]. MAP kinase-activated protein kinase-2 (MK-2), which is activated by p38 MAPK, is necessary for LPS-induced TNFα biosynthesis in murine macrophages [10]. The p38 MAPK inhibitors also inhibit the transcription and stability of the TNFα mRNA [11-13] and activation of p38 MAPK pathway is sufficient to stimulate the TNFα promoter in T cells [14]. Similarly, the Ras/Raf/MEKl/ERK signaling pathway has also been implicated in the LPS-induced activation of the TNFα promoter [15], in the transport of the TNFα mRNA from the nucleus to the cytoplasm [2] and in the derepression of the translational blockade normally imposed by the TNFα 3'-UTR in macrophages [15]. Control of the stability and translatability of the TNFα mRNA is believed to involve the interactions of specific proteins with the ARE [16-18]. hnRNP Ao, a protein that binds to the TNFα ARE, is an in vitro substrate for MK-2, and its interaction with cytokine mR As is regulated by the p38 MAPK pathway in macrophages (Rousseau et al, EMBO, 21:6505-6514, 2002). However, the signaling connections between the p38 MAPK pathway and the control of the translation of the TNFα mRNA remain unclear. T cells also synthesize and secrete TNFα. Some pathological situations are associated with overproduction of TNFα by T cells, as in superantigen-induced septic shock 20]. Several reports have shown that post-transcriptional regulation is important in the control of TNFα expression in stimulated T cells. In an animal model, removal of the inhibitory 3' -UTR of the TNFα mRNA resulted in a phenotype where the animals showed both inflammatory bowel disease and chronic inflammatory arthritis [3]. Interestingly, when these mice were crossed with Rag^{" "} mice (lacking T and B lymphocytes), only the latter phenotype was observed, suggesting that uncontroled production of TNFα by mature T and/or B cells was responsible for the inflammatory bowel disease. Activation-induced splicing of TNFα pre-mRNA could play a role in mediating the rapid production of TNFα seen in activated T cells [21]. In fact, a cw-acting element in the 3'-UTR can regulate splicing of the TNFα mRNA [22]. As in macrophages, the stability of the TNFα mRNA and its translatability appear to be controled in T cells [13,23]. In T cells, the protein kinases ERK, JNK and p38 MAPK seem to play a major role in controling the expression of TNFα [13,14,25]. MAP kinase signal-integrating kinase (Mnk) 1 is phosphorylated and activated by ERK1, ERK2 andp38 MAP kinases α/β in vitro and in vivo [26-28]. Studies conducted in vivo argue in favour of Mnkl as the physiological kinase acting on translation eukaryotic initiation factor (elF) 4E [28-30], the cap-binding protein that mediates recruitment of translation initiation complexes and the 40S ribosomal subunit to the 5'-end of the mRNA during translation initiation [31]. Mnkl, through its interaction with translation initiation factor eIF4G, phosphorylates eIF4E [28-29] and may phosphorylate other proteins involved in translation initiation [32]. These data implicate Mnkl in the regulation of the translational machinery. However, recent evidence suggests a negative role of Mnkl and Mnk2 in the general translation of capped mRNAs [30]. Given the important role that 3'-UTR-dependent translational control plays in regulation of TNFα synthesis in macrophages and the lack of parallel studies in T cells, we sought to determine the contribution that the 3'-UTR of the TNFα mRNA plays in controling the translation and stability of a reporter mRNA in T cells. We have also examined the roles played by the ERK and p38 MAP kinases, and their common substrate Mnkl, in the post- transcriptional regulation of TNFα synthesis in T cells. In this paper we present evidence indicating for the first time a role for Mnkl in promoting the translation of an mRNA containing the TNFα 3'-UTR.

It is an object of the present invention to provide a method of identifying potential new anti-inflammatory agents.

SUMMARY OF THE INVENTION

Thus, in a first aspect, there is provided a method for identifying an agent for use as a lead agent in treating an inflammatory condition, which method comprises: a) providing a MAP kinase signal-integrating kinase (MNK) polypeptide or a fragment, homologue, derivative or mutant thereof; b) contacting the MNK polypeptide, fragment, derivative or mutant thereof, with a test agent under conditions that would permit MNK to phosphorylate at least one AU-rich element binding protein (AREBP); and c) detecting whether said test substance is able to modulate the ability of said MNK polypeptide, a fragment, derivative or mutant thereof to phosphorylate said at least one AREBP. A lead agent identified by the above method may further be tested for its ability to modulate TNFα activity by administering the substance which has been determined to modulate MNK polypeptide, or a fragment, derivative or mutant thereof, and determining any modulatory effect of the substance on TNFα. Such agents or substances may also be referred to as agonists or antagonists. It will be understood that all references to MNK polypeptides, fragments, derivatives or mutants thereof, refer to MNK and variants which possess a kinase activity, which is easily testable in vitro by the skilled addressee. At least two forms of MNK are currently known [26,27] and the present invention encompasses both such MNKs Typically the aforementioned method may be conducted in vitro using a cell-free based method. That is, the components of the method may be provided in substantially or partially purified form from cell extracts and the like. Indeed this can be advantageous, as cell-based assays are generally more complex and costly to perform. In a second aspect there is provided a method for identifying an agent for use as a lead agent in modulating tumour necrosis factor α (TNFα) activity, which method comprises: a) providing a MNK polypeptide or a fragment, homologue, derivative or mutant thereof; b) contacting the MNK polypeptide, fragment, derivative or mutant thereof, with a test agent under conditions that would permit MNK to modulate TNFα activity; and c) detecting whether said test substance is able to have an effect on the ability of said MNK polypeptide, fragment, derivative or mutant thereof to modulate TNFα activity. Generally the method of the second aspect is carried out as a cell-based method, which could be conducted on isolated cells or alternatively in tissues or even in vivo. In this manner the MNK polypeptide, fragment, derivative or mutant thereof will be added to a cell which is capable of expressing TNFα. Exemplary cells include T cells, such as Jurkat T cells. Modulation of TNFα is likely to be an indirect modulation, by affecting the ability of AREBP(s), to act on TNFα mRNA. Moreover, the test agent could effect different parts of the pathway. For example the test agent may act to prevent/minimise phosphorylation of MNK and hence its ability to activate said AREBP(s); or the agent could disrupt the ability of MNK to bind said AREBP(s), or the AREBP(s) from binding TNFα mRNA. AREBP(s) according to the present invention include hnRNP JKT BP, hnRNP A0 and hnRNP Al . The term "modulation" refers to both positive and negative modulation. "Positive modulation", as used herein refers to an increase in the kinase activity of MNK, or a fragment, derivative, homologue or mutant thereof relative to the activity of MNK in the absence of said test agent or to AREBP(s) acting on TNFα mRNA. "Negative modulation" as used herein refers to a decrease in the kinase activity of MNK, or a fragment, derivative, homologue or mutant thereof relative to the activity of MNK in the absence of said test agent or to AREBP(s) acting on TNFα mRNA. In general, the term "polypeptide" refers to a molecular chain of amino acids with a biological activity. It does not refer to a specific length of the products, and if required it can be modified in vivo and/or in vitro, for example by glycosylation, myristoylation, amidation, carboxylation or phosphorylation; thus inter alia peptides, oligopeptides and proteins are included. The polypeptides disclosed herein may be obtained, for example, by synthetic or recombinant techniques known in the art. The term "homologues" refers to variants of MNK from different species which may not be identical in sequence but do have closely related functions. The term "mutants" refers to also mutations of said MNK protein which still result in a protein with kinase activity, but this could be increased or decreased with respect to wild-type MNK. It will be understood that for the particular polypeptides, homologues or mutants embraced herein, variations may occur due to polymorphisms that can exist between individuals or between members of the family. These variations may be demonstrated by (an) amino acid difference(s) in the overall sequence or by deletions, substitutions, insertions, inversions or additions of (an) amino acid(s) in said sequence. All such derivatives showing the recognised activity of wild-type MNK are included within the scope of the invention. For example, for the purpose of the present invention conservative replacements may be made between amino acids within the following groups:

(I) Serine, threonine;

(II) Glutamic acid and aspartic acid;

(III) Arginine and leucine; (IN) Asparagine and glutamine; (N) Isoleucine, leucine and valine;

(NI) Phenylalanine, tyrosine and tryptophan. Derivatives may also be in the form of for example a fusion protein wherein MΝK, a homologue, derivative or mutant thereof is fused, using standard cloning techniques, to another polypeptide which may, for example, comprise a reporter protein, a transcriptional activation domain or a ligand suitable for affinity purification (for example glutathione-S- transferase or six consecutive histidine residues). Detection of phosphorylated AREBP(s) may easily be achieved by using for example isotopic variants of phosphorous e.g γ³²P-ATP and detecting incorporation of ³²P into the AREBP(s) by kinase action of the MΝK, by for example separating the AREBP(s) by gel electrophoresis and detecting radioactive bands. Without wishing to be bound by theory, it is understood that Mnkl and Mnk2 phosphorylate specific sites in the AREBP hnRΝP Al [ Accession No. AAH74502 http://www.ncbi.nlm.nih.gov/entrez], namely at serine residues Ser 192, Ser 310, Ser 311 and Ser 312. These sites are understood to be phosphorylated in vivo in response to T-cell stimulation, which triggers TNFα synthesis. Advantageously, it has been found that phosphorylation of these sites is blocked by inhibitors of Mnkl and Mnk2, leading to an increase in the binding of hnRNP Al to TNFα mRNA. Detection of modulation of TNFα may be determined by, for example, observing expression of a reporter protein e.g. Green Fluorescent Protein (GFP) which has been generated from a construct comprising the reporter gene fused in frame to the TNF 3'-UTR. Active MNK serves to phosphorylate AREBP(s) which in turn bind the TNF 3'-UTR and subsequent increased expression of the associated reporter protein. Thus, in a further aspect of the present invention there is provided a method for identifying an agent for use as a lead agent in modulating TNFα synthesis, which method comprises: a) providing a hnRNP polypeptide or a fragment, homologue, derivative thereof comprising one or more of Serine residues 192, 310, 311 and 312 corresponding to Serine residues of hnRNP Al amino acid sequence [Accession No. AAH74502]; b) contacting the hnRNP polypeptide or a fragment, homologue, derivative thereof comprising of said one or more of Serine residues 192, 310, 311 and 312 with a test agent; c) detecting whether said test agent inhibits the ability of said Serine residues to be phosphorylated. Preferably, said hnRNP polypeptide or a fragment, homologue, derivative thereof comprises the peptides QEMASASSSQR and/or NQGGYGGSSSSSSYGSGR or fragment thereof, which comprise one or more of Serine residues 192, 310, 311 and 312 (marked as S, shown in bold type) as shown in Figure 10. Preferably, said hnRNP polypeptide is hnRNP A0, hnRNP Al, hnRNP A2, hnRNP D, hnRNP I, hnRNP K, hnRNP JKT BP or a fragment, homologue, derivative thereof. More preferably, said hnRNP polypeptide is hnRNP Al or a fragment, homologue, derivative thereof. Fragments, homologues, or derivatives of hnRNP are intended to encompass variants of hnRNP Al [Accession No. AAH74502; http://www.ncbi.nlm.nih.gov/entrez], which comprise one or more of Serine residues 192, 310, 311 and 312 but which maintain the activity of said hn RNP when phosphorylated to bind TNFα. In a further aspect of the present invention there is provided use of the peptide(s) QEMASASSSQR and/or NQGGYGGSSSSSSYGSGR or fragment thereof to identify inhibitors of TNFα activity. In a yet further aspect of the present invention there is provided the peptide(s) QEMASASSSQR and/or NQGGYGGSSSSSSYGSGR or fragment thereof for use in identifying agents which modulate the activity of TNFα. The term "modulate the activity of TNFα" is generally understood to mean an increase or decrease in the levels of synthesis of TNFα in the presence of said agent as compared to the levels of synthesis of TNFα when said agent is absent. The MNK or hnRNP polypeptide, fragments, derivatives, homologues or mutants thereof, used in the methods of the present invention may be obtained from mammalian extracts, produced recombinantly from, for example, bacteria, yeast or higher eukaryotic cells including mammalian cell lines and insect cell lines, or synthesised de novo using commercially available synthesisers. Preferably, the MNK or hnRNP polypeptide, fragments, derivatives, homologues or mutants thereof, used in the methods are recombinant. Candidate agents may be used for example in an initial screen in batches of, for example 10 substances per reaction, and the substances of those batches that show modulatory activity tested individually. Candidate substances which show activity in in vitro screens such as those described herein can then be tested in in vivo systems, such as mammalian cells which will be exposed to the substance and tested for, for example, altered expression of TNFα or nucleic acid associated therewith such as the TNFα 3'-UTR. Administration of candidate substances to AREBP(s), or cells may be performed by for example adding directly to the medium comprising the AREBP(s) or cell culture medium or injection into the cell. The assay is typically carried out in vitro. The candidate substance is contacted with the cells, typically cells in culture. The cells may be cells of a mammalian cell line. The invention further provides a substance capable of modulating the activity of MNK, or a fragment, derivative, homologue or mutant thereof or hnRNP polypeptide or a fragment, homologue, derivative thereof comprising at least one of Serine residues 192, 310, 311 and 312 corresponding to Serine residues of hnRNP Al amino acid sequence [Accession No. AAH74502], for use in treating the human or animal body by therapy or for use in diagnosis, whether or not practised on the human or animal body. Such a substance may thus be used in the prevention or treatment of, for example, inflammation, e.g. acute or chronic inflammation, rheumatoid arthritis, asthma, inflammatory bowel disease, atheroscelorsis, or psoriasis, as well as septic shock. The formulation of a substance according to the invention will depend upon the nature of the substance identified but typically a substance may be formulated for clinical use with a pharmaceutically acceptable carrier or diluent. For example it may be formulated for oral, rectal, nasal, topical, parenteral, intravenous, intramuscular, subcutaneous, intraocular or transdermal administration. A physician will be able to determine the required route of administration for any particular patient and condition. If, the substance is used in an injectable form, it may be mixed with any vehicle which is pharmaceutically acceptable for an injectable formulation, preferably for a direct injection at the site to be treated. The pharmaceutical carrier or diluent may be, for example, sterile or isotonic solutions. The dose of substance used may be adjusted according to various parameters, especially according to the substance used, the age, weight and condition of the patient to be treated, the mode of administration used and the required clinical regimen. A physician will be able to determine the required route of administration and dosage for any particular patient and condition.

The present invention will now be further described by way of example and with reference to the figures, which show:

Figure 1. Expression of GFP constructs in Jurkat T cells

A. Jurkat cells were transfected with 5μg of glob-GFP-glob or glob-GFP-tnf plasmids, and GFP fluorescence was determined by FACS analysis of living cells. B. Jurkat cells were transfected with lOμg of glob-GFP-glob or glob-GFP-tnf plasmids. GFP fluorescence was determined by FACS analysis of living cells. Mean linear fluorescence intensity (MFI) and the percentage of GFP-positive cells of the samples were determined and the expression was calculated as (% GFP-ve cells)x(MFI GFP-ve cells). The mean- of three independent experiments is represented (± SD). C. The production of GFP in transfected cells was determined by immunoblotting (WB) of total cell lysates with anti-GFP antibody. To verify similar loading in each lane of the western blot the same filter was reprobed with an anti-actin antibody. D. Aliquots of the transfected cells were lysed and total RNA was extracted and hybridised to the chimeric probe GFP-TNF (see Materials and Methods). The hybridised probe was treated with RNase and analysed on a urea-denaturing gel. The positions of the undigested probes are indicated by arrowheads. Arrows indicate the positions of protected fragments. Radioactivity in protected bands was determined by phosphorimager analysis of the gel. The ratio between the radioactivity of bands corresponding to GFP and GAPDH mRNAs of three independent experiments was calculated and represented in panel E (± SD)..

Figure 2. CD3+CD28 stimulation of transfected Jurkat T cells

A. Jurkat cells were transfected with 7μg of glob-GFP-tnf plasmid, and stimulated with anti- CD3 (αCD3) and anti-CD28 (αCD28) antibodies. Cells were harvested at different times after stimulation and analysed for GFP fluorescence. Values of GFP expression indicate the mean ±SD of duplicate points and are normalised to the value obtained for non-stimulated control samples. Where bars are not visible, this is because they are two small to be seen. B. Levels of expression of the GFP mRNA in the same samples analysed in (A) were determined by RNase protection assay (RPA). The positions of the undigested probes are indicated by arrowheads. Arrows indicate the position of protected fragments. The labeled antisense RNA probe used for GFP in the experiment shown was 231 nucleotides long and was generated as indicated in Materials and Methods (Probe 1). C. GFP/GAPDH ratio after quantitation of the radioactivity values in bands of gels of three independent experiments. Results are plotted as percentage of the maximum GFP mRNA expression at lh (± SD).

Figure 3. Roles of the ERK and p38 MAP kinase pathways in mediating TNF production in Jurkat cells.

Jurkat cells growing in DMEM 10%FCS, were pre-treated for lh with 30μM PD98059, lOμM SB203580 or DMSO vehicle, and stimulated with anti-CD3 plus anti-CD28 for 90min before harvesting. A. TNFα secretion in cell supernatant was determined by ELISA of duplicate samples, the average ± SD of three indpendent experiments is represented. B. The activation state of ERK1 and ERK2 was determined by immunoblotting (WB) with phospho-specific antibodies. Loadings in each lane of the western blot were visualised by reprobing the same filter with an anti-ERK2 antibody. C. Activation of p38 MAPK was assayed using an in vitro kinase assay with hsp25, a substrate for MAPKAPK2, a kinase downstream of p38 MAPK. The figure shows an autoradiograph of the fixed and stained gel.

Figure 4. PD098059 and SB203580 inhibit glob-GFP-tnf expression in αCD3+αCD28 stimulated cells

Jurkat cells were transfected with lOμg of plasmid glob-GFP-tnf, and 24h after transfection cells were pretreated for lh with 30μM PD098059 and 20μM SB203580 or DMSO vehicle, before stimulation with αCD3 plus αCD28. Green fluorescence of live cells was analysed by FACS (after 4h of stimulation). A. The histogram for FACS analysis shows the average ±SD of calculated expression for GFP-positive cells of duplicate samples. One experiment representative of a total of 3 is shown. B and C. Aliquots of the same cells analysed on (A) were used to extract total RNA and to analyse specifically GFP mRNA by RNAse protection assay as indicated in Fig. 2. The positions of undigested probes are indicated by the arrowheads (B). Arrows indicate the positions of protected fragments. The amount of radioactivity in protected bands of the gel was determined by phosphorimaging analysis and represented as GFP/GAPDH ratio in (C). One representative experiment from a total of 3 is shown. The labeled antisense RNA probe for GFP used in this experiment is 169 nt long and was generated as indicated in Materials and Methods (Probe 2).

Figure 5. Mnkl increases the expression of GFP protein from glob-GFP-tnf mRNA

Jurkat cells were transfected with lOμg of glob-GFP-tnf and 20μg of Mnkl constructs coding for wild type Mnkl (WT), a kinase dead form (T2A2), or empty vector (V). 24h after transfection, cells were harvested to analyse eIF4E phosphorylation and GFP expression. A. Levels of phosphorylation of endogenous eIF4E in transfected cells were determined by isoelectric focusing and immunoblotting with anti-eIF4E antibody. The positions of phospho- and dephospho-eIF4E are shown. The production of GFP in transfected cells was determined by immunoblotting (WB) of total cell lysates with anti-GFP antibody. To verify similar loading in each lane of the western blot the same filter was reprobed with an anti-actin antibody. B. The histogram for FACS analysis shows the mean ±SD of five independent experiments, each with duplicate determinations. GFP expression was calculated as indicated in Fig. 1. *, data significantly differ from "vector" values (p < 0.01, Student's t test). C. Aliquots of the same cells were used to extract total RNA and to analyse specifically GFP mRNA by RNAse protection assay. The amount of radioactivity in protected bands of the gel was determined by phosphorimaging analysis and represented as GFP/GAPDH ratio. The average ±SD of three independent transfections is represented. The labeled antisense RNA probe used for GFP is 231 nucleotides long and was generated as indicated in Materials and Methods (Probe 1). D. Translational efficiency (GFP protein)/(GFP mRNA) was calculated for samples represented in (B) and (C). The histogram shows the mean ±SD of the ratio (GFP protein)/(GFP mRNA) from three independent experiments shown in (B) and (C). *, Data significantly differing from "vector" values (p < 0.01, Student's t test). E. Titration of transfected Mnkl forms. Jurkat cells were transfected with lOμg of glob-GFP-tnf and increasing amounts of plasmids coding for the different forms of Mnkl, or empty vector. 24h after fransfection, cells were harvested to analyse GFP expression by FACS as in Fig. 2. Represented is the mean ± SD of three independent transfections, each with duplicate determinations. F. Jurkat cells were transfected with lOμg of glob-GFP-glob and 20μg of wild type Mnkl (WT) or empty vector (V). 24h after transfection, GFP expression in live cells was determined by FACS analysis. The mean ±SD of three independent transfections is shown. GFP expression was calculated as indicated in Fig. 1.

Figure 6. GFP mRNA polysome distribution in transfected cells

Jurkat cells were fransfected with lOμg of the glob-GFP-tnf and 40μg of Mnkl WT construct or empty vector used as control. A. Cytoplasmic mRNA was extracted and fractionated on a 10-30% Optiprep gradient. Fractions from a simultaneously-run gradient from untransfected Jurkat T cells was run on a formaldehyde-denaturing gel and ribosomal RNA stained with ethidium bromide to control the quality of the gradient. The positions on the gel of the 28S, 18S and 5S ribosomal RNA are indicated, and the fractions corresponding to 40S and 60S subunits and to polysomes are indicated. B. Fractionated RNA was hybridised simultaneously to GFP and GAPDH riboprobes and the level of GFP and GAPDH mRNAs in each fraction were quantitated by RNAse protection assay. Shown are those parts of the urea-denaturing gels where the protected GAPDH probe is localised. Radioactivity values of protected GAPDH bands are expressed as % of the total signal quantified by a phosphorimager. C. Shown are those parts of the same urea-denaturing gels as in (B) where the protected GFP probe is localised. Radioactivity values of protected GFP bands are expressed as % of the total signal quantified by a phosphorimager. A labeled antisense RNA probe for GFP of 169 nucleotides was generated as indicated in Materials and Methods and used in this experiment (Probe 2).

Figure 7. XYZ inhibits the in vivo production of TNFα

Jurkat cells growing in DMEM 10%FCS, were pre-treated for lh with increasing concentrations of XYZ [(N3-(4-Fluoro-phenyl)-lH-pyrazolo[3,4-d]pyrimidine-3,4-diamine); Ref. 30] or DMSO vehicle, and stimulated with anti-CD3 plus anti-CD28 for 90min before harvesting. A. Cell lysates were prepared and the state of eIF4E phosphorylation determined by isoelectric focusing (IEF) and immunoblotting with an anti-eIF4E antibody. One representative experiment from a total of 3 is shown. B. TNFα secretion in cell supernatant was determined by ELISA. The average ±SD of three independent experiments is shown. C. The activation state of ERK1/2 and p38MAPK was determined by immunoblotting (WB) with phospho-specific antibodies. As loading control anti-ERK2 antibody was used. D.Cells were incubated with XYZ at the concentrations mentioned for lh prior to the stimulation with CD3+CD28. After 30min stimulation, ³⁵S-methionine was added and cells incubated for a further 1.5h. Cells were than extracted and samples processed to measure incorporation of label into trichloroacetic acid-precipitable material. Incorporation was normalised to the protein content of each sample. The mean +/-SD of 2 independent experiments assayed in tripicates is shown.

Figure 8. MNK phosphorylates AREBPs in vitro

A. Schematic diagram of recruitment of MNK to the eIF4F complex bound to the 5 'cap of a messenger RNA. MNK binds the C-ter of eIF4G, scaffold protein that also binds eIF4E and PABP causing circularisation of the messenger. Arrows indicate the phosophorylation of eIF4E by the MNKs and the putative in vivo phosphorylation of proteins bound to the AU- rich element of TNFα.

B. MNK2 phosphorylates hnRNPs that bind the ARE of TNFα. Bound and eluted AREBPs were incubated in the presence or absence of p38 MAPK actived MNK2 and γ P-ATP. Proteins were separated by SDS-PAGE and the fixed and stained gel was autoradiographed. Labeled bands were identified by Mass Spectrometry. As a control the p38MAPK used to activate MNK2 inhibited with SB203580 was used.

C. MNK2 phosphorylates in vitro recombinant hnRNP-Al. An in vitro kinase assay was performed with p38MAPK activated MNK2 in the presence of either hnRNPAl or eIF4E, in vivo substrate for MNKs. As a confrol the p38MAPK used to activate MNK2 was used.

Figure 9. Mnk inhibition blocks the in vivo production of TNFα

Jurkat cells growing in DMEM 10% FCS were pre-treated for lh with increasing concentrations of CGP57380 or DMSO (the vehicle), and then stimulated with anti-CD3 plus anti-CD28 before harvesting. A. TNFα secretion was determined by ELISA in cell supernatants after 90min of anti-CD3/anti-CD28 stimulation. The average ±SD of three independent experiments is shown. B. Endogenous mRNA levels for TNFα and GAPDH were measured by RPA. Only the parts of the urea-denaturing gel where the protected GFP and protected GAPDH probes are localised are shown here. A representative experiment from three performed is shown. C. Radioactivity in protected bands in E was quantified by phosphorimager analysis of the gel. The ratio between the signal for bands corresponding to TNFα and GAPDH mRNAs was calculated and represented (±SD, n= 3). Figure 10. Mnks phosphorylate recombinant hnRNP Al in vitro at two specific sites

A. Identification of the sites in hnRNP Al phosphorylated by Mnkl . Purified hnRNP Al was phosphorylated in vitro by active Mnkl and subjected to SDS-PAGE. The band corresponding to hnRNP Al was excised, digested with trypsin and the resulting peptides were separated by reverse phase hydrophobic interaction chromatography on a C18 column equilibrated in 0.1% trifluoroacetic acid and developed with acetonitrile. ³²P-radioactivity is shown by the full line, and the acetonitrile gradient by the broken line. The masses of the two major tryptic phosphopeptides were obtained by MALDI-TOF, the sequence of the peptides and the sites of phosphorylation were identified by solid phase sequencing. B. Two- dimensional tryptic phosphopeptide map of hnRNP Al phosphorylated in vitro by Mnkl. The positions of the origin and the peptides containing the identified phosphorylation sites are indicated. Direction of chromatography (vertical arrow) and polarity of electrophoresis (plus and minus signs) are shown. C. Mnkl and Mnk2 phosphorylate the same sites in hnRNP Al in vitro. Shown are the two-dimensional tryptic phosphopeptide maps of hnRNP Al phosphorylated in vitro by Mnkl or Mnk2.

Figure 11. Analysis of phosphorylation of recombinant hnRNP Al (A-D) Two dimensional analysis of tryptic peptides from bacterially expressed hnRNP Al wild type (A), hnRNP Al S192A (B), hnRNP Al S311A (C) and hnRNP Al S310A S311A S312A (D), phosphorylated in vitro by Mnkl.

Figure 12. Analysis of phosphorylation of endogenous hnRNP Al (A-B) Endogenous hnRNP Al was immunoprecipitated from metabolically labelled Jurkat cells, digested with trypsin and the peptides were resolved on two-dimensional maps. Four maps are shown corresponding to hnRNP Al from unstimulated Jurkat cells (E), cells incubated with XYZ (CGP57380) for 45min (CGP57380, F), stimulated with anti-CD3/anti- CD28 for 30min (anti-CD3/anti-CD28, G) or pretreated with XYZ (CGP57380) prior to stimulation (anti-CD3/anti-CD28+CGP57380, H). The peptides containing the Mnk phosphorylation sites identified in vitro are indicated (arrows).

Figure 13. hnRNP Al binding to TNFα mRNA

A-B. Binding of bacterially expressed hnRNP Al to the TNFα oligoribonucleotide was analysed by surface plasmon resonance BiaCore analysis as described in Experimental Procedures. A. Binding profile. The oligoribonucleotide encoding for TNFα ARE (sample channel) or the irrelevant oligo (control channel) were attached to the sensor chip. Association and dissociation profiles were recorded for five different concentrations (15.6, 31.25, 62.5, 125, 250nM) of either phosphorylated or mock phosphorylated hnRNP Al (incubated with inactive Mnkl) B. The response level at the steady-state binding was plotted versus the log of the hnRNP Al concentration. Binding to the biotinylated irrelevant oligoribonucleotide was used as a measurement of non-specific binding and was subtracted from the binding observed with the TNFα oligoribonucleotide. C. hnRNP Al binds in vivo to TNFα mRNA. First panel shows the PCR product (ethidium bromide staining) corresponding to TNFα from RNA extracted from hnRNP Al immunoprecipitates. mRNA levels detected by RT-PCR from Jurkat cells either untreated or stimulated with anti-CD3/anti-CD28 in the absence or presence of CGP57380. As a control TNFα and GAPDH were amplified from a total RNA exfraction (lower panels).

Figure 14. Roles of p38 MAPK, ERK and the Mnks in the production of cytokines by T cells and macrophages.

A. Jurkat cells were prefreated with PD098059, SB203580 and or XYZ (CGP57380) and then either left untreated or stimulated with anti-CD3 and anti-CD28 for 4 hours. Supernatants were assayed for TNF-α or GM-CSF by ELISA. Protein levels from cells treated with the inhibitors are expressed as a percentage compared with stimulated cells in the presence of DMSO (vehicle for the inhibitors). Data are the means of three (TNFα) or two (GM-CSF) independent experiments ± S.E.

B. Adherent RAW 264.7 cells were pretreated or not with PD098059, SB203580 and/or XYZ (CGP57380) and then either left untreated or stimulated for 4 hours with LPS. Lysates were separated by SDS-PAGE and after transfer to polyvinylidene fluoride, membranes were probed with a TNFα or a MIP-2 specific antibody. EXPERIMENTAL

Chemicals and Antibodies

SB203580 and PD098059 (both from Tocris, Biogen, Madrid, Spain) are dissolved in DMSO at 20 or 60mM, respectively, and stored at -20°C. Anti-GFP was from Roche Diagnostics (Barcelona, Spain), anti-human actin was from Sigma- Aldrich (Madrid, Spain), anti-phospho- ERK1/2 was from New England Biolabs (UK). Anti-ERK2 and anti-GST antibodies were from Santa Cruz Biotechnology (Quimigranel, Barcelona, Spain). Anti-phospho-p38MAPK was from Cell Signaling. Anti-human eIF4E antibody was prepared as previously described [33]. Anti-CD3 is a mouse IgG2a monoclonal antibody (33-2A3 workshop II, a kind gift of Dr. R. Nilella, Hosp. Clinic, Barcelona, Spain), it was used as a hybridoma supernatant at 1 :1000 dilution, which was shown to produce maximum TΝFα secretion in Jurkat T cells. Anti-CD28 is a mouse IgM monoclonal antibody (CK243), (a kind gift of Dr. Pedro Romero (Ludwig Institute for Cancer Research, Lausanne Branch, Switzerland). It was used as a hybridoma supernatant at 1 :20 dilution, this having been optimised by titration to produce maximum TΝFα secretion in combination with anti-CD3 in Jurkat T cells (data not shown).

Plasmids

The plasmids containing the different forms of Mnkl used in this work fused to GST were described previously [27, 28]. Plasmid pCS3glob-GFP-glob was generated as follows. The fragment glob-GFP-glob was excised from plasmid pT7glob-GFP-glob (a gift from Dr.A.A.M. Thomas, Utrecht, the Netherlands [34]), containing chimpanzee β-globin 5'- and 3'- UTRs flanking the GFP sequence, by digestion with H dIII and EcoRI. This fragment glob-GFP-glob was subcloned downstream of CMN promoter into the vector pCS3+mT [28]. The human TΝFα 3'-UTR used in this work corresponds to a 823-bp EcoRI- EcoRI TNF gene fragment comprised of 573 3 '-terminal base pairs of the 3' -UTR (which contains the ARE elements), the polyadenylation site and downstream sequences. It was subcloned from the pWE15 cosmid containing the TNFα gene (a generous gift of V. Jongeneel, Ludwig Institute, Lausanne Branch, Switzerland) into pGEM-T (Promega, Innogenetics, Barcelona, Spain). The TΝFα 3 '-UTR fragment was excised from pGEM-T by digestion with Eαgl and Spel and subcloned into the plasmid pT7glob-GFP-glob opened at the same Eαgl and Spel sites downstream of the GFP coding region, and generating pT7glob-GFP-tnf.glob. Digestion of this plasmid with Bglll and Spel allowed purification of a GFP-tnf fragment that was substituted into the plasmid pCS3glob-GFP-glob generating pCS3glob-GFP-tnf. The constructs pCS3glob-GFP-glob, pCS3glob-GFP-tnf, were fully sequenced (ABI PRISMTM, Perkin-Elmer, Barcelona, Spain) before use in transfection experiments.

Cell culture and analysis of TNFα

Jurkat T cells were grown in DMEM containing 10% FCS. Where indicated, cells were freated with PD98059 and/or SB203580 for 1 h prior to stimulation. Cells that did not receive inhibitors received the vehicle solvent (DMSO). After several hours of stimulation with anti- CD3 and anti-CD28 antibodies (for the times indicated in figure legends), supernatants were harvested and assayed for levels of TNFα using the Becton Dickinson specific sandwich ELISA assay according to the manufacturer's instructions (Opteia human TNF, ref. 2637KI, Pharmingen, Becton Dickinson S.A., Spain) using 96-well flat bottom plates MaxiSorp (Nunc, Labclinics, Barcelona, Spain).

Western blotting

Cells were lysed in Laemmli sample buffer. The samples were heated at 95°C for 30min and run on SDS/PAGE. A 15% PAGE was used to analyse GFP, a 12.5% PAGE used to analyse ERK, and a 12% PAGE for Mnk. The proteins were blotted onto polyvinylidene difluoride membranes and detected by Western blot analysis. GFP was detected with a mixture of monoclonal antibodies raised in mouse, actin was detected with a polyclonal antibody raised in rabbit, ERK2 was detected with a polyclonal antibody raised in sheep, phosphor-ERKl/2 and phosphop-38MAPK with a polyclonal antibody raised in rabbit.

Assessment of phosphorylation of eIF4E

Cells were harvested in a buffer containing 20 mM Hepes (pH 7.4), 50 mM β- glycerophosphate, 0.2 mM EDTA, 1% Triton X-100, 10% glycerol, 1 μg/ml leupeptin, 1 μg/ml pepstatin, 1 μg/ml antipain, 1 mM benzamidine, and 1 mM dithiothreitol. Using 7- methyl-GTP-Sepharose (15 μl of slurry), eIF4E was pulled down from approx. 350 μg of extract as described in [35]. Sample buffer appropriate for a one-dimensional isoelectric- focusing gel was added [36]. Samples were run on a one-dimensional isoelectric-focusing gel, transferred to a polyvinylidene difluoride membrane, and proteins detected by Western analysis using a polyclonal raised in rabbit [37].

Transfections

Jurkat cells were diluted to 0.5x10⁶ cells/ml the day before transfection. The next day the cells were pelleted, washed in PBS, counted and resuspended to a final concentration of 5x10⁷ cells/ml in 0.2 cm-wide elecfroporation cuvettes (Invitrogen, Spain). Transient transfection was performed by the elecfroporation method. Briefly, 10 μg of plasmid DNA was transfected into 200 μl cell suspension (1700 μF, 72 Ω, 126 V, 30 ms, using a BTX 600). Cells were then seeded into Petri dishes at a final density of 5x10⁵ cells/ml. Experiments were carried out 24h post-fransfection. Cells (0.5x10⁶ in 1 ml) were taken directly from culture flasks into 3 ml tubes for FACS analysis, 1 μl of propidium iodide (0.07%) added, and maintained in ice and darkness before flow cytometry studies.

Flow Cytomefrv

Transgene-expressing cells were identified by flow cytometric analysis on an Epics XL flow cytometer (Coulter Corporation, Miami, Florida). Excitation of the sample was done using a 488nm air-cooled argon-ion laser at 15mW power. The instrument was set up with the standard configuration: Forward scatter (FS), side scatter (SS), green (525 nm) fluorescence for GFP and red (675nm) fluorescence for propidium iodide were collected. Cell populations were selected gating in an FS vs. SS dot plot, excluding aggregates and cell debris. Dead cells were detected and excluded of the analysis according to their propidium iodide incorporation. Red fluorescence emitted by propidium iodide was collected through a 675 nm band pass filter. Photomultiplier tube voltage was set at 800 V. Green fluorescence was collected using a 550 dichroic long pass filter and a 525 band pass filter; photomultiplier tube voltage was set at 730 V. Green fluorescence was represented in a logarithmic liistogram. Mean fluorescence intensity (MFI) of transfected cells was determined as previously described [38]. Optical alignment was based on optimized signal from 10 nm fluorescent beads (Flowcheck, Epics Division, Coulter Corp.). Time vs. fluorescence was used as a control of the stability of the instrument.

Ribonuclease protection assay and GFP probes.

RNase protection assays were performed as previously described [39]. Probe 1. A DNA fragment of 254bp was generated by PCR on the plasmid glob-GFP- tnf using the primers: "GFP forward" AGCAAGGGCGAGGAG and "T7-GFP reverse" GAATTCTAATACGACTCACTATAGGTGTGGTCGGGGTAGC. T7 polymerase generates from that fragment an antisense RNA of 231 nt. The protected fragment after hybridisation with GFP RNA and digestion with RNases A and Tl has 229 nt, 2 nt difference from the non- digested one. Probe 2 was prepared similarly as probe 1, but using the following GFP primers: "GFP forward" ATCACTTACACAAGTTCAGCGTGTC and "T7-GFP reverse" GAATTCTAATACGACTCACTATAGGTGTGGTCGGGGTAGC which generate a fragment of 192 bp. T7 polymerase generates from this fragment an antisense RNA of 169 nt. The protected fragment after hybridisation with GFP RNA and digestion with RNases A and Tl has l59 nt. A chimeric probe GFP-TNF was prepared from a DNA fragment generated by PCR on the plasmid glob-GFP-tnf, using the following primers: "GFP forward" AGTGCTTCAGCCGCTACCC and "T7-TNF reverse"

GAATTCTAATACGACTCACTATAGGTCCAGATTCCAGATGTCAGG, and cloning the amplified fragment into the vector pSTBlue-1 (Novagen, Bionova, Madrid, Spain). The recombinant plasmid was digested with Fokl. T7 polymerase generates from Fok I-digested plasmid an antisense RNA of 494 nt. The protected fragment when probing samples containing glob-GFP-glob mRNA contains 337 nt. When probing samples containing glob- GFP-tnf mRNA, the protected fragment is 434 nt long.

Polysome gradients

Polysome separation was performed as described in [40]. In brief, cells were lysed in NP-40 lysis buffer ( 0.2% Nonidet P-40, 40 mM KC1, 3 mM MgCl₂, 5% glycerol, 10 M Tris-HCl, 5 mM dithiothreitol, 50 Units RnaseOUT (Life technologies S.A., Spain), cycloheximide lOOμg/ml, pH 7.5). Cytoplasmic extracts were loaded onto pre-prepared Optiprep (Sigma- Aldrich, Madrid, Spain) gradients (0-40% Optiprep in 10 mM Tris-HCL, 40 mM KC1, 3 mM MgCl ,pH 7.5 buffer, final volume 10 ml) and centrifuged in a SW28 rotor for 2 h , 28,000rpm at 4°C . Total RNA was purified from resulting fractions (500 μl) by exfraction with phenol/chloroform/isoamyl alcohol (25:24:1) and precipitation in ethanol. Subsequent RNase protection analysis was performed as described above.

Protein synthesis assay Cells were freated as usual and 1.5h before harvesting 1.5μl (15μCi) of S-methionine was added. Cells extract was obtained and V of the sample was spotted on label squares of 3MM paper, 3 for each treatment. Papers were boiled in 5%TCA for 2min two times. They were than rinsed in 100% ethanol, dried in the oven and put in scintillation vials with 3ml scintillation fluid. ³⁵S incorporation was measured in the scintillation counter, and the results normalised to the protein content of each sample measured with Bradford solution.

AREBPs pull down or RNA affinity chromatography

Streptavidin-coated magnetic beads were made RNAse free and bound to a biotinylated RNA oligonucleotide encoding the AU-rich region of TNFα.

(UUAUUAUUUAUUAUUUAUUUAUUAUUUAUUUAUUU) according to the manufacturer's instructions (Dynal). The 5 'biotinylated oligo was synthetized in vitro and then deprotected and gel purified according to standard protocols. Jurkat cells were washed twice with cold PBS and lysed in buffer A (50mM Tris-HCl pH=7.4, 150mM KC1, O.lmM EDTA, 1% (w/v) NP-40, 4mM DTT, 20mM NaF, 40mM sodium β-glycerophosphate, 2mM sodium orthovanadate, 50U/ml of RNAsin and protease inhibitors (Leupeptin, Benzamidine, Antipsin, Pepstatin and PMSF). Cell extract was incubated with the RNA oligo bound beads in binding solution, equal volumes of buffer A (lysis buffer) and buffer B (25mM Tris HCl pH=7.4, 0.5% NP40, lOOmM KC1, 20mM β- glycerophosphate, ImM orthovanadate, lOmM aF, 5mM MgCl₂, and just before use RNAsin and protease inhibitors were added). The beads were than washed 3 times in buffer C (25mM Tris-HCl pH=7.4, lOOmM NaCI, 5mM MgCl₂, RNAsin), and the AREBPs resuspended in buffer D (25mM TrisHCl pH=7.4, lOOmM NaCI, 5mM MgCl₂, 5% glycerol), boud AREBPs or eluted in buffer D containing 1.5M NaCI. Eluted AREBPs were dialysed O.N against buffer D and were than ready to use in the in vitro kinase assay.

Kinase assay

Recombinant his-tagged MNK was activated in vitro with active SAPK2α (DSTT) in kinase buffer (lOOmM HepesKOH pH=7.4, 250mM KC1, 50mM MgCL₂, 25% glycerol, ImM DTT and 0.5mM Na₃VO₄) in the presence of lOOμM ATP. After 2h at 30°C, SB203580 at a final concenfration of lOμM was added. Active MNK was used to in vitro phosphorylate eluted and bound AREBPs in the presence of 100μM ATP and γ³²P-ATP. Phosphorylated AREBPs were separated in a 15% acrylamide/bisacrylamide gel, hot bands detected by autoradiography were cut and the phosphorylated proteins identified by Peptide Mass Fingerprinting. EXAMPLES SECTION

Example 1: The 3'-UTR of the TNF a mRNA suppresses its stability and translation in Jurkat cells

In order to study the regulatory role of sequences in the 3'-UTR of the TNFα mRNA in controling protein expression, we fused the TNF 3'-UTR to the GFP reporter gene. As a confrol plasmid, GFP was linked to the β-globin 3'-UTR. Both reporter constructs also contain the 5'-UTR from the β-globin mRNA. Jurkat cells were fransfected with each of these vectors and expression of the reporter, GFP, was monitored in live cells by FACS analysis. 62% of the cells fransfected with the glob-GFP-glob vector expressed GFP above the threshold level. The proportion of cells expressing GFP from the glob-GFP-tnf mRNA was much lower, at around 9% (Fig. 1A). In these transient transfections, the expression of GFP in individual cells within the population is highly heterogeneous. Therefore, the median fluorescence intensity of the whole cell population was calculated according to Kar-Roy et al. This is shown in Fig. IB for three independent experiments. GFP expression is 15 fold higher in cells transfected with glob-GFP-glob than for the cells that received glob-GFP-tnf. To further confirm these differences in GFP expression, cell lysates were analysed by western blotting using anti-GFP antibodies. The data in Fig. IC verify that the level of GFP expression was many fold higher in the glob-GFP-glob fransfected cells than in the glob-GFP- tnf transfected ones. This marked difference in the expression of GFP from the two mRNAs could be due either to differences in their levels of expression or in their translation. The transcript levels were therefore examined by RNAase protection assay (RPA, see methods) using GAPDH as a confrol for normalisation. Fig. ID shows a typical set of data. When normalised against the levels of GAPDH, and calculated for three independent experiments, the difference in transcript levels is about 2.5 fold (Fig. IE). Thus, although the level of the glob-GFP-glob transcript is higher than that of the transcript containing the TNFα 3'-UTR, this difference is much too small to account fully for the difference in GFP expression. This indicates that additional effects must play an important role in regulating GFP synthesis from an mRNA containing the TNFα 3' -UTR. Given that both mRNAs encode the same protein, the most likely explanation of these findings is that the TNFα 3'-UTR also negatively influences the translation of the encoded mRNA. We next analysed whether stimulation of the T-cell receptor (TCR) and the co- stimulatory molecule CD28 influenced the levels of the mRNA containing the TNFα 3'-UTR or the expression of the protein it encodes. Both stimuli are necessary for fully T-cell activation (ref.). Jurkat cells were therefore challenged simultaneously with antiCD3 (αCD3) and antiCD28 (αCD28) antibodies, hi unstimulated cells, the levels of the glob-GFP-glob mRNA were much higher than those of the mRNA containing the TNFα 3'-UTR. To ensure that we remained within the linear range of the analysis, we subsequently transfected cells with less of the former vector (5 μg) than of the latter (10 μg). As shown in Fig. 2 A, the level of expression of GFP from the glob-GFP-glob mRNA was almost unchanged after stimulation of the cells, while the level of GFP derived from the glob-GFP-tnf mRNA rose quickly and markedly after freatment with αCD3/CD28. This effect was sustained up to 7 h after addition of the antibodies. We again assessed the levels of the transcripts by RPA (Fig. 2B) and while it was clear that αCD3/CD28 did increase the levels of the glob-GFP-tnf transcript, this effect was transient. Furthermore, even the maximal extent of the effect on transcript levels (about 5- fold) was smaller than the magnitude of the sustained effect on the levels of GFP itself. Thus, the effect on GFP synthesis clearly cannot be explained solely by the changes in levels of the transcript. The changes in mRNA level were much greater for the mRNA containing the tnf 3'- UTR (Fig. 2B,C) than for the globin 3'-UTR confrol, where no change in mRNA levels was observed (data not shown). Since both reporters are driven by the same promoter, the differences cannot be attributed to changes in transcription, and are more likely due to modulation of transcript stability.

Example 2: Regulation of TNF a synthesis in Jurkat cells involves signaling through the ERK andp38 MAP kinase pathways

We considered important also to study the regulation of the production of endogenous TNFα in growing Jurkat cells in response to stimulation with αCD3/CD28. To address which signaling pathway(s) are important for the increased expression of TNFα we employed two signaling inhibitors. These are PD098059 (which inhibits MEK, an upstream kinase of ERK in the classical MAP kinase pathway [41,42]) and SB203580 (which inhibits ρ38 MAP kinases α and β [43]). When used individually, each partially inhibited the marked increase in TNFα production caused by αCD3/CD28 (Fig. 3 A) and the combination of both completely blocks the production of TNFα. This suggested that both pathways are required for the effect. To rule out the alternative possibility that these inhibitors did not completely block the pathways, we examined the phosphorylation of ERK and the activity of MK-2, a downstream effector of p38 MAP kinase α/β [44]. As shown in Fig. 3B, PD098059 essentially completely blocked activation of ERK, as manifested by its phosphorylation at the T-loop sites. αCD3/CD28 also activate the p38 MAP kinase pathway, and this effect was blocked by the SB203580. We consistently observed that SB203580 actually enhanced the phosphorylation of ERK. This is in agreement with other studies showing that phosphorylation and activation of p38α enhances its interaction with ERK1/2, blocking ERK1/2 phosphorylation by MEK1 [45]. The observation that the effect of SB203580 is smaller than that of PD098059 could reflect either a lesser involvement of this pathway in activation of TNFα production, or its ability to activate ERK, which clearly also plays a role here. These data imply that the expression of endogenous TNFα is regulated through signaling events that require both the classical (ERK) and p38 MAP kinase pathways. We therefore then studied the effects of the signaling inhibitors on the expression of GFP from our reporter constructs. As shown in Fig. 4A, a combination of PD098059 and SB203580 almost completely blocked the enhanced expression of GFP from the glob-GFP-tnf reporter that is seen in response to αCD3/CD28. We also examined the effects of these drugs on transcript levels, looking in this case at the earlier time point of lh, at which changes in transcript levels are maximal (Fig. 2C). As observed earlier in this study, the effect of αCD3/CD28 on transcript levels was much smaller than the effect on GFP production, implying a role for translational control in modulating its expression. Fig. 4B shows that PD098059 and SB203580 also blocked the change in transcript levels. It therefore appears that these pathways regulate both the translation of the glob-GFP-tnf reporter mRNA and its level of expression (probably via changes in mRNA stability).

Example 3: Expression of Mnkl enhances translation of a reporter mRNA containing the TNFa 3^>-UTR

The Mnks are regulated through both the signaling pathways that modulate TNFα and GFP reporter expression in the Jurkat cells, i.e., the ERK and p38 MAP kinase pathways. In particular, Mnk 1 has a low basal activity that is enhanced by activation of either ERK or p38 MAP kinase [33] and is thus a candidate for mediating these effects. To study the role of Mnkl we co-transfected Jurkat cells with our reporter constructs and either vector encoding Mnkl or the corresponding empty vector. We also made use of Mnkl T2A2, a mutant of Mnkl in which Thrl97 and 202 within the T-loop have been mutated to alanines. Waskiewicz et al. reported [27] that this mutant does not undergo autophosphorylation and has much lower activity against eIF4E than the wildtype protein. Nonetheless, we have consistently observed that in vivo overexpression of Mnkl T2A2 in 293 induces some eIF4E phosphorylation by an unknown mechanism. As expected, transfection of cells with WT Mnkl resulted in a marked increase in the state of phosphorylation of the known Mnk substrate, eIF4E, above the almost undetectable levels seen in untransfected cells (Fig. 5A). This demonstrates that Mnkl is expressed in functional form in these cells, and is active without further stimulation of the cells. In contrast, the T2A2 mutant elicited only a very small increase in eEF4E phosphorylation. Expression of WT Mnkl markedly increased the expression of GFP encoded by glob-GFP-tnf, while the T2A2 mutant had no obvious effect on GFP expression, as assessed by western blotting (Fig. 5 A). To study this effect further, we also quantified GFP expression by FACS analysis of the cells (Fig. 5B). Again, it is clear that WT Mnkl strongly increases GFP expression, and in this case a modest stimulatory effect of the T2A2 mutant was also evident. The earlier data show that the ERK and p38 MAP kinase pathways affect both the stability and the translation of the glob-GFP-tnf reporter. It was therefore important to assess whether expression of Mnkl affected either or both of these parameters. As shown in Fig. 5C, if anything, expression of WT Mnkl slightly repressed the level of the glob-GFP-tnf reporter mRNA (when normalised to GAPDH), although the effects did not reach statistical significance. A smaller trend towards decreased transcript levels was also seen in cells expressing Mnkl(T2A2). This indicated that the stimulatory effect of Mnkl on GFP expression was not due to increases in mRNA levels. To assess its effects on the translation of the mRNA, we calculated the 'translational efficiency' defined as 'GFP protein levels '/'transcript levels'. It is clear from Fig. 5D that expression of WT Mnkl greatly enhances this ratio, while the expression of the T2A2 variant has a smaller stimulatory effect. We also examined the effect of increasing amounts of Mnkl or the T2A2 mutant on GFP expression. Fig. 5E shows that, as the amount of Mnkl DNA used in the transfection was increased, so the level of GFP expression also rose. There may be a tlireshold effect here, as low levels of DNA (1 or 3 μg) had no detectable effect on GFP expression while larger amounts elicited a marked increase, although studying the possible basis of this lies beyond the scope of this investigation. As mentioned above, the best known substrate for Mnkl is the general translation factor eIF4E, which binds to the 5 '-cap of all cytoplasmic mRNAs [28,29]. It was therefore important to assess whether this stimulatory effect of Mnkl on the glob-GFP-tnf mRNA was merely an effect on translation of mRNAs in general, or specific to this mRNA. To test this, we made use of the glob-GFP-glob reporter. Although transfection with Mnkl did bring about a small increase in expression of GFP from this mRNA (barely significant, p=0.043 in a Student's t test) (Fig. 5F), this effect was very much smaller than the four-fold increase seen for expression of GFP from the glob-GFP-tnf reporter (p=0.009 in Student's t test). Thus, although expression of Mnkl may have a modest effect on the globin confrol, the effect on the mRNA containing the TNF 3'-UTR is much greater. The above data show that Mnkl increases the translational efficiency of the reporter mRNA containing the TNF 3' -UTR. An increase in translational efficiency should be manifested as a shift in the mRNA into polysomal material, i.e., its association with active ribosomes. To study this, we fractionated lysates from Jurkat cells fransfected with the glob- GFP-tnf reporter and either a vector encoding Mnkl or the empty vector. Fractions were collected and analysed by RPA for the reporter mRNA or for GAPDH, as a control. Fig. 6A shows an ethidium bromide stained gel of the fractions illustrating the positions of 18S and 28S rRNA, and thus of 40S and 60S ribosomal subunits. Fractions 15 and above contain polysomal material, while the earlier fractions presumably contain inactive mRNAs. In both cases, the GAPDH mRNA was found almost entirely within the polysomal material (Fig. 6B). This housekeeping mRNA thus appears to be translated with high efficiency and this was not affected by expression of Mnkl . i contrast, much of the reporter mRNA was found in the non-polysomal fractions of the same gradients. In cells in which Mnkl is not overexpressed, only 33%) of the RNA was associated with polysomes. Expression of Mnkl both increased the proportion of the glob-GFP-tnf mRNA that was associated with polysomes (to 50%) and especially increased the amount associated with the largest polysomes (the final two fractions), which together account for 30%o of the mRNA in the Mnkl expressing cells. These data confirm that Mnkl enhances the efficiency with which the glob-GFP-tnf reporter is translated in Jurkat cells. Example 4: In vivo production of TNFα is inhibited by the MNK inhibitor XYZ

To study the in vivo role of MNKs in TNFα production, we made use of the MNK inhibitor XYZ [(N3-(4-Fluoro-phenyl)-lH-pyrazolo[3,4-d]pyrimidine-3,4-diamine); Ref. 30]. The increase on eIF4E phosphorylation due to T-cell activation (CD3+CD28 triggering) is prevented by the addition of XYZ, being almost completely blocked at 40μM final concenfration (Fig. 7A). At the same time the production of TNFα measured by ELISA of cell supernatants was also inhibited in a dose-dependent manner (Fig. 7B), suggesting a direct involvement of the MNKs in the regulation of TNFα in vivo. To determine the specificity of the inhibitor, we checked whether the ERK or p38MAPK were also inhibited and as shown in Fig. 7C this was not the case. To rule out the possibility that inhibition of MNK and thus dephosphorylation of eIF4E could be inhibiting the total protein synthesis, we measure ³⁵S incorporation in cells stimulated with αCD3+αCD28 plus increasing amounts of XYZ. Although eIF4E is not phosphorylated in the presence of 40μM XYZ, the total protein synthsis is only slightly inhibited (Fig. 7D). All these data together show for the first time a direct involvement of MNK in the translation of a specific mRNA, TNFα mRNA. These results are also supported in Figure 9.

Because eIF4E recognises all 5 'cap structures we hypothesis that a MNK substrate other than eIF4E and specific for certain mRNAs might be involved. The mRNAs of cytokines, oncoproteins, growth and transcription factors, are well known for carrying AU-rich elements in their 3 'UTR involved in the regulation of both stability and translation of the messenger through binding of protein complexes. Because MNK binds the C-terminus of eIF4G, a scaffold protein that at the same time binds eIF4E and PABP causing mRNA circularisation, it might be physically close enough to phosphorylate and regulate proteins bound to the AU- rich element (AREBPs) as shown in Fig. 8A. To test this hypothesis we used a biotinilatyed RNA oligo encoding for the ARE of TNFα to pull down AREBPs from Jurkat cell exfract. An in vitro kinase assay was than perform on this protein complexes with active MNK1 and 2, and in vitro substrates of MNKs were identified by incorporation of γ³²P-ATP. We obtained similar results using either MNK1 or MNK2, Fig. 8B shows a typical autoradiograph of labelled proteins separated by SDS-PAGE identified by peptide mass fingerprinting. To further test the validity of the results obtained we got hold of recombinant hnRNP Al, one of the AREBPs identified, and as shown in Fig. 8C recombinant hnRNP Al is a substrate in vitro for MNK2. Example 5 Mnks phosphorylate recombinant hnRNP Al in vitro at two specific sites

As depicted in Figure 10 sites have been identified in hnRNP Al that are phosphorylated by Mnks. These sites contain Serine residues Ser 192, Ser 310, Ser 311 and Ser 312. These sites are phosphorylated in vivo in response to T-cell stimulation, which triggers TNF synthesis, and their phosphorylation is blocked by the Mnk inhibitor XYZ (CGP57380) - see Figure 12.

Example 6 hnRNP Al binding to TNFαmRNA

The phosphorylation of hnRNP Al impairs its binding to an oligonucleotide containing the AREs of the TNFαmRNA in vitro (Figures 13A and 13B). The Mnk inhibition also increases binding of hnRNP Al to the TNFαmRNA in vivo, following stimulation of T cells (Figure 13 C)

Example 7 Roles of p38 MAPK, ERK and the Mnks in the production of cytokines by T cells and macrophages

Mnk inhibition also blocks synthesis of TNFα in macrophages and the production of other cytokines (whose mRNAs contain AREs) such as GM-CSF in T-cells and MIP-2 in macrophages (Figure 14)

DISCUSSION

In murine macrophages, the TNFα 3'-UTR confers instability upon, and represses the translation of, its own mRNA and of chimaeric reporter mRNAs [4]. The results presented in this paper indicate that the TNFα 3'-UTR also has similar effects on a heterologous reporter mRNA in a human T cell line. Furthermore, we provide evidence that both the stability and the translation of the glob-GFP-tnf mRNA are enhanced following TCR/CD3 stimulation (Fig. 2). The transient nature of the CD3/CD28-induced increase in the level of the glob-GFP- tnf mRNA would be consistent with this mRNA having a half-life of lh- 2h (Fig. 3 and Fig. 4), similar to that reported for the whole TNFα mRNA in CD3/CD28-stimulated T cells [23]. The increase in glob-GFP-tnf mRNA levels observed after anti-CD3 plus anti-CD28 stimulation (Fig. 4) cannot be explained by increased transport from nucleus to cytoplasm [2], because our analyses of TNFα mRNA levels were performed with total cellular RNA. Similarly, a mechanism based on activation-induced splicing [21] of glob-GFP-tnf nuclear pre-mRNA can be excluded as the GFP constructs used here lack introns. Therefore, the increase in the level of glob-GFP-tnf mRNA elicited by stimulation of cells with anti- CD3/CD28 can only be explained by a transient stabilisation of the glob-GFP-tnf mRNA. The regulatory function of the TNFα 3'-UTR during T cell activation is probably mediated through its recognition by ARE-binding proteins. Bohjanen et al. [46] demonstrated that, during T cell activation, an inducible protein, AU-B, interacts specifically with the TNFα ARE. Unfortunately, this protein was not identified or further characterised. Mitogenic levels of anti-CD3 are able to up-regulate HuR, a protein that can stabilise a TNFα ARE- containing mRNA [4pj,47]. Alternatively, TNFα mRNA destabilising proteins such as tristetraprolin could also be involved in the regulation of the glob-GFP-tnf mRNA observed in this study. [16,17]. However, it is not known whether the activity of human tristetraprolin is regulated during T cell activation. Based on the effect of the SB203580 compound, the ARE of the TNFα 3'-UTR also have been defined as a target of p38 MAPK for modulation of the translation and stability of the TNFα mRNA in murine macrophages [3]. Stimulation of human T cells with antigen activates the ERK and p38 MAP kinase pathways [48] and both pathways positively modulate TNFα production [13,14,Aj3|], in agreement with the present data for Jurkat cells. When these cells were prefreated with PD098059 and SB203580 the increase in glob-GFP-tnf mRNA accumulation due to CD3 and CD28 stimulation was inliibited (Fig. 4B/4C), probably due to a blockade of TNFα mRNA stabilization during T cell stimulation, and indicating that CD3 targeting of TNFα 3'-UTR requires signaling through the ERK and or p38 MAP kinase pathways. A similar mechanism of destabilization of TNFα mRNA upon freatment of human macrophages with the inhibitors SB203580 and PD098059 has been recently proposed [12]. Given that PD098059/SB203580 block completely both the 7-fold increase in protein expression and the 2-fold increase in mRNA levels due to CD3 and CD28 stimulation, it is likely that the ERK and p38 MAP kinase pathways also act to enhance the translation of the reporter containing the TNFα 3' -UTR apart from stabilizing the messenger. The expression of TNFα in human T cells has previously been shown to be confroled at the level of translation [13,24]. However, the region of the TNFα mRNA involved in this effect had not previously been investigated. Our data suggest that the 3'-UTR of the TNFα mRNA reduces both mRNA translation and stability, and that these effects are negated by signaling events involving the ERK and p38 MAP kinase pathways. Mnkl is activated by both the ERK and p38 MAP kinase pathways [26,27] and was thus a potential candidate for a role in stabilising the glob-GFP-tnf reporter and/or enhancing its translation. However, overexpression of active Mnkl in Jurkat T cells did not give rise to the increase in glob-GFP-tnf mRNA levels observed when cells were activated through TCR CD3 (Fig. 5C). Mnkl does not therefore appear to modulate the stability of this mRNA. Our data suggest that Mnkl acts instead to promote the translation of an mRNA containing the TNFα 3 '-UTR. It is likely that the p38 MAPK pathway regulates the stability of the mRNA through another subsfrate, MK-2, which has already been shown to be involved in the stabilisation of cytokine mRNAs [49] and in TNFα biosynthesis [Ijϋ]. We show here that overexpression of Mnkl overcomes the translation-inhibitory effect of the TNFα 3'-UTR. Comparison of the distribution in a polysome gradient of glob- GFP-tnf mRNA from Jurkat cells fransfected with empty- vector and Mnkl indicates that Mnkl promotes the recruitment of glob-GFP-tnf mRNA into polysomes. This is reminiscent of the LPS-stimulated association of TNFα transcripts with polysomes in the macrophage cell line Raw 264.7 [8]. However MNKs not only regulate a reporter construct carrying the 3 'UTR of TNFα but also regulate endogenous TNFα. The TNFα production in T-cells stimulated by αCD3+αCD28 is almost completely blocked by the addition of the MNK inhibitor XYZ,. This effect seems specific since XYZ does not affect activation of either ERK or p38MAP kinases and does not block general protein synthesis. The best-known substrate for Mnkl is the cap-binding translation factor eIF4E [28,29]. The results presented here (Fig. 5) indicate that the overexpression of Mnkl elicits increased phosphorylation of eIF4E in Jurkat T cells, consistent with its reported function in other cell types [28-30]. Recently, it has been reported that, in cell lines stably transfected with appropriate cDNAs, Mnkl and Mnk2 each exert modest inhibitory effects on cap- dependent protein synthesis [30]. However, we did not see an inhibitory effect of Mnkl on the levels of the polysomal GAPDH mRNA, perhaps because we analysed endogenous GAPDH while only a modest percentage of the cells are transiently fransfected and express Mnkl. Indeed, transient fransfection of cells with active Mnkl only results in partial phosphorylation of the endogenous eIF4E. Taken together with the data showing that Mnkl expression increases the recruitment of glob-GFP-tnf mRNA into polysomes, our data suggest that the Mnkl -induced increase in glob-GFP-tnf mRNA franslation is achieved by the activation of initiation onto this mRNA, presumably by overcoming an inhibition imposed by the TNFα 3'-UTR. Since eIF4E binds to the 5 '-end of all cytoplasmic mRNAs, it is thus hard to explain an effect of Mnkl on the translation of specific cytokine mRNAs in terms of the phosphorylation of this general translation factor. It is perhaps more likely that the stimulatory effect of Mnkl expression on reporter mRNA translation reflects its action on additional target proteins, e.g., proteins that bind the 3'-UTR of the TNFα mRNA. MK-2 has been shown to be necessary for LPS-induced TNFα biosynthesis in murine macrophages [10]. Mice lacking MK-2 show a reduction of approximately 90%> in the production of LPS-inducible TNFα, whereas the level of its mRNA is not repressed. These and other data [g ] suggest that MK-2 provides a positive input to the translation of the TNFα mRNA. The present data show that Mnkl can also mediate activation of TNFα translation. The Mnkl input may explain the role of the ERK pathway in modulating TNFα synthesis in Jurkat cells. MK-2 cannot be responsible for this input as it is not activated by ERK [1| | ] Although human Mnkl shares significant similarity with MK-2, with a 34% amino acid identity in their kinase domains [26], they have distinct subsfrate specificities. For example, Mnkl does not phosphorylate a peptide subsfrate for MK-2 [26] while MK-2 cannot phosphorylate eIF4E in vitro [p3J]. It may therefore be that MK-2 and Mnkl phosphorylate different proteins that bind to the AREs of the TNFα mRNA, thereby regulating its stability and franslation. It is already known that an ARE-binding protein, hnRNP A0 is an in vitro substrate for MK-2, and that its interaction with the AU-rich elements is regulated through the p38 MAP kinase pathway [54]. We have been able to identify proteins that bind to an oligo encoding the ARE of TNFα and that are in vitro substrates for the MNKs, and we have been able to further confirm one of them, hnRNP Al, as the recombinant protein is as well an in vitro substrate. This finding supports the hypothesis that MNKs might be regulating the translation of specific messengers through phosphorylation of proteins bound to their 3 'UTR. The results presented here show that T-cell stimulation through TCR engagement signals through the ERK and p38 MAP kinase pathways to regulate the accumulation and translation of an mRNA containing the TNFα 3'-UTR. This may involve targets of these pathways such as Mnkl, which increases the association of this mRNA with polysomes and in vivo regulates the production of TNFα probably through phosphorylation of AREBPs. Therefore, Mnks seem a promising target for specific anti-inflammatory therapy.

REFERENCES

1 Kruys, N., Kemmer, K., Shakov, A., Jongeneel, N. and Beutler, B. (1992) Constitutive activity of the TΝF promoter is canceled by the 3 '-UTR in nonmacrophage cell lines: a trans- dominant factor overcomes this suppressive effect. Proc. Νatl. Acad. Sci.USA 89, 673-677

2 Dumitru, C. D., Ceci, J. D., Tsatsanis, C, Kontoyiannis, D., Stamatakis, K, Lin, J. H., Patriotis, C, Jenkins, Ν. A., Copeland, Ν. G., Kollias, G. and Tsichlis, P. Ν. (2000) TΝF- alpha induction by LPS is regulated postfranscriptionally via a Tpl2/ERK-dependent pathway. Cell 103, 1071-83.

3 Kontoyiannis, D., Pasparakis, M., Pizarro, T. T., Cominelli, F. and Kollias, G. (1999) Impaired on/off regulation of TΝF biosynthesis in mice lacking TΝF AU-rich elements: implications for joint and gut-associated immunopathologies. Immunity 10, 387-398

4 Han, J., Brown, T. and Beutler, B. (1990) Endotoxin-responsive sequences control cachectin/tumor necrosis factor biosynthesis at the translational level. J. Exp. Med. 171, 465- 475

5 Iyer, S., Kontoyiannis, D., Chevrier, D., Woo, J., Mori, Ν., Cornejo, M., Kollias, G. and Buelow, R. (2000) Inhibition of tumor necrosis factor mRΝA franslation by a rationally designed immunomodulatory peptide. J. Biol. Chem. 275, 17051-7

6 Han, J., Thompson, P. and Beutler, B. (1990) Dexamethasone and pentoxifylline inhibit endotoxin-induced cachectin/tumor necrosis factor synthesis at separate points in the signaling pathways. J. Exp. Med. 172, 391-394

7 Swantek, J. L., Cobb, M. H. and Geppert, T. D. (1997) Jun Ν-terminal kinase/Stress- activated protein kinase (JΝK/SAPK) is required for lipopolysaccharide stimulation of tumor necrosis factor alpha (TΝF-α) franslation: glucocorticoids inhibit TΝF-α franslation by blocking JΝK/SAPK. Mol. Cell. Biol. 17, 6274-6282

8 Crawford, E. K, Ensor, J. E., Kalvakolanu, I. and Hasday, J. D. (1997) The role of 3' poly(A) tail metabolism in tumor necrosis factor-alpha regulation. J. Biol. Chem. 272, 21120- 7

9 Lee, J. C, Laydon, J. T., McDonnell, P. C, Gallagher, T. F., Kumar, S., Green, D., McΝulty, D., Blumenthal, M. J., Heys, J. R., Landvatter, S. W., Strickler, J. E., McLaughlin, M. M., Siemens, I. R., Fisher, S. M., Livi, G. P., White, J. R., Adams, J. L. and Young, P. R. (1994) A protein kinase involved in the regulation of inflammatory cytokine biosynthesis. Nature 372, 739-745 10 Kotlyarov, A., Neininger, A., Schubert, C, Eckert, R., Birchmeier, C, Nolk, H. D. and Gaestel, M. (1999) MAPKAP kinase 2 is essential for LPS-induced TΝF-alpha biosynthesis. Nature Cell Biol. 1, 94-7

11 Dean, J. L. E., Brook, M., Clark, A. R. and Saklatvala, J. (1999) p38 mitogen- activated protein kinase regulates Cyclooxygenase-2 mRNA stability and transcription in lipopolysaccharide-treated human monocytes. J. Biol. Chem. 274, 264-269

12 Rutault, K, Hazzalin, C. A. and Mahadevan, L. C. (2001) Combinations of ERK and p38 MAPK Inhibitors Ablate Tumor Necrosis Factor-α (TNF-α ) mRNA Induction. Evidence for selective destabilization of TNF-alpha transcripts. J. Biol. Chem. 276, 6666-6674.

13 Buxade, M., Ramirez- Alvarado, M., Fernandez-Troy, N., MacKenzie, S., Casaroli- Marano, R. P., Nilella, R. and Espel, E. (2001) Integrating signals from T-cell receptor and serum by T cells enhance franslation of TΝF-alpha. Immunology 102, 416-25.

14 Hoffmeyer, A., Grosse-Wilde, A., Flory, E., Νeufeld, B., Kunz, M., Rapp, U. R. and Ludwig, S. (1999) Different mitogen-activated protein kinase signaling pathways cooperate to regulate tumor necrosis factor alpha gene expression in T lymphocytes. J. Biol. Chem. 274, 4319-4327

15 Geppert, T. D., Whitehurst, C. E., Thompson, P. and Beutler, B. (1994) Lipopolysaccharide signals activation of tumor necrosis factor biosynthesis through the ras/raf-1/MEK/MAPK pathway. Mol. Med. 1, 93-103

16 Carballo, E., Lai, W. S. and Blackshear, P. J. (1998) Feedback inhibition of macrophage tumor necrosis factor-α production by tristetraprolin. Science 281, 1001-1005

17 Lai, W. S., Carballo, E., Strum, J. R, Kennington, E. A., Phillips, R. S. and Blackshear, P. J. (1999) Evidence that tristetraprolin binds to AU-rich elements and promotes the deadenylation and destabilization of tumor necrosis factor alpha mRΝA. Mol. Cell. Biol. 19, 4311-4323

18 Gueydan, C, Droogmans, L., Chalon, P., Huez, G., Caput, D. and Kruys, N. (1999) Identification of TIAR as a protein binding to the franslational regulatory AU-rich element of tumor necrosis factor α mRΝA. J. Biol. Chem. 274, 2322-2326

19 Piecyk, M., Wax, S., Beck, A. R., Kedersha, Ν., Gupta, M., Maritim, B., Chen, S., Gueydan, C, Kruys, N., Streuli, M. and Anderson, P. (2000) TIA-1 is a franslational silencer that selectively regulates the expression of TΝF-alpha. EMBO J. 19, 4154-63 20 Miethke, T., Wahl, C, Heeg, K., Echtenacher, B., Krammer, P. H. and Wagner, H. (1992) T cell-mediated lethal shock triggered in mice by the superantigen staphylococcal enterotoxin B: critical role of tumor necrosis factor. J. Exp. Med. 175, 91-8

21 Yang, Y., Chang, J.-F., Parnes, J. R. and Fathman, C. G. (1998) T cell receptor (TCR) engagement leads to activation-induced splicing of tumor necrosis factor (TNF) nuclear pre- mRNA. J. Exp. Med. 188, 247-254

22 Osman, F., Jarrous, N., Ben-Asouli, Y. and Kaempfer, R. (1999) A cis-acting element in the 3 '-untranslated region of human TNF-alpha mRNA renders splicing dependent on the activation of protein kinase PKR. Genes Dev. 13, 3280-93.

23 Lindsten, T., June, C. H., Ledbetter, J. A., Stella, G. and Thompson, C. B. (1989) Regulation of lymphokine mRNA stability by a surface-mediated T cell activation pathway. Science 244, 339-343

24 Ramirez, M., Fernandez-Troy, N., Buxade, M., Casaroli-Marano, R. P., Benitez, D., Perez-Maldonado, C. and Espel, E. (1999) Wortmannin inhibits franslation of tumor necrosis factor α in superantigen-activated T cells. Int. Immunol. 11, 1479-1489

25 Ballester, A., Nelasco, A., Tobena, R. and Alemany, S. (1998) Cot kinase activates tumor necrosis factor-a gene expression in a cyclosporin A-resistant manner. J. Biol. Chem. 273, 14099-14106

26 Fukunaga, R. and Hunter, T. (1997) Mnkl, a new MAP kinase-activated protein kinase, isolated by a novel expression screening method for identifying protein kinase substrates. EMBO J. 16, 1921-1933

27 Waskiewicz, A. J., Flynn, A., Proud, C. G. and Cooper, J. A. (1997) MAPKs activate the ser/thre kinases Mnkl and Mnk2. EMBO J. 16, 1909-1920

28 Waskiewicz, A. J., Johnson, J. C, Penn, B., Mahalingam, M., Kimball, S. R. and Cooper, J. A. (1999) Phosphorylation of the cap-binding protein eukaryotic translation initiation factor 4E by protein kinase Mnkl in vivo. Mol. Cell. Biol. 19, 1871-1880

29 Pyronnet, S., Imataka, H., Gingras, A.-C, Fukunaga, R., Hunter, T. and Sonenberg, Ν. (1999) Human eukaryotic franslation initiation factor 4G (eIF4G) recruits Mnkl to phosphorylate eIF4E. EMBO J. 18, 270-279

30 Knauf, U., Tschopp, C. and Gram, H. (2001) Negative regulation of protein franslation by mitogen-activated protein kinase-interacting kinases 1 and 2. Mol Cell Biol 21, 5500-11.

31 Gingras, A.-C, Raught, B. and Sonenberg, N. (1999) eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation. Annu. Rev. Biochem. 68, 913-963 32 Raught, B., Gingras A.-C, Gygi S.P., hnataka H., Morino S., Gradi A., Aebersold R. and Sonenberg N. (2000) Serum-stimulated, rapamycin-sensitive phosphorylation sites in the eukaryotic franslation initiation factor 4GI. EMBO J. 19, 434-444

33 Wang, X., Flynn, A., Waskiewicz, A. J., Webb, B. L., Nries, R. G., Baines, I. A., Cooper, J. A. and Proud, C G. (1998) The phosphorylation of eukaryotic initiation factor eIF4E in response to phorbol esters, cell stresses, and cytokines is mediated by distinct MAP kinase pathways. J. Biol. Chem. 273, 9373-7.

34 van der Nelden, A. W., Voorma, H. O. and Thomas, A. A. (2001) Vector design for optimal protein expression. Biotechniques 31, 572, 574, 576-80, passim.

35 Kleijn, M., Korthout, M. M., Voorma, H. O. and Thomas, A. A. (1996) Phosphorylation of the eIF4E-binding protein PHAS-I after exposure of PC 12 cells to EGF andΝGF. FEBS Lett. 396, 165-71.

36 Kleijn, M., Voorma, H. O. and Thomas, A. A. (1995) Phosphorylation of eIF-4E and initiation of protein synthesis in P19 embryonal carcinoma cells. J. Cell. Biochem. 59, 443-52.

37 Herbert, T. P., Kilhams, G. R, Batty, I. H. and Proud, C. G. (2000) Distinct signalling pathways mediate insulin and phorbol ester- stimulated eukaryotic initiation factor 4F assembly and protein synthesis in HEK 293 cells. J. Biol. Chem. 275, 11249-56.

38 Kar-Roy et al.

39 Espel, E., Garcia-Sanz, J. A., Aubert, V., Menoud, V., Sperisen, P., Fernandez, Ν. and Spertini, F. (1996) Transcriptional and translational control of TΝF-α gene expression in human monocytes by major histocompatibility complex class II ligands. Eur. J. Immunol. 26, 2417-2424

40 MacKenzie S., F.-T. Ν., Espel E. (2002) Post-transcriptional regulation of TΝF-α during in vitro differentiation of human monocytes / macrophages in primary culture. J. Leuk. Biol. 71, 1026-32

41 Alessi, D.R., Cuenda, A., Cohen, P., Dudley, D.T., Saltiel,A.R. (1995) PD 098059 is a specific inhibitor of the activation of mitogen-activated protein kinase kinase in vitro and in vivo. J. Biol. Chem. 270, 27489-27494.

42 Dudley, D.T., Pang, L., Decker, S.J., Bridges, A.J., Saltiel, A.R. (1995) A synthetic inhibitor of the mitogen-activated protein kinase cascade. Proc. Νatl. Acad. Sci. U S A. 92, 7686-9.

43 Cuenda, A., Rouse, J., Doza, Y.Ν., Meier, R., Cohen, P., Gallagher, T.F., Young, P.R., Lee, J.C. (1995) SB 203580 is a specific inhibitor of a MAP kinase homologue which is stimulated by cellular stresses and interleukin-1. FEBS Lett. 364, 229-33. 44 Shi, Y., Gaestel, M. (2002) In the cellular garden of forking paths: how p38 MAPKs signal for downstream assistance. Biol. Chem. 383, 1519-1536.

45 Ward, S. G. (1996) CD28: a signalling perspective. Biochem.J. 318, 361-377

46 Atasoy, U., Watson, J., Patel, D. and Keene, J. D. (1998) ELAV protein HuA (HuR) can redistribute between nucleus and cytoplasm and is upregulated during serum stimulation and T cell activation. Journal of Cell Science 111, 3145-3156

47 Peng, S. S.-Y., Chen, C.-Y. A., Xu, N. and Shyu, A.-B. (1998) RNA stabilization by the AU-rich element binding protein, HuR, an ELAV protein. EMBO J. 17, 3461-3470

48 Brook, M., Sully, G., Clark, A. R. and Saklatvala, J. (2000) Regulation of tumour necrosis factor alpha mRNA stability by the mitogen-activated protein kinase p38 signalling cascade. FEBS Lett 483, 57-61.

49 Bu, X., Haas, D. W. and Hagedorn, C H. (1993) Novel phosphorylation sites of eukaryotic initiation factor-4F and evidence that phosphorylation stabilizes interactions of the p25 and ρ220 subunits. J Biol Chem 268, 4975-8.

50 Lamphear, B. J. and Panniers, R. (1990) Cap binding protein complex that restores protein synthesis in heat- shocked Ehrlich cell lysates contains highly phosphorylated eIF-4E. J Biol Chem 265, 5333-6.

51 Minich, W. B., Balasta, M. L., Goss, D. J. and Rhoads, R. E. (1994) Chromatographic resolution of in vivo phosphorylated and nonphosphorylated eukaryotic translation initiation factor eIF-4E: increased cap affinity of the phosphorylated form. Proc Natl Acad Sci U S A 91, 7668-72.

52 Scheper, G. C, van Kollenburg, B., Hu, J., Luo, Y., Goss, D. J. and Proud, C G. (2002) Phosphorylation of eukaryotic initiation factor 4E markedly reduces its affinity for capped mRNA. JBiolChem 277, 3303-3309

53 Winzen, R., Kracht M., Ritter B., Wilhelm A., Chen C-Y.A., Shyu A.-B., Muller M., Gaestel M., Resch K., and Holtmann H. (1999) The p38 MAP kinase pathway signals for cytokine-induced mRNA stabilization via MAP kinase-activated protein kinase 2 and an AU- rich region targeted mechanism. EMBO J. 18, 4969-4980

54 Mahtani, K. R., Brook, M., Dean, J. L., Sully, G., Saklatvala, J. and Clark, A. R. (2001) Mitogen-activated protein kinase p38 controls the expression and posttranslational modification of tristefraprolin, a regulator of tumor necrosis factor alpha mRNA stability. Mol Cell Biol 21, 6461-9. 55 Bohjanen, P. R., Petryniak, B., June, C H., Thompson, C. B. and Lindsten, T. (1991) An inducible cytoplasmic factor (AU-B) binds selectively to AUUUA multimers in the 3' untranslated region of lymphokine mRNA. Mol Cell Biol 11, 3288-95.

56 Ford, L. P., Watson, J., Keene, J. D. and Wilusz, J. (1999) ELAV proteins stabilize deadenylated intermediates in a novel in vitro mRNA deadenylation/degradation system. Genes Dev 13, 188-201.

57 Rincon, M., Enslen, H., Raingeaud, J., Recht, M., Zapton, T., Su, M. S.-S., Penix, L. A., Davis, R. J. and Flavell, R. A. (1998) Interferon-gamma expression by Thl effector T cells mediated by the ρ38 MAP kinase signaling pathway. EMBO J. 17, 2817-2829

58 Schafer, P. H., Wang, L., Wadsworth, S. A., Davis, J. E. and Siekierka, J. J. (1999) T cell activation signals up-regulate p38 mitogen-activated protein kinase activity and induce TNF alpha production in a manner distinct from LPS activation in monocytes. J.frnmunol. 162, 659-668

59 Neininger, A., Kontoyiannis, D., Kotlyarov, A., Winzen, R., Eckert, R., Volk, H. D., Holtmann, H., Kollias, G. and Gaestel, M. (2002) MK2 targets AU-rich elements and regulates biosynthesis of tumor necrosis factor and interleukin-6 independently at different post- transcriptional levels. J Biol Chem 277, 3065-8.

60 Zhang, H., Shi, X., Hampong, M., Blanis, L. and Pelech, S. (2001) Stress-induced Inhibition of ERKl and ERK2 by Direct Interaction with p38 MAP Kinase. J Biol Chem 276, 6905-6908.

61 Singh, R. P., Dhawan, P., Golden, C, Kapoor, G. S. and Mehta, K. D. (1999) Oneway cross-tallc between p38(MAPK) and p42/44(MAPK). Inhibition of p38(MAPK) induces low density lipoprotein receptor expression through activation of the p42/44(MAPK) cascade. J Biol Chem 274, 19593-600.

62 Foltz, I. N., Lee, J. C, Young, P. R. and Schrader, J. W. (1997) Hemopoietic growth factors with the exception of interleukin-4 activate the p38 mitogen-activated protein kinase pathway. J Biol Chem 272, 3296-301.

63 Guay, J., Lambert, H., Gingras-Breton, G., Lavoie, J. N., Huot, J. and Landry, J. (1997) Regulation of actin filament dynamics by p38 map kinase-mediated phosphorylation of heat shock protein 27. J Cell Sci 110, 357-68.

64 Morley, S. J. and McKendrick, L. (1997) Involvement of stress-activated protein kinase and p38/RK mitogen-activated protein kinase signaling pathways in the enhanced phosphorylation of initiation factor 4E inNIH 3T3 cells. J.Biol.Chem. 272, 17887-17893

Claims

1. A method for identifying an agent for use as a lead agent in treating an inflammatory condition, wliich method comprises: a) providing a MAP kinase signal-integrating kinase (MNK) polypeptide or a fragment, homologue, derivative or mutant thereof; b) contacting the MNK polypeptide, fragment, derivative or mutant thereof, with a test agent under conditions that would permit MNK to phosphorylate at least one AU-rich element binding protein (AREBP); and c) detecting whether said test substance is able to modulate the ability of said MNK polypeptide, fragment, derivative or mutant thereof to phosphorylate said at least one AREBP.

2. A method for identifying an agent for use as a lead agent in modulating tumour necrosis factor α (TNFα) activity, which method comprises: a) providing an MNK polypeptide or a fragment, homologue, derivative or mutant thereof; b) contacting the MNK polypeptide, a fragment, derivative or mutant thereof, with a test agent under conditions that would permit MNK to modulate TNFα activity; and c) detecting whether said test substance is able to have an effect on the ability of MNK polypeptide, a fragment, derivative or mutant thereof to modulate TNFα activity.

3. The method according to either of claims 1 or 2 wherein said method is an in vitro method.

4. The method according to either of claims 1 or 2 wherein said method is an in vivo method.

5. An agent capable of modulating the activity of MNK, or a fragment, derivative, homologue or mutant thereof, identified by the method of any preceding claim for use in treating the human or animal body by therapy.

6. An agent capable of modulating the activity of MNK, or a fragment, derivative, homologue or mutant thereof, identified by the method of any preceding claim for use in diagnosis on the human or animal body.

7. Use of an agent identified by the methods of any preceding claim for the manufacture of a medicament for the prevention or treatment of inflammation.

8. A method for identifying an agent for use as a lead agent in modulating TNFα synthesis, which method comprises: a) providing a hnRNP polypeptide or a fragment, homologue, derivative thereof comprising one or more of Serine residues 192, 310, 311 and 312 correponding to Serine residues of hnRNP Al amino acid sequence [Accession No. AAH 74502]; b) contacting the hnRNP polypeptide or a fragment, homologue, derivative thereof comprising of said one or more of Serine residues 192, 310, 311 and 312 with a test agent; c) detecting whether said test agent inhibits the ability of said Serine residues to be phosphorylated.

9. A method according to claim 8 wherein said hnRNP polypeptide or a fragment, homologue, derivative thereof comprises the peptides QEMASASSSQR and/or NQGGYGGSSSSSSYGSGR or fragment thereof.

10. A method according to claim 8 or 9 wherein said hnRNP polypeptide or a fragment, homologue, derivative thereof is hn RNP Al polypeptide or a fragment, homologue, derivative thereof.

11. Use of the peptide(s) QEMASASSSQR and/or NQGGYGGSSSSSSYGSGR or fragment thereof to identify inhibitors of TNFα activity.

12. The peptide(s) QEMASASSSQR and/or NQGGYGGSSSSSSYGSGR or fragment thereof for use in identifying agents which modulate the activity of TNFα.

13. An agent capable of modulating the activity of hnRNP, or a fragment, derivative, or homologue thereof comprising one or more of Serine residues 192, 310, 311 and 312, identified by the method of claims 8 to 10 for use in freating the human or animal body by therapy.

14. An agent capable of modulating the activity of hnRNP, or a fragment, derivative, or homologue thereof comprising one or more of Serine residues 192, 310, 311 and 312, identified by the method of claims 8 to 10 for use in diagnosis on the human or animal body.

15. Use of an agent identified by the methods of claims 8 to 10 for the manufacture of a medicament for the prevention or freatment of inflammation.