WO2005002594A1

WO2005002594A1 - An anti-tumor rna interference drug for multidrug resistance

Info

Publication number: WO2005002594A1
Application number: PCT/CN2004/000762
Authority: WO
Inventors: Zhongchao Han; Zhi Peng
Original assignee: Institute Of Hematology, Chinese Academy Of Medical Sciences
Priority date: 2003-07-08
Filing date: 2004-07-07
Publication date: 2005-01-13
Also published as: CN1476899A; CN1217700C

Abstract

The invention discloses a kind of anti-tumor RNA interference drug for multidrug resistance, and provides a group of polynucleotide sequences of RNAi used as medicament against leukemia and other tumors in which the expression of multidrug resistance gene (mdr-1) and the functionality of P-glycoprotein (P-gp) are involved. The drug aims to inhibit the expression of multidrug resistance gene (mdr-1) and the functionality of P-glycoprotein (P-gp) in tumor cells, increases the sensitivity of leukemia to the normal chemotherapy medicament, and enhances the effect that the chemotherapy medicament kills cells of malignancy in the hemopoietic system.

Description

Antitumor multidrug resistance NA interference drugs Technical field

The present invention relates to anti-tumor drugs, especially anti-tumor multi-drug resistant RNA interference drugs. Background technique

Multidrug resistance (MDR) is an important obstacle to conventional chemotherapy for malignant tumors such as leukemia, which is difficult to obtain long-term remission. Studies have shown that over-expression of P-glycoprotein (P-gp) encoded by the mdr-1 gene on the surface of tumor cells is the main mechanism leading to multi-drug resistance of tumor cells and a good target for reversing drug resistance. There are dozens of drugs that have been reported to be able to reverse MDR, but the toxicity is large at effective drug concentrations, which causes severe adverse reactions, which limits its clinical application. Therefore, target therapy for mdr-1 gene and its protein is a hotspot of multidrug resistance reversal in leukemia at home and abroad.

RNA interference (RNAi) is a newly developed effective method for blocking gene expression. It uses 21-23 nucleotide long interfering RNA (siRNA) homologous to the target gene to transfect into target cells, and forms an induction silencing complex (RISC) with the endonuclease in the cell. RISC uses siRNA For the template to specifically identify its homologous gene mRNA and perform progressive cutting on it, it forms a strong and efficient waterfall effect, induces sequence-specific mRNA degradation, and the cell displays a defective phenotype of a specific gene. This strategy can turn off cancer cause, and only one base mutation loses RNA interference, which has little effect on normal cells and has strong specificity.

Summary of the invention

The technical problem to be solved by the present invention is to provide an anti-tumor multi-drug resistant RNA interference drug. The RNAi technology is used to reverse the drug-resistant phenotype of a multi-drug resistant cell line cell line using RNAi technology at the mRNA level. Can effectively inhibit the expression of the multidrug resistance gene mdr-1.

In order to solve the above technical problems, the technical scheme adopted by the present invention is: an anti-tumor multi-drug resistant RNA interference drug, targeted treatment for the multi-drug resistance gene mdr-1 and its expressed protein, and has targeted resistance The expression and function of multidrug-resistant mdr-1 gene and P-glycoprotein in tumor cells. The interfering RNA sequence is a three-segment 21-base siRNA sequence selected for different positions of the mdr-1 gene mRNA, which is called si-mdrl. , Si ~ mdr2 and si-mdr3, the RNA interference drugs are si-mdrl, Any one, two, or a combination of three nucleotide sequences of si-mdr2, si-mdr3, the three nucleotide sequences of si-mdr si-mdr2, si-mdr3 are:

si-mdrl: CUGUACUGGUCCAUACGGAUU

UUGACAUGACCAGGUAUGCCU

si-mdr2: CGCCGAGGCUAUGUACCAAUU

UUGCGGCUCCGAUACAUGGUU

si-mdr3: CCUCCGGUUGUAUGUACGGUU

UUGGAGGCCAACAUACAUGCC

The target sites of si-mdrl, si_mdr2, and si-mdr3 are:

Target site of si-mdrl: 5,-AAGACAUGACCAGGUAUGCCU -3,-(865-885) Target site of si_mdr2: 5,-AAGCGGCTCCGATACATGGTT-3 '-(2472-2492) Target site of si-mdr3: 5,-AAGGAGGCCAACATACATGCC-3, (3564-3584) The route of administration can be: direct naked DNA injection method, liposome-encapsulated DNA direct injection method, gold-coated DNA gene gun bombardment method, reproduction defective bacteria carrying plasmid DNA One of the methods.

The siRNA developed by the invention can effectively inhibit the expression of the multidrug resistance gene MDR-1, and provides experimental evidence and effective new drugs for the application of RNAi technology to the treatment of leukemia.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig. 1 is an electrophoresis product of PCR amplification products of mdr-1 of K562 / A02 cells 24 hours after the siRNA treatment of the present invention.

Figure 2 is the result of the effect of siRNA treatment on P-gp expression in the present invention.

In the figure, 1: si-neg group; 2: si-mdrl group; 3: si-mdr2 group; 4: si-mdr3 group; 5:

PCR negative control. detailed description

The antitumor multi-drug resistant RNA interference drug of the present invention is described in further detail below with reference to the drawings and specific embodiments:

The present invention uses RNAi technology to reverse the drug-resistant phenotype of the multidrug-resistant cell line K562 / A02 cells using siRNA (small interfering RNA, siRNA) against the mdr-1 gene at the mRNA level. The K562 cell line is a cell line derived from patients with red leukemia. The K562 / A02 cell line

2 Screening of adriamycin-resistant (ADM) cell lines.

The siRNA sequence involved in the present invention is a three-segment 21-base siRNA sequence selected for different positions of the mRM-1 gene mRM, and is called si-mdrl, si-mdr2, and si-mdr3. A random sequence was set as a negative control (si-neg). The siRNA sequence is as follows:

Target sites of si-mdrl: 5,-AAGACAUGACCAGGUAUGCCU _3,-(865-885)

si-mdrl: CUGUACUGGUCCAUACGGAUU

UUGACAUGACCAGGUAUGCCU

Target sites for si-mdr2: 5,-AAGCGGCTCCGATACATGGTT -3,-(2472-2492) si-mdr2: CGCCGAGGCUAUGUACCAAUU

UUGCGGCUCCGAUACAUGGUU

Target sites for si-mdr3: 5,-AAGGAGGCCAACATACATGCC-3,-(3564-3584) si-mdr3: CCUCCGGUUGUAUGUACGGUU

UUGGAGGCCAACAUACAUGCC

si-neg: 5, -AATAGGATACGTGACGCTATG-3,

UCCUAUGCACUGCGAUACUU UUAGGAUACGUGACGCUAUG

The K562 / A02 cell line used in the present invention is a doxorubicin (ADM) resistant red leukemia cell line. Cells were inoculated in RPMI1640 (Gibco BRL) culture medium containing 10% calf serum, and cultured in a CO ₂ incubator at 37 ° C and 5% by volume, and cultured without drugs for two weeks before the experiment. To optimize the transfection conditions, add si-mdrl, si-mdr2, si-mdr3, and si-neg to K562 / A02 cell culture solution at a final concentration of 200nmol, and harvest cells 24 to 48 h after incubation for testing. mRNA and protein levels were used to detect the effects of si-mdrl, si-mdr2, and si-mdr3 on inhibiting multidrug resistance gene expression and increasing the sensitivity of drug-resistant leukemia cells to chemotherapy drugs. The mRNA was detected by RT-PCR and PCR product quantitative analysis. Technical route: 1) RT-PCR: Total RNA is extracted according to the TRIzol Total RNA Extraction Kit. The quality of RNA was identified by electrophoresis and quantified by UV spectrophotometer. Take 2.5 μg of total RNA, add 50 μ 1 reverse transcription reaction system, and use Superscript ™ "reverse transcription kit (purchased from Invitrogen) to perform reverse transcription according to the instructions. The PCR reaction system is conventional (reagents purchased from Invitrogen) Company). Cycling conditions: Denaturation at 94 ° C for 45 seconds, annealing at 58 ° C for 1 minute, extension at 72 ° C for 1 minute, and final extension for 10 minutes.

Form feed detail 26 In addition, β-actin amplification products were used as internal control. The amplification primer sequences and amplified fragments are as follows:

mdr-1 upstream primer: 5'— TTACACGTGGTTGGAAGC— 3 '

Downstream primer: 5 CATAGATCAGCAGGAAAG-3 ', amplified fragment 300bp. β-act in upstream primer: 5-, GTGGGGCGCCCCAGGCACCA-3,

Downstream arch I: 5'-CTCCTTAATGTCACGCACGATTC-3 ', amplified fragment 548bp.

Quantification of PCR products: 10 μl of the amplified product was run on a 15 g / L agarose gel electrophoresis, with PCR mark (Huamei Company) as the molecular mass standard, voltage 100V, 20 minutes. Ethidium bromide was stained, visualized and photographed on a UV reflectometer. Scan analysis was used to semi-quantify the target gene (the ratio of mdr-1 / βactin cDNA reflects the expression level of mdr-1 mRM).

The expression of the multidrug resistance gene mdr-1 was measured using flow cytometry to detect the expression of P-gp. Collect K562 / A02 cells of each group for 48 h, wash them twice with PBS, add P-gp mAb 10 μ 1 (Neomarkers), 4 ° C, 30 minutes; wash with PBS, add FITC-labeled secondary antibody, 4. C, 30 minutes. Wash with PBS and test on the machine.

In the present invention, MTT is used to detect the IC ₅ of the half-inhibitor amount of doxorubicin on drug-treated leukemia cells and control K562 cells. Using the relative reversal efficiency as the evaluation index, the relative reversal efficiency = (ICsoA- ICsoB) / (IC ₅₀ A- IC50C). IC _5Q A is IC ₅ of K562 / A02. IC _{_50,} IC ₅₀ B is a siRNA effect after, IC ₅₀ C K562 is the IC _5. ; IC _{5 for} resistance factor RF = K562 / A02. / K562 of IC _50.

The invention also uses a flow cytometer to measure the intracellular daunorubicin accumulation. The RNAi-treated cells are adjusted to 1 × 107ml and lg / ml daunorubicin are co-incubated at 37 ° C, and removed after 1 hour , Ice bath to stop the effect of daunorubicin. Flow cytometry was used to detect the intracellular daunorubicin-induced fluorescence intensity to reflect the concentration of DNR in the cell, with an excitation wavelength of 488 nm and an emission wavelength of 550 nm. Untreated K562 / A02 cells were used as blank controls.

Targeting the mdr-1 gene and its protein is a hot topic in the study of leukemia multidrug resistance reversal at home and abroad. The concentrations of verapamil, cyclosporin A and other commonly used reversal agents are effective in reversing Serious adverse reactions in the human body limit its clinical application. Because the RNAi used by the present invention has a high degree of sequence specificity, it can specifically silence specific genes, obtain loss of function or reduce mutations. Therefore, both in functional genomic research and tumor gene therapy have a broad vision of application.

According to the design principle of the siRNA user guide of Elbashir et al., The present invention designs three interference siRNA sequences for different target sites of the mdr-1 gene to reverse the MDR of a leukemia multidrug-resistant cell line. K562 / A02 is a chronic myelogenous leukemia leukemia cell line with typical multi-drug resistance characteristics, and highly expresses the mdr-1 gene. IC _5Q , intracellular drug concentration, pl70 expression, and relative mRNA detection confirmed that the three sequences could block the mdr-1 gene to varying degrees and reverse the cell-resistant phenotype. These inventions confirm that siRNA is expected to be an effective means to reverse tumor resistance. The siRNA of the invention can be used alone or in combination of several siRNAs, and can also be combined with other reversal agents such as antisense nucleic acids to make pharmaceutical compositions for the treatment of leukemia and other tumors.

There are several methods for the administration of the above gene sequences:

1.Direct naked DNA injection method

(1) New jet injection system releases naked DNA treatment sequence. A new jet injection system can be used to release naked DNA into lung tumors in the body. Dr. Walther O. Walther and colleagues have developed a portable "high-speed jet injector" system that offers another option beyond viral vectors and liposome gene delivery systems. The researchers used this system to inject 3 segments of naked DNA into Lewis lung tumors in mice. The first plasmid expressed the β-galactokinase gene (LacZ), the second expressed the green fluorescent (GFP) gene, and the third expressed Human tumor necrosis factor- (TNF-α). Each mouse received 5 injections at a pressure of 3 Pa and released 3 to 5 microliters of plasmid DNA. Dr. Walser et al. Reported in Gene Therapy that genes in tumors were widely expressed after injection. LacZ and GFP gene expression became apparent 48 hours after injection and reached a peak at 72 to 96 hours; LacZ expression and TNF-α secretion appeared at 24 to: 120 hours. They argue that "these findings demonstrate the applicability of jet injection to use the smallest dose of naked DNA for cancer gene therapy when delivering genes to tumors in vivo."

(2) Direct injection of naked DNA: Inject naked plasmid DNA directly into the body's muscles, intradermis, subcutaneously, mucosa, and veins. This method is simple and easy to implement.

2. Direct injection of liposome-encapsulated DNA: DNA-encapsulated liposomes can undergo membrane fusion with tissue cells, and DNA is taken in to reduce the damage of DNA by nucleases. The injection route is the same as the direct injection of naked DNA.

3. Gold-coated DNA gene gun bombardment method: The plasmid DNA is coated on the surface of gold particles, and the DNA-coated gold particles are penetrated into tissue cells at high speed with a gene gun.

Form feed fine 2 4. Breeding defective bacteria carry plasmid DNA method: Select a bacterium that easily enters a certain tissue and organ, remove its reproduction gene, and then transform the bacteria with plasmid DNA. When these bacteria enter a certain tissue and organ, they cannot lyse because they cannot lyse. Instead, plasmid DNA is released. gfJ: Attenuated Salmonella that can be taken orally. Example 1. RNAi expression of drug resistance gene mdr-1 mRNA

K562 / A02 cells were detected after siRNA treatment for 24 h. Compared with the negative control, mRNA expression in the si-mdrl group was down-regulated (17. 23 ± 2. 47)% (p> 0.05), si-mdr2 and si-mdr3 treatments. After 24 hours, the mRNA expression of mdr-1 was significantly reduced, which were (38 ± 1. 23)% and (58 ± 1. 54)% (p <0.05), respectively, as shown in Figure 1. Example 2.P-gp expression detection

Flow cytometry after 48 hours of siRNA action showed that pl70 expression was inhibited to varying degrees in the three groups. The positive rate of pl70 expression in the si-mdrl group was reduced from (76. 0 ± 1.03)% before treatment to treatment After (56.72 ± 1.41)%, the si-mdr2 effect group decreased to (42.70 ± 1.17)% (p <0. 05); while the positive rate of pl70 expression in the si-mdr3 effect group was significant The reduction is (19. 57 ± 1. 94)% (p <0. 01). There was no significant change in the positive rate of pl70 expression in the si-neg experimental group before and after treatment: (76.0 ± 1.03)% before treatment, (74.6 ± 0.75)% (p> 0.05) after treatment, see figure 2.

Changes in drug sensitivity of K562 / A02 cells after RNAi treatment: IC ₅ . Refers to the concentration of chemotherapeutic drugs at a cytostatic rate of 50%. It can be seen from Table 1 that after the action of si-mdr2 and si-mdr3, K562 / A02 has increased sensitivity to chemotherapeutic drugs ADM, suggesting that RNAi can restore K562 / A02 to chemotherapeutic drugs. Sensitivity. Example 3. Reversal of drug resistance of K562 / A02 cells by siRNA

Table 1 shows the comparison of the reversal effects of siRNA on the resistance of K562 / A02 cells. Each experiment was repeated 3 times, and 3 parallel holes were set each time, and the average value was taken. Si-mdrl, si-mdr2, and si-mdr3 all have multidrug resistance reversal effects, and si-mdr3 has the most significant effect.

6 Table 1

ICso (^ g / ml) Relative reversal efficiency

(%)

K562 0. 05 1

K562 / A02 4. 47 1

si-neg 4. 28 4. 29

si-radr 1 3. 67 18. 10

si-mdr2 2. 53 * 43. 89

si-mdr3 1. 36 ** 70. 36

Note: Compared with K562 / A02 cell group, p value: * <0. 05, ** <0.01. Example 4. Changes in DNR accumulation in cells after R Ai treatment

K562 / A02 and K562 cells were treated with si-mdr. It was found that the DNR in K562 / A02 cells had an increase in fluorescence intensity and positive rate compared with that before treatment, and there were significant differences. However, compared with the parental cell K562, the fluorescence intensity and positive rate are still low, as shown in Table 2.

Table 2: Changes in intracellular accumulation after si-RNA treatment

Mean fluorescence intensity Positive rate (%)

562 86. 35 97. 18

Si-neg 37. 66 27. 76

si- mdrl 41. 05 34. 57

si-mdr2 57. 88 * 61. 40

si-mdr3 64. 8 ** 78. 07 **

Note: 1. Compared with K562 / A02 cell group, p value: * <0. 05, ** <0. 01; 2. Each experiment was repeated 3 times, and the average value was taken.

Claims

Claim

1. An anti-tumor multi-drug resistant RNA interference drug for targeted therapy against the multi-drug resistance gene mdr-1 and its expressed protein, with targeted anti-tumor cells multi-drug resistance mdr-1 gene and P -Glycoprotein expression and function, characterized in that the interfering RA sequence is a three-segment 21-base siRNA sequence selected for different positions of the mRNA of the mdr-1 gene, which are called si-mdrl, si-mdr2 and si-mdr3 The RNA interference drug is any one, two, or a combination of three nucleotide sequences of si-mdrl, si-mdr2, and si-mdr 3, and three of si-mdrl, si-mdr2, and si-mdr 3 The nucleotide sequence is:

si-radrl: CUGUACUGGUCCAUACGGAUU

UUGACAUGACCAGGUAUGCCU

si-mdr2: CGCCGAGGCUAUGUACCAAUU

UUGCGGCUCCGAUACAUGGUU

si-mdr3: CCUCCGGUUGUAUGUACGGUU

UUGGAGGCCAACAUACAUGCC

2. The anti-tumor multi-drug resistant RNA interference drug according to claim 1, wherein the target sites of si-mdrl, si_mdr2, and si-mdr3 are:

Target site of si-mdrl: 5 '-AAGACAUGACCAGGUAUGCCU-3,-(865-885) Target site of si-mdr2: 5,-AAGCGGCTCCGATACATGGTT _3,-(2472-2492) Target site of si-mdr3 : 5, ― AAGGAGGCCAACATACATGCC -3,-(3564-3584)

3. The anti-tumor multi-drug resistant RNA interference drug according to claim 1, characterized in that the administration route can be: direct naked DNA injection method, liposome-encapsulated DNA direct injection method, gold-coated DNA gene gun One of the bombardment and reproduction-defective bacteria carrying plasmid DNA methods.

8

Replacement page (Article 26)