WO2005001133A2

WO2005001133A2 - Compositions and methods for high throughput construction and functional analysis of expression libraries

Info

Publication number: WO2005001133A2
Application number: PCT/US2004/017494
Authority: WO
Inventors: Hong Zhu; Denise M. Hickey; Leigh J. Hsu
Original assignee: Collateral Therapeutics, Inc.
Priority date: 2003-06-03
Filing date: 2004-06-03
Publication date: 2005-01-06
Also published as: WO2005001133A3

Abstract

The present invention provides methods and compositions for rapid construction and high throughput functional analysis of expression libraries. More particularly, the invention provides methods for the rapid construction of expression libraries comprising transcription cassettes and use of such transcription cassettes in high throughput assay systems for the identification and validation of transcription and expression products relevant to drug development.

Description

COMPOSITIONS AND METHODS FOR HIGH THROUGHPUT CONSTRUCTION AND FUNCTIONAL ANALYSIS OF EXPRESSION LIBRARIES

Field of the Invention [0001] The present invention relates to compositions and methods for rapid construction and high throughput functional analysis of expression libraries. More particularly, the invention relates to methods for the rapid construction of expression libraries comprising transcription cassettes and use of such transcription cassettes in high throughput assay systems for the identification and validation of transcription and expression products relevant to drug development.

Background [0002] Identification of genes, particularly mammalian genes, and elucidation of their function is important in understanding cellular processes in both normal and disease states. Genome sequencing projects, including the Human Genome Project, have generated vast amounts of polynucleotide sequence information and gene expression research has identified thousands of genes expressed in a variety of tissues. Characterization of genes abnormally expressed in disease conditions have led, and will continue to lead, to the identification of particular genes that can serve as prognostic and/or diagnostic markers for the disease, as well as, to the identification of targets for therapeutic development and as potential biotherapeutic candidates themselves. [0003] High-throughput gene expression profiling techniques, such as microarray technology and Serial Analysis of Gene Expression (SAGE), have accelerated the process of identifying genes that may play a role in normal and/or pathological biological processes. For example, such methods provide information as to particular genes that are expressed at increased or decreased levels in diseased tissues as compared with levels in normal tissues. The results of gene expression profiling can provide suggestions as to gene sequences that may be of interest relative to a particular disease state; however these assays generally do not provide information as to the functional characteristics and/or biological activity of the gene expression product. [0004] Elucidation of a functional characteristic or biological activity of a particular gene often involves expression of the gene sequence in a cell, generally in vitro, but sometimes in vivo. Techniques for introducing and expressing a polynucleotide sequence in cells are well known. Once expressed, the cells can be analyzed for phenotypic changes that may then be associated with expression of the polynucleotide sequence. However, typically such determinations are made using processes that are labor intensive and time consuming and/or though able to screen numerous genes, are not designed for analysis of specific function(s) of those genes, particularly in a rapid, high throughput manner. [0005] Examples of recent attempts at rapid, high throughput construction of expression libraries and/or functional analysis thereof are described for example in Cen, et al. WO 99/55886, published November 4, 1999; Vogels, et al, US 2003/0027170, published February 6, 2003, Vogels, et al. US Patent No: 6,340,595 issued January 22, 2002; Vogels, et al. US Patent No: 6,413,776, issued July 2, 2002; Felder, et al, WO 99/32663, published July 1, 1999; Lofquist, Alan, WO/02/053732, published July 11, 2002 and Michiels, et al, Nature Biotechnology 20:1154-1157 (2002). , [0006] Despite these attempts, however, there is continued interest in the development of new compositions and methods which provide rapid, efficient construction of expression libraries, particularly mammalian libraries, and functional analysis thereof.

Summary of the Invention [0007] The present invention provides methods and compositions for the high throughput construction and functional assaying of polynucleotides, particularly polynucleotides, such as cDNA, encoding proteins/polypeptides or encoding anti-sense polynucleotides. Thus, in one aspect, provided is a system for high throughput construction and analysis of transcriptional polynucleotides comprising providing an array of (n) sample sites having a single predominant transcriptional polynucleotide per sample site; associating the transcriptional polynucleotides of each sample site with a transcription promoting element and transcription termination mediating element to form a transcription cassette; associating the transcription cassette with a delivery biomolecule; delivering the transcription cassettes to a high-throughput functional assay; detecting readouts from the functional assay for the transcription cassettes; and identifying those transcriptional polynucleotides exhibiting a desired readout in the functional assay, wherein (n) is an integer equal to or greater than 6, preferably equal to or greater than 12, more preferably equal to or greater than 48 and still more preferably equal to or greater than 96. [0008] In one embodiment, in a method for high throughput construction and analysis of transcriptional polynucleotides, the step of providing an array of (n) samples sites having a single predominant transcriptional polynucleotide per sample site comprises providing an array of (n) sample sites; dispensing aliquots of a cDNA library to each of (n) sample sites; designing (n) sets of PCR primers, wherein each set is specific to an individual cDNA sequence of the library; introducing a different set of PCR primers to each of (n) sample sites; and amplifying individual cDNA sequences at each sample site by PCR. In some embodiments, the step of designing (n) sets of PCR primers each set specific to an individual cDNA sequence of the library further comprises designing the (n) sets of PCR primers to incorporate a first restriction endonuclease recognition site (RE1) at one end of the individual cDNA sequence and a second restriction endonuclease recognition site (RE2) at the other end of the individual cDNA sequence, where RE1 an RE2 are different from one another and each comprise at least eight nucleotides. [0009] In one embodiment, in a method for high throughput construction and analysis of transcriptional polynucleotides, the step of associating the transcriptional polynucleotides of each sample site with a transcription promoting element and transcription termination mediating element to form a transcription cassette comprises providing a transcription promoting element (TPE) comprising a first restriction endonuclease recognition site (RE1) at its 3' end; providing a transcription termination mediating element (TTM) comprising a second restriction endonuclease recognition site (RE2) at its 5' end; contacting the TPE with a restriction endonuclease recognizing RE1, the transcriptional polynucleotide (TP) with restriction endonucleases recognizing RE1 and RE2 and the TTM with a restriction endonuclease recognizing RE2, such that said TPE, TP and TTM are cleaved; and mixing the TPE, TP and TTM under ligation conditions such that a transcription cassette of the type TPE- (RE1)-TP-(RE2)-TTM is formed. [0010] In some embodiments, the step of associating the transcription cassette with a delivery biomolecule comprises associating the transcription cassette with a viral vector. In some embodiments, the viral vector is a replication-defective viral vector comprising a transcription promoting element (TPE) linked to a multiple-cloning site (MCS) comprising an RE1 site and RE2 site, which MCS is linked to a transcription termination mediating element (TTM). In some embodiments the methods further comprise delivering a replication-defective adenoviral vector comprising the transcription cassette into a complementing cell line to produce recombinant replication-defective adenovirus comprising said transcription cassette. [0011] In another aspect, the present invention combines a method of amplifying individual polynucleotide species, for example individual cDNAs comprised within a library of cDNAs, in a multi-well format such that each well comprises a single predominant polynucleotide species, with a single plasmid to adenoviral vector (SPA™) method of recombinant virus production to provide a molecular biology based method of expression library construction that is less prone to error and more amenable to a high throughput construction format than other methods, such as those requiring homologous recombination to produce recombinant adenovirus. [0012] Thus, in one aspect, provided herein is a method for the construction of recombinant adenovirus without the use of shuttle plasmids or homologous recombination, comprising providing a replication-defective adenoviral vector plasmid comprising a heterologous promoter sequence linked via a multiple-cloning site to a polyadenylation signal; providing a transcriptional polynucleotide, such as for example a cDNA comprising a first linking region (LRl) at its 5' end and a second linking region (LR2) at its 3 'end, which linking regions each comprise a restriction endonuclease recognition site (REl and RE2, respectively) corresponding to a different restriction endonuclease site of the multiple-cloning site; digesting the replication-defective adenoviral vector plasmid and transcriptional polynucleotide with the restriction endonucleases recognizing the REl and RE2 sites; ligating the transcriptional polynucleotide into the multiple-cloning site of the replication-defective adenoviral vector plasmid; and transfecting adenoviral complementing cells with the replication-defective adenoviral vector plasmid comprising the transcriptional polynucleotide under conditions for production of adenovirus. [0013] In a still further aspect of the present invention, various compositions are provided that are useful in practicing or that result from practicing the methods described herein. Transcription cassettes comprising a transcription promoting element (TPE) linked via a first linking region (LRl) to a transcriptional polynucleotide (TP) which is linked via a second linking region (LR2) to a transcription termination mediating element (TTM), wherein the first and second linking regions comprise a first and second restriction endonuclease recognition site, (REl and RE2, respectively) that differ from one another and are at least eight nucleotides in length, are provided and are particularly suited to use in the high throughput construction and functional analysis methods described herein. Vectors, including viral vectors, comprising the transcription cassettes are likewise provided herein.

Brief Description of Drawings [0014] FIG. 1 provides a table of illustrative restriction endonucleases and their corresponding recognition sites, which recognition sites may serve as first or second restriction endonucleases in accordance herewith. [0015] FIG. 2 provides a schematic illustrating construction of a multiple cloning site in accordance herewith. [0016] FIG. 3 provides a schematic illustrating construction of a transcription promoting region comprising an enhanced CMV (eCMV) promoter. [0017] FIG. 4 provides a schematic illustrating construction of a SPA™ (single plasmid to adenoviral) vector in accordance herewith.

Detailed Description of Invention [0018] Various aspects of the present invention are summarized below and further described and illustrated in the subsequent detailed descriptions and figures. [0019] The present invention provides compositions and methods for rapid construction and high throughput functional analysis of expression libraries. More particularly, the invention provides methods for the rapid construction of expression libraries comprising transcription cassettes, which transcription cassettes comprise a transcriptional polynucleotide, and use of such libraries in high throughput assay systems for the identification and/or validation of functional characteristics, toxicity and/or biological activities of expression products resulting from the transcription and/or translation of the transcriptional polynucleotides. [0020] hi one aspect, provided is a system for high throughput construction and functional analysis of transcriptional polynucleotides comprising providing an array of (n) sample sites having a single predominant transcriptional polynucleotide per sample site; associating the transcriptional polynucleotides of each sample site with a transcription promoting element and transcription termination mediating element to form a transcription cassette; associating the transcription cassette with a delivery biomolecule; delivering the transcription cassettes to a high-throughput functional assay; detecting readouts from the functional assay for the transcription cassettes; and identifying those transcriptional polynucleotides exhibiting a desired readout in the functional assay, wherein (n) is an integer equal to or greater than 6, preferably equal to or greater than 12, more preferably equal to or greater than 48 and still more preferably equal to or greater than 96. [0021] In another aspect, the present invention combines a method of amplifying individual polynucleotide species, for example individual cDNAs comprised within a library of cDNAs, in a multi-well format such that each well comprises a single predominant polynucleotide species, with a single plasmid to adenoviral vector (SPA™) method of recombinant virus production to provide a molecular biology based method of expression library construction that is less prone to error and more amenable to a high throughput construction format than other methods, such as those requiring homologous recombination to produce recombinant adenovirus. [0022] Thus, in one aspect, provided herein is a method for the construction of recombinant adenovirus without the use of shuttle plasmids or homologous recombination, comprising providing a replication-defective adenoviral vector plasmid comprising a heterologous promoter sequence linked via a multiple-cloning site to a polyadenylation signal; providing a transcriptional polynucleotide, such as for example a cDNA comprising a first linking region (LRl) at its 5' end and a second linking region (LR2) at its 3 'end, which linking regions each comprise a restriction endonuclease recognition site (REl and RE2, respectively) corresponding to a different restriction endonuclease site of the multiple-cloning site; digesting the replication-defective adenoviral vector plasmid and transcriptional polynucleotide with the restriction endonucleases recognizing the REl and RE2 sites; ligating the transcriptional polynucleotide into the multiple-cloning site of the replication-defective adenoviral vector plasmid; and transfecting adenoviral complementing cells with the replication-defective adenoviral vector plasmid comprising the transcriptional polynucleotide under conditions for production of adenovirus. [0023] The transcription cassettes of the present invention comprise transcriptional polynucleotides operably linked via a first restriction endonuclease site to a heterologous transcription promoting element and operably linked via second restriction endonuclease site to a transcription termination mediating element, wherein the first and second restriction endonuclease sites are different from one another and comprise at least eight nucleotides, preferably at least eight specific nucleotides. This configuration allows for the rapid, high throughput construction of a number of different transcription cassettes at once. By way of example, standard ligation reactions (employed to ligate the three components of the transcription cassettes to one another) may be conducted within each well of a multi-well plate, employing a different transcriptional polynucleotide in each reaction thereby generating a library of transcription cassettes in an array of sample sites. In an alternative embodiment, the transcription promoting element and transcription termination mediating element provided in each well can be comprised within a vector, such that the transcriptional polynucleotides may be ligated thereto using a standard ligation reaction. The vectors comprising complete transcription cassettes may then be further modified or used directly in high throughput functional assays in accordance herewith. [0024] With the use of the transcription cassettes, the invention provides rapid, efficient methods for generating information regarding biological activity, function and/or toxicity of the expression product resulting from transcription and/or translation of transcriptional polynucleotides. Such information can be collected whether or not the complete sequence of the transcriptional polynucleotide is known prior to testing. The high throughput methods allow for large scale testing and/or analysis of transcriptional polynucleotides in a variety of cells and with a variety of functional assays. In addition to use in identifying a biological activity and/or function of a particular transcriptional polynucleotide, a library of polynucleotides can be efficiently analyzed for a particular biological and/or functional activity. [0025] Once a particular biological activity and/or function of a transcriptional polynucleotide is identified, the transcriptional polynucleotide and/or its translation product may be of use as a potential drug target or a potential therapeutic agent. Thus, the invention provides methods that can lead to identification and/or validation of potential drug targets and/or therapeutic agents by providing functional data relative to such transcriptional polynucleotides. As will be appreciated by those of skill in the art, the data generated relative to a particular transcriptional polynucleotide may indicate various therapeutic applications, including without limitation that the polynucleotide itself is useful as a therapeutic, e.g., as a gene therapeutic; that the translation product of the polynucleotide is useful as a therapeutic, e.g., a protein therapeutic; or that the polynucleotide or its expression product(s) is/are useful as targets for therapeutic intervention, e.g., identification of a gene, the up or down regulation of which provides a desired effect. [0026] The ability to collect activity and/or toxicity information about a particular transcriptional polynucleotide rapidly and early in the analysis process can be important in the area of drug development, for example, where thousands of gene products are evaluated as potential drug targets or therapeutic agents. Accordingly, the invention provides rapid, high throughput methods for screening out candidates early in the functional analysis and throughout development processes that do not meet the desired criteria, thereby providing significant savings of time and money. Determining information about biological activity and/or toxicity of potential therapeutic agents can be important not only at the initial analysis and discovery stages but also throughout the development process of potential products. For example, as potential therapeutic agents or drug candidates are modified, for example, to optimize effectiveness and/or reduce unwanted activities, efficient analysis of the modified agents continues to be important. In this respect, the present invention provides rapid, high throughput methods for screening such compounds, for example using cell-based assays comprising transcription cassettes in accordance herewith. [0027] Once through an initial screening process, for example using one or more in vitro cell-based assays, transcription cassettes and vectors of the invention may also be used for efficient introduction of the transcriptional polynucleotides into animals or tissues, providing further assessment of biological activity, functional characteristics and/or toxicology of the expression products of the transcriptional polynucleotides. Additionally or alternatively, the transcription cassettes may be used to create transgenic animals or tissues and drug candidates, such as small molecules may be tested thereon to determine efficacy, toxicology and/or the like.

Definitions [0028] "Transcriptional polynucleotide" is a polynucleotide sequence which, when operably linked to a transcription promoting element and transcription termination mediating element, is transcribed into a transcription product which transcription product may or may not be translatable, for example into a protein or peptide. While frequently the transcriptional polynucleotides of the present invention will be sequences encoding proteins or peptides, it will sometimes be desirable to transcribe an anti-sense product of the transcriptional polynucleotide, in which case no translation of the so transcribed polynucleotide need occur. Illustrative transcriptional polynucleotides include, without limitation, DNAs, cDNAs, previously cloned DNAs, genomic DNAs, ESTs, genes, synthetic double stranded oligonucleotides; randomized sequences derived from one or multiple related or unrelated sequences or any other polynucleotide capable of being transcribed by the transcription machinery of a host cell or in in vitro transcription reactions when operably linked to a transcription promoting element and transcription termination mediating element. [0029] The transcriptional polynucleotides of the present invention may further comprise one more tag sequences, in particular "epitope tag" sequences, useful for confirming translation of the transcriptional polynucleotide. By way of example, in a preferred embodiment, one or more tag sequences can be linked to the transcriptional polynucleotide within the reading frame thereof, such that upon translation of the tag sequence a fusion protein is formed. Typically, a tag sequence a short peptide sequence that is specifically, but reversibly, bound by a receptor agent, such as for example an antibody. Illustrative epitope tags include GST-tag; Streptag (see, e.g., Skerra and Schmidt, Biomol. Eng. 16:79-86 (1999)); 6xHis-tag; various high affinity hexapeptide ligands (which are recognized by the anti- dynorphin mAb 32.39) (see, e.g., Barrett et al, Neuropeptides 6:113-120 (1985) and Cull et al, PNAS 89:1865-1869 (1992)); and a variety of short peptides known to bind the MAb 3E7 (see, e.g., Schatz, Biotechnology 11:1138-43 (1993)). In a preferred embodiment, described further herein, an epitope tag known as a FLAG™ tag (Eastman Kodak, New Haven, CT) is employed, preferably at the 3' end of the transcriptional polynucleotide, to facilitate confirmation of translation of the entire transcriptional polynucleotide. The FLAG™ tag is an eight amino acid peptide. In a preferred embodiment, the 24 base pair polynucleotide coding sequence is linked to the 3' end of the transcriptional polynucleotide which is then linked to the second linking region which is linked to the transcription termination mediating element. Alternatively, the 24 base pair polynucleotide encoding the FLAG tag may be located between the second linking region and transcription termination mediating element, provided however that it is still within the reading frame of the transcriptional polynucleotide such that it is translated with the transcriptional polynucleotide. The FLAG™ peptide includes an enterokinase recognition site corresponding to its carboxy-terminal five amino acids. This tag is recognized by various antibodies, including Anti-FLAG Ml, M2 and M5, all of which are commercially available. [0030] "Transcription cassette" is used to refer to a polynucleotide sequence of the present invention comprising at least a transcription promoting element (TPE), a first linking region (LRl), a transcriptional polynucleotide (TP), a second linking region (LR2) and a transcription termination mediating element (TTM), wherein said first and second linking regions comprise, respectively a first restriction endonuclease (REl) recognition site and a different second restriction endonuclease (RE2) recognition site, each of which recognition sites comprises at least eight nucleotide residues. Transcription cassettes of this type, i.e., TPE-LR1-TP-LR2-TTM, are a basic transcription cassette of the present invention which are preferably further associated with one or more delivery biomolecules, for example lipid-based biomolecules, proteins, other polynucleotide sequences (e.g., viral or plasmid vectors) and/or the like for delivery of the transcription cassette into cells wherein the transcriptional polynucleotide is transcribed and, if appropriate, translated. Additionally, biomolecules useful for amplification, transcription, translation and/or detection of the transcription cassette or transcriptional polynucleotide or its expression products may likewise be associated with the transcription cassette. By way of example, preferred delivery biomolecules include lipid-based biomolecule (such as, Lipofectamine 2000, Invitrogen, Carlsbad, CA) and viral and plasmid vectors. [0031] In a particularly preferred embodiment, provided are transcription cassettes comprised within a viral vector delivery biomolecule. Transcription cassettes of this type may be represented as LA(V)-TPE-LR1-TP-LR2-TTM-RA(V), wherein "LA(V)" and "RA(V)" represent, respectively, the left arm (LA) and right arm (RA) sequence of the vector (V). As discussed further elsewhere herein, both viral or non- viral vectors useful for facilitating transfection and/or transcription/translation of exogenous coding sequences in host cells are well known to those of skill in the art. As used herein, the left arm (LA) and right arm (RA) of a vector (V), refer to those portions of a vector between which a transcription cassette in accordance herewith is to be juxtaposed. It is intended that, together, the left arm of the vector and right arm of the vector comprise the entirety of the vector to be used. [0032] In a particularly preferred embodiment detailed herein, transcription cassettes comprising adenoviral vector sequences are described. Such transcription cassettes, denoted as LAAd-TPE-LRl-TP-LR2-TTM-RAAd, wherein "LAAd" and RAAd" refer respectively to a left arm adenoviral sequence and right arm adenoviral sequence, may be provided as linear polynucleotides or may be further associated with plasmid sequences or other biomolecules designed to further facilitate amplification, transfection or the like. Thus, for example, in this preferred embodiment the transcriptional polynucleotide is preferably located in the early region 1 (El) of the adenoviral genome and sequences from each of the El and E3 (early region 3) regions are deleted from the genome. Thus, the left arm of the vector comprises 5' sequences of the adenoviral genome up to the El deletion into which the transcriptional polynucleotide is to be inserted. By way of example, the left arm comprises base pairs 1-341 of the adenoviral 5 genome. The right arm then comprises the remainder of the adenoviral genome following the El deletion, i.e., beginning at base position 3529 and continuing to the end of the adenoviral genome, but excluding the E3 sequences deleted therefrom (i.e., base pairs 27865-30995). In this preferred embodiment, the LAAd-TPE-LRl-TP-LR2-TTM-RAAd vector comprises a replication-defective adenoviral genome that, when transfected into a complementing cell line, produces recombinant replication-defective adenovirus comprising the transcription cassette. Numerous other vectors as well as variations on the presently described adenoviral vector are known to those of skill in the art which may be used in accordance herewith and are likewise contemplated hereby. [0033] Further examples of polynucleotide sequences with which the transcription cassettes of the present invention may be associated include, without limitation amplification primers, in particular, polymerase chain reaction (PCR) primers, marker or tag sequences, antibiotic resistance encoding sequences, enhancers and the like. Such sequences may be, and preferably are, associated with the transcription cassettes in addition to vector sequences. [0034] In still further embodiments, provided are "precursor" transcription cassettes. Such precursor transcription cassettes lack transcriptional polynucleotides and thus have the first and second linking regions linked directly to one another. Preferably, the first and second linking regions of the precursor transcription cassettes comprise more than two, preferably at least four and more preferably at least six different restriction endonuclease recognition sites each comprising at least eight nucleotide residues. The linking regions of the precursor transcription cassettes thus form a multiple cloning site (MCS) which is used to insert transcriptional polynucleotides into the cassettes. The precursor transcription cassettes are denoted herein as TPE-MCS-TTM and preferably are associated with vector sequences. [0035] In particularly preferred embodiments, the MCS of the precursor transcription cassettes comprises at least six highly specific restriction endonuclease sites each of which comprises at least eight specific nucleotide residues. Thus, for example, while these highly specific endonuclease restriction recognition sites may comprise some number of unspecified nucleotides (typically represented as "N" for any nucleotide base or "Py" or "Pu" for pyrimidine and purine bases, respectively), at least eight of the residues are specific nucleotide bases, i.e. A (adenine), C (cytosine), T (thymine) or G (guanine). Providing such highly specific MCS sequences within the precursor transcription cassettes confers a number of advantages, for example, it increases the flexibility of stock reagents comprising the cassettes as there are numerous, specific, restriction endonuclease sites from which to choose for insertion of transcriptional polynucleotides, as well as further reducing the risk of unwanted or unintended cleavage/ligation reactions. [0036] In another preferred embodiment, the restriction endonuclease recognition sites of the MCS are selected such that the cleavage products (i.e., sticky or overhanging ends) of each are either rich in guanine (G) and cytosine (C) residues or are rich in adenine (A) and thymine (T) residues. In particular, it is preferred that the restriction sites at one end of the MCS be rich in the same (G/C or A T) nucleotide bases, while those at the other end be rich in the other two bases. Thus, for example, where the MCS of the precursor transcription cassette comprises six restriction endonuclease recognition sites, it is preferred that the three sites located at the 5' end of the MCS be G/C or A/T rich sites whereas the three sites located at the 3' end be rich in the other two bases. Such a configuration readily permits selection of first and second restriction endonuclease sites that are even less likely to ligate with one another. Additional discussion concerning such restriction endonuclease sites is provided below. [0037] "Transcription promoting element" (TPE) refers to one or more polynucleotide sequences effecting initiation of transcription of a transcriptional polynucleotide including at least one sequence, a promoter sequence, that controls transcription of a transcriptional polynucleotide to which it is operably linked. A large number of promoters, including constitutive, inducible, repressible, ubiquitous, tissue specific and cell specific promoters, from a variety of different sources, are well known in the art (and identified in databases such as GenBank) and are available as or within cloned polynucleotide sequences (from, e.g., depositories such as the ATCC as well as other commercial or individual sources). Preferably, the promoter sequence of the TPE is heterologous to the transcriptional polynucleotide to which it is operably linked, that is it is not the promoter sequence that is naturally occurring for the transcriptional polynucleotide. Further, in preferred embodiments, the promoter sequence is one that is high functioning in mammalian cells, for example, an "enhanced" CMV promoter (eCMV) which is a promoter derived from human cytomegalovirus (CMV) which contains an endogenous intron, the presence of which results in increased function of the promoter as compared to a truncated sequence lacking the intron. The eCMV promoter was isolated from the gWIZ-Luc plasmid (Gene Therapy Systems, San Diego, CA) which comprises the eCMV promoter operably linked to a luciferase-encoding cDNA. The transcription promoting elements provided herein are linked at their 3' end to a "linking region" (LRl), described below, which linking region comprises at least one restriction endonuclease recognition site designed to facilitate rapid and efficient construction of transcription cassettes and the expression libraries comprising the same of the present invention. [0038] A tianscription promoting element may include other polynucleotide sequences in addition to promoter sequences. By way of example, transcription promoting elements may include one or more enhancer sequences. As used herein, "enhancer" refers to a polynucleotide sequence that enhances transcription of a transcriptional polynucleotide to which it is operably linked. A large number of enhancers, from a variety of different sources are well known in the art (and identified in databases such as GenBank) and available as or within cloned polynucleotide sequences (from, e.g., depositories such as the ATCC as well as other commercial or individual sources). A number of polynucleotides comprising promoter sequences (such as the commonly-used CMN promoter) also comprise enhancer sequences. Additionally, the transcription promoting elements of the present invention may comprise one or more restriction endonuclease recognition sites to facilitate linking of the TPE to other sequences such as an LRl or vector sequence. Those of skill in the art will readily appreciate that additional or different polynucleotide sequences may likewise be comprised within a transcription promoting element. Further, it is noted that additional polynucleotide sequences related to or effecting transcription promotion may additionally be present outside the transcription promoting element of the present invention. [0039] "Transcription termination mediating element" as used herein, refers to one or more polynucleotide sequences effecting the termination of transcription of a transcriptional polynucleotide and/or the processing of the 3 ' end of a tianscription product. Transcription termination mediating elements of the present invention comprise at least one polynucleotide sequence, such as a polyadenylation sequence, that when operably linked to a transcriptional polynucleotide, is capable of facilitating the termination of the transcription thereof. The tianscription termination mediating elements provided herein are operably linked at their 5' end to a "linking region" (LR2), described below, which linking region comprises at least one restriction endonuclease site designed to facilitate rapid and efficient construction of transcription cassettes and expression libraries comprising the same. Other and additional polynucleotide sequences may likewise be included in a transcription termination mediating element, such as for example other sequences related to transcription termination (e.g., splicing signal sequences), restriction endonuclease recognition sites (e.g., to facilitate linking of the TTM to an LR2 or vector sequence) or the like. Thus, not all polynucleotide sequences effecting transcription termination need be in the transcription termination mediating element. [0040] "Restriction endonuclease" refers to any of various enzymes that cleave polynucleotides into fragments at specific sites, i.e., at specific polynucleotide sequences. The specific nucleotide sequence upon which such enzymes act is referred to as the "restriction endonuclease site" or "recognition site". As used herein, the first and second restriction endonuclease sites, comprised respectively within first and second linking regions, comprise at least eight nucleotide residues and preferably more than eight residues. Longer restriction endonuclease recognition sites occur less frequently in nature and are less likely to occur within the transcriptional polynucleotide or other elements of a transcription cassette, thereby reducing the likelihood of unwanted or unintended cleavage or ligation of polynucleotide sequences. Various restriction endonucleases having recognition sites of eight or more specific nucleotides, including restriction endonucleases recognizing sequences of 10, 20, 40 and even more nucleotides, are well known to those of skill in the art. Illustrative restriction endonucleases having various lengthy recognition sites are provided in FIG. 1. This list is by no means exclusive, but rather illustrative. Such enzymes are commercially available from various sources. New restriction endonuclease enzymes are routinely identified and continue to be commercialized and thus are likewise useful herein and contemplated hereby. Where the nucleotide sequence of a transcription promoting element, transcription termination mediating element, transcriptional polynucleotide and or any other polynucleotide sequence of a tianscription cassette is known, restriction endonuclease sites that are not present in such known sequences will preferably be selected for inclusion in the tianscription cassette. [0041] References herein to "first" and "second" restriction endonuclease sites are generally used to distinguish two restriction endonucleases from each other. Hence, for example, whereas an important aspect of the present invention is that different restriction endonuclease sites be used to ligate the transcriptional polynucleotide to the transcription promoting element and transcription termination mediating element, for clarity, these restriction endonuclease sites are referred to as first and second sites or "REl" and "RE2" sites respectively. Preferably, the first and second restriction endonuclease sites are selected such that cleavage thereof results in non-overlapping, non-complementary ends thereby reducing the likelihood of unintended or unwanted ligation. By way of example, a first restriction endonuclease site (located at the 3 ' end of a transcription promoting element) may be selected to provide, upon cleavage thereof, a 3' overhanging sequence and/or an overhanging sequence that is rich in adenine (A) and thymine (T) residues. Then a second restriction endonuclease site (located at the 5' end of a transcription termination mediating element) may be selected to provide, upon cleavage thereof, a 5' overhanging sequence and/or an overhanging sequence that is rich in guanine (G) and cytosine (C) residues. [0042] As used herein, an "adenine and thymine rich" restriction site is a restriction site that, following cleavage with the corresponding restriction endonuclease, results in an overhanging sequence comprising greater than 50% A's and T's, preferably greater than 65%, more preferably greater than 75% and still more preferably 100%. As used herein, a "guanine and cytosine rich" restriction site is a restriction site that , following cleavage with the corresponding restriction endonuclease, results in an overhanging sequence comprising greater than 50% G's and C's, preferably greater than 65%, more preferably greater than 75% and still more preferably 100%. [0043] As used herein, "expression product" refers not only to the product resulting from transcription and translation of a transcriptional polynucleotide, but also to the transcription product itself where that product is not further translated such as in the case of an anti-sense product. [0044] "Functional analysis assays", as used herein refer to assays in which at least one activity, including, but not limited to biological, physiological, physical and functional activity, associated with the transcription and/or translation of the transcriptional polynucleotide is assessed. Also described herein are "biological assays" which are biology-based functional assays. In general such assays will be cellular based assays used as functional analysis assays to generate a detectable "readout", such as for example a biological, physiological, chemical or visual readout or the like. Readouts are detectable effects arising as a consequence of expression (including tianscription and/or translation) of the transcriptional polynucleotide and may be a direct or an indirect indicator of activity of the expression product of the transcription cassette. In some cases, the readout may be predictive of a function of the transcriptional polynucleotide or its encoded product in a cell or tissue. [0045] A "heterologous" component refers to a component that is introduced into or produced within a different entity from that in which it is naturally located. For example, a polynucleotide derived from one organism, such as a mammal, and introduced by genetic engineering techniques into a different organism, such as a virus, is a heterologous polynucleotide which, if expressed, for example in a mammalian cell, can encode a heterologous polypeptide. Similarly, a promoter or enhancer that is removed from its native coding sequence and operably linked to a different coding sequence is a heterologous promoter or enhancer, regardless of whether the native coding sequence and different coding sequence are from the same or different organisms or species. Thus, for example, a human myosin light chain promoter operably linked to a transcriptional polynucleotide derived from a human cDNA library and introduced into a mammalian cell for expression therein, is a "heterologous" promoter as that termed is used herein. [0046] "Operably linked" refers to a juxtaposition of two or more components, wherein the components so described are in a relationship permitting them to function in their intended manner. By way of example, a promoter is operably linked to a transcriptional polynucleotide if the promoter controls tianscription of that sequence. Although an operably linked promoter is generally located upstream of the coding sequence, it is not necessarily contiguous with it. An enhancer is operably linked to a polynucleotide sequence if the enhancer increases transcription of that sequence. Operably linked enhancers can be located upstream, within or downstream of so effected polynucleotide sequence. A polyadenylation sequence is operably linked to a polynucleotide sequence if it is located at the downstieam end of that sequence such that transcription proceeds through the polynucleotide sequence into the polyadenylation sequence. [0047] "Polynucleotide" as used herein, refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides, or analogs thereof. This term refers to the primary structure of the molecule, and thus includes double- and single-stranded DNA, as well as double- and single-stranded RNA. Also included are modified polynucleotides such as methylated and/or capped polynucleotides. [0048] A "recombinant" polynucleotide is one that has been created by combining two or more polynucleotides, for example by cloning, restriction and/or ligation reactions, chemical synthesis and/or the like. When used to describe a virus, viral vector, plasmid or the like, the polynucleotide or genome of the virus, viral vector or plasmid is recombinant, such as, for example, comprising a transcriptional polynucleotide in accordance herewith. [0049] "Replication-defective" is used herein to refer to a virus (or viral vector) that is not capable of replication without one or more essential genes being provided in trans, that is from without the virus/vector. Typically, replication-defective virus and vectors lack the function of one or more genes essential to competent replication, for example due to deletion, disruption or other inactivation of such gene(s). Some viruses, however, such as for example, adeno-associated virus (AAV) are naturally non-replicative, in this case, requiring the presence of an adenovirus (or certain adenoviral genes) to achieve replication. Those of skill in the art are familiar with numerous methods of rendering a virus/viral vector replication-defective, see for example the numerous references relative to viral vectors and cited herein. [0050] "Amplification primer(s)", as used herein, refers to polynucleotide sequences, in particular oligonucleotides, for use in initiating replication of a polynucleotide sequence to which said amplification primers are operably linked. Typically, such amplification primers will be used in polymerase chain reactions (PCR). [0051] The terms "polypeptide," "peptide," and "protein" are used interchangeably to refer to polymers of amino acids of any length. These terms also include proteins that are post- tianslationally modified through reactions that include glycosylation, acetylation and phosphorylation. [0052] As used herein, "delivery" of a tianscription cassette of the present invention to a cell refers to the introduction of the exogenous polynucleotide into a host cell, irrespective of the method used for the introduction. Such methods include a variety of well-known techniques such as vector-mediated delivery (by, e.g., viral infection/transfection, or various other protein-based or lipid-based delivery complexes) as well as techniques facilitating the delivery of "naked" polynucleotides (such as electroporation, "gene gun" delivery and various other techniques used for the introduction of polynucleotides). The introduced polynucleotide may be stably or transiently maintained in the host cell. Stable maintenance typically requires that the introduced polynucleotide either contain an origin of replication compatible with the host cell or integrate into a replicon of the host cell such as an extrachromosomal replicon (e.g., a plasmid) or a nuclear or mitochondrial chromosome. As is known in the art and described herein, a number of vectors are known to be capable of mediating transfer of polynucleotides, such as comprise the transcription cassettes of the present invention, into various cells, including mammalian cells. [0053] "In vivo " delivery, transfer and the like of the tianscription cassettes as used herein, are terms referring to the introduction of a composition, comprising such transcription cassettes, directly into the body of an organism, such as non-human mammal, whereby the exogenous polynucleotide comprised within the tianscription cassette is introduced into a cell of such organism in vivo. [0054] The terms "vector" and "delivery biomolecule" are both used herein to refer to a macromolecule or complex of molecules capable of delivering a polynucleotide, such as a transcription cassette, to a host cell or synthetic expression system. Examples of such include, without limitation, viral vector plasmids, replication-defective virus, plasmids, liposomes, micelles and lipid-containing emulsions.

References [0055] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology and the like, which are within the skill of the art. Such techniques are explained in the literature. See e.g., Molecular Cloning: A Laboratory Manual, (J. Sambrook et al, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989); Current Protocols in Molecular Biology (F. Ausubel etal. eds., 1987 and updated); Essential Molecular Biology (T. Brown ed., IRL Press 1991); Gene Expression Technology (Goeddel ed., Academic Press 1991); Methods for Cloning and Analysis of Eukaryotic Genes (A. Bothwell et al. eds., Bartlett Publ. 1990); Gene Transfer and Expression (M. Kriegler, Stockton Press 1990); Recombinant DNA Methodology (R. Wu et al. eds., Academic Press 1989); PCR: A Practical Approach (M. McPherson et al, IRL Press at Oxford University Press 1991); Cell Culture for Biochemists (R. Adams ed., Elsevier Science Publishers 1990); Gene Transfer Vectors for Mammalian Cells (J. Miller & M. Calos eds., 1987); Mammalian Cell Biotechnology (M. Butler ed., 1991); Animal Cell Culture (J. Pollard et al. eds., Humana Press 1990); Culture of Animal Cells, 2nd Ed. (R. Freshney et al. eds., Alan R. Liss 1987); Flow Cytomehy and Sorting (M. Melamed et al. eds., Wiley-Liss 1990); the series Methods in Enzymology (Academic Press, Inc.); Techniques in Immunocytochemistry, (G. Bullock & P. Petrusz eds., Academic Press 1982, 1983, 1985, 1989); Handbook of Experimental Immunology, (D. Weir & C. Blackwell, eds.); Cellular and Molecular Immunology (A. Abbas et al, W.B. Saunders Co. 1991, 1994); Current Protocols in Immunology (J. Coligan et /. eds. 1991); the series Annual Review of Immunology; the series Advances in Immunology; Oligonucleotide Synthesis (M. Gait ed., 1984); Animal Cell Culture (R. Freshney ed., IRL Press 1987. [0056] The references cited in the above section are hereby incorporated by reference herein to the extent that these references teach techniques that are employed in the practice of the present invention. Incorporation by Reference [0057] Unless otherwise indicated herein, all references cited within this application, including patents, patent applications and other publications, are hereby incorporated by reference in their entirety.

Description of Illustrative Embodiments [0058] The present invention relates to compositions and methods for rapid construction and high throughput functional analysis of expression libraries. More particularly, the invention provides methods for the rapid construction of expression libraries comprising a multiplicity of transcription cassettes, each transcription cassette comprising a different transcriptional polynucleotide, and use of such transcription cassettes in high throughput functional assay systems to identify and/or validate functional characteristics of at least one of the transcriptional polynucleotides of such a library. In one aspect, the transcription cassettes of the present invention comprise, in order, (i) a transcription promoting element (TPE); (ii) a first linking region (LRl); (iii) a transcriptional polynucleotide(TP); (iv) a second linking region (LR2) and (v) a transcription termination mediating element (TTM). The first and second linking regions of the transcription cassettes comprise, respectively, a first (REl) and second (RE2) restriction endonuclease recognition site, wherein said REl and RE2 recognition sites are different from one another and comprise at least eight nucleotide residues. Further, the TPE comprises a promoter sequence which is preferably heterologous to the TP to which it is operably linked. Upon introduction of the tianscription cassette into a cell, for example a mammalian cell, the transcriptional polynucleotide of the transcription cassette can be transcribed and, where necessary or desirable, translated into an expression product. [0059] In a further embodiment of the tianscription cassettes an epitope tag is provided, preferably incorporated at an end of the transcriptional polynucleotide and within the tianscriptional polynucleotide reading frame such that, upon translation of the tianscriptional polynucleotide, a fusion protein comprising the product of the transcriptional polynucleotide and the epitope is produced. Advantageously, the epitope tag may then be detected using an antibody directed thereto, thereby providing a mechanism for confirming the presence of the tianscriptional polynucleotide product. In a particularly preferred embodiment, the epitope tag is provided at the 3' end of the transcriptional polynucleotide, providing a clearer indication of expression of the entire transcriptional polynucleotide product and facilitating subsequent purification thereof. [0060] In a preferred embodiment, the expression library provided herein comprises a multiplicity of tianscription cassettes in an array of sample sites, wherein the transcription cassettes located at any single sample site comprise a predominant transcriptional polynucleotide. In a further embodiment, the tianscription cassettes of the present invention can each be comprised within a vector, such as a viral or non- viral vector. In a particularly ₍preferred embodiment, the tianscription cassettes are contained within an adenoviral vector, especially replication-defective adenoviral vector or recombinant adenovirus produced therefrom. [0061] Advantageously, the transcription cassettes of the present invention maybe constructed rapidly, in a high throughput manner and can provide anti-sense as well as sense expression products (i.e., by incorporating the tianscriptional polynucleotide into the transcription cassette in an antisense rather than sense orientation). In a further aspect of the present invention, methods of construction of the transcription cassettes and expression libraries comprising the same are provided. In a preferred embodiment, these methods employ first (REl) and second (RE2) restriction endonuclease recognition sites of the first and second linking regions (LRl) and (LR2) to ligate a transcriptional polynucleotide to each of a transcription promoting element and a transcription termination mediating element in a single ligation reaction. By providing the transcription promoting element and transcription termination mediating element separately from the transcriptional polynucleotide and employing different restriction endonuclease recognition sites of at least eight residues in length for ligation of these components, the present invention provides a particularly flexible and robust system for construction of the transcription cassettes and functional analysis of transcriptional polynucleotides therein. [0062] By way of example, in one aspect, individual cDNA sequences are preferentially amplified, from a cDNA library of interest, with specific different restriction endonuclease recognition sites of at least eight residues in length incorporated at the ends thereof, by, for example, adding the desired restriction endonuclease recognition sequence linkers to the amplification primers. These restriction endonuclease sites can then be employed to ligate amplified cDNA sequence, in either the sense or anti-sense direction, to a transcription promoting element comprising a heterologous promoter sequence and to a transcription termination mediating element. Thus, in preferred embodiments, the transcriptional polynucleotide is a cDNA, preferably a cDNA from a particular library of interest, such as for example a disease-related mammalian cDNA library. The first and second restriction endonuclease sites employed in these methods are preferably selected to be different from one another and to comprise at least eight nucleotide residues. Longer restriction endonuclease recognition sites occur less frequently in nature and are less likely to occur within the transcriptional polynucleotide or other elements of a transcription cassette. By using restriction endonuclease recognition sites of at least eight residues in length, the likelihood of unwanted or unintended cleavage (or ligation) of the components of the tianscription cassettes can be advantageously reduced and the efficiency of construction of the cassettes can be increased. In preferred embodiments, likewise useful to reduce the likelihood of unwanted or unintended cleavage and ligation products, the first and second restriction endonuclease sites can further be differentiated from one another in that one is preferably a 3' overhanging end and the other is preferably a 5' overhanging end and/or one is preferably rich in adenine (A) and thymine (T) residues and the other is preferably rich in guanine (G) and cytosine (C) residues. [0063] Also provided herein are reagents useful in the construction of the transcription cassettes of the present invention. By way of example, provided are a multiplicity of stocks of transcription promoting elements each comprising, at their 3' ends, a first linking region, which first linking region includes a restriction endonuclease recognition site of at least eight residues in length and which stocks each comprise a different restriction endonuclease site. Also, provided are a multiplicity of stocks of transcription termination mediating elements each comprising, at their 5' ends, a second linking region including a restriction endonuclease recognition site of at least eight residues in length and which stocks each comprise a different restriction endonuclease site. Each of these reagent stocks then comprises a single transcription promoting element/first linking region combination or a single second linking region/transcription termination mediating element combination. Further provided are multiplicities of stocks of transcriptional polynucleotides comprising first linking regions at their 5' ends and second linking regions at their 3' ends, wherein the first and second linking regions comprise, respectively, first and second restriction endonuclease recognition sites of at least eight residues in length and different from one another. [0064] In another embodiment, provided are precursor tianscription cassettes lacking a transcriptional polynucleotide and thus having the first and second linking regions linked directly to one another. Preferably, the first and second linking regions of such a precursor tianscription cassette comprise, together, more than two, preferably at least four and more preferably at least six different restriction endonuclease recognition sites, each comprising at least eight nucleotide residues, thus forming a multiple cloning site (MCS) for use in inserting transcriptional polynucleotides into the cassette. The precursor transcription cassettes are preferably provided in association with vector sequences, such as for example viral and/or plasmid sequences. Advantageously, insertion of a transcriptional polynucleotide into the MCS of such a vector may be accomplished using standard cleavage/ligation reactions and preferably is accomplished using a single ligation reaction. [0065] In particularly preferred embodiments a precursor transcription cassette is provided within a vector, preferably a viral vector, and more preferably an adenoviral vector, such as a replication-defective adenoviral vector. Replication-defective vectors can be and typically are provided by deleting or otherwise inactivating one or more regions or genes of the viral genome that are essential for replication. Production of such viral vectors can generally be performed using cell lines which provide the one or more lacking regions or genes, for example in trans. By way of example, illustrated herein are replication-defective adenoviral vectors, lacking the adenoviral El region and comprising an insertion of a precursor transcription cassette, preferably in the region of the El deletion. In a further aspect of the present invention, such adenoviral vectors comprising a precursor transcription cassette can be provided as a stock of vectors useful in the rapid, high throughput construction of a recombinant adenoviral expression library in accordance herewith. Advantageously, tianscriptional polynucleotides may be inserted into such viral vectors using standard cleavage/ligation reactions and the resulting adenoviral vectors used to generate recombinant adenovirus from a complementing cell line, without the need for co-tiansfection with other plasmids or viral genes and thus, without the need for homologous recombination. In a further embodiment of the present invention, then, provided are methods for the production of recombinant adenovirus wherein a single plasmid, comprising a replication-defective adenoviral genome and tianscription cassette in accordance herewith, can be transferred into a complementary cell and recombinant adenovirus produced therefrom. Significantly, this single-plasmid-to-adeno virus (SPA™) method of construction of recombinant adenovirus allows for efficient, rapid, high throughput construction of an adenoviral expression library with essentially no possibility of generating replication competent adenovirus (RCA). [0066] In yet another preferred embodiment, adenoviral expression libraries comprising the tianscription cassettes of the present invention are provided in an array of sample sites, for example a multiplicity of micro wells, wherein the adenovirus at each sample site predominantly comprise the same transcriptional polynucleotide(s), that is at least greater than 50%, more preferably 75% and most preferably greater than 90% of the adenovirus at a particular sample site comprise the same transcriptional polynucleotide(s). Such an expression library can be particularly well suited to use in high throughput functional analysis assays in accordance herewith. [0067] Thus, further provided herein are methods for the high throughput functional analysis of the tianscriptional polynucleotides comprised within the tianscription cassettes of the present invention. In a preferred embodiment, the method includes providing an array of cell-based assay sites, to which members of the expression library can be added. The assay can then be conducted, resulting in a detectable readout providing an indication of biological activity, function, toxicity and/or other biological relevance of the expression product encoded by the transcription cassette. Based upon the data collected, individual members of the expression library may then be selected for further in vitro high throughput assaying and/or for in vivo testing. [0068] In another embodiment, the transcription cassettes of the present invention comprise disease-related transcriptional polynucleotides. Such disease-related transcriptional polynucleotides may be produced, fo example, using standard techniques to isolate mRNA transcripts from diseased tissue, e.g., diseased myocardium where the disease of interest is heart disease, which mRNA transcripts can then be used as templates for production of a cDNA library of disease-related polynucleotides, said disease-related polynucleotides can then be used as transcriptional polynucleotides in the construction of disease-related transcription cassettes in accordance herewith. Disease specific assays are then preferably used to analyze such disease-related transcription cassettes, providing physiological readouts more closely related to a particular disease of interest. (See e.g., disease-related assays described the Examples, below.)

Transcription Cassettes [0069] The transcription cassettes of the present invention provide a powerful tool for the rapid, high throughput construction and functional analysis of expression libraries. This is in part due to the fact that numerous different promoter/polynucleotide combinations may be rapidly and simultaneously constructed, providing increased flexibility in the testing of individual transcriptional polynucleotide sequences. [0070] The transcription cassettes provided herein comprise a tianscription promoting element linked via a first linking region to a transcriptional polynucleotide which is linked via a second linking region to a transcription termination mediating element, wherein the first and second linking regions comprise, respectively, first and second restriction endonuclease recognition sites which are each at least eight residues in length and which are different from one another. Once constructed, for example using standard ligation techniques, the transcription cassettes of the present invention will, generally, be amplified then subjected to in vitro and or in vivo functional analysis assays, as described in more detail elsewhere herein. [0071] In one aspect, amplification primers can be used to amplify the transcription cassettes for example via a polymerase chain reaction (PCR). The amplified cassettes may then be associated with delivery vectors or may be used directly in functional analysis assays. Where a tianscription cassette is to be associated with a polynucleotide-based delivery vector, it generally will be modified to include restriction endonuclease sites at either end to facilitate ligation into the delivery vector. By way of example, a transcription cassette in accordance herewith may be modified using standard molecular biology techniques to include the same or two different restriction endonuclease sites at either end and then ligated into a plasmid and the plasmid may then be encapsulated in a liposome. [0072] In another aspect, the tianscription cassettes of the present invention can be constructed within polynucleotide-based delivery vectors, particularly viral vectors, which can then be amplified along with the transcription cassettes. Use of delivery vectors to deliver the transcription cassettes to a host cell can facilitate functional analysis of the tianscriptional polynucleotide in a wide variety of functional analysis assays, for example cell-based assays. In a preferred embodiment detailed below, a viral vector is prepared comprising a transcription promoting element linked via a multi-cloning site to a transcription termination mediating element, wherein the multi-cloning site comprises at least the first and second restriction endonuclease sites for use in constructing the tianscription cassette. Advantageously, the transcriptional polynucleotide can then be ligated into the viral vector in a single ligation reaction, using the first and second restriction endonucleases. In preferred embodiments, the multi-cloning site comprises at least three and more preferably at least six restriction endonuclease sites. The presence of multiple restriction endonuclease sites increases the flexibility of the viral vector as it allows for alternative choices in selecting the restriction endonuclease to be used in the ligation reaction. Thus, for example should a transcriptional polynucleotide happen to include a one of the restriction endonuclease sites internally, an alternative restriction site may be employed without the need for a different viral vector. [0073] In further preferred embodiments, the viral vector comprises a replication- defective viral genome. Replication-defective viral genomes are well known in the art and generally comprise a deletion of genes necessary for replication and/or an insertion of nucleic acids disrupting such genes. Thus, for example, the tianscription cassette of the present invention can be inserted into the site of gene deletion in the viral genome or may be used as the insertion sequence to disrupt the particular viral genes. In a preferred embodiment detailed herein, an adenoviral vector is described comprising a multiple cloning site (MCS) flanked by a transcription promoting element and transcription termination mediating element as described above. In this example, the adenoviral genome contains a deletion of genes in the El region, rendering the genome replication-defective. The transcription promoting element/MCS/tianscription termination mediating element complex is, preferably, inserted in the area of the El deletion. Advantageously, stocks of adenoviral vectors comprising a tianscription promoting element/MCS/tianscription termination mediating element complex can be prepared and used for rapid, high throughput construction of adenoviral expression libraries comprising the transcription cassettes of the present invention.

Transcriptional Polynucleotides [0074] Transcriptional polynucleotides of the present invention are polynucleotide sequences that encode a transcription and/or translation product, when associated with a transcription promoting element and a tianscription termination mediating element and introduced, alone or in association with additional biomolecules, into an expression system, such as a host cell or in vitro expression system. Illustrative tianscriptional polynucleotides include, without limitation, genomic DNA, cDNA, previously cloned DNA, ESTs, synthetic double stranded oligonucleotides and randomized sequences derived from one or multiple related or unrelated sequences. The transcription products of the transcription polynucleotides may be further translated into proteins or polypeptides or may themselves be biologically active, such as antisense polynucleotides. Accordingly, in some cases a tianscription product may be a genetic suppressor element (GSE), for example, encoding either truncated proteins, acting as dominant-negative mutants, or inhibitory antisense RNA segments counteracting the gene from which they are derived. The tianscription polynucleotides may be derived from any organism including fish, nematodes, insects, yeasts, fungi, bacteria and plants and are preferably obtained from mammals (for example, human, monkey, swine, mouse or rat). The tianscriptional polynucleotides may be derived from single or multiple tissue or cell types, including diseased or healthy tissues and/or cells of the organism. By way of example, in a preferred embodiment, the tianscriptional polynucleotides are derived from a cDNA library constructed from diseased tissue (such as a heart) of an animal, particularly a mammal, suffering from the disease of interest (such as heart disease) and used to construct an expression library, which expression library is then subjected to high throughput functional analysis assays in accordance herewith. The transcriptional polynucleotides of the present invention may alternatively be prepared using synthetic oligonucleotides for example, from commercially available DNA synthesizers and kits. Typically, the transcriptional polynucleotides will be provided as double-stranded molecules, even more typically, as double-stranded DNA molecules. [0075] To facilitate the rapid construction of the tianscription cassettes, and hence expression libraries, of the present invention, the tianscriptional polynucleotides further comprise first and second linking regions, including, respectively first and second restriction endonuclease recognition sites. The first linking region is located at the 5' end of the transcriptional polynucleotide and corresponds to a first linking region on the 3' end of a tianscription promoting element. The second linking region is located at the 3' end of the tianscriptional polynucleotide and corresponds to a second linking region on the 5 'end of a tianscription termination mediating element. As discussed further elsewhere herein, the first and second restriction endonuclease recognition sites located within the first and second linking regions, respectively, are selected to be different from one another and each comprise at least eight nucleotide residues. Generally, the first and second linking regions will be added to the transcriptional polynucleotide during its synthesis or during amplification using PCR primers, although other standard techniques may likewise be used. [0076] In a preferred embodiment, the transcriptional polynucleotides of the present invention further comprise a marker sequence that, when translated along with the transcriptional polynucleotide, can be detected, thereby providing an indication of successful translation of the transcriptional polynucleotide. As described further herein, in a particularly preferred embodiment, the marker sequence is an epitope tag located at the 3' end of the tianscriptional polynucleotide before the transcription termination mediating element and in the reading frame of the transcriptional polynucleotide. Translation of the transcriptional polynucleotide results in a fusion protein comprising the epitope tag at its carboxy terminal. An antibody, specific to the epitope tag may then be employed to detect the protein, providing an indication that the entire transcriptional polynucleotide has been translated. [0077] In particularly preferred embodiments, the transcriptional polynucleotides will be derived from a cDNA library. While the function of the products resulting from transcription and or tianslation of the transcriptional polynucleotides will generally be unknown, the sequences of the cDNA species comprising the cDNA library may be known (for example by reference to publicly available databases or information supplied by the vendor of the cDNA library or by direct sequencing). This sequence information can be used to design PCR primers specific for discrete cDNA sequences contained within the library and individual cDNA sequences amplified therefrom. Preferably, the PCR primers are additionally designed to incorporate first and second linking regions into the amplified cDNA, as well as any additional sequences desired, such as for example epitope tags or similar marker sequences. Advantageously, amplification of individual cDNA sequences (including modification thereof to include first and second linking regions, eptiope tags and the like) can then be done in a high throughput manner to provide a single transcriptional polynucleotide (i.e. single cDNA species) as the predominant polynucleotide species per sample site of an array, for example per well of a multi-well plate. A "predominant polynucleotide species" as used herein, is one which is present at a level of about a log greater than other polynucleotide sequences. In preferred embodiments, the predominant polynucleotide sequence is that sequence that has been modified to include first and second linking regions and has been amplified by PCR, such that it is present at a level that is at least about a log in excess of any other polynucleotide sequence.

Transcription Promoting Elements [0078] The tianscription promoting elements used to construct tianscription cassettes of the present invention are polynucleotide sequences effecting initiation of a tianscriptional polynucleotide and include at least one sequence, a promoter sequence, that controls transcription of a tianscriptional polynucleotide to which it is operably linked. Transcription promoting elements may additionally include enhancer sequences, signal sequences or the like. Importantly, the transcription promoting elements of the present invention further comprise a restriction endonuclease site at their 3' end, referred to herein as a first restriction endonuclease (REl) site, which restriction endonuclease site is comprised within a first linking region (LRl) (or is itself the first linking region). This restriction site facilitates the rapid, efficient construction of the transcription cassettes and expression libraries of the present invention, as discussed elsewhere herein. [0079] The promoter sequence comprised within the transcription promoting element preferably is a heterologous promoter and may be constitutive or inducible and may be ubiquitous in its activity or tissue specific in its activity. Generally, the promoter sequence will be selected based upon the nature of the transcriptional polynucleotides upon which it is to operate and based upon the host cells to be used in the high throughput in vitro and in vivo assays to be performed. By way of example, in one preferred embodiment, an enhanced CMV promoter, eCMV (isolated from the gWIZ-Luc plasmid, Gene Therapy Systems, San Diego, CA) is selected for use as it is a highly active promoter operable in mammalian cells. In other embodiments, a tissue specific promoter may be preferred. For example, if a particular biological assay comprises a mixture of cell types at each sample site, it may be desirable to target one or more particular cell types within the mixture for tianscription and/or expression of the transcriptional polynucleotide. A tissue (or cell) specific promoter may be used to achieve such targeting. Illustrative ubiquitous promoters include human cytomegalovirus (CMV) (see, e.g., Boshart etal, Cell (1985) 41:521); eCMV; human phosphoglycerate kinase (PGK); E1B; hsp70 promoters (Levy-Holtzman ,R. and I. Schechter (Biochim. Biophys. Acta (1995) 1263: 96-98) Presnail, J. K. and M. A. Hoy, (Exp. Appl. Acarol. (1994) 18: 301-308); and the like. Promoters which are specifically or preferentially expressed in a particular tissue type or organ have likewise been identified in the art for most tissues and organs of interest. Taking the heart as an illustrative example, there are a number of such heart tissue specific promoters, see e.g., ventricular myocyte-specific myosin light chain 2 (MLC-2v) (see, e.g., Zhu H, et al, Mol. Cell Biol. 11(4):2273-81 (1991)); a -myosin heavy chain promoter (a -MHC) (see, e.g., Subramaniam A, et al, JBiol Chem. 268(6):4331-6 (1993)); cardiac akyrin repeat protein promoter (CARP) (see, e.g., Manning BS, et al, Circulation 102(22) :2751-7 (2000)); Nkx2.5 promoter (see e.g., Reecy JM, et al, Development 126(4):839-49 (1999)); atiial natiiuretic factor (ANF) promoter (see, e.g., Ardati A, et al. EMBO J. 12(13):5131-9 (1993)) and sodium calcium exchanger promoter (see, e.g., Gabellini N, et al, Ann N Y Acad Sci. 976:282-4 (2002)). [0080] Advantageously, the tianscription promoting elements of the present invention can be provided as reagent stocks for use in construction of the transcription cassettes of the present invention. By way of example, one may prepare, using standard molecular biology techniques, a multiplicity of stocks of different promoters, wherein each stock comprises the same or different restriction endonuclease sites from one another, thereby have a ready source of different tianscription promoting elements for use in construction of transcription cassettes and expression libraries in accordance herewith. [0081] As discussed further below, in another aspect of the present invention, the tianscription cassettes can be comprised within vectors for delivery of the cassette to a host cell. In such embodiments, the transcription promoting element will generally be linked via its 5' end to such delivery vector. In particularly preferred embodiments described herein, the tianscription promoting element (TPE) and tianscription termination mediating element (TTM) are both provided within a delivery vector into which the transcriptional polynucleotide is inserted (between the TPE and TTM) using the first and second restriction endonuclease sites.

Transcription termination mediating elements [0082] The transcription termination mediating elements used to construct the tianscription cassettes and expression libraries of the present invention comprise at least one polynucleotide sequence, such as a polyadenylation sequence, that, when operably linked to a transcriptional polynucleotide, is capable of signaling the end of the transcription product thereof. Generally, a tianscription termination mediating element comprises at least one polyadenylation signal sequence, but may further comprise other signal sequences, such as splicing sequences, or the like. As with the tianscription promoting elements described herein, the transcription termination mediating elements further comprise a restriction endonuclease site, though at their 5' end. Additionally, as described above relative to tianscription promoting elements, stocks of transcription termination mediating elements may be provided, thereby further facilitating the rapid, efficient construction of the tianscription cassettes and expression libraries of the present invention. Illustrative tianscription termination mediating elements include the S V40-derived polyadenylation signal sequence, bovine growth hormone polyadenylation signal sequence and the like. [0083] As mentioned above discussed further below, the transcription cassettes of the present invention can be comprised within vectors for delivery of the cassette to a host cell. In such embodiments, the tianscription termination mediating element will generally be linked via its 3' end to such delivery vector, with both a transcription promoting element (TPE) and a transcription termination mediating element (TTM) are provided within a delivery vector, in particularly preferred embodiments. The tianscriptional polynucleotide can then be inserted between the TPE and TTM using the first and second restriction endonuclease sites. Restriction Endonuclease Sites [0084] The present invention employs restriction endonuclease sites of at least eight residues in length, for construction of the transcription cassettes and expression libraries. Restriction endonuclease recognition sites of this length occur with less frequency in nature than shorter sequences and as such are less likely to occur in the tianscriptional polynucleotides or other elements of the tianscription cassettes, thereby reducing the likelihood of unwanted or unintended cleavage/ligation reaction products. Use of two different restriction endonuclease sites of this length further reduces that likelihood. In preferred embodiments, at least one restriction endonuclease site comprises 10, 20, 40 or more specific nucleotides. [0085] In preferred embodiments, the first and second restriction endonuclease sites are selected such that the cleavage products thereof are non-overlapping, non-complementary overhanging ends. By way of example, use of a PI-Psp I recognition site as the first restriction endonuclease site results in a 3' overhanging end having the sequence TTAT and use of a Not I recognition site as the second restriction endonuclease site results in a 5' overhanging end having the sequence GGCC. Thus, use of these two sites will result in overhanging (or sticky) ends which are non-overlapping and non-complementary relative to each other. This is particularly advantageous, for example, to avoid ligation of a transcription promotmg element to a transcription termination mediating element during construction of a tianscription cassette in accordance herewith. Additionally, selection of first and second restriction endonuclease sites that, upon cleavage, result in one adenine (A) and thymine (T) residue-rich end and one guanine (G) and cytosine (C) residue-rich end, further reduces the possibility of unwanted or unintended re-annealing or ligation.

Construction of Transcription Cassettes [0086] Transcription cassettes in accordance with the present invention can be produced readily using standard molecular biology techniques, particularly cloning, restriction enzyme digestion and ligation techniques. In general, transcriptional polynucleotides, transcription promoting elements and transcription termination mediating elements can be constructed as described above. All three components of the transcription cassette can then be mixed with the first and second restriction endonucleases in a standard restriction (cleavage) reaction. The three components can then be ligated to one another, preferably in a single reaction vessel, to form the transcription cassette. [0087] In a preferred embodiment, a library of transcription cassettes is constructed in a rapid, high throughput manner. By way of example, aliquots of a mammalian, preferably human, cDNA library can be provided in an array of sample sites, such as wells of a multi-well plate. PCR primer pairs can then be designed, based upon the sequences of the cDNA molecules comprising the library, to amplify individual sequences out of each aliquot. Thus, a specific primer pair (preferably also coding for first and second restriction endonuclease sites) is added to each sample site and an individual cDNA sequence amplified therein. Once the PCR reaction is conducted, the individual amplified cDNA sequences can be separated from the non-amplified sequences using, for example, high throughput column chromatography apparatus (for example, QIAquick 96 PCR Purification Kit, Qiagen, Valencia, CA), thereby providing a library of transcriptional polynucleotides in an array of sample sites, wherein a single predominant polynucleotide sequence is present at any given sample site. Following construction of the tianscriptional polynucleotides, the transcription promotmg elements and terminal processing elements may be added to each sample site and restriction/ligation reactions carried out therein. Advantageously, this method of construction relies on chemical reactions to generate the transcription cassettes, rather than biological reactions.

Transfection Vectors Comprising Transcription Cassettes [0088] In another aspect of the present invention, the transcription cassettes provided herein may be contained within a vector for delivery of the tianscription cassette to a host cell, such as, for example cells of a biological assay. Advantageously, expression libraries comprising the transcription cassettes of the present invention contained within delivery vectors can be produced rapidly and in a high throughput manner permitting direct transfer to high throughput functional analysis assays as described herein. [0089] Numerous vectors are known in the art that are capable of mediating transfer of polynucleotides,' such as comprise the transcription cassettes of the present invention, into various cells, including mammalian cells. Illustrative vectors include plasmids, viral vectors, such as retiovirus, adenovirus (Ad) or adeno-associated virus (AAV), protein-based vectors and lipid-based vectors, such as liposomes, micelles or lipid-containing emulsions. As those of skill in the art are aware, different vectors may be preferred for different delivery situations. By way of example, a delivery vector maybe selected for its transient maintenance or stable maintenance within the host cell; for its efficient in vivo transfection or efficient cell type transfection; for its tropism (i.e., ability to transfect a broad range of host cells or only selected cell types; or for its in vitro stability, cell selectivity or the like. For instance, where it is contemplated that the transcriptional polynucleotides will be tested in both in vitro and in vivo mammalian fimctional analysis assays, the delivery vector will preferably be selected to be safe for in vivo use as well as efficient for both in vitro and in vivo use. Similarly, vectors may be modified to facilitate their use with particular cell types, for example to enable discrimination between cell types, even within a single well or sample site, or to enhance or inhibit transfection of one or more cell types. Methods for such are known to those of skill in the art.

Viral Vectors [0090] Use of viral vectors, including recombinant virus, to deliver exogenous polynucleotides to cells, both in vitro and in vivo, is well known in the art. In a preferred embodiment, the tianscription cassettes of the present invention are provided in replication- defective viral vectors, such as replication-defective adenoviral vectors or adeno-associated vectors, and used to generate recombinant virus for example, for delivery of the transcriptional polynucleotide into cells of cell-based functional assays. Advantageously, viral vectors comprising the tianscription cassettes provided herein can be constructed in a rapid, high throughput manner. Thus, in one aspect, provided herein are methods for the rapid construction of viral (in particular, adenoviral) expression libraries comprising transcription cassettes in accordance herewith. [0091] Construction of a recombinant viral vector comprising a heterologous polynucleotide involves the consideration of a number of factors. For example, since many viral vectors exhibit size-constraints associated with packaging, and since replication-defective viral vectors are generally preferred for in vivo as well as many in vitro delivery protocols, the heterologous polynucleotides are typically introduced by replacing one or more portions of the viral genome. When such deletions render the viruses replication-defective, the deleted function(s) are generally provided in trans during viral replication and encapsidation (by using, e.g., a helper virus or a packaging cell line carrying genes necessary for replication and/or encapsidation) (see, e.g., the references and illustrations herein). Illustrative vectors include modified adenoviral vectors in which the heterologous polynucleotides are inserted in place of one or more replication necessary genes of the El region; and modified AAV vectors in which the heterologous polynucleotides are inserted in place of viral rep and/or cap genes, both of which are well known in the art. Similarly, modified viral vectors in which a polynucleotide to be delivered is carried on the outside of the viral particle have also been described (see, e.g., Curiel, DT, et al. PNAS 88:8850-8854, 1991). References describing these and other delivery vectors are known in the art, a number of which are cited herein. [0092] As is known to those of skill in the art and described in various cited references, viral vectors can also comprise other components or functionalities that further modulate delivery or even expression of a heterologous polynucleotide, or that otherwise provide beneficial properties to the targeted host cells. Such other components include, for example, components that influence binding or targeting to cells (including components that mediate cell-type or tissue-specific binding); components that influence uptake of the vector by the cell; components that influence processing and/or localization of the vector and its nucleic acid within the cell after uptake (such as agents mediating intiacellular processing and/or nuclear localization); and components that influence transcription and/or expression of the polynucleotide. Such components also might include markers, such as detectable and/or selectable markers that can be used to detect or select for cells that have taken up and are expressing the polynucleotide delivered by the vector. Such components can be provided as a natural feature of the vector (such as the use of certain viral vectors which have components or functionalities mediating binding and uptake), or vectors can be modified to provide such functionalities. A detectable marker gene or the presence of antibiotic resistance allows cells carrying the polynucleotide of interest to be specifically detected (e.g., distinguished from cells which do not carry the marker gene). One example of such a detectable marker gene is the lacZ gene, encoding beta-galactosidase, which allows cells transduced with a vector carrying the lacZ gene to be detected by staining. Selectable markers can be positive, negative or bifunctional. Positive selectable markers allow selection for cells carrying the marker, whereas negative selectable markers allow cells carrying the marker to be selectively eliminated. A variety of such marker genes have been described, including bifunctional (i.e. positive/negative) markers (see, e.g., Lupton, S., WO 92/08796, published 29 May 1992; and Lupton, S., WO 94/28143, published 8 December 1994). Such marker genes can provide an added measure of control that can be advantageous in the context of in vivo and in vitro functional analysis assays. A large variety of such vectors are known in the art and are generally available (see, e.g., the various references cited herein). [0093] References describing adenovirus vectors and other viral vectors, which could be used in accordance with the present invention include the following: Horwitz, M.S., Adenoviridae and Tlieir Replication, in Fields, B., et al.. (eds.) Virology, Vol. 2, Raven Press New York, pp. 1679-1721, 1990); Graham, F., et al, pp. 109128 mMethods in Molecular Biology, Vol. 7: Gene Transfer and Expression Protocols, Murray, E. (ed.), Humana Press, Clifton, N.J. (1991); Miller, N., et al, FASEB Journal 9: 190-199, 1995; Schreier, H, Pharmaceutica Acta Helvetiae 68: 145-159, 1994; Schneider and French, Circulation 88:1937- 1942, 1993; Curiel D.T., et al, Human Gene Therapy 3: 147-154, 1992; Graham, F.L., et al, WO 95/00655 (5 January 1995); Falck-Pedersen, E.S., WO 95/16772 (22 June 1995); Denefle, P. et al, WO 95/23867 (8 September 1995); Haddada, H. et al, WO 94/26914 (24 November 1994); Perricaudet, M. et al, WO 95/02697 (26 January 1995); Zhang, W., et al, WO 95/25071 (12 October 1995). A variety of adenovirus plasmids are also available from commercial sources, including, e.g., Microbix Biosystems of Toronto, Ontario (see, e.g., Microbix Product Information Sheet: Plasmids for Adenovirus Vector Construction, 1996). Various additional adenoviral vectors and methods for their production and purification are regularly identified. [0094] Additional references describing AAV vectors which could be used in accordance with the present invention include the following: Carter, B., Handbook of Parvoviruses, vol. 1, pp. 169-228, 1990; Berns, Virology, pp. 1743-1764 (Raven Press 1990); Carter, B., Curr. Opin. Biotechnol, 3: 533-539, 1992; Muzyczka, N., Current Topics in Microbiology and Immunology, 158: 92-129, 1992; Flotte, T.R., et al, Am. J. Respir. Cell Mol. Biol 7:349-356, 1992; Chatterjee et al, Ann. NY Acad. Sci., 770: 79-90, 1995; Flotte, T.R., et al, WO 95/13365 (18 May 1995); Trempe, J.P., et al, WO 95/13392 (18 May 1995); Kotin, R., Human Gene Therapy, 5: 793-801, 1994; Kotin et al, WO 98/11244 (19 March 1998); Kotin et al, WO 99/61601 (2 December 1999); Flotte, T.R., et al, Gene Tlierapy 2:357-362, 1995; Allen, J.M., WO 96/17947 (13 June 1996); and Du et al, Gene Tlierapy 3: 254261, 1996. Various additional AAV vectors and methods for their production and purification are regularly identified. [0095] As described above and in the scientific literature, a number of retrovirus- derived systems have also been developed to be used in in vivo as well as in vitro polynucleotide delivery. By way of illustration, the lentivirus genus of retro viruses (for example, human immunodeficiency virus, feline immunodeficiency virus and the like) can be modified so that they are able to transduce cells that are typically non-dividing (see, e.g., Poeschla t α/., PNAS 96:11395-11399, 1996; Naldini et α/., PNAS 96:11382-11388, 1996; Naldini et al, Science 272:263-267, 1996; Srinivasakumar et al, J. Virol. 71: 5841-5848, 1997; Zufferey et al, Nat. Biotechnol. 15: 871-875, 1997; Kim et al, J. Virol. 72: 811-816, 1998; Miyoshi et al, J. Virol. 72:8150-8157, 1998; see also Buchschacher et al, Blood 15:2499-2504, 2000; see also The Salk Institute, WO97/12622 (10 April 1997)). While HIV- based lentiviral vector systems have received some degree of focus in this regard, other lentiviral systems have recently been developed, such as feline immunodeficiency virus-based lentivirus vector systems, that offer potential advantages over the HIV-based systems (see e.g. Poeschla et α/., Nat. Med. 4:354-357, 1998; Johnston et al, J. Virol. 73: 2491-2498, 1999; and Johnston et al, J. Virol. 73: 4991-5000, 1999; see also the review by Romano et al, Stem Cells 18:19-39, 2000 and references reviewed therein). [0096] Recombinant adenovirus have become increasingly widely used for both in vitro and in vivo delivery of exogenous' olynucleotides to host cells. Adenovirus efficiently infects both dividing and non-dividing cells and therefore is useful for expressing recombinant polynucleotides in non-replicative cells such as cardiac myocytes. Thus, in particularly preferred embodiments, described herein, provided are recombinant adenovirus expression libraries comprising the tianscription cassettes of the present invention.

Non- Viral Vectors [0097] In addition to viral vectors, non-viral vectors that maybe employed as a delivery means for exogenous polynucleotides are likewise known and continue to be developed. For example, non^Jviral protein-based delivery platforms, such as macromolecular complexes comprising a DNA binding protein and a carrier or moiety capable of mediating polynucleotide delivery, as well as lipid-based vectors (such as liposomes, micelles, lipid- containing emulsions and others) have been described in the art. References describing non- viral vectors which could be used according to the present invention include the following: Oudrhiri, et al, Proc. Natl. Acad. Sci. USA 94(5):1651-1656, 1997; Murphy, et al, Nuc. Acids Res., 29(17):3694-3704, 2001; Ledley, ΕO, Human Gene Therapy 6: 11 29-1144, 1995; Miller, N., et al, FASEB Journal 9: 190-199, 1995; Chonn, A., et al, Curr. Opin. in Biotech. 6: 698-708, 1995; Schofield, JP, et al, British Med. Bull. 51: 56-71, 1995; Brigham, K. L., et al, J. Liposome Res. 3: 31 49, 1993; Brigham, K.L., WO 91/06309 (16 May 1991); Feigner, P.L., et al, WO 91/17424 (14 November 1991); Solodin et al, Biochemistry 34: 13537-13544, 1995; WO 93/19768 (14 October 1993); Debs et al, WO 93/125673; Feigner, P.L., et al, U.S. Patent 5,264,618 (November 23, 1993); Epand, R.M., et al, U.S. Patent 5,283,185 (February 1, 1994); Gao et al, WO 96/22765 (1 August 1996); Gebeyehu et al, U.S. Patent 5,334,761 (August 2, 1994); Feigner, P.L., et al, U.S. Patent 5,459,127 (October 17, 1995); Overell, R.W., et al, WO 95/28494 (26 October 1995); Jessee, WO 95/02698 (26 January 1995); Haces and Ciccarone, WO 95/17373 (29 June 1995); Lin et al, WO 96/01840 (25 January 1996); Patrick, et al, U.S. Patent No: 6,086,913 (11 July 2000); Maclachlan, Ian, WO 02/087541, 7 Nov. 2002; Maclachlan, et al. US Patent No: 6,410,328, 25 June 2002 and Maclachlan, Ian US Application No: 2003/0077829 24 April 2003. Numerous additional lipid-mediated in vivo delivery vectors and vector delivery co-factors have likewise been identified (see e.g. Kollen et al, Hum. Gene Ther. 10:615-22, 1999; Roy et al, Nat. Med. 5:387-391; Fajac et al, Hum. Gene Ther. 10:395-406, 1999; Ochiya et al, Nat. Med. 5:707-710, 1999). Additionally, the development of systems which combine components of viral and non- viral mediated polynucleotide delivery systems have been described and may be employed herein (see e.g. Philip et al, Mol Cell Biol, 14:2411-2418, 1994; see also Di Nicola et al, Hum Gene Ther 10:1875-1884, 1999; Cooper, Mark, U.S. Patent No: 6,339,065 (15 January 2002)). Various additional non- viral delivery vectors and methods for their preparation and purification are known and likewise contemplated for use herein.

Expression Libraries Comprising Transcription Cassettes [0098] A significant advantage to the transcription cassettes of the present invention is the flexibility they provide in the construction of expression libraries: permitting high throughput creation of such libraries, which can then be analyzed in a rapid, high throughput manner to elucidate functional activities of the transcriptional polynucleotides comprised therein. In one aspect, this advantage is realized by incorporating a precursor transcription cassette into a vector, for example a viral vector, viral/plasmid vector, or plasmid vector, then employing restriction endonuclease cleavage and standard ligation reactions to incorporate tianscriptional polynucleotides into the vector. The precursor tianscription cassettes comprise a transcription promoting element and transcription termination mediating element with first and second linking elements there between. The first and second linking elements preferably comprise, together, ^'more than two, more preferably at least four and most preferably at least six different restriction endonuclease sites, each comprising at least eight nucleotide residues. The linking elements thus form a multiple cloning site (MCS) available for insertion of tianscriptional polynucleotides into the transcription cassettes. One advantage to such an MCS is the flexibility realized from having a number of different restriction endonuclease sites from which to choose when inserting a transcriptional polynucleotide into the precursor transcription cassettes. Another aspect of the present invention then, is the provision of stocks of vectors comprising precursor transcription cassettes, wherein the multi-cloning site, juxtaposed between the transcription promoting element and the transcription termination mediating element, comprises at least six (6) different restriction endonuclease recognition sites, each comprising at least eight nucleotide residues. Such stocks can be particularly useful for the high throughput construction of vector-based expression libraries, as described further herein.

Amplification of Transcriptional Polynucleotides for Use in Expression Libraries [0099] The transcriptional polynucleotides to be used in construction of the expression libraries herein may be any polynucleotides of interest, for example, cDNA, genomic DNA, synthetic oligonucleotides and the like. However, preferably, the transcriptional polynucleotides will be derived from one or more cDNA libraries of interest. Numerous cDNA libraries are commercially available. In preferred embodiments, the cDNA library employed to construct the transcriptional polynucleotides of the present invention is selected based upon its relevance to a particular organ or tissue or disease or disorder of interest. By way of example, organs of interest may include heart, liver, lung, brain/central nervous system, peripheral nervous system, vascular system, skin, uterus, etc. Illustrative tissues of interest may include epithelial tissue, connective tissue, muscle tissue, nerve tissue, etc. With respect to diseases or disorders of interest, illustrative are heart disease, neurodegenerative diseases, cancers, diabetes, muscular dystrophy, vascular disease, lung diseases and the like. Such organ, tissue and/or disease-relevant cDNA libraries may be purchased from commercial vendors or may be constructed, using standard molecular biology techniques to reverse transcribe mRNA isolated from disease-relevant tissue, such as myocardium tissue from a heart disease patient, followed by PCR and subcloning into appropriate cloning vectors. [0100] Once the desired cDNA library is acquired or prepared, individual cDNAs can then be amplified from the library, preferably by designing amplification primers (such as PCR primers) to target specific cDNA sequences within the library. Numerous databases are publicly available which include complete cDNA (as well as genomic DNA) sequence information of various species, including humans. Such sequence information may be used to design specific amplification primers for the amplification of individual cDNAs out of the library pool. Preferably, the amplification primers are designed with the help of commercially available computer software, such as for example, DNAsis Max, (Molecular Biololy Insights, Inc., Cascade, CO), DNA Engine (MJ Research, Waltham, MA) or DNA Star (DNAStar, Inc. Medison, WI), by inputting the sequence data relevant to the cDNA library being amplified. In order to use the amplified cDNAs as tianscriptional polynucleotides in accordance herewith, at least the first and second restriction endonuclease sites of the first and second linking regions are added to the 5' and 3' ends of the individual sequences. This may be accomplished using standard molecular biology techniques. For example, in preferred embodiments, the amplification primers can be designed to include the desired restriction endonuclease sites to be incorporated into the cDNA amplification product. In further preferred embodiment the amplification primers can be designed to also include an epitope tag sequence for incorporation into the cDNA amplification product, preferably at the 3' end thereof. [0101] In preferred embodiments, amplification of individual cDNAs from the cDNA library is performed in a high throughput format. By way of example, aliquots of a cDNA library can be placed in an array of sample sites, such as wells of a multi-well plate. Different cDNA specific primer pairs can then be added to each sample site and PCR reactions performed, thereby amplifying an individual cDNA sequence at each sample site. Preferably the PCR reactions conducted at each sample site are performed contemporaneously with one another, for example simultaneously. Preferably, the first and second restriction endonuclease sites to be used in construction of the transcription cassettes are incorporated into the individual cDNAs during amplification. While less preferred, the restriction endonuclease sites may alternatively be added to the individual cDNAs after amplification using standard molecular biology techniques. Amplified cDNAs can then be separated from their reaction mixtures, for example using standard high throughput column chromatography techniques and apparatus. Prior to separation, single-strand specific DNA nucleases can be used to digest non- amplified DNA, thereby facilitating the separation of amplified from non-amplified molecules. Alternatively to column chromatography, high throughput gel electrophoresis apparatus may be employed to separate amplified from non-amplified cDNA in accordance herewith. Such apparatus are available for example from Invitrogen of Carlsbad, California and Promega of Madison, Wisconsin. Advantageously, this high throughput method of cDNA amplification results in a library of transcriptional polynucleotides in an array of sample sites wherein each sample site comprises a single predominant transcriptional polynucleotide (for example, a single cDNA species per well of a multi-well plate), ready for further use, modification or amplification or for storage as a library stock. High Throughput Construction of Vector-Based Expression Libraries [0102] In preferred embodiments of the present invention, the expression libraries comprising tianscription cassettes in accordance herewith are vector-based expression libraries. The vectors may be viral vectors, such as adenoviral, retroviral, adeno-associated viral or the like, or may be non-viral vectors, such as plasmid, lipid-based, protein associated or the like. For the purposes of high throughput construction of the vector-based expression libraries, the vector may be provided as a stock comprising a precursor tianscription cassette as described above or, as described further herein, may be provided as a collection of stocks of different components to be assembled into vectors comprising the transcription cassettes. Various techniques are known for inserting a precursor transcription cassette into a vector. By way of example, where the precursor tianscription cassette is to be inserted into a vector's polynucleotide sequence, for example, a plasmid, viral genome or the like, standard cloning and/or cleavage/ligation reactions can be used. Thus, in one aspect, the vector polynucleotide can be digested with one or more restriction endonucleases, the transcription cassette similarly cleaved and the two mixed in a ligation reaction. Restriction endonucleases used to insert a precursor transcription cassette into a vector polynucleotide will preferably selected to be different from the restriction endonucleases to be used to insert the transcriptional polynucleotide into the transcription. [0103] In an alternative embodiment, the components for construction of the vector may be provided as stocks of reagents which can then be used to construct vectors comprising complete transcription cassettes, i.e., including the tianscriptional polynucleotides of interest.

By way of example, a first reagent stock can be provided comprising the left arm (LA) of an adenoviral vector linked at its 3' end to a tianscription promoting element (TPE) which comprises a first linking region (LRl) at its 3' end. A second reagent stock is also provided comprising the right arm (RA) of an adenoviral vector linked via its 5' end to a transcription termination mediating element (TTM) which further comprises a second linking region (LR2) at its 5' end. These components can then be ligated (in a single or multiple reactions, following digestion with appropriate restriction endonuclease enzymes) to transcriptional polynucleotides (TP) comprising corresponding first and second linking regions at their 5' and

3 ' ends, respectively. The completed adenoviral vector, which may be represented as: LA-

TPE-LR1-TP-LR2-TTM-RA, is preferably replication-defective, for example as a result of deletion of genes from the El region thereof. The resulting linear, replication-defective adenoviral vector is then preferably used to transfect a complementing cell line, for example A549 (see, e.g., WO 98/39411), HEK293 or PERC6 cells and recombinant replication- defective adenovirus thereby generated. [0104] If desired, insertion of transcriptional polynucleotides into the transcription cassettes can be confirmed by any of several standard methods, prior to delivery to a host cell. By way of example, the transcription cassette can be amplified by PCR using primers derived from the tianscription promoting element and transcription termination mediating element. The size of the PCR amplification products may then be measured, for example by gel electrophoresis, to confirm successful insertion of the transcriptional polynucleotide. Additionally or alternatively, an aliquot of the transcription cassette may be subjected to DNA sequencing for example, using the same primers as those used for the PCR amplification reaction or using a primer corresponding to a region of vector (where a polynucleotide vector, such as a viral vector, is used) in conjunction with a primer corresponding to a region of the transcription cassette sequence. Additionally, standard restriction digestion techniques can be used to confirm the orientation of the transcriptional polynucleotide in the cassette, where desired. [0105] As an illustration, an expression library in accordance herewith can be constructed in a high throughput manner as follows. Aliquots of vector comprising precursor tianscription cassettes can be placed in an array of sample sites, for example into the wells of a multi-well plate. Preferably the array comprises at least 36 sample sites, more preferably 48 sites and most preferably 96 or more sample sites. A library of tianscriptional polynucleotides comprising first and second restriction endonuclease sites can then be digested with the corresponding restriction endonuclease enzymes and the same first and second restriction endonucleases added to each vector sample, also in a digestion reaction. The transcriptional polynucleotides can then be ligated into the vectors at each sample site, using standard ligation reactions. [0106] Exemplified herein is the high throughput construction of an adenoviral expression library comprising the transcription cassettes of the present invention. Advantageously, the adenoviral expression library can be constructed in a single plasmid to vector method that does not require homologous recombination between two plasmids to generate the recombinant adenoviral genome. In a preferred embodiment, a stock of vectors comprising precursor transcription cassettes as described above can be constructed. Those of skill in the art will recognize that a number of standard methods may be employed to construct such a vector stock. By way of example, plasmids comprising the precursor transcription cassette can be amplified by first transforming an appropriate E. coli strain with the plasmid. The transformed cells can then be propagated in an appropriate medium thereby permitting amplification of the plasmid. The amplified plasmid can then be isolated from the cells and purified, for example, using an EndoFree Maxi-Plasmid kit (Qiagen, Valencia, CA) or similar commercial kit available for such purpose.

High Throughput. Functional analysis of Expression Libraries [0107] In part because the transcription cassettes of the present invention can be constructed in a high throughput manner, the entire process, starting from a collection of polynucleotides encoding unknown products to identification of certain of those polynucleotides as having potentially useful expression products to validation of such usefulness can be performed in a largely automated, flexible and high throughput manner. Further, as described in more detail below, by focusing this process on identification of tianscriptional polynucleotides relevant to a specific disease or disorder, the time required to identify and validate potential drug targets and/or therapeutic polynucleotides or expression products can be greatly reduced. [0108] The invention provides methods for determining a biological activity associated with expression of a transcription cassette described herein. In general, the methods of the invention can be used in high throughput functional analysis of a large number of functional analysis assays. In some embodiments, methods of the invention can be used for determining the level of a particular activity associated with the expression of a transcriptional polynucleotide. In some cases, the level of activity determined can be no activity, for example, when the expression product of the tianscriptional polynucleotide does not have the particular activity analyzed by the assay. [0109] In one embodiment, transcription cassettes described herein can be expressed in cells and the cells then subjected to functional analysis assays to determine whether or not the expressed product of the transcriptional polynucleotide can be associated with a biological activity in the cell. [0110] The particular functional assays to be used in analyzing an expression library can be selected, for example, based upon the particular activity or function desired to be assessed, the particular disease or disorder of interest and the like. Functional assays in accordance herewith may employ synthetic systems of biomolecules for transcribing and/or expressing the transcriptional polynucleotides of interest, but typically employ cells for such purpose, whether in a cell-based in vitro assay setting, tissue-based assay setting (for example, in vitro or in situ) or whole animal assay (for example, ex vivo or in vivo or tiansgenic). Numerous and varied cell-based assays are known that have been adapted to or are readily adaptable to use in an array format, such as a multi-well plate format. Further, those of skill in the art will understand that a number of different tools are available for ascertaining biological readouts from such assays. By way of example, with respect to many assay types, particularly in vitro and in situ assays, the biological readouts may be based upon microscopic analysis, biochemical analysis, subcellular analysis, visual analysis, analysis/detection of light, radiation or other emissions or the like. With respect to whole animal assays, biological readouts generally may additionally or alternatively include ascertainment of physiological, physical or other phenotypic changes to the animal. In preferred embodiments, high throughput cell-based in vitro assays can be used for initial analysis of the expression products of transcriptional polynucleotides. Those transcriptional polynucleotides testing positive in such in vitro assays, i.e., providing an indication of possible interest, can then be subjected to further in vitro, tissue- based and/or whole animal assays. [0111] A wide variety of functional assays suitable for use in the present invention are known and others are routinely developed. Generally, any assay that can provide information concerning the biological function or role of a tianscriptional polynucleotide when employed in the assay comprised within a transcription cassette of the present invention, is contemplated hereby. Illustrative of the wide variety of available assays includes, without limitation, biochemical assays, viability assays, apoptosis assays, toxicity assays, immunocytochemistry assays, endogenous gene expression assays, reporter gene expression assays, cell morphology assays, cell motility assays, proliferation assays, intiacellular activity assays, subcellular localization assays, cell activation assays and the like as have been reported in the art and are regularly developed. In some instances, functional analysis assays and the biological readouts generated therefrom can be designed to identify transcriptional polynucleotides that may be involved in diseases as well as transcriptional polynucleotides that may modulate various cellular physiological functions. [0112] High throughput cell-based assays may be based on assessment of a population of cells or on assessment of individual cells within a population. High throughput microscopy and image analysis technologies are known in the art and provide a means for detecting biological readouts of individual cells in a population. Such technologies provide a high level of automation, speed and accuracy, particularly for image based assays and analysis. A number individual technologies are known and several "bundled" systems are available; for example, the high throughput screening systems including analysis instrumentation and informatics systems of Cellomics, Inc., Pittsburgh, Pennsylvania and Q3DM, San Diego, California. In some instances, individual cells in a population can be assessed both for a biological readout of interest and for the presence of the transcription cassette and/or of the expression product from the transcription cassette thus facilitating correlation between expression of the transcription cassette and a detected biological activity, if any. By way of example, in a particularly preferred embodiment, an epitope tag can be employed within the transcription cassette, as described herein, to permit assessment for the presence of the expression product from the cassette. [0113] In some cases, functional analysis assays described herein may involve immunostaining to detect the biological readout of the assay. Immunostaining techniques, immunostaining reagents and methods for detecting immunostaining are well known in the art. Immunostaining techniques can be used to assess, for example, an increase or decrease in a target gene expression (for example, reporter gene or endogenous gene), changes in cellular localization of an antigen, changes in cell factor production and/or secretion, changes in cell morphology, cell viability, cell motility, cell to cell associations and the like. [0114] For high throughput functional analysis, transcription cassettes and/or cells to be assayed can be provided in an, array of sample sites, such as wells of a multi-well plate. Sample arrays for use in the invention include, but are not limited to, those with 36, 48, 96, 384, and 1536 sample site formats. In addition, miniaturization technologies are now being used to provide even higher density sample arrays, for example, "nanoarrays" which can incorporate orders of magnitude greater numbers of samples in a single array. (See, e.g., systems available from Genomatica, Inc., San Diego, CA.) In some embodiments, cells can be placed in an array of sample sites and a different transcription cassette added to each cell sample site in a manner and/or under conditions to support cellular uptake of the transcription cassette. After the cells are allowed or induced to express the tianscriptional polynucleotide, cells in the array of sample sites can be subjected to the functional analysis assay. Timing of the assay is generally dependent on, for example, the cell type employed in the assay and the nature of the biological readout being generated. By way of example, enzymatic or biochemical readouts typically are realized in shorter time periods whereas, physiological readouts, such as for example cell division, changes in morphology and the like, typically take a longer time to be realized. As is routinely done, it is generally desirable to conduct assays with controls, preferably both positive and negative. Likewise, it is generally desirable to identify those assay conditions (e.g., timing, temperature, etc.) that maximize signal-to-noise ratios (i.e., the signal detected with a positive control versus background noise associated with a negative control). Positive and negative controls used in the assay can be and often will be used to establish the signal-to-noise ratio for that particular run of the assay. [0115] Expression libraries comprising transcription cassettes of the invention may be delivered to cells for the functional analysis through means appropriate to the library as described herein. Following the delivery procedure, the recipient cells generally can be cultured for a period of time to allow for expression of the transcriptional polynucleotide and for the biological readout to be detectable. The period of time will vary with, among other things, the type library vector used, if any; the type of cell; assay conditions; and the like. The period of time to allow for expression may be from about 6 hours to about 30 days, from about 12 hours to about 20 days, from about 1 day to about 14 days, from about 2 days to about 10 days, or from about 3 days to about 7 days. [0116] In one embodiment, the functional analysis assay readout is based on biochemical analysis. Examples of biochemical readout assays include, but are not limited to changes in ligand binding, receptor binding, growth factor activity, and enzymatic activity. In some instances, biochemical readout assays are performed after expression of the transcriptional polynucleotide in a cell or cell population. In other instances, such assays are performed after the transcription cassette has been subjected to in vitro tianscription and/or translation. [0117] As described herein, the expression product of transcription cassettes analyzed in the assays may be a sense or an anti-sense expression product. In many cases, activity of a sense expression product will generally reflect activity of the translated expression product. When the activity of an anti-sense expression product is being assessed, the biological readout may involve a decrease in the expression of a target gene or a decrease in the concentration of a polypeptide, and/or the biological readout may involve a physical or biological effect or result due to a decrease in the expression of the target gene or a decrease in the polypeptide concentration. [0118] As described herein, methods of the invention can be of use in identifying and/or characterizing an activity of a particular tianscriptional polynucleotide in conjunction with a particular role in a particular disease. Specific diseases of interest include, but are not limited to, cardiovascular diseases, metabolic diseases, diabetes, neurodegenerative diseases, cancer, autoimmune diseases, infection and inflammation. [0119] As described herein, expression libraries based on genes known to be expressed in particular disease states and/or known to be expressed in cell types associated with particular disease states can be generated comprising transcription cassettes of the invention. Accordingly, activity of such possible disease-related genes can be rapidly identified and characterized using functional analysis assays and biological readouts appropriate for the particular disease. [0120] For example, to identify and characterize genes involved in cardiovascular disease, the tianscriptional polynucleotides of the expression libraries can be assessed, for example, in cardiomyocyte apoptosis assays, cardiomyocyte hypertrophy assays, cardiomyocyte differentiation assays, endothelial cell proliferation assays and the like. Apoptosis in cardiomyocytes contributes to loss of cardiac muscle mass in both acute myocardial infarction and chronic heart failure. With regard to cardiovascular disease, apoptosis assays may be conducted on a variety of cells including, but not limited to, neonatal rat cardiomyocytes, murine fibroblasts, murine cardiomyocytes, human umbilical vein endothelial cells, human coronary artery endothelial cells and human coronary artery smooth muscle cells. By way of example, components of the expression library can be delivered to and expressed in the test cells and a biological readout, generated in response to an apoptotic stimulator or inducer (eg. H₂O₂, UV, serum deprivation), can be determined for individual cells or for a population of cells receiving the tianscription cassette of the expression library. [0121] Apoptosis assays are generally conducted to study those factors (in this case, transcriptional polynucleotide expression products) that contribute to or inhibit apoptosis or programmed cell death. These assays can assess a variety of biological readouts associated with apoptosis including, but not limited to, nuclear condensation, DNA fragmentation, cytoskeletal disruption, mitochondrial disruption, increased caspase activity and annexin V binding. In some analyses, one or more of these biological readouts can be assessed on the same cell or cell population. [0122] Nuclear fragmentation, mitochondrial membrane potential disruption and caspase-3 activation are considered to be indicators of early stages of apoptosis. Translocation of phosphatidylserine (PS), located on the cytoplasmic surface of the cell membrane in normal cells, to the outer leaflet of the plasma membrane is an indicator of intermediate stages of apoptosis. This PS translocation is detectable with annexin V staining. Finally, permeability to propidium iodide and cytoskeletal collapse generally occur later in apoptosis. [0123] Nuclear condensation can be assessed using techniques known in the art including, for example, nucleic acid stains such as Hoechst 33342 or 33528 dyes, green- fluorescent YO-PRO-1 stain (Molecular Probes), green-fluorescent SYTO dyes, including the SYTO 13 and SYTO 16 nucleic acid stains (Molecular Probes). In some apoptosis assays, nucleic acid stains can be used in combination with other dyes such as propidium iodide and calcein AM (Molecular Probes) which labels all cells that have intact membranes with green fluorescence. [0124] Mitochondrial disruption, such as disruption of mitochondrial membrane potential and alterations in oxidation-reduction potential of the mitochondria, can be assessed using techniques known in the art including, for example, uptake of fluorescent dyes by the mitochondria. Examples of such mitochondrial dyes include, without limitation, JC-9 dye (Molecular Probes) and any of the MitoTracker dyes from Molecular Probes, Inc. of Eugene, Oregon, such as derivatives of the red fluorescent X-rosamine (MitoTracker Red) which produce a longer- wavelength fluorescence that can be well resolved from fluorescein's fluorescence in double-labeling experiments. Mitochondrial disruption can also be detected using free radical probes and ion indicators as known in the art. [0125] Caspase activity can be assessed using techniques known in the art including, for example, using a fluorescently labeled caspase substrate which changes fluorescent properties upon cleavage with an activated caspase, a cysteine aspartic acid-specific protease. Caspase substrates are known in the art and include, for example, a caspase-3/7 substrate of rhodamine 110 labeled CBZ-Asp-Glu-Val-Asp (DEVD) peptide and a caspase 8 substrate of fluorescently labeled peptide containing the caspase-8 recognition sequence Ile-Glu-Thr-Asp (IETD). [0126] PS translocation from the inner to the outer leaflet of the plasma membrane can be detected by annexin V binding as described, for example, in EP 0 755 516 Bl and US Pat. No. 5,834,196. The human anticoagulant annexin V is a 35-36 kilodalton, Ca²⁺-dependent phospholipid-binding protein that has a high affinity for PS. Annexin V-fiuorescent dye conjugates are useful, for example, with confocal or epifluorescence microscopy for accurate assessment of mixed populations of apoptotic and nonapoptotic cells. Examples of fluorescent annexin V conjugates include but are not limited to Alexa Fluor 488 annexin V, Fluorescein (FITC) annexin V, Oregon Green 488 annexin V, Alexa Fluor 568 annexin V, and Alexa Fluor 647 annexin V (all available from Molecular Probes). Annexin- V detecting reagents can be used in combination with other apoptosis detection reagents. Cytoskeletal disruption can be assessed using techniques known in the art including, for example, assessing F-actin content with fluorescently labeled phalloidin. [0127] Cell types which can be induced to undergo apoptosis include, for example, endothelial cells, cardiomyocytes, fibroblasts, hepatocytes, smooth muscle cells, lymphocytes, tumor cells derived from lymphocytes, tumors of epithelial cell origin. Cells in culture can be induced to undergo apoptotic death by a variety of stimuli, depending on the particular cells. For example, some cells undergo apoptosis after exposure to conditions of hypoxia and/or serum deprivation, when cultured at low density or in the absence of specific serum factors (Ishizaki et al. (1995) Mol. Endocrinol 7:840-851). Certain cells enter apoptosis after exposure to glucocorticoids, tumor necrosis factors, or other natural agents. In addition, many cell types undergo apoptosis when exposed to radiation or chemotherapeutics. Further, cells may be engineered to contain genes which have been implicated in the control of, protection from or participation in apoptosis under the control of an inducible promoter, including but not limited to, Bcl-2 (Korsymeyer (1992) Immunol. Today 13:285-288), c-myc (Shi et al. (1992) Science 257:212-214; Evan et al. (1992) Cell 69:119-128), ρ53 (Rotter et al. (1993) Trends Cell. Biol. 3:46-49), TRPM-2/SGP (Kryprianou et al. (1991) Cancer Res. 51:162-166), and Fas/APO-1 (Itoh et al. (1991) Cell 66:233-243). Many conditions for inducing apoptosis in a variety of cell types are known in the art. [0128] Apoptosis can be induced in cardiomyocytes, for example, through serum deprivation, exposure to hypoxic conditions, exposure to hypoxic conditions and serum deprivation followed by re-oxygenation, or exposure to hydrogen peroxide. [0129] In one aspect of apoptotic analysis methods of the present invention, the transcription cassette of the expression library can be delivered to the test cell, wherein expression of the transcription cassette occurs (or is induced) followed by introduction of an apoptotic stimuli into the test cells. Using one or more of the various biological readouts of apoptosis, members of the transcription cassette expression library can be analyzed for activity in stimulating, inhibiting or in some way altering apoptosis in the cells. [0130] With regard to cardiovascular disease, hypertrophy assays are generally designed to identify genes (i.e., polynucleotides) that are involved in hypertrophic growth in cardiomyocytes, which hypertrophic growth is associated with congestive heart failure. In hypertrophy assays, cardiomyocytes that contain a transcription cassette of the expression library may be assessed for any one of several markers associated with hypertrophic growth including, but not limited to, morphologic changes, such as changes in sarcomeric density and/or cell size, the secretion of atrial natriuretic factor (ANF) into the culture media, and the expression of a myocardial hypertrophy marker, such as α-cardiac actin and β-myosin heavy chain. [0131] Morphologic changes can be assessed using techniques known in the art including, for example, changes in cytoplasmic area and spread using, for example, fluorescently labeled phalloidin to stain cytoplasmic area, and changes in nuclear size using, for example, Hoechst 33342 staining. Cell production of hypertrophic markers can be assessed using immunodetection techniques known in the art. [0132] Cell proliferation is associated with a number of disease states. The potential activity of the transcriptional polynucleotides of the present invention in modulating cell proliferation can be assessed using a variety of cell types and number of different assays. By way of example, in the area of cardiovascular disease, proliferation assays using human umbilical vein endothelial cells, human coronary artery smooth muscle cells or rat smooth muscle cells have been designed to identify genes (i.e., polynucleotides) that play a role in modulation of proliferation of these cells. Proliferation of such cells can be assessed using techniques known in the art including, for example, cell counting, determining DNA replication in an entire population of cells using, for example, ³H-thymidine incorporation, and determining DNA replication in individual cells using, for example, bromodeoxyuridine (BrdU) incorporation. A proliferating cell nuclear antigen (PCNA) assay may also be used to identify individual proliferating cells as PCNA expression is elevated in such proliferating cells. All of these assays are suitable for automation using cells in a multi-well format and can often be performed concurrently with other methods of analysis of other biological readouts. [0133] Functional analysis assays can also be performed to identify expression products of transcriptional polynucleotides in the expression libraries that may be involved in anti-proliferation activity by, for example screening for those that effect changes in expression of, for example, a member of the Cdk inhibitor family of proteins, such as pl5, p21 and ρ27. Identification of a polynucleotide expression product that can increase expression of one of these CDK inhibitors would suggest potential anti-proliferation activity of the expressed polynucleotide. [0134] Functional analysis assays can be performed to identify tianscriptional polynucleotides in the expression libraries that modulate particular cell or tissue developmental programs. Biological readout of such assays may be based on stimulation or suppression of expression of a particular endogenous gene or genes that are indicative of or specifically regulated in a particular developmental program or on induction of changes in cell morphology or cell activity. Alternatively, the assays may use cells stably transfected with a reporter gene operably linked to a transcription promoter region, activity of which is indicative of or specifically regulated in a particular developmental program. Such assays can be used to identify transcriptional polynucleotides involved in, for example, immunologic, neurologic or cardiogenic development. [0135] A functional analysis assay generally designed to identify genes in an expression library that activate cardiogenic programs may use non-muscle cells, including, without limitation, embryonic stem cells, bone marrow stem cells and cardiac fibroblasts, as the assay cells expressing the transcriptional polynucleotide. The biological readout in these assays may be expression of endogenous cardiac muscle specific genes, including, for example, L-type calcium channel, Na+-Ca+ exchanger and/or myosin heavy chain genes. Such gene expression can be detected using well known techniques including, for example, immunostaining techniques. In addition, or alternatively, assays to identify tianscriptional polynucleotides in an expression library that activate cardiogenic programs may involve as a biological readout induction of muscle cell-like morphology, cell-cell comiection and/or synchronized beating. [0136] In addition, or alternatively, the non-muscle cells used in the assay may contain a reporter gene operably linked to a cardiac muscle specific tianscription promoter, such as a promoter from α-myosin heavy chain gene or from an ANF gene. Reporter genes appropriate for use in such an assay include those whose expression is amenable to high throughput analysis such as, for example, genes that encode green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), luciferase, and β-galactosidase. Reporter gene expression can be monitored through detection of fluorescence associated with the reporter gene expression product, detection of enzymatic activity associated with the reporter gene product and/or detection of the reporter gene expression product using, for example, immunodetection techniques. [0137] Functional analysis assays for transcriptional polynucleotides that maybe involved in stimulating or suppressing cancer and/or otherwise affecting cell growth and/or proliferation include assays that detect changes in the expression of the following, without limitation: GADD45 and GADD153 for tumor suppression; nm23 for suppression of tumor metastasis; VEGFA, VEGFB, VEGFC, VEGFD, P1GF and FGF2 for angiogenesis; MDR for drug resistance; CASP100 for apoptosis; and PDGFA, PDGFB, FGF1, FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, IGF1, IGF11, cyclin A, cyclin Bl, cyclin C, cyclin Dl, cyclin D2, cyclin D3, cyclin E, cyclin F, cyclin Gl, cyclin H, c-myc and c-Jun for cell proliferation. [0138] Assays that may detect tianscriptional polynucleotides involved in inflammation include those that detect changes in expression of the following, without limitation: Cox-2, IL- lβ, IL-6, TNFα, IL-13, E-selectin, VCAM1, ICAM1, ICAM2, NFkB, c-Rel, RelB, DcBβ and Bel 3. Assays that may detect tianscriptional polynucleotides involved in autoimmunity include those that detect changes in expression of, for example, Fas and Fas ligand. Assays that may detect transcriptional polynucleotides involved in infection include those that detect changes in expression of the following, without limitation: chemokines such as MlP-lα, MIP- lβ, MIP-2, RANTES, MCP-1, MCP-2, GROα, GROβ, GROγ, ENA-78, IP10, and cytokines such as IL-2, IL-13, GM-CSF, G-CSF and M-CSF. [0139] Assays that may detect tianscriptional polynucleotides involved in atherosclerosis include those that detect changes in expression of, for example, Egr-I. Assays that may detect tianscriptional polynucleotides involved in diabetes include those that detect changes in expression of the insulin, for example. Assays that may detect transcriptional polynucleotides involved in obesity include those that detect changes in expression of leptin and leptin receptor, for example. Assays that may detect tianscriptional polynucleotides involved in Alzheimer's disease include those that detect changes in expression of the following, without limitation: tau, CRF, CRF receptor, CRF-BP, APD, AB peptides, urocortin, and neuronal growth factors such as BDNF, NT3, NT4, NT5, CNTF and GDNF. Assays that may detect transcriptional polynucleotides involved in Parkinson's disease include those that detect changes in neurotiansmitter release or expression of tyrosine hydroxylase and α- synuclein, for example. [0140] Transcriptional polynucleotides identified as possibly having activity of interest in the primary functional analysis assays may be used to generate tiansgenic animals, tissues or organs to confirm or extend the primary results in in vivo, ex vivo and/or in situ assays. Alternatively or additionally, adenoviral vectors comprising the transcription cassettes of interest can be rapidly packaged in adenoviral virions and used to transfect tissues or animals for further in vivo, ex vivo and/or in situ study. [0141] For example, transcriptional polynucleotides identified as modulating proliferation of endothelial cells can be introduced into cells or tissues and tested in tiansgenic chick chorioallantoic membrane (CAM) and/or rat aortic ring culture systems. Such culture systems can be used to evaluate to activity of the expression product of the tianscriptional polynucleotide for example, in stimulating or inhibiting proliferation of vascular endothelial cells, generation of blood vessels, migration of vascular endothelial cells, stability of new blood vessels. These models, in combination with primary cell-based assays, may also be employed to validate transcription polynucleotides useful for inhibiting vascular diseases such as restenosis. Transcriptional polynucleotides identified in functional assays can be delivered, for example, to hearts of experimental animals and the hearts and heart function of such animals can be systematically evaluated by a variety of physiologic tools. Transcriptional polynucleotides identified in functional analysis assays as providing a possible activity of use in treating stable myocardial ischemia, acute myocardial infarction or congestive heart failure can be further evaluated in an Langenhoff "hanging heart" model system to determine the effect of the transcriptional polynucleotide' s expression product, using, for example, contractility of the heart as a biological readout. [0142] The following Examples are provided to illustrate, but not limit, the invention.

Examples

Example 1 Construction of Illustrative Transcription Cassettes

A. TPE-LR1-TP-LR2-TTM Transcription Cassettes [0143] As described above, tianscription cassettes of the type TPE-LR1-TP-LR2-TTM are a basic transcription cassette unit comprising a transcription promoting element (TPE), first linking region (LRl), transcriptional polynucleotide (TP), second linking region (LR2) and tianscription termination mediating element (TTM). The first and second linking regions comprise, respectively, first and second restriction endonuclease recognition sites that differ from one another and each comprise at least eight nucleotide residues. Illustrative transcription cassettes of this type have been constructed and have been used to successfully transfect various cell lines wherein the tianscriptional polynucleotide was transcribed and translated into the expected expression product. [0144] In one aspect, the SPA-EGFP plasmid described in Example B(l) was used as a PCR template in order to amplify the linear expression cassette. The PCR reaction was set up as follows: 4 μg SPA-EGFP plasmid 50 μl 10 x Pfx Amplification Buffer (Invitrogen, Carlsbad, CA) 60 μl 2.5 mM dNTP Mix (Invitrogen, Carlsbad, CA) 10 μl 50 mM MgSO4 (Invitrogen, Carlsbad, CA) 10 μl Pfx DNA polymerase (Invitrogen, Carlsbad, CA) 1.5 μl 100 μM forward primer (5'CGACTCAGTACAATCTGC3\ Proligo, San Diego, CA) 1.5 μl 100 μM reverse primer (5'CTGCAGATCTGCTGGTTCTT3', Proligo, San Diego, CA) H2O up to final of 500 μl [0145] PCR amplification was performed in a thermocycler by the following program: 94 °C, 2 min 94 °C, 20 sec 55 °C, 45 sec 68 °C, 4 min repeat 2) to 4) 34 times 68 °C, 10 min 4 °C, for ever (reaction was removed as soon as the thermocycler reached 4 °C) [0146] The PCR product that contains the eCMV promoter, EGFP cDNA, and BGH polyadenylation signal was purified by gel electrophoresis and extraction using Qiagen' s Quick Gel Extiaction kit (Valencia, CA). To tiansfect cultured HEK293 cells and neonatal rat cardiomyocytes, 1 μg of purified EGFP expression cassette was mixed with Opti-MEM (Invitrogen, Carlsbad, CA) in a final volume of 250 μl and 3 μl Lipofectamin2000 was mixed with 247 μl Opti-MEM. The above mixtures were incubated at room temperature for 5 minutes before they were mixed gently and incubated at room temperature for 20 minutes. Meanwhile, cells cultured in a 60-mm dish were changed to Opti-MEM plus 10% Fetal Bovine Serum (FBS). The above 500 μl of DNA and Lipofectamine2000 mixture in Opti-MEM was added drop-wise to the cells. The transfection was carried out for 24 hours before the cells were changed to regular culture media. The expression of EGFP was confirmed by fluorescent microscopy. [0147] Alternatively to digesting a SPA plasmid as described above, the components of the transcription cassette, that is, TPE-LR1, LR1-TP-LR2 and LR2-TTM, construction of which is described below, are ligated to one another in a standard ligation reaction to provide the tianscription cassettes. Once ligated, the transcription cassettes may be amplified by PCR, for example where they are about 3000 bases or less in length. Where the transcription cassettes are not amenable to PCR amplification, they are preferably cloned into a plasmid and amplified in an appropriate cell line.

B. LA(N)-TPE-LR1-TP-LR2-TTM- RA(V) Transcription Cassettes

1) Cloning Method of Production - Adenoviral/Plasmid Vector (SPA™) [0148] An illustrative tianscription cassette of the type LA(V)-TPE-LR1-MCS-LR2- TTM-RA(V) employing adenoviral vector sequence is described, wherein the LA(V) and RA(V) form a continuous polynucleotide sequence comprised of adenoviral sequence and bacterial plasmid sequence. This vector may advantageously be produced and then replicated, for example in a bacterial cell line such as E. coli, to provide a stock of vectors comprising a precursor transcription cassette with a multiple cloning site for insertion of transcriptional polynucleotides in accordance herewith. i) Construction of Multiple Cloning Site (MCS .■ [0149] In this preferred embodiment of a vector comprising a precursor transcription cassette, the multiple cloning site (MCS) comprises multiple restriction endonuclease recognition sites, each one comprising at least eight specific nucleotide residues required for recognition. In particular, two of the restriction sites comprise eight residues and the other six comprise in excess of twenty residues each with the Pl-Scel site comprising forty (40) specific residues. [0150] Construction of the MCS was as follows: Four single strands of DNA were purchased from MWG Biotech (Highpoint, NC). These oligos are as follows: (i) 5'- GGGCCCTAACTATAACGGTC-3' (ii)5'-GGGCCCTAACTATAACGGTCCTAAGGTAGCGATGGCAAACAGCT ATTATGGGTATTATGGGTTAGGGATAACAGGGTAATGCGGCCGCGGC GCGC-3' (iii)3'ATACCCATAATACCCAATCCCTATTGTCCCATTACGCCGGCGCC GCGCGGTAGATACAGCCCACGCCTCTTTCTCCATTACTTTACCGACCAT GG-5' (iv) 3'-CATTACTTTACCGACCATGG-5' [0151] The four oligos were mixed and nucleotide extension and PCR were conducted to generate and amplify the MCS region. The internal oligos (ii and iii) served as extension sequences and the region of complementary sequence is underlined above. These two strands were annealed and after extension using thermostable polymerase, the double stranded MCS was made and amplified using the two external primers (i and iv) which also contain the Apal and Kpnl restriction recognition sequences. The PCR reaction was performed under the following conditions: 2.5mM dNTP mix, Platinum Pfx DNA Polymerase, lOOuM primer 1, lOOuM oligos were mixed in a 500ul reaction containing lOx Pfx amplification buffer, 2.5mM dNTPs, 50mM MgSO , lOOuM primers, lOul Pfx and water, using the annealed oligonucleotides (ii) and (iii), above as a template. The PCR reaction was as follows: denaturing temperature was 94°C, primer annealing was at 55°C and extension was at 68°C. After the reaction was complete, PCR product was maintained at 4°C. PCR product was then gel purified by agarose gel electrophoresis. After the PCR reaction, the product was blunt-end ligated into pCR-Bluntll-TOPO (Invitrogen, Carlsbad, CA). This plasmid was then digested with Kpnl and Apal and the MCS was gel purified and prepared for ligation into the SPA plasmid described below. This strategy for construction of an MCS in accordance herewith is outlined in FIG. 2. ii) Generation of Enhanced Promoter Region [0152] The enhanced CMV promoter was used in the SPA construct. This promoter was amplified using gWIZ-Luc (GeneTherapySystems, San Diego, CA) as a template and PCR was conducted using two primers specific for the left and right arms of the modified CMV promoter. These primers also contain polylinker recognition sites for Mfel and Apal. Primer sequences are as follows: 5'-CGCAATTGCCGCACAGATGCGTAAGGAG-3' 3 '-ATGGGCCCCCGCGATATCTGATCACACG-5 ' [0153] The PCR reaction was carried out using primers and Pfx-DNA polymerase and generated a sequence of approximately 1.6kb which was blunt-end ligated into the pCR-Blunt II-TOPO cloning vector (Invitrogen, Carlsbad, CA). After digestion with Mfel and Apal, the 1.6kb sequence was ready for ligation into the SPA plasmid. This illustrative strategy is outlined in FIG. 3. iii) Construction of SPA™ Plasmid [0154] pAdenoX plasmids were purchased from Clontech (Palo Alto, CA) and used in a three-way ligation procedure to generate the single-plasmid-to-adenoviral- vector (SPA™) plasmid. Briefly, the pShuttle plasmid was linearized with Mfel and Kpnl. The PCR product was digested with Apal and Kpnl and the CMV promoter was digested with Mfel and Apal. The digestions of pShuttle, MCS and the enhanced CMV were done individually in 20ul volumes and included lul Apal, lul Kpnl, or lul Mfel as needed. 2ul universal buffer and 16ul plasmid or PCR product were used and the reaction was allowed to proceed at 37°C for 1 hour. [0155] The three-way ligation reaction included 4ul of 5x DNA dilution buffer, 6ul (0.01 ug ul) digested pShuttle, 5ul (0.06 ug/ul) digested MCS, and 5ul 0.06ug/ul digested enhanced CMV. To this mixture, 20ul of 2x ligation buffer and 2.5ul T4 DNA ligase were added and the reaction was mixed well and was left at room temperature for 2 hours. Components of the ligation reaction mix were from Roche (Indianapolis, IN). 8ul of the ligation reaction were then used to transform One Shot TOP 10 Competent E. coli cells and cells were plated on 10cm LB-agar plates containing Kanamycin and incubated at 37°C overnight. [0156] Forty individual bacterial colonies were selected and grown individually in LB media at 37°C overnight. DNA was prepared from mini-preps using Qiaprep (Qiagen, Valencia, CA) and clones containing insert were verified by double restriction digestion using Apal and Kpnl and visualized by agarose gel electrophoresis. E-coli containing positive clones were amplified for additional plasmid purification and glycerol stocks were made and stored at -70°. The overall strategy of the three-way ligation is illustrated in FIG. 4. a) Use of SPA Plasmid in Generation of Adenovirus Expressing Exemplary Transcriptional Polynucleotides [0157] The SPA plasmid was used to generate recombinant adenovirus comprising exemplary tianscriptional polynucleotides in accordance with the present invention. In this illustrative example, adenovirus expressing EGFP and luciferase were constructed; however, the methods may likewise be applied to other transcriptional polynucleotides. [0158] The EGFP and luciferase transcriptional polynucleotides were amplified by PCR from gWIZ-luc and gWIZ-EGFP obtained from Gene Therapy Systems (San Diego, CA). The amplified cDNAs were cloned into the MCS site of the TPO plasmid obtained from Invitrogen (Carlsbad, CA). The TOPO plasmids containing the EGFP and luciferase cDNAs were then digested with PI-PspI and Notl to provide the tianscriptional polynucleotides (i.e., EGFP and luciferase) both with LRl (PI-PspI) and LR2 (Notl) regions at either end. The LR1- TP-LR2 reagent was then ready for insertion into the MCS of the SPA plasmid.

High-throughput Plasmid Isolation [0159] In this illustrative example, high-throughput plasmid isolation is based on the Wizard^® SV 96 Plasmid DNA Purification System (Promega Corporation, Madison, WI). A Vac-Man^® 96 Vacuum Manifold (consisting of a lysate clearing plate, a manifold collar, binding plate, manifold base and vacuum port with insert), a Washing Apparatus (consisting of binding plate, pins for manifold collar alignment, and mamfold base), and Elution Apparatus (consisting of binding plate, manifold collar, elution plate and manifold bed) were used in conjunction with the purification system. [0160] Bacterial cultures were grown overnight in LB media with appropriate antibiotics and pelleted in a deep-well culture plate (provided) by centrifuging for 15 minutes at l,500xg in a tabletop centrifuge. As much as 4.0 O.D.600 of total cell mass could be processed per well. Supernatant was removed and plate was blotted upside down on a paper towel to remove excess liquid. Cell pellets could be stored at -20°C for later processing. Each cell pellet was resuspended by adding 250μl of Cell Resuspension Solution and was pipetted thoroughly 8-10 times until a uniform cell suspension was achieved. 250μl of Cell Lysis Solution was added to each sample and mixed by tapping the plate against the palm of your hand 3—4 times. Plates were then incubated for 3 minutes at room temperature. The vacuum manifold was prepared and to ensure that samples and well numbers correspond on both plates, the plates were oriented with the numerical column headers toward the vacuum port. [0161] 350μl of Neutralization Solution was added to each sample and bacterial lysates were transferred to the Lysate Clearing Plate assembled on the Vacuum Mamfold. After filtration disks had been wet uniformly, a vacuum was applied to the manifold (15-20 inches of Hg or the equivalent) using a vacuum pump fitted with a control valve. After 3-5 minutes under vacuum for the lysates to pass through both the Lysate Clearing Plate and the Binding Plate, the vacuum was released and checked that the lysate had cleared both the Lysate Clearing and Binding Plates. If not, the vacuum was reapplied until all lysate was pulled through both plates. The Clearing Plate and collar were then removed. [0162] 500μl of the Neutralization Solution was added to each well of the Binding Plate and a vacuum was applied for 1 minute. 1.0ml of Wash Solution containing ethanol was added to each well of the Binding Plate followed by a vacuum for 1 minute. The wash step was repeated. After the wells had been emptied, it was continued for an additional 10 minutes under vacuum to allow the binding matrix to dry. The vacuum line was released from the. . Manifold Base and snapped into the vacuum port in the Vacuum Manifold Collar. The Binding Plate was removed from the Manifold Base and blotted by tapping onto a clean paper towel to remove residual ethanol. The DNA Elution Plate in the Manifold Bed was assembled and the Vacuum Manifold Collar was oriented on top with the plate with the numerical column headers toward the vacuum port. [0163] The Binding Plate tips were centered over the Elution Plate wells and both plates were in the same orientation. lOOμl of Nuclease-Free Water was added to each well of the Binding Plate and plates were incubated for 1 minute at room temperature. A vacuum was applied for 1 minute as previously described. The vacuum was released and the Binding Plate was removed followed by carefully removing the Manifold Collar, making sure that the Elution Plate remained positioned in the Manifold Bed. If droplets were present on the walls of the Elution Plate wells, plates were centrifuged briefly to collect the droplets on the bottom of the wells. Eluate volumes were generally 60-70μl and samples could be stored at 4°C or - 20°C by covering the plate tightly with a plate sealer. Generation of Adenovirus Encoding Exemplary Transcriptional Polynucleotides Using SPA Technology [0164] To generate recombinant adenovirus expressing a tianscriptional polynucleotide, the recombinant SPA plasmid was used in transient transfection of a permissive cell line such as HEK293 cells, which has been engineered to produce Ad5 El proteins essential for adenovirus replication and packaging. Since the SPA plasmid contains the entire ? E1/E3 Ad5 genome, it was sufficient to generate infectious recombinant adenoviral particles in HEK293 cells. SPA-EGFP and SPA-luciferase were linearized with Pad and transfected into HEK 293 cells using Lipofectamine (Invitrogen, Carlsbad, CA). Cells were incubated for 24 hours and then the media replaced. Cytopathic effect (CPE) occurred over the course of approximately two weeks and upon observation of CPE, crude lysate was isolated and transferred to multiple wells containing fresh HEK 293 cells in order to amplify the adenovirus. Stock plates of crude lysate were saved and frozen at -70°C.

Confirmation of Adenoviral Expression of Transcriptional Polynucleotide Products

EGFP/Luciferase Assays: [0165] The exemplary transcriptional polynucleotides illustrated herein provide a readily detectable signal upon expression. Thus, following amplification of adenoviral clones in HEK293 cells, HUVEC (human umbilical vein endothelial) cells were infected with either adenovirus containing EGFP or luciferase. To confirm EGFP expression, transduced cells were examined under a fluorescent microscope for green fluorescent cells. To confirm luciferase expression, transduced cells were lysed and the lysates were used in a standard luciferase assay (Promega, Madison, WI).

ELISA: [0166] Alternatively or additionally, enzyme linked immunoabsorbent assays (ELISAs) are conducted to verify that the cells transfected with the recombinant adenovirus express the desired protein as well as to quantify the amount of protein produced. ELISA kits are commercially available, for example from R&D Systems, Minneapolis, Minnesota, and can be used to conduct the ELISA reactions in a high-throughput manner, such as in 96 well plates. Briefly, lOul a monoclonal antibody targeted to the tianscriptional polynucleotide expression product is mixed with 10ml coating buffer and lOOul of the mixture added to each well. Plates are covered and incubated overnight at 4°C. Coating buffer is then removed and a non-specific block (eg. BSA) prepared is in sterile ddH₂O and sample buffer. 200ul of this mixture is added per well and the plates are incubated for 1 hour at room temperature. A standard curve is prepared using serial dilutions of the tianscriptional polynucleotide expression product. Samples are added to each well of the plates in a volume of lOOul. Plates are then incubated with shaking for 6 hours at room temperature followed by five washings. Polyclonal antibody recognizing the transcriptional polynucleotide expression product is then prepared in blocking buffer and lOOul added per well followed by overnight incubation at 4°C. The next day, plates are washed five times and IgG-HRP (horseradish peroxidase) conjugate prepared and added to each well (lOOul well). Plates are incubated with shaking for two hours at room temperature followed by washing 5 times. lOOul of substrate solution is then added to each well followed by incubation for 30 minutes. The solution is then stopped by adding Stop Solution (provided with ELISA kit) and the A_j.₅o absorbance is read using a plate reader. Protein concentration can be calculated with reference to the standard curve.

2) Exemplary Ligation Method of Production - Adenoviral Vector [0167] The SPA plasmid is digested with Pac I restriction endonuclease to expose the ITR of the LA(V)-TPR-LR1-MCS-LR2-TTM-RA(V) and separate it from the rest of the plasmid. The LA(V)-TPR-LR1-MCS-LR2-TTM-RA(V) fragment is purified by gel electrophoresis and extiaction (for example using Quick Gel Extraction kit, Qiagen, Valencia, CA). The purified LA(V)-TPR-LR1-MCS-LR2-TTM-RA(V) fragment is subsequently digested by two restriction endonuclease at the MCS site to expose both LRl and LR2 and LA(V)-TPR-LR1 from LR2-TTM-RA(V) are separated by gel electrophoresis and extiaction. Human cDNA is amplified using primers containing both sequences derived from the coding region and the same endonuclease recognition sites (REl and RE2) as in LRl and LR2. The PCR-amplified cDNA is digested with the two selected restriction endonuclease to generate compatible ends to those of LA(V)-TPR-LR1 and LR2-TTM-RA(V). Ligation reaction is set up with the following reagents: i. LA(V)-TPR-LR1 ii. LR2-TTM-RA(V) iii. LR1-TP-LR2 (the PCR product) iv. T4 DNA ligation buffer (Roche, Indianapolis, IN) v. T4 DNA ligase (Roche, Indianapolis, IN) [0168] The ligation reaction is carried out at 20°C for 5 minutes before it is assessed by electrophoresis. The linear LA(V)-TPR-LR1-MCS-LR2-TTM-RA(V) fragment is transfected in HEK293 cells as described above in order to generate recombinant adenovirus that overexpress the human cDNA.

C. Exemplary Construction of Stocks of Transcription Cassette Components

1) TPE-LRl - Transcription Promoting Element/Linking Region 1 [0169] Numerous promoters, enhancers and like sequences that maybe employed as transcription promoting elements are commercially available and/or may be readily synthesized. In a preferred method of construction of a stock of a transcription promoting element/linking region 1, PCR amplification is used to amplify the transcription promoting element (for example, promoter sequence) of interest, employing a primer including an adapter end encoding linking region 1 (LRl). Following PCR amplification, the TPE-LRl component may be purified, for example by gel electrophoresis. [0170] Alternatively, the TPE-LRl is produced by PCR amplification using the SPA vector as the template as described above. PCR amplification primers are designed to amplify the TPE-LRl component, for example using a 5' primer sequence directed to the 5' end of the promoter region of the TPE (e.g., the eCMV promoter of the above described SPA plasmid) and a 3' primer sequence directed to the 3' end of the restriction endonuclease site desired for inclusion at the 3'end of the LRl component (e.g., the 3' end of the I-Ceul, PI-PspI or I-Scel restriction endonuclease recognition sites of the MCS of the above described plasmid). Following amplification, the PCR product can be cleaved with the appropriate restriction endonuclease to generate a sticky end at LRl for subsequent ligation reaction. If the PCR product is not so cleaved the TPE-LRl component would simply be cleaved just prior to use in a subsequent ligation reaction. Following restriction endonuclease digestion (if employed), the TPE-LRl fragment is purified, for example by gel electrophoresis. a) LACVVTPE-LR1 - Left Arm Viral Vector-TPE-LRl [0171] Various molecular biology techniques combined with the disclosures herein can be employed in the construction of an LA(V)-TPE-LR1 stock. In one embodiment, an LA(V)- TPE-LR1 reagent comprising an adenoviral (type 5) left arm is constructed by digesting the SPA plasmid, described above, with Pac I (recognition sites for which flank the adenoviral sequence in the SPA construct) followed by gel purification of the adenoviral portion of the digestion products. Next a restriction endonuclease (REl) recognizing a restriction site within the LRl region of the multiple-cloning site (MCS) of the purified adenoviral sequence (e.g., Ceu-I, PI-PspI or I-Scel) is used to cleave the adenovirus sequence into a left arm (LA) portion comprising the transcription promoting element (TPE) and first linking region (LRl) and a right arm (RA) portion comprising the remainder of the MCS and the tianscription termination mediating element (TTM). (Discussed below is a method for the simultaneous construction of the LR2-TTM-RA(V) component using a second restriction endonuclease.) The LA(V)-TPE- LR2 digestion product is then gel purified. [0172] Whereas LA(V)-TPE-LR1 component derived from the SPA plasmid is less than 3000 base pairs in length, this component is amplified by PCR, following purification by gel electrophoresis. Alternatively, the SPA plasmid can be amplified in bacterial cells, separated from the bacterial cells and then subjected to the Pac I restriction digestion, gel purification, REl digestion, second gel purification processes. [0173] In an alternative method, the left arm of the vector of interest is cleaved from a plasmid comprising the vector. Such plasmids are commercially available; typically including a restriction map of the vector sequences that can be used to identify which restriction endonucleases will provide the desired left arm sequences. Following cleavage, the left arm is ligated to the TPE-LRl of interest (which can be constructed as described above). Where the left arm of the vector is less than about 3000 base pairs in length, it can be amplified by PCR then ligated to (previously amplified) TPE-LRl or, provided the entire LA(V)-TPE-LR1 component is less than about 3000 base pairs, the entire component can be PCR amplified.

2) LR2-TTM - Transcription Termination Mediating Element/Linking Region 2 [0174] As with construction of the TPE-LRl tianscription cassette component described above, various polyadenylation signals that may be employed as tianscription termination mediating elements in accordance herewith are known and/or readily synthesized. Thus, in a preferred method, PCR amplification is used to amplify the transcription termination mediating element (TTM) (typically a polyadenylation signal) of interest, using a primer that includes an adapter end encoding linking region 2 (LR2). Following PCR amplification, the LR2-TTM component is purified, for example by gel electrophoresis. [0175] Alternatively, the LR2-TTM is produced by PCR amplification using the SPA vector as the template as described above. PCR amplification primers are designed to amplify the LR2-TTM component, for example using a 5' primer sequence directed to the 5' end of the restriction endonuclease site desired for inclusion at the 5'end of the LR2 component (e.g., the 5' end of the Not-I, Asc-I or Pl-Scel restriction endonuclease recognition sites of the MCS of the above described SPA plasmid) and a 3' primer sequence directed to the 3' end of the TTM (e.g., the bovine growth hormone polyadenylation (BGHpolyA) sequence fo the above described SPA plasmid). Once amplified, the PCR product can be cleaved with the appropriate restriction endonuclease to generate a sticky end at LR2 for subsequent ligation reaction. If the PCR product is not so cleaved the LR2-TTM component is simply cleaved just prior to use in a subsequent ligation reaction. Following restriction endonuclease digestion (if employed), the LR2-TTM fragment is purified, for example by gel electrophoresis.

B. LR2-TTM-RA(V, - LR2-TTM - Right Arm Viral Vector [0176] The SPA plasmid, described above, is amplified in a suitable bacterial cell line, for example E. coli, and an LR2-TTM-RA(V) reagent, comprising an adenoviral (type 5) right arm is derived therefrom. The SPA plasmid is digested with Pac I (recognition sites for which flank the adenoviral sequence in the SPA construct) followed by gel purification of the adenoviral portion of the digestion products. Next a restriction endonuclease (RE2) recognizing a restriction site within the LR2 region of the multiple-cloning site (MCS) of the purified adenoviral sequence (e.g., Not-I, Asc-I or Pl-Scel) is used to cleave the adenovirus sequence into a right arm (RA) portion, comprising the transcription termination mediating element (TTM) and second linking region (LR2), and a left arm (LA) portion comprising the remainder of the MCS and the transcription promoting element. The LR2-TTM-RA(V) component is then purified by gel electrophoresis. Where the LR2-TTM-RA(V) component is less than about 3000 base pairs in length (for example, where the multiple-cloning site is inserted into the E3 region of an adenoviral vector rather than the El region), the component can be amplified by PCR after construction, as described above for the LA(V)-TPE-LR1 component, alternatively to amplification in bacterial cells prior to digestion. [0177] In an alternative method, the right arm of the vector of interest is cleaved from a plasmid comprising the vector and subsequently ligated t the 3' end of an LR2-TTM component. Such plasmids are commercially available; typically including a restriction map of the vector sequences that can be used to identify which restriction endonucleases will provide the desired right arm sequences. Where the right arm of the vector is less than about 3000 base pairs in length, it can be amplified by PCR then ligated to (previously amplified) TTM-RLR2 or, provided the entire component is less than about 3000 base pairs, the entire LR2-TTM- RA(N) component can be PCR amplified. If the right arm of the vector is not amenable to amplification by PCR, then the plasmid comprising the vector sequence is amplified, for example in a suitable bacterial cell line, isolated and digested with appropriate restriction endonucleases. The cleaved right arm is then ligated to an already amplified LR2-TTM reagent and gel purified, as necessary or desirable, to provide a stock of LR2-TTM-RA(V) reagent. [0178] In yet another alternative, the LA(N)-TPE-LR1 reagent and LR2-TTM-RA(N) reagent are constructed at the same time from a SPA plasmid. Following digestion of the SPA plasmid with Pad and gel purification of the adenoviral digestion product, as described above, two different restriction endonucleases (REl) and (RE2) are used to digest two different sites within the multiple-cloning site (MCS) thereby providing both the LA(V)-TPE-LR1 reagent and LR2-TTM-RA(V) reagent which are then purified by gel electrophoresis.

3 LRl -TP-LR2 - Linking Region 1 /Transcriptional Polynucleotides/Linking Region 2 [0179] In a particularly preferred embodiment, LR1-TP-LR2 components are constructed from a cDΝA library of interest and may be stored as stocks of different transcriptional polynucleotide sequences once constructed. In this method, PCR primer pairs are designed to amplify individual cDΝA sequences as well as to incorporate desired restriction endonuclease sites (i.e., LRl and LR2) into the amplification product. By way of example, aliquots of the cDΝA library can be placed into each well of a multi-well plate. Individual sets of specific primers can then be added to individual wells and amplification by PCR carried out. If necessary or appropriate, for example where nesting PCR primers are employed, additional PCR reactions are performed. Once amplification is completed, the amplified cDΝA is separated from the reaction mixture, for example using high throughput column chromatography, either alone or in combination with single-stiand-targeted DΝA nuclease digestion. Use of this illustrative method results is a multiplicity of cDΝAs in an array of sample sites wherein each sample site contains a single predominant cDΝA species. Inclusion of Epitope Tag in LR1-TP-LR2 [0180] To include an epitope tag, for example a FLAG tag in the LR1-TP-LR2 component, PCR amplification is carried out using primers further containing a FLAG tag, encoding sequence (5'GATTACAAGGATGACGACAAG3'). Preferably, the FLAG tag is associated with the LR2 primer such that it is incorporated at the 3' end of the transcriptional polynucleotide (TP) and in the same reading frame as the TP. Following PCR reaction, the PCR products are cleaved with restriction endonucleases recognizing restriction sites in the LRl and LR2 regions to generate compatible sticky ends for ligation to the remaining tianscription cassette components.

Example 2 ' Construction of an Illustrative Expression Library [0181] The SPA vector, described above is cleaved by LRl and LR2 recognizing restriction endonucleases, gel purified, -and dispensed into wells of 96-well plates. In a separate 96-well plate, aliquots of cDNA are dispensed into the wells and specific cDNA species amplified in each well by PCR amplified by adding a pair of gene specific primers to each well as described above. The amplified cDNA is subjected digestion with the two restriction endonucleases corresponding to those of the LRl and LR2 region digestions of the SPA vector. The amplified cDNA is added to the 96-well plates containing the linearized SPA vector. Ligation is carried out by adding ligation buffer and T4 DNA ligase to each well. Following ligation, transformation is carried out in E coli cells to amplify the recombinant SPA that contains a specific cDNA in each well. Following plasmid isolation as described above, Pac I restriction digestion is performed by adding Pac I enzyme and proper buffer. The Pac I digested recombinant SPA is used to tiansfect HEK293 cells seeded in separate 96-well plates to generate recombinant adenoviruses. Once cytopathic effect (CPE) is observed, the recombinant adenoviruses are amplified by inoculating fresh HEK293 cells seeded in separate 96-well plates. Example 3 Illustrative Functional Assays

A. Cell-Based Assays

Illustrative Assays Related to Cardiovascular Disease [0182] Assays performed below used recombinant adenovirus expressing an insulinlike growth factor (IGF) that was produced using the BD-AdenoX™ adenoviral expression system (BD Biosciences Clontech, Palo Alto, CA). The promoter used was CMV and the polyadenylation signal was BGHpolyA. Both single population cell-based assays and mixed population cell-based assays are contemplated herein and the expression libraries described herein are amenable to use in both assay types. a) Cardiomyocyte Apoptosis Assays [0183] Apoptosis assays may be conducted in neonatal rat cardiomyocytes, human umbilical vein endothelial cells, murine fibroblasts, murine cardiomyocytes, human coronary artery endothelial cells and/or human coronary artery smooth muscle cells. These cells are grown and manipulated using the Biomek® 2000 liquid handler (Beckman Coulter, FuUerton, CA) and have been tested multiple times in apoptosis assays for caspase activation as well as staining of nuclei (nuclear condensation), mitochondria (disruption of membrane potential) and F-actin (cytoskeletal disruption). These assays may be conducted in a 96-well format and the Cellomics Arrayscan (Pittsburgh, Pennsylvania) can be used to analyze either a single well (population of cells) or individual cells which can give a more direct correlation between tianscriptional polynucleotide expression and phenotypic output. [0184] These assays are designed to identify those tianscriptional polynucleotides that may play a critical role in apoptosis of cardiomyocytes, which contributes to loss of cardiac muscle mass in both acute myocardial infarction and chronic heart failure. The assays are conducted in several ways to identify transcriptional polynucleotides that either inhibit apoptosis or induce apoptosis. Illustrative Preparation of Cells

Buffer solution: [0185] 0.3ml enzyme solution was used per rat neonatal heart per digestion. A stock solution of Ads buffer was prepared according to the following protocol: for a 1-liter solution the following were dissolved by stirring in about 900 ml dH₂0: 6.8g NaCI, 4.76g HEPES, 0.12g NaH₂PO₄, 1.0g glucose (or Dextiose), 0.4g KCI, O.lg MgSO₄ and 0.02g Phenol red. The pH was adjusted to 7.35 ± 0.5 with IN NaOH, and the volume was brought up to 1 liter with dH₂O. The solution was filtered with a GS filter (Millipore #GSWPO47, 22uM) and stored in a sterile bottle at 2-8°C). [0186] Collagenase (Worthington Cat #4176, Lot #FIE362, 262 Units/mg, Lakewood, New Jersey) was weighed at 108 Units/ml (divided by 262 Units/mg) = 0.41 mg/ml, and Pancreatin (Gibco Cat # 610-5725, Invitrogen, Carlsbad, CA) was used at 0.6 mg/ml in Ads buffer. After adding the enzymes to the Ads buffer described above, the enzyme solution was stirred gently for ~5 min, and bubbled gently with oxygen, filtered with a small filter unit and placed on ice.

Dissections: [0187] Approximately 25 neonatal rats, aged 1 to 2 days, were used to prepare cardiomyocytes. Neonates were held behind their front legs with large curved forceps and were dipped in 70% EtOH followed by decapitation with large scissors. Decapitated neonates were placed on paper towels (3-4 animals at a time). A midline incision was made through the sternum holding the body down with large curved forceps. Forceps were pressed downward to pop the heart up through the incision. Hearts were clipped out with fine scissors and transferred to a dish containing Ads buffer (pool up to 25 hearts/ dish). As the hearts were being collected, atria, fat and connective tissue were trimmed with fine scissors and forceps in order to obtain ventricular cells). The trimmed hearts were trisected and transferred to a clean dish containing Ads buffer prewarmed at 37°C, then put at room temp. Once all the hearts had been trisected, hearts were poured into a spinner flask (a pasteur pipet could be used to "scoop" any hearts that stuck), the Ads buffer was removed with pasteur pipet and the flask was covered. Cell Collection: [0188] Enzyme solution was added (30ml for 100 hearts, 20ml for 65 hearts, 6ml for 20 hearts) with a sterile pipet through the side arm of the flask and then incubated in the spinner flask jacked with 37°C water X 6 min. The flask was spun just fast enough for the hearts to be mixed well with the enzyme solution, and care was taken because cell damage could occur. The enzyme solution was then removed and discarded from the spinner flask with a pipet, leaving the hearts in the flask. New enzyme solution (30ml for 100 hearts, 20ml for 65 hearts, 6ml for 20 hearts) was added to the spinner flask and incubated for 15-20 min at 37°C while stirring. With a sterile 5ml pipet, the enzyme solution was transferred to a sterile 50ml conical centrifuge tube containing ~2ml NCS (new born calf serum) which was used to inactivate the enzymes. Fresh enzyme solution was added to the spinner flask and incubated for 15-20 min at 37°C. The 50ml conical centrifuge tube was centrifuged for 6 min at 1000- 1500 rpm. Supernatant was aspirated off with a pasteur pipet. 4ml of NCS was added to the pellet, resuspended with a pasteur pipet and cells were transferred to a clean 50ml conical tube. The tube was placed in a 37°C incubator with the lid loosened to allow for air exchange in the incubator. The digestion steps were repeated 4 more times (for a total of 5 saved digestions) and if the undigested material in the flask was not digested well, a 6th digestion may have been required. While repeating digestion, tissue culture plates were coated with 1% gelatin in the following volumes (2-3 ml/6 cm plate, 3-5 ml/10 cm plate, 6-7 ml/15 cm plate). The 50 ml conical tube containing the pooled cells was centrifuged for 6 min. at 1000-15 OOrpm. The supernatant was aspirated and the cell pellet was resuspended in 24ml Ads buffer.

Preparing the Percoll Gradient: [0189] Before finishing the plating steps the percoll gradients were prepared. However, gradients should not be set up too early since the interface between the two densities should be as sharp as possible, and the interface would diffuse with time. The top percoll (T) could be done early, but the bottom percoll (B) should be done when pelleting the cells for thefinal time. Percoll should be used at a density of 1 J 3 g/ml and was made by the following: PS = "Percoll Stock" (density = 1. 110 g/ml) is made by diluting percoll with 10 X Ads: 9 parts Percoll : 1 part 10X Ads. T=Toρ Percoll (T): density = 1.059 g ml percoll stock: lxAds buffer=9: 11. B=Bottom Percoll (B): density = 1.082 g ml percoll stock: lxAds buffer=l 3 :7. [0190] 4ml of Top percoll was placed in a 15ml polystyrene tube with a 10ml pipet (10 hearts per gradient). Using a 5ml pipet, 3ml of Bottom percoll was slowly pipetted in the bottom of the tube, so that the top percoll layer would come up (by inserting the pipet «/ong the edge, and a small amount of air was in the tip of the pipet, followed by very slow pipetting). The interface between the two layers should be as sharp as possible and would lead to sharper separation of cells later. 2ml of cells were layered onto each gradient, again being very careful to make a very sharp interface between the cells and the top percoll. The tubes were centrifuged at 3000 rpm for 30 min in a tabletop centrifuge. Nonmyocardial mesonchymal cells (NMCs) were aspirated off and the cardiac cells were collected with a pasteur pipet and transferred into two 50cc conical tubes (half in each tube). Tubes were topped off with Ads buffer and centrifuged at 1000-1500rpm for 6 min. Supernatant was aspirated and ~4ml Ads buffer was added to one of the tubes and the cells were resuspended. Cells and buffer in the other tube were resuspended. 40ml Ads buffer was added to the empty tube and transferred to the tube containing the cells. Tubes were centrifuged for 6 min at 1000- 1500 rpm. Cells were washed and respun. The final washed pellet was resuspended with 40ml of plating media.

Counting and Plating the Cells: [0191] Cells were counted using a standard hemocytometer using the cell suspension, trypan blue and plating media. 1 x 10⁴ to 2 x 10⁴ cells were plated in each well of 96-well plates and when plating, cells were mixed and the bottle containing cells and media were swirled well each time before pipeting to ensure consistent cell densities.

Introduction of Transcriptional Polynucleotides and Induction of Apoptosis

Hypoxia and Serum Deprivation Induced Apoptosis [0192] Cells were prepared and plated according to the protocol described above and allowed to attach in 96-well plates for 24 hours. Cells were transfected with recombinant adenovirus comprising transcriptional polynucleotides in accordance herewith. Media was replaced with media containing 10%FCS or media without FCS. Plates were then incubated in a hypoxic chamber (5%CO₂, 95%NO₂) for 24 hours and then subject to apoptosis analysis.

Hypoxia Peroxide Induced Apoptosis [0193] Neonatal rat cardiomyocytes were prepared as described above and cultured in 96-well tissue culture dishes. After one day of attachment, culture media was removed and replaced with culture media containing luM/L H₂O₂. The next day, cells were then assayed for apoptosis using the Cellomics Multiparameter Apoptosis 1 Hitkit as described above.

Apoptotic Assay I - Cellomics Multiparameter Apoptosis 1 HitKit [0194] The Cellomics Multiparameter Apoptosis 1 HitKit (catalog #K04-0001-1, Pittsburgh, Pennsylvania) was used in conjunction with the Cellomics Arrayscan (Pittsburgh, Pennsylvania) to quantify apoptotic changes in cell culture. The assay allows for analysis of nuclear morphology, mitochondrial mass/potential and F-actin content with each monitored on respective fluorescent channels and within the same population of cells. Changes in nuclear morphology were observable using a fluorescent nuclear dye, Hoechst 33342. Mitochondrial mass/membrane potential changes were based on the uptake of fluorescent dye, Mitotracker Red, into the mitochondria of cells. The uptake of this dye was proportional to the membrane potential according to the Nernst equation. F-actin content was determined by the amount of fluorescent phalloidin staining. Alexa Fluor 488-Phalloidin binding was proportional to the amount of F-actin present. [0195] 200ul per well volume was used to perform the apoptotic analysis. Alexa Fluor 488 conjugates, Hoechst 33342 dye, and Mitotracker Red have approximate absorption maximums of 495nm, 350nm and 579nm, and fluorescence emission maximum of 519nm, 461nm and 599nm respectively. Cells were plated in lOOul culture media. Positive control stock solution was diluted and 50ul/well was added and cells were incubated for approximately 0.5 hours at 37°C. At 30 minutes before completion of the compound incubation, 50ul of Mitotracker or Hoechst solution was added and cells were incubated for 30 minutes at 37°C. lOOul Fixation solution was then added directly to each well without removing medium and cells were incubated in a fume hood at room temperature for 10 minutes. Fixation solution was pre- warmed to maintain cell integrity. Wells were aspirated, and plates were washed once with lx Wash buffer. After removing Wash buffer, lx Permeabilization buffer was added and cells were incubated for 90 seconds. Permeabilization buffer was removed and cells were washed again with Wash buffer. 50ul of Alexa Fluor 488 Phalloidin solution was added per well and cells were incubated for 30 minutes followed by aspiration and washing with Wash buffer three times leaving the last wash in the wells. The cell culture plate was sealed and run on the Cellomics Arrayscan HCS system. Apoptotic Assay II - Annexin-V Binding Assay [0196] One of the events during the early stages of apoptosis is the translocation of phosphatidylserine from the inner part of the plasma membrane to the outer layer where it is exposed to the extracellular space. Annexin-V is a Ca²⁺-dependent phospholipid-binding protein with a high affinity for phosphatidylserine. Therefore, after treatment and induction of apoptosis cells can be assayed for Annexin-V binding. [0197] The Annexin- V-Fluos kit was used (Roche, Nutley, NJ) to quantify the amount of protein binding. Briefly, cells were prepared in the 96 well format as described above and transfected with recombinant adenovirus comprising the tianscriptional polynucleotides in accordance herwith. Annexin-V solution was prepared by diluting 20ul Annexin- V-Fluos labeling reagent per 1ml solution containing lOmM Hepes/NaOH, pH 7.4, 140mM NaCI, 5mM CaCl₂. After treatment to induce apoptosis (eg. H₂O , serum deprivation), media was removed and Annexin- V-Fluos labeling solution was added to the cells and plates were incubated for 10-15 minutes at 15-25°C. Binding was then visualized using the Cellomics Arrayscan using an excitation wavelength between 450-500nm and a detection wavelength in the range of 515- 565nm.

Apoptotic Assay III - Caspase Activation Assay [0198] Members of the cysteine aspartic acid-specific protease (caspase) family are key effector molecules in the apoptotic process in mammalian cells. Certain fluorescent substrates can be used to measure the activity of these enzymes and specific reagents can be used for high-throughput cell culture analysis. Caspase 3 and 7 was measured using reagents in the Apo-One Assay Kit from Promega (Madison, WI). Briefly, the reagents included a cell lysis buffer and a caspase-3/7 substrate known as rhodamine 110, bis-(N-CBZ-L-aspartyl-L- glutamyl-L-valyl-L-aspartic acid amide)(Z-DEVD-Rl 10). The buffer and substrate were mixed and added to the sample. Upon cleavage and removal of DEVD peptides by caspase 3/7 and excitation at 499nm, the rhodamine 110 leaving group became fluorescent and the emission maximum was 521nm. The amount of fluorescent product generated was proportional to the amount of caspase 3/7 cleavage activity present in the sample. [0199] Specifically, using the Apo-One Assay Kit, lOOx substrate and buffer were thawed and mixed. Substrate was diluted 1:100 with buffer to obtain desired volume of homogeneous caspase-3/7 reagent. Cardiomyocytes were counted and normalized for equal cell number and grown in 96 well tissue culture dishes for 24 hours. Following transfection with transcriptional polynucleotides in accordance herewith, apoptosis was induced, and lOOul of caspase reagent was added to each well in a robotic fashion. The wells contained blanks, controls, or cells. Plates were then mixed using a plate shaker at 300-500 rpm for 30 seconds up to read time. Cells were incubated at room temperature for 30 minutes to 18 hours depending on the expected level of apoptosis. Fluorescence was then measured using the Cellomics Arrayscan at an excitation wavelength of 485+/-20nm and an emission wavelength of 530+/-25nm.

Apoptotic Assay IV - Genomic DNA Fragmentation Assay [0200] DNA was prepared as described above. Following precipitation, DNA pellets were rehydrated using DNA hydration solution and incubated at 65°C for 1 hour. DNA was end-labeled with 0.5uCi of [α-³² P]ddATP using 5 units of terminal tiansferase per microgram of DNA enzyme at 37°C for 1 hour. The reaction was terminated by adding EDTA (pH=8.0) to a final concentration of 25mM. Labeled DNA was separated from unincorporated radionucleotide and run on agarose gel electrophoresis.

[0201] Rat neonatal cardiomyocytes were prepared as described above. Cells were transfected with transcriptional polynucleotides in accordance herewith and apoptosis induced. Following treatment Δψ_M was measured directly by using 40nM 3,3 '-dihexyloxacarbocyanide (Molecular Probes, Eugene, OR). Fluorescence was measured after staining the cells for 15 minutes at 37°C and imaged in the Cellomics Arrayscan after excitation at 488nm. i b) Cardiomycyte Hypertrophy Assays [0202] Hypertrophy assays were conducted primarily in neonatal rat cardiomyocytes and a murine cardiomyocyte cell line. Cells were grown in a 96-well format and manipulated using the robotic liquid handler and analyzed using the Arrayscan in whole cell populations or in single cells. These assays included the secretion of Atrial Natriuretic Factor (ANF) into the media or staining of α-cardiac actin (a molecular marker of myocardial hypertrophy). [0203] These assays are designed to identify those transcriptional polynucleotides that control hypertrophic growth in cardiomyocytes associated with congestive heart failure (CHF), where the left ventricular (LV) wall is thinner than normal. Hypertrophic growth in the existing cardiomyocytes will help increase the LV wall thickness and thereby the contractility. On the other hand, cardiomyocyte hypertiophy could be detrimental in cases such as hypertiophic cardiomyopathy. Thus, hypertiophy will be either induced or inhibited depending on the pathologic condition of the patients. In any event, identification of hypertrophy- controlling tianscriptional polynucleotides provides the biopharmaceutical industry with powerful molecular handles on regulation of this process. To conduct hypertiophy assays, cardiomyocytes transduced with a recombinant adenovirus expressing insulin-like growth factor were quantified for hypertrophic growth at both the morphologic level (sarcomeric density and cell size) and molecular level (expression of hypertrophic markers such as ANF).

Hypertrophy Assay I - Morphological Analysis of HypertaOphic Growth [0204] Morphological changes were quantified by immunofluorescent staining and ArrayScan-mediated image acquisition for increases in both cell size and sarcomeric density. The Cellomics Cell Spreading HitKit (Catalog #K06-0001-1, Pittsburgh, Pennsylvania) was used to measure the extent of cellular ability to attach and spread in cell culture. This assay was performed on live cells using Rhodamine-conjugated phalloidin which stained the cell cytoplasm for cell area measurements and Hoechst 33342 which identified the nuclear region of the cells. Cytochalasin D was also used as a negative control compound to inhibit cell spreading. The procedure was as follows. Cells were prepared and grown in 96-well plates as described above with respect to apoptosis assays. Negative control cell wells were tieated with 25ul of negative control working solution (i.e., media without cells) and mixed by pipetting 3 times, and experimental cell wells were transfected with transcriptional polynucleotides in accordance herewith. Cells were incubated for 3 hours at 37°C. Following incubation, all cells were tieated with 200ul pre-warmed Fixation solution and then cells were incubated in a fume hood for 30 minutes. Fixation solution was aspirated and cells were washed once with lOOul lx Wash buffer followed by addition of lOOul of lx Permeabilization buffer and a 15-minute incubation at room temperature. Cells were washed again with lx Wash buffer and lOOul Staining solution was added followed by 30-minute incubation at room temperature. Staining solution was aspirated off and cells were washed 3 times with lx Wash buffer. 200ul lx Wash buffer was added per well and the plate was sealed and run on the Arrayscan HCS system.

Hypertrophy Assay II - Expression of Hypertiophic Markers [0205] The expression of ANF, which is a secreted protein, was quantified by either ELISA assay using the cell culture media, immunofluorescence staining of cardiomyocytes, or quantitative PCR. Hits were confirmed by secondary cell-based assays (e.g. protein or RNA to DNA ratio and expression of additional hypertiophic markers such as β-myosin heavy chain and α-cardiac actin) and CHF animal models. The RNA to DNA ratio is increased in hypertiophied cardiomyocytes and thus, it serves as a reliable molecular marker for quantifying hypertrophy. To isolate both RNA and DNA from the same samples, the RNA DNA kit (Qiagen, Valencia, CA) is used following cell lysis. The quantification of RNA and DNA is accomplished by OD₂₆o measurement. To quantify the expression of other hypertiophy markers, total RNA is isolated from cardiomyocytes using the RNA Easy kit , (Qiagen, Valencia, CA) and reversed-tianscribed to cDNA using Invitrogen' s Superscript kit (Carlsbad, CA). PCR is carried out using hypertrophy marker specific primers and probes, the mRNA levels of those hypertrophy markers are quantified by TaqMan7700 (ABI, Foster City, CA). c) Proliferation Assay [0206] Proliferation assays were conducted in human umbilical vein endothelial cells, rat smooth muscle cells and human coronary artery endothelial cells and human coronary artery smooth muscle cells. Assays included ³H-incorporation (measuring DNA replication in whole cell populations), BrdU staining (measuring DNA replication in individual cells) and cell counting (which was done in an automated and controlled fashion using the Cellomics Arrayscan). These assays were done robotically in a 96-well format and in some cases more than one method of analysis was conducted simultaneously to provide additional confirmation of data. [0207] These assays were designed to identify those transcriptional polynucleotides that encode mitogenic factors for either vascular cells (endothelial or smooth muscle cells) or cardiomyocytes for heart muscle regeneration.

Proliferation Assay I - Endothelial or Smooth Muscle Proliferation Assay [0208] Cell proliferation was quantified by measuring DNA replication or counting the cells. The rate of proliferation was directly proportional to the increases in DNA replication and cell numbers. The Cellomics Mitotic Index HitKit (Catalog #K05-0001-1) and the Cellomics Arrayscan (Pittsburgh, Pennsylvania) were used to analyze the number of mitotic cells in a population. The assay was performed on live cells and reagents used were a primary antibody specific to an epitope present in mitotic cells and a secondary antibody conjugated with fluorescent dye, Alexa fluor 488. [0209] Endothelial and smooth muscle cell lines (from Cell Applications, San Diego, CA or ATCC, Rockville, Maryland) were grown in 96-well plates as described above with respect to cardiomyocytes used for the apoptosis assays. After transfection with transcriptional polynucleotides in accordance herewith, cells were allowed to recover and proliferation was analyzed using the following protocol: 25ul of pre-warmed Anti-Mitotic Control Compound Working Solution (final concentiation=500nM) was added to wells. Cells were incubated for 7 hours at 37°C. All subsequent steps were conducted at room temperature. Medium was removed and lOOul of pre-warmed Fixation solution was slowly added to the wells. Cells were incubated in a fume hood for 15 minutes. Fixation solution was removed and cells were washed with lOOul lx Blocking buffer. Blocking buffer was removed and lOOul of 0.2x Permeabilization buffer was added followed by incubation for 15 minutes. Cells were then washed again with Blocking buffer and 50ul of primary antibody solution was added per well. Cells were incubated for 1 hour to allow antibody binding. After removal, cells were washed twice with Blocking buffer followed by addition of 50ul Staining solution and 1 hour incubation (protected from light). Staining solution was removed and cells were washed twice with Blocking buffer and then lOOul of lx Wash buffer was added to each well. The plate was sealed and run on the Arrayscan HCS system. d) Cardiogenesis Assay [0210] This assay is designed to identify those tianscriptional polynucleotides that activate cardiogenic programs in non-muscle cells (e.g. embryonic stem cells, bone marrow stem cells, and cardiac fibroblasts) so that the newly engineered cardiomyocytes can be utilized to regenerate the injured myocardium by replacing those cardiomyocytes lost in either acute myocardial infarction or chronic heart failure. The assay detects expression of endogenous cardiac muscle specific genes (e.g. L-type calcium channel, Na⁺-Ca²⁺ exchanger, and myosin heavy chain) in those non-muscle cells, following transduction with the expression library, by immunofluorescent staining. However, to increase the throughput of cell-based assays, those non-muscle cells can also be stably transfected with plasmids containing a cardiac muscle specific promoter (e.g. the α-MHC or ANF promoter) and a reporter gene, such as EGFP. Expression of EGFP in those cells following the transduction with the expression library indicates the expression of a transcriptional polynucleotide relevant to cardiogenesis. Hits, that is transcriptional polynucleotides testing positive, can be further validated by additional in vitro cell-based assays (e.g. induction of muscle cell-like morphology, cell-cell connection, and synchronized beating).

2) Illustrative Assays related to the Central Nervous System a) Illustrative Cell Line [0211] The rat pheochromocytoma cell line (PC 12) is an illustrative cell line useful for neuronal assays because of their neuronal origin, expression of many neuronal markers, ability to form synapses in culture, and neurosecretory properties representative of neurotransmitter- like activity. PC12 cells are maintained at 37°C, 5% CO in Dulbecco's modified Eagle's medium (high glucose), supplemented with 10% fetal bovine serum (Hyclone, Logan, UT), and 1% v/v penicillin/streptomycin until ready for use, for example, in one or more of the following assays. b 3-(4.5-Dimethythiazolyl)-2.5-Diphenyl-2HTetrazolium-Bromide (MTT) Assay [0212] To assess the effects of gene expression on cellular viability via mitochondrial activity, the MTT colorimetric assay is used to determine the level of NADH production within cell clones. Amelioration of this effect is accomplished by adding vitamins with antioxidant properties such as vitamin E. For vitamin E treatment, a stock concentration of α-tocopherol acetate (stock 1:10 in 100% alcohol; Sigma Chemical Co., St. Louis, MO) is further diluted 1:5 in fetal bovine serum (Hyclone, Logan, UT) and then mixed 1:5 with medium standard for the cell culture used. Briefly, following transfection with a tianscription library in accordance herewith, the standard medium is replaced with an MTT dye solution (final concentration, 0.9 mg/ml; available from Sigma Chemical Co., St. Louis, MO). Cells are incubated for 4 hours at 37°C, then 100 ml of solubilization solution (50% dimethylformamide/20% sodium dodecyl sulfate) is added and the cells incubated overnight. The presence of blue formazan is then detected, for example in a plate reader, at 560 nm. c) Lactase Dehvdrogenase Activity Assay [0213] An assay available to assess cell viability is the CytoTox 96 assay (Promega, Madison, WI). It is preferred, when performing this assay, that a minimum of four replicates per transcriptional polynucleotide being tested be used and that each experiment include a collection of control (i.e., untiansfected) cells. Briefly, following transfection of cells with the transcription library, the cells are incubated for 3 hours. The cell media is then removed and replaced with 100 ml of standard media followed by administration of 20 ml of CytoTox reagent to each sample site. Cells are then incubated for an additional 2 to 3 hours and counted on a 96-well plate reader at 492 nm to determine cell viability. If desired, additional analysis of cell viability is performed using the Trypan blue staining method. d) Neurite Extension Assay [0214] For this assay PC12 cells are grown on plastic dishes at 37°C in a 5% CO₂ humidified atmosphere in DMEM (Gibco, MD) supplemented with 10% fetal calf serum, 5% horse serum (Hyclone, Logan, UT), and 100 U/ml penicillin/streptomycin (Biowhittaker). For immunofluorescence studies, cells are plated on poly-L-ornithine (10 μg/ml)-tieated coverslips and cultured in the same medium. Cells are then transfected with transcription libraries, in accordance herewith and propagated for a few days. Where indicated, cells are treated with medium supplemented withNGF (nerve growth factor) (50 ng/ml) and re-supplemented every other day. For neurite extension experiments, cells are viewed with a phase-contrast microscope and photographed every 12 h. ; [0215] For quantitative analysis of neurite extension, phase-contrast photographs of at least six fields of each sample are taken every 24 h, using for example an HP ScanJet 6100C scanner (Hewlett-Packard, Palo Alto, CA). To measure the length of the processes, computer programs based upon the public domain image analysis program NIH Image (developed at the U.S. National Institutes of Health, Bethesda, MD, and available at http://rsb.nih.gov/nih-image) are used. The total length of neurites per cell is determined by measuring all the processes present in a field, normalized by the number of cell bodies. The data can be statistically analyzed using Student's t-test.

3) Illustrative Assays related to Cancer [0216] Those of skill in the art will recognize that numerous cell types are available for conducting cell-based assays related to cancer, including cell lines relevant to particular cancers, such as for example, prostate, breast, leukemia, glioblastoma or the like and cell lines more broadly related to multiple or all cancers, such as for example, cell lines transformed with oncogenes such as, for example, c-myc, ras or S V40 large T antigen or the like. a) Matrigel Invasion Assay [0217] Matrigel matrix (Becton Dickinson Labware, Franklin Lakes, NJ) insert plates are created by applying and polymerizing the matrix in a 24- well plate as 9-mm inserts containing polyethylene terephtphalate (PET) membranes with 8-μm pores, creating invasion chambers as directed by the supplier (Becton Dickinson). In separate plates, cells are grown to near confluence, transfected with transcription libraries, in accordance herwith, harvested by trypsinization, which is then inactivated with media containing bovine calf serum. Cells are washed twice in DMEM without added serum or proteinase inhibitor and suspended in DMEM at lxl0⁵/ml. DMEM (0.6 ml) containing 5% fetal bovine serum and a chemoattractant. Next, 0.2 ml (2x10⁴ cells) of cell suspension are added to each matrigel matrix insert. Assays are preferably performed in triplicate. The plates of inserts are incubated for 6 hours at 37°C. Non-coated membrane inserts are also seeded, to serve as controls. After incubation the chambers are processed and stained as directed by the supplier (Becton Dickinson). Cells are enumerated by counting four fields per chamber under lOOx magnification with the aid of a ruled grid. Data is expressed as percent invasion, ie, the ratio of cells invading through the Matrigel-coated inserts relative to the uncoated control inserts. (See, e.g., Wolf W. et al. A synthetic tissue kallikrein inhibitor suppresses cancer cell invasiveness. Am J. Path 159:1191- 1805 (2001)). b) Transformation Assay [0218] In an illustrative transformation assay, 10 cells are seeded in tissue culture dishes with medium plus 2% calf serum (CS) followed by transfection with tianscription libraries, in accordance herewith, and incubation for 14 days. The cell cultures are then fixed in Bouin's reagent and stained with 4% Giemsa in phosphate buffer, pH 7.0. Cells are suspended by trypsinization after completion of the assay. Cells are then counted electronically to determine their saturation density and seeded for further serial assays as described below. Foci are classified as light or dense depending on their staining characteristics. The light foci represent an early stage of transformation and consist of cells more densely packed than the surrounding cells but still mainly in monolayer. The dense foci, which represent progression to a later stage of transformation, are heavily multilayered and produce sarcomas within a few weeks of subcutaneous inoculation into nude mice. In the event that the seeding of 10⁴ cells produces so many foci that they overlap and cannot be accurately counted, the cells from individual clones are diluted and 10³ cells seeded. (See, e.g., 11 Chow & Rubin, Coculturing diverse clonal populations prevents the early-stage neoplastic progression that occurs in the separate clones, Proc. Natl. Acad. Sci. USA 97:174-178 (2000)).

B. Tissue-Based Assays

1) Illustrative Assays Related to Cardiovascular Disease [0219] A number of ex vivo, tissue assays have been established to confirm the data of primary screening prior to the initiation of in vivo confirmation. For example, the chick chorioallantoic membrane (CAM) and rat aortic ring culture systems can be utilized to further evaluate the potency of growth factors identified by cell-based primary screening in inducing growth of new blood vessels. Compared to cell-based assays, not only will these ex vivo models be able to assess the potency of growth factors in terms of inducing proliferation of vascular endothelial cells, but they can also be used to assess the potency regarding migration of vascular endothelial cells, formation of vessels, and stability of the newly formed vessels. Similarly, these models, in combination with primary cell-based assays, may also be employed to validate tianscriptional polynucleotides for inhibiting vascular diseases such as restenosis. Thus, for example, tianscriptional polynucleotides that are identified by the cell-based primary screening for potentially treating stable myocardial ischemia, acute myocardial infarction, or congestive heart failure can be further evaluated by the Langendorff "hanging heart" model system (described below) to determine the effects of transcriptional polynucleotides of interests on the functions of isolated hearts (e.g. contractility) prior to the full-scale in vivo studies, wherein transcriptional polynucleotides are delivered to the hearts of experimental animals. The hearts isolated from such animals will be systematically evaluated by a variety of physiologic tools. Due theimuti-cell type and physiological nature, the ex vivo model systems will serve critical bridge between the cell-based and animal testing. a) Rat Hanging Heart Model

Preparation [0220] Before beginning the isolation of the rat heart, sterile solutions of Heart Media (described below) and 1.88M KCI stock (3.5gm + 25 mis sterile H₂O, filter solution through a 0.2 μm filter.) are prepared. A perfusion system is also set up by sequentially eluting with: 500 mis IN HC1, 500 mis 0.1N HC1, 500 mis of boiling ddH₂O and 200 mis of sterile ddH₂O. Before attaching the heart, the perfusion system is washed with 50 mis, room temperature Heart Media. The perfusion system is connected to a water bath flow through system with the temperature set at 37°C. [0221] The following medias are prepared for use in this model:

A) Heart Media i) Joklik modified (GIBCO-BRL, M-0518) to 1000ml sterile water Reagents mg/L Cone. (mM) NaCI 6500 KCI 400 5.4 MgCl₂ (anhyd) 94.70 1 NaH₂PO₄ H₂0 1340 D-glucose 2000 11.1 ii) To Joklik, add For lL For 2L HEPES (GIBCO) 11 of 1M Stock 10 20mls Taurine (Sigma, T-8691) 3750 30 7.5gm DL-Carnitine (Sigma, C-9500) 400 2 800mg Creatine (Sigma, C-0780) 300 2 600mg [0222] The pH of the solution after adding 950 ml sterile water is adjusted with 5M NaOH to a final pH of 7.4. The solution is then filtered through a 0.2μm filter.

B) O.IM Calcium Chloride Dihydrate [0223] Made by dissolving 73.5mg CaCl₂ (Sigma, C-3881) in 5 mis ddH₂O and filtering through a 0.2μm filter.

C) 1.88 M Potassium Chloride [0224] Made by dissolving 3.5gm KCI (Sigma, P-9541) in 25 mis ddH₂O and filtering through a 0.2μm filter.

D) Washing Solution [0225] lgm of BSA and 20μl of O.IM CaCl₂ are dissolved in 100ml of Heart Media to provide final concentrations of 1% BSA and 20μM CaCl₂. E) Culture Media [0226] 199 Media (Life Technologies, 12350-039, Invitrogen, Carlsbad, CA) is used. This media contains L-Glutamine, 140 mg/L Calcium, HEPES and low NaHCO and does not contain Taurine, Carnitine and Creatine.

F) Attachment Media [0227] 100 ml 199 Media, 4 ml FBS and 1 ml lOOx Penicillin Streptomycin are combined and filtered through a 0.2 μm filter.

G) Maintenance Media [0228] 100 ml 199 Media, 1 gm BSA and 1 ml lOOx Penicillin Streptomycin are combined and filtered through a 0.2 μm filter.

Heart Isolation: [0229] To prepare the rat for the heart isolation procedure, 5U/gram body weight heparin (10,000 U/ml) is administered via intraperitoneal (IP) injection. Five (5) minutes thereafter, the rat is anesthetized with a ketamine/xylazine (ket/xy) solution also administered via IP injection. The ket/xy dose is 1 OOmg/kg body weight ketamine/10 mg/kg body weight xylazine. A stock ket/xy solution comprising 50 mg/ml ketamine and 5 mg/ml xylazine solution may be prepared by diluting 5 ml ketamine (lOOmg/ml) and 0.5 ml xylazine (lOOmg/ml) in 4.5 ml normal saline. [0230] The following table illustrates appropriate ket/xy doses for different rat body weights:

[0231] Following anesthetization, the rat's chest is opened and the heart removed while taking care to cut the aorta as long as possible, close to the liver. The heart is then gently rinsed in cold (4°C) Heart Media with 9.4mMKCl in a 60mm petti dish followed by room temperature Heart Media. The heart may be slightly squeezed or massaged to aid in removal of blood. The aorta is then cannulated using surgical silk to tie the heart onto the cannula. Perfusion fluid should be gently dripping from the aortic cannula prior to cannulation to help minimize the chance of air emboli at the time the heart is attached to the cannula. The tip of the cannula is positioned at the aorta so that the coronaries are perfused. Preferably, this is done by holding the heart gently between the tips of blunt-ended fine curved forceps, taking care to avoid stretching or ripping of the aortic wall and gently easing the aorta over the end of the cannula, taking care not to insert the cannula too far into the aorta since this could occlude the coronary ostia or damage the aortic valve. The aorta is then clamped to the cannula with a small blunt artery clip, which allows for tying a suture around the aorta onto the cannula. Once the suture is secured, the artery clip can be removed. Next, a syringe of Heart Media is connected to a bubble trap so that no oxygen enters the heart and the heart is connected to the perfusion system and excess tissue, if any, cut off. The "hanging heart" is then ready for use, for example, it may be perfused with a recombinant adenovirus comprising a transcriptional polynucleotide of interest and effects of expression of such polynucleotide, such as changes in contractility are assessed. b) Rat Aortic Ring Model [0232] This assay is designed to determine the effect of tianscriptional polynucleotide expression product upon rat aorta vessel growth and number. By way of example, a recombinant adenovirus comprising an tianscription cassette in accordance herewith is used to transduce HUVEC cells and the media therefrom is used to conduct the assay.

Materials: EBM medium (Biowhitaker/Clonetics, Cat #cc-3121) Collagen Type 1 Rat Tail ( BD Biosciences cat # 354236)

Media 1 - EBM with 50ug/ml Gentamycin.

Two Fischer 344 male rats DOB 4-5 weeks old From Harlan Sprague Dawley.

Nuncleon, 4 well multidishes, Nunc Cat # 176740

Type rV-A Agarose, Sigma cat # A9668

100x150mm X-Plate petri dish Fisher Cat # 08757125

Glacial Acetic Acid, Fisher Scientific Cat# UN2789

Sodium Bicarbonate, Sigma Cat# S-8875 rhVEGF- R&D systems Cat#293-VE

VEGF ELISA - R&D systems, Quantikine human VEGF Cat # DVE00

Method:

Collagen Preparation

1. Make up 0.5M Acetic Acid by combining 2.87 ml 17.4N glacial acetic acid and 97.13 ml sterile water.

2. Diluted BD collagen to lJmg/ml by combining 10.2 ml collagen and 19.79 ml 0.5M Acetic Acid at 4°C.

3. Made up 3L of 0.1XMEM at pH 4 using 4°C water.

4. Pre wet 2 Dialysis chambers in the 0JX DMEM.

5. Using an 18g needle and syringe loaded 15ml of 1.3mg/ml BD collagen per Dialysis chambers.

6. Dialysed overnight at 4°C

7. Changed Dialysis Buffer to a fresh 3L of 0.1 X MEM at pH 4 at 4°C.

8. Dialysed overnight at 4°C.

9. Remove dialysed collagen from dialysis chambers into 50 ml conical tube and store at 4° for up to one year.

Preparation of Agarose Culture Plates

1. Poured 300ml of distilled water into a 500ml bottle

2. Added 4.5 g agarose and autoclaved

3. Cooled bottle in 42°C water bath.

4. Coated five 10 cm sterile tissue culture plates each with 35 ml of agarose. 5. Let agarose gel in plates in hood with lid ajar, then place in air tight box at 4°C. Plates can be stored at 4°C for up to one month. Day l Rat Aorta Isolation

1. Sacrifice a 4-5 week old Fischer 344 male rat by interperitoneal injection of sodium pentobarbital. 2. Shave the thoracic and abdominal skin with a hair clipper. 3. Lay the rats on their back with their legs extended, either pinned down with needles or tied back. 4. Wet the skin with 80% Ethanol. 5. Cut a Y shaped incision through the thoracic and abdominal skin. 6. Dissect away the skin from the underlying muscle layer and open the abdominal cavity using a cross shaped cut. 7. Cut the sternal plate and attached diaphram with scissors. 8. Clamp the xyphoid process of the sternum with a hemostat and fold the whole sternal plate over the right side of the animal to expose the thoracic cavity. 9. Displace the stomach, spleen and liver to the right. 10. Section the diaphram in a ventral/dorsal direction, making sure not to cut the diaphragmatic vessels. 11. Ligate the thoracic aorta 2-0 silk sutures both proximally, below the aortic arch and distally, above the diaphram. 12. The sutures are passed around the aorta after creating an opening with fine curved microdisection forceps, between the aorta and the vertebral column. 13. While the aorta is held by the distal suture, the aorta is excised from the posterior mediastinum and transferred to a compartmentalized felsen dish with each compartment containing 4 ml of Media 1. 14. Under a dissecting microscope remove loose fibroadipose tissue attached to the Aortas using sterile microdisection scissors, making sure not to stretch the vessel. 15. Under a dissecting microscope cut the aortas into ~lmm cross sections using a straight edge, sterile scalpula. A ruler can be placed under the petri dish for reference. Approximately 18-24 ring / aorta are obtained. 16. Wash the rings 12 times with Media 1, by transferring the rings to successive compartments of the compartmentalized felsen dishes each containing 4ml of Media 1 17. Transfer each ring to a well of a 96 well plate containing 150 μl Media 1. 18. Incubate plate at 37°C, 5% CO2 for 9 days changing the media every 2-3 days. This incubation period allows endogenous vessel formation and retraction to occur so that the vessels become quiescent.

DAY 4

Production and Quantification of Growth Factor from Infected Cells.

19. For each condition to be tested, plus 3 flasks for negative control media, plate out one T-25 flask of HUVEC cells at 7e5 cells per flask in 6 ml of EGM media.

DAY 5

20. When cells are 80-90% confluent, infect each plate with 2el0 vp of the adenovirus to be tested.

DAY 6

21. Wash each flask with PBS and add 6ml of fresh media 1 to each flask. DAY 9

22. Transferred media from each flask to separate 15 ml conical tubes and centrifuged at 220RCF for 5 minutes. 23. Transfer the supernatant to 15 ml conical tubes. And store media supernatant at 4°C. / 24. Perform ELISA upon each supernatant to determine the concentration of protein to be tested.

DAY 9

Preparation of Agarose Rings

25. Using 17 mm diameter punch, punch 9 circles in each agarose plate. 26. Using the 10mm diameter punch, punch a circle inside each of the previous circles. 27. Remove the Agarose from each well outside and inside the rings. 28. Transfer 20 rings into 5 x 10cm plates, 4 rings / plate. 29. Pat down rings on plates with spatula to make a tight connection between the plate and the ring.

COLLAGEN PREPARATION

30. Prepare collagen on ice in a 50 ml conical tube, by combining one volume 10X MEM, one volume 23.4 mg /ml Sodium Bicarbonate and 8 volumes of 1.3 mg /ml Dialysed BD collagen.

31. Coat the bottom inside of each agarose ring with 200μl of collagen.

32. Let collagen gel for at least 30 minutes in 37°C incubator. EMBED RINGS IN COLLAGEN

33. Place 2 of the aortic rings on the lip of the collagen coated agarose rings.

34. Transfer 300μl of collagen to the inside of the 2 agarose rings and tap the aortic rings into the collagen.

35. If needed with tweezers tip the agarose rings on their side in the collagen.

36. Repeat previous steps till all of the rings are embedded in collagen.

37. Allow the collagen coated rings to gel for 45 minutes at 37°C, 5%CO2.

38. After the collagen has gelled, The Agarose is removed from the collagen using a scalpel blade and bent spatula.

39. Remove the Agarose from the plate and add 10 ml of Media 1 to each plate.

40. Using a bent spatula, tiansfer each collagen gel to a separate 18mm well containing 0.5 ml of Media l.

41. Incubate plates at 37°C, 5% CO2. Addition of Growth Factor

42. Make up dilutions of each supernatant in Media 1 to desired concentiations based on the ELISA results. Make 2ml of each dilution so that each condition can be tested in quadruplicate.

43. As a positive control make up 2ml of recombinant VEGF 165 at 10 ng / ml in Media l.

44. Pipetted off media from each well containing the aortic rings.

45. Added 0.5ml per well of each condition in quadruplicate to each collagen embedded ring. 46. Incubated Rings at 37°C, 5% CO2 and stored unused infected media containing growth factor at 4°C.

DAY 12

47. Replace the media on each collagen embedded ring by repeating steps 31-35. DAY 14

48. Count the vessel number per ring under the microscope and take the average for each condition tested

E. Whole Animal Analysis Systems

1) Relative to Cardiovascular Disease

Porcine Models of Pacing Induced Congestive Heart Failure (CHF) and Ameroid Constrictor Induced Myocardial Ischemia (MI)

Preparation of Animal Model of Pacing Induced CHF [0233] Yorkshire pigs (Sus scrofa) weighing 40±6 kg are anesthetized with ketamine (50 mg/kg IM) and atropine sulfate (0J mg/kg IM) followed by sodium amytal (100 mg/kg IV). After endotiacheal intubation, halothane (0.5% to 1.5%) is delivered by a pressure-cycled ventilator throughout the procedure. At left thoracotomy, catheters are placed in the aorta, pulmonary artery, and left atrium. A Konigsberg micromanometer is placed into the left ventricular' apex, and an epicardial unipolar lead is placed 1.0 cm below the atrio ventricular groove in the lateral wall of the left ventricle. The power generator (Spectiax 5985; Medtronic, Inc.) is inserted into a subcutaneous pocket in the abdomen. A subset of animals are instrumented with a flow probe (Transonic, Inc.) around the main pulmonary artery. The pericardium is loosely approximated and the chest closed. Seven to 10 days after thoracotomy, baseline measures of hemodynamics, left ventricular function, and myocardial blood flow are made. Ventricular pacing is then initiated (220±9 bpm (beats per minute) for example, using a stimulus amplitude is 2.5 V and pulse duration 0.5 ms. Preferably, pigs are paced for about seven (7) days at which time the pacemaker is inactivated for approximately 8 to 12 hours and transcriptional polynucleotides to be tested are administered. Preparation of Animal Model of Ameroid Constrictor Induced MI [0234] Advantageously, this porcine model of myocardial ischemia mimics clinical coronary artery disease in humans. Placement of an ameroid constrictor around the left circumflex (LCx) coronary artery results in gradual complete closure (within 7 days of placement) with minimal infarction (1 % of the left ventricle, 4.+-Λ% of the LCx bed) (Roth, et al. Circulation 82:1778, 1990, Roth, et al. Am JPhysiol 235 :H 1279, 1987, White, et al. Circ Res 71:1490, 1992, Hammond, et al. Cardiol 23:475, 1994, and Hammond, et al JClin Invest 92:2644, 1993). Myocardial function and blood flow are normal at rest in the region previously perfused by the occluded artery (referred to as the ischemic region), due to collateral vessel development, but blood flow reserve is insufficient to prevent ischemia when myocardial oxygen demands increase. Thus, the LCx bed is subject to episodic ischemia, analogous to clinical angina pectoris. Collateral vessel development and flow-function relationships are stable within 21 days of ameroid placement, and remain unchanged for four months (Roth, et al. Circulation 82:1778, 1990, Roth, et al. Am JPhysiol 235:H1279, 1987, White, et al. Circ Res 71:1490, 1992). [0235] Briefly, a left thoracotomy is performed on domestic pigs (30-40 kg) under sterile conditions for instrumentation. Catheters are placed in the left atrium and aorta, providing a means to measure regional blood flow, and to monitor pressures. Wires are sutured on the left atrium to permit ECG recording and atrial pacing. An ameroid is placed around the proximal left circumflex artery (LCx), the chest closed and the animal allowed to recover. The ameroid material is hygroscopic and slowly swells, leading gradually to complete closure of the artery 7-10 days after placement, with minimal infarction (<1% of the left ventricle). Approximately 35 ± 3 days after ameroid placement, when a stable degree of ischemia has developed, the tianscriptional polynucleotides to be tested are administered, preferably via intiacoronary injection.

Administration of Transcriptional Polynucleotides [0236] While various embodiments of the expression libraries comprising tianscriptional polynucleotides as described herein may be employed in this animal model, adenoviral expression libraries are preferred. Similarly, while different methods of administering the transcriptional polynucleotides of the expression libraries to the hearts of pigs are known, intiacoronary delivery is presently preferred. Thus, in preferred embodiments, animals are anesthetized, and arterial access acquired via the right carotid artery by cut-down and a 5F Cordis sheath is placed. A 5F Multipurpose (A2) coronary catheter is used to engage the coronary arteries. In the case of the ameroid pig, closure of the LCx ameroid is confirmed by contrast injection into the left main coronary artery. The catheter tip is then placed 1 cm within the arterial lumen so that minimal material will be lost to the proximal aorta during injection. Injection of the transcriptional polynucleotide to be tested (for example 4.0 ml recombinant adenovirus solution containing about 10¹¹ viral particles) is made by slowly injecting 2.0 ml into each of the left and right coronary arteries. [0237] In both models, initial studies are preferably preformed 14 ± 1 days after administiation of the transcriptional polynucleotide, with baseline measurements, where necessary and/or desirable, taken about 1 day prior to administiation thereof. Studies may and frequently will also be repeated at later dates post administiation of tianscriptional polynucleotide.

Terminal Surgeries

(a) Termination without Fixing Heart [0238] When ready to terminate, animals are anesthetized and inrubated, and midline sternotomies are made. The still-beating hearts are submerged in saline (4°C), the coronary arteries rapidly perfused with saline (4°C), the right ventricle and left ventricle (including IVS) are weighed and tiansmural samples from each region of the heart are rapidly frozen in liquid nitrogen and stored at a temperature of -70°C.

(b) Termination with Fixation of Heart [0239] Alternatively, the heart of the pig may be perfusion-fixed at the time of sacrifice, for example, to permit quantitation of capillary growth by microscopy. In this method, animals are anesthetized and midline thoracotomy performed. The brachycephalic artery is isolated, a cannula inserted, and other great vessels ligated. The animals receive intravenous heparin (10,000 IU) and papaverine (60 mg). Potassium chloride is given to induce diastolic cardiac arrest, and the aorta cross-clamped. Saline is delivered through the brachycephalic artery cannula (120 mmHg pressure), thereby perfusing the coronary arteries. Glutaraldehyde solution (6.25%, 0J M cacodylate buffer) is perfused (120 mmHg pressure) until the heart is well fixed (10-15 min). The heart is then removed and the beds identified using color-coded dyes injected anterograde through the left anterior descending (LAD), left circumflex (LCx), and right coronary arteries. Samples are taken from various regions of the heart, for example perfused and ischemic, preferably divided into thirds and at least the endocardial and epicardial thirds plastic-imbedded.

Illustrative Studies Using the Animal Models [0240] The following studies are illustrative of those that may be performed using the present porcine CHF and MI models to generate biological readouts concerning the effects of the expression products of the transcriptional polynucleotides delivered to the animal, in vivo, in accordance herewith. It will be readily appreciated by those of skill in the art that various tests and measurements may be employed to obtain biological readout data form this model. By way of example, physiological data related to heart function, cardiac blood flow and the like are instructive in this regard. Thus, the following should be considered illustrative only and by no means exclusive.

(i) Hemodynamic Studies [0241] Hemodynamic data are obtained from conscious, unsedated animals. In the case of pacing induced CHF pigs, data are obtained after the pacemaker has been inactivated for at least 1 hour and animals are in a basal state. Data are preferably obtained in each animal at 7-day intervals. Pressures are obtained from the left atrium, pulmonary artery, and aorta. Left ventricular dP/dt is obtained from the high-fidelity left ventricular pressure. Pulmonary artery flow is recorded, and aortic and pulmonary blood samples are obtained for calculation of arteriovenous oxygen content difference.

(ii) Echocardio graphic Studies [0242] Echocardiography is a method of measuring regional myocardial blood flow which involves injection of a contrast material into the individual or animal. Contrast material (microaggregates of galactose) increase the echogenicity ("whiteness") of the image after left atrial injection. The microaggregates distribute into the coronary arteries and myocardial walls in a manner that is proportional to blood flow (Skyba, et al, Circulation, 90:1513-1521, 1994). The peak intensity of contrast enhancement is correlated with myocardial blood flow as measured by microspheres (Skyba, et al, Circulation, 90:1513-1521, 1994). [0243] Conscious animals are suspended in a sling and pressures from the LV, LA and aorta, and electrocardiogram are recorded in digital format on-line (at rest and during atrial pacing at 200 bpm). These studies may be performed using the contrast material (Levovist) which is injected into the left atrium during atrial pacing (200 bpm). Two-dimensional and M- mode images are obtained with a Hewlett Packard Sonos 1500 imaging system. Images are obtained from a right parastemal approach at the mid-papillary muscle level and recorded on VHS tape. Measurements are made according to criteria of the American Society of Echocardiography (Sahn, DJ, et al, Circulation. 58:1072-1083 (1978)). Because of the midline orientation of the porcine interventricular septum (IVS) and use of the right parastemal view, short-axis M-mode measures are preferably made through the IVS and the anatomic lateral wall. All parameters, including end-diastolic dimension (EDD), end-systolic dimension (ESD), and wall thickness, are measured on at least five' random end-expiratory beats and averaged. End-diastolic dimension is obtained at the onset of the QRS complex. End-systolic dimension is taken at the instant of maximum lateral position of the IVS or at the end of the T wave. Left ventricular systolic function is assessed by use of fractional shortening, FS=[(EDD-ESD)/EDD]xl00. Percent wall thickening (%WTh) is calculated as %WTh=[(ESWTh-EDWTh)/EDWTh]xl00. To demonstrate reproducibility of baseline echocardiographic measurements, animals may be imaged on 2 consecutive days before the pacing protocol is initiated. Experience has shown that the data from separate determinations are highly reproducible (e.g., fractional shortening, R²=.94, R=.006; lateral wall thickening, R²=.90, R=.005). Peak contrast intensity is measured from the video images using a computer- based video analysis program (Color Vue II, Nova Microsonics, Indianapolis, Indiana), that provide an objective measure of video intensity. All of these measurements are obtained with pacemakers inactivated.

(iii) Myocardial Blood Flow [0244] Myocardial blood flow can be determined by the radioactive microsphere technique as described in detail in Roth, DM, et al, Am. J. Physiol 253:H1279-H1288, (1987); and Roth, DM, et al, Circulation 82:1778-1789, (1990). Transmural samples from the left ventricular lateral wall and IVS are divided into endocardial, midwall, and epicardial thirds, and blood flow to each third and transmural flow are determined. Transmural sections are taken from regions in which echocardiographic measures have been made so that blood flow and functional measurements corresponded within each bed. In the case of the pacing induced CHF model, microspheres are injected in the control state (unpaced), at the initiation of ventricular pacing (225 bpm), and then at 7-day intervals during ventricular pacing at 225 bpm; microspheres are also injected with the pacemakers inactivated at 14 days (n=4) and 21 to 28 days (n=3). In the ameroid MI model, echocardiographic measurements were made using standardized criteria (see, e.g., Sahn, et al. Circulation 58:1072, (1978). Myocardial blood flow per beat is calculated by dividing myocardial blood flow by the heart rate (recorded during microsphere injection) (Indolfi, C, et al, Circulation 80:933-993 (1989)). Mean left atrial and mean arterial pressures are recorded during microsphere injection so that an estimate of coronary vascular resistance can be calculated; coronary vascular resistance index equals mean arterial pressure minus mean left atrial pressure divided by transmural coronary blood flow.

(iv) Systolic Wall Stress [0245] Additional end-systolic wall stress (Riechek, N., et al, Circulation 65:99-108 (1982)) can be calculated using the equation meridional end-systolic wall stress (dynes) = (0.334xPxD)÷[h(I-h/D)], where P is left ventricular end-systolic pressure in dynes, D is left ventricular end-systolic diameter in cm, and h is end-systolic wall thickness. In the pacing induced CHF model, meridional end-systolic wall stress is preferably calculated for both lateral wall and IVS before the initiation of pacing and subsequently at weekly intervals (pacemaker off).

(v) Adenine Nucleotides - Post Mortem [0246] ATP and ADP are measured in transmural samples of the IVS and lateral wall. Samples taken from the experimental animals are preferably obtained with the pacemalcers off (60 minutes) on the day the animals are killed. ATP and ADP are measured in a Waters high- performance liquid chromatograph as previously described (Pilz, R.B., et al, J. Biol. Chem. 259:2927-2935 (1984)).

(vi) Microscopic Analysis of Fixed Heart Tissue - Post Mortem [0247] Plastic-imbedded, perfusion-fixed samples may be analyzed microscopically to quantitate capillary number as previously described (Mathieu-Costello, et al. Am JPhysiol 369:H204, 1990). Four 1 μm thick transverse sections are taken from each subsample (endocardium and epicardium of each region) and pointcounting is used to determine a capillary number per fiber number ratio at 400X magnification. Preferably, twenty to twenty- five high power fields are counted per subsample. Where the capillary number to fiber number ratios within each region are similar in endocardium and epicardium, the 40-50 field per region can be averaged to provide a transmural capillary to fiber number ratio.

(vii) Confirmation of Transcriptional Polynucleotide Transfer and Expression - Post Mortem [0248] Standard PCR and RT-PCR techniques may be employed to confirm the presence of transcriptional polynucleotides in tissue samples. Alternatively or additionally, where the transcriptional polynucleotide includes an epitope tag, tissue sample may be probed with an antibody specific for that epitope tag using standard techniques and thereby confirming expression of the transcriptional polynucleotide.

Cross-reference [0249] These porcine models of congestive heart failure and myocardial ischemia, including illustrative uses thereof, are described in detail in U.S. Patent No. 5,792,453,. issued August 11, 1998; PCT application number WO 96/26742, published September 6, 1996; and PCT application number WO 98/50079, published November 12, 1998 the disclosures of each of which are hereby incorporated in their entirety.

2) Relative to the Central Nervous System

Murine Model of MPTP Induced Neurode generation [0250] Significant insights into the mechanisms by which dopaminergic neurons may die in Parkinson's Disease have been achieved by the use of the neurotoxin l-methyl-4-phenyl- 1,2,3,6-tetiahydropyridine (MPTP), which replicates in humans and nonhuman primates a severe and irreversible PD-like syndrome. In several mammalian species, MPTP reproduces most of the biochemical and pathological hallmarks of PD, including the dramatic neurodegeneration of the nigrostiiatal dopaminergic pathway. The following animal model then is particularly instructive with regard to this neurodegenerative disease.

Preparation of Animal Model/Administration of Transcriptional Polynucleotides [0251] 8-week-old male C57BL/6 mice for example, from Charles River Laboratories (Wilmington, MA), are used for this assay. For MPTP intoxication, mice receive four intraperitoneal (IP) injections of MPTP-HC1 (18 or 16 mg/kg of free base; Sigma, St. Louis, MO) in saline at 1 to 2 hr intervals. Control mice receive saline only. Mice are then treated with transcriptional polynucleotides of the expression libraries using standard techniques, for example via intravenous, intiaperitoneal or intiacranial injection or by use of an osmotic pump. The brains of the mice are then harvested and used for morphological and biochemical analyses.

Illustrative Processing and Analysis of Brain [0252] At the time of sacrifice, the mouse brains are fixed and processed for immunostaining, for example as described previously (Liberatore et al, 1999). Primary antibodies that can be used in this study are as follows: mouse anti-GFAP (1 : 1000; Boehringer Mannheim, Indianapolis, IN), and a rabbit polyclonal anti-tyrosine hydroxylase (TH) (1:1000; Calbiochem, San Diego, CA). Immunostaining is visualized by using either 3,3'- diaminobenzine (brown) or SG substrate kit (gray blue; Vector Laboratories, Burlingame, CA). Sections are counterstained with thionin. The total number of TH-positive SNpc neurons is counted in the various groups of animals at various time points after the last MPTP or saline injection using the optical fractionator method as described previously (Liberatore et al, 1999). This is an unbiased method of cell counting that is not affected by either the volume of reference (SNpc) or the size of the counted elements (neurons). Stiiatal density of TH immunoreactivity is determined as described previously (Burke et al, 1990). [0253] Further details and examples relevant to this model and use thereof are described in detail in the following references each of which is hereby incorporated in its entirety: Burke et al, J. Neurosci. Methods 35:63-73 (1990); Liberatore et al, Nature Med. 5:1403-1409 (1999); Przedborski et al, Restor. Neurol NeurosciΛ6:l35-U2 (2000); and Wu et al, J. Neurosci. 22:1763-1771 (2002).

3) Relative to Cancer

In vivo Tumorigenicity Assays [0254] In order to assess the tumorigenicity of transcriptional polynucleotides of the present invention, growth of tumorigenic cells can be studied in severe combined immunodeficiency (SCID) mice. Briefly, cells are transfected ex vivo then introduced into the SCID mouse and the mouse observed for development of tumors. Preparation of Animal Model/ Administration of Transcriptional Polynucleotides [0255] Various cell lines are available for use in tumorgenicity assays such as this. By way of example, Phoenix 293T, Ampho, DLD-1, HCT-116 (ATCC, Manassas, VA) can be used. Cells are transfected with transcriptional polynucleotides of the present expression libraries using standard techniques. Transfected cells (approx. 2x10⁵) are then injected subcutaneously into the lower abdomen of 5-week old male SCID mice (n=4/cell line). Mice are examined every two days and tumor length and width are measured using calipers. Tumor volume is calculated using the following formula: (length x width )π/6. At approximately 22 days, mice are euthanized, for example, by CO₂ asphyxiation and tumors are excised. Portions of tumors are snap-frozen and stored in liquid nitrogen or fixed in 10% buffered formalin for routine histopathological processing.

Illustrative Post Mortem Assays [0256] Tumor tissue may be embedded in paraffin using standard techniques. The paraffin-embedded tissues are then sectioned and immunostained for various markers of oncogenicity such as phosphorylated MAP Kinase (pMAPK) or phosphorylated Protein Kinase B (pPKB) using specific antibodies. TUNEL staining is also performed and apoptotic index is scored by counting the number of positive-staining cells per 10 high power fields for each tumor sample. [0257] Details of this model and illustrative uses thereof are described, for example, in the following references, each of which is hereby incorporated by reference in its entirety: Koch & Shows, Proc. Natl. Acad. Sci. USA 77:4211-4215 (1980); and Long et al, Mol. Cancer Res. 1:393-401 (2003).

Claims

What is claimed is: 1. A method for high throughput construction and analysis of tianscriptional polynucleotides comprising: (a) providing an array of (n) sample sites having a single predominant transcriptional polynucleotide per sample site; (b) associating the tianscriptional polynucleotides of each sample site with a tianscription promoting element and tianscription termination mediating element to form a tianscription cassette; (c) associating the tianscription cassette with a delivery biomolecule; (d) delivering the transcription cassettes to a high-throughput functional assay; (e) detecting readouts from the functional assay for the tianscription cassettes; and (f) identifying those transcriptional polynucleotides exhibiting a desired readout in the functional assay, wherein (n) is an integer equal to or greater than 6.

2. The method of claim 1 , wherein the step of providing an array of (n) samples sites having a single predominant transcriptional polynucleotide per sample site comprises: (a) providing an array of (n) sample sites; (b) dispensing aliquots of a cDNA library to each of (n) sample sites; (c) designing (n) sets of PCR primers, wherein each set is specific to an individual cDNA sequence of the library; (d) introducing a different set of PCR primers to each of (n) sample sites; and (e) amplifying individual cDNA sequences at each sample site by PCR.

3. The method of claim 2, wherein the step of designing (n) sets of PCR primers, wherein each set is specific to an individual cDNA sequence of the library further comprises designing said (n) sets of PCR primers to incorporate a first restriction endonuclease recognition site (REl) at one end of the individual cDNA sequence and a second restriction endonuclease recognition site (RE2) at the other end of the individual cDNA sequence, wherein REl an RE2 are different from one another and each comprise at least eight nucleotides.

4. The method of claim 3, wherein REl and RE2 are independently selected from the group of restriction endonuclease recognition sites of FIG. 1.

5. The method of claim 3, wherein the step of associating the transcriptional polynucleotides of each sample site with a transcription promoting element and transcription termination mediating element to form a transcription cassette comprises (a) providing a transcription promoting element (TPE) comprising a first restriction endonuclease recognition site (REl) at its 3' end; (b) providing a tianscription termination mediating element (TTM) comprising a second restriction endonuclease recognition site (RE2) at its 5' end; (c) contacting the TPE with a restriction endonuclease recognizing REl , the transcriptional polynucleotide (TP) with restriction endonucleases recognizing REl and RE2 . and the TTM with a restriction endonuclease recognizing RE2, such that said TPE, TP and TTM are cleaved; and (d) mixing the TPE, TP and TTM under ligation conditions such that a transcription cassette of the type TPE-(RE1)-TP-(RE2)-TTM is formed.

6. The method according to claim 3, wherein the step of associating the transcription cassette with a delivery biomolecule comprises associating the tianscription cassette with a viral vector.

7. The method of claim 6, wherein the viral vector is an adenoviral vector.

8. The method of claim 7, wherein the adenoviral vector is a replication-defective viral vector.

9. The method of claim 8, wherein the replication-defective viral vector comprises a transcription promoting element (TPE) linked to a multiple-cloning site (MCS) comprising an REl site and RE2 site, which MCS is linked to a tianscription termination mediating element (TTM).

10. The method of claim 9, wherein the wherein the step of associating the tianscription cassette with the replication-defective adenoviral vector comprises digesting each of said adenoviral vector and tianscriptional polynucleotide with restriction endonucleases recognizing REl and RE2 and ligating the transcriptional polynucleotide to the replication- defective adenoviral vector to form a tianscription cassette within said vector.

11. The method of claim 9 further comprising delivering said replication-defective adenoviral vector comprising said tianscription cassette into a complementing cell line to produce recombinant replication-defective adenovirus comprising said tianscription cassette.

12. The method according to any of the preceding claims wherein (n) is an integer equal to or greater than 12.

13. The method of claim 12 wherein (n) is an integer equal to or greater than 48.

14. The method of claim 13 wherein (n) is an integer equal to or greater than 96.

15. A method for the rapid production of a tianscription cassette comprising: (a) providing a transcription promoting element (TPE) comprising a first restriction endonuclease site (REl); (b) providing a transcriptional polynucleotide (TP) comprising a first restriction endonuclease site (REl) at one end and a second restriction endonuclease site (RE2) at the other end; (c) providing a tianscription termination mediating element (TTM) comprising a second restriction endonuclease site (RE2), wherein said first and second restriction endonuclease sites are different from one another and each comprise a recognition sequence comprising at least 8 specific nucleotide residues; (d) contacting said TPE with a restriction endonuclease recognizing REl , said TP with restriction endonucleases recognizing REl and RE2, and said TTM with a restriction endonuclease recognizing RE2, such that said TPE, TP and TTM are cleaved; and (e) mixing said cleaved TPE, TP and TTM under ligation conditions such that said TPE is linked to said TP via said first restriction endonuclease site (REl) and said TTM is linked to said TP via said second restriction endonuclease site(RE2).

16. The method of claim 15 wherein said method is performed in an array of (n) sample sites, wherein n is an integer equal to or greater than six and wherein a single predominant transcriptional polynucleotide is provided to each sample site.

17. The method of claim 16 wherein (n) is an integer equal to or greater than twelve.

18. The method of claim 17 wherein (n) is an integer equal to or greater than forty- eight.

19. The method of claim 18 wherein (n) is an integer equal to or greater than ninety-six.

20. The method of claim 19 wherein (n) is an integer greater than ninety-six.

21. The method of claim 15, wherein said TPE and said TTM are linked on a plasmid.

22. A method for the rapid production of a tianscription cassette comprising: mixing: (a) a transcription promoting element (TPE) comprising a cleaved first restriction endonuclease site at the 3 ' end, (b) a transcription termination mediating element (TTM) comprising a cleaved second restriction endonuclease site at the 5' end, (c) a tianscriptional polynucleotide (TP) wherein the 5' end is the cleaved first restriction endonuclease site and the 3' end is the cleaved second restriction endonuclease site, wherein said first and second restriction endonuclease sites are different from one another and each comprise a recognition sequence comprising at least 8 specific nucleotide residues, and wherein said mixing is under ligation conditions such that said TPE is linked to said TP via said first restriction endonuclease site and said TTM is linked to said TP via said second restriction endonuclease site

23. The method of claim 22 wherein said mixing is performed in an array of sample sites and each sample site contains a different tianscriptional polynucleotide.

24. The method of claim 23, wherein said TPE and said TTM are linked on a plasmid.

25. A method for the rapid production of an adenoviral vector comprising a transcription cassette comprising: mixing: (a) a left arm of an adenoviral vector linked to a transcription promoting element (TPE), said TPE comprising a cleaved first restriction endonuclease site (REl) at the 3' end, (b) a right arm of an adenoviral vector linked to a tianscription termination mediating element (TTM), said TTM comprising a cleaved second restriction endonuclease site (RE2) at the 5' end, (c) a transcriptional polynucleotide (TP) comprising a cleaved REl site at the 5' end and a cleaved second restriction endonuclease site at the 3' end, wherein said first and second restriction endonuclease sites are different from one another and each comprise a recognition sequence comprising at least 8 specific nucleotide residues; and wherein said mixing is under ligation conditions such that said TPE is linked to said TP via said first restriction endonuclease site and said TTM is linked to said TP via said second restriction endonuclease site.

26. The method of claim 25 wherein said mixing is performed in an array of sample sites and each sample site contains a different predominant transcriptional polynucleotide.

27. A method of amplifying a recombinant vector library within an array of sample sites, wherein the recombinant vectors at each sample site comprise a transcription cassette comprising a single tianscriptional polynucleotide, the method comprising: (a) providing an array of sample sites, each site containing a population of cells, and (b) transfecting into at least one cell of each of said populations of cells at each of said sample sites, a recombinant vector comprising a transcription cassette according to claim 44, under conditions such that said recombinant vector library is amplified, wherein the vector contains an origin of replication active in the populations of cells.

28. A method of producing a recombinant adenovirus library within an array of sample sites, wherein each sample site comprises distinct recombinant adenoviral vectors, each distinct vector containing a unique tianscriptional polynucleotide, the method comprising: (a) providing a plurality of populations of cells within an array of sample sites, each population of cells containing at least one cell comprising adenoviral polynucleotide sequences comprising adenoviral E-l -complementing sequences, and (b) transfecting into said at least one cell of each said population of cells an adenoviral vector comprising a replication-defective adenoviral genome and a unique transcription cassette according to claim 44, under conditions such that said recombinant adenoviral vector library is produced.

29. The method of claim 28, wherein said replication-defective adenoviral genome comprised within said adenoviral vector has a deletion within the El region.

30. The method of claim 29, wherein said unique transcription cassette comprised within said adenoviral vector is located in the region of said El deletion.

31. A method for assaying for at least one function of a transcriptional polynucleotide present in a recombinant adenovirus of any one of claims 59-61, the method comprising: (a) transducing a multiplicity of cells with at least one recombinant adenovirus comprising said tianscriptional polynucleotide; (b) culturing said multiplicity of cells while allowing for transcription of said tianscriptional polynucleotide; (c) subjecting said multiplicity of cells to a functional assay; and (d) determining a biological readout of the functional assay for said multiplicity of cells.

32. A method for assaying for a transcriptional polynucleotide with a desired biological activity, the method comprising: (a) providing a plurality of populations of cells; (b) contacting each population with a different tianscription cassette comprising a transcriptional polynucleotide according to claim 44, wherein the transcription cassette is associated with a delivery biomolecule; (c) culturing said populations while allowing for transcription of said transcriptional polynucleotide; (d) subjecting said populations to an assay correlated with a desired biological activity; (e) determining a readout of the assay for said populations; and (f) selecting the tianscriptional polynucleotide with a desired biological activity based on the readout form the population of cells containing the transcriptional polynucleotide.

33. The method according to claim 32, wherein the delivery biomolecule is an adenoviral vector.

34. The method according to claim 32, wherein the delivery biomolecule is a lipid- based vector.

35. The method according to claim 32, wherein the plurality of populations of cells are in an array of sample sites in a multi-well plate.

36. The method according to claim 32, wherein the cells are also assayed for the expression of the transcriptional polynucleotide.

37. The method of according to claim 36, further correlating the biological readout with the expression of the transcriptional polynucleotide.

38. A method for determining the level of a biological activity of a transcriptional polynucleotide in a cell, the method comprising: (a) contacting at least one cell of a multiplicity of cells with at least one tianscription cassette comprising a transcriptional polynucleotide according to claim 44, wherein said transcription cassette is associated with a vector; (b) culturing said multiplicity of cells while allowing for transcription of said tianscriptional polynucleotide; (c) subjecting said multiplicity of cells to an assay; (d) determining a biological readout of the assay; and (e) correlating the biological readout of the assay with the level of biological activity of said transcriptional polynucleotide in said cells.

39. The method according to claim 38, wherein the vector is an adenoviral vector.

40. The method according to claim 38, wherein the vector is a lipid-based vector.

41. The method according to claim 38, wherein the plurality of populations of cells are in an array of sample sites in a multiwell plate.

42. _ The method according to claim 38, wherein the cells are also assayed for the expression of the tianscriptional polynucleotide.

43. The method of according to claim 42, further correlating the biological readout with the expression of the transcriptional polynucleotide.

44. A tianscription cassette comprising: (a) a heterologous tianscription promoting element (TPE); (b) a first linking region (LRl), comprising a first restriction endonuclease (REl) recognition site; (c) a transcriptional polynucleotide (TP); (d) a second linking region (LR2), comprising a second restriction endonuclease (RE2) recognition site; and

(e) a transcription termination mediating element (TTM), wherein said first (REl) and second (RE2) restriction endonuclease recognition sites are different from one another and each comprise a recognition sequence comprising at least eight specific nucleotide residues.

45. The tianscription cassette according to claim 44 wherein said first and second restriction endonuclease recognition sites are selected such that one recognition site is a 3' overhanging end and the other recognition site is a 5' overhanging end.

46. The tianscription cassette according to claim 44 or claim 45 wherein one of the restriction endonuclease recognition sites is an adenine and thymine rich site and the other of the restriction endonuclease recognition sites is a guanine and cytosine rich site.

47. The transcription cassette according to claim 44 wherein said transcription promoting element comprises a promoter sequence selected from the group consisting of CMV, eCMV, PGK, hsp70, MLC-2v, α-MHC, CARP, Nkx2.5, ANF and sodium calciumexchange promoter.

48. The tianscription cassette according to claim 44 wherein said first restriction endonuclease recognition site is selected from the group consisting of I-Ceul, PI-PspI and I- Scel and said second restriction endonuclease recognition site is selected from the group consisting of Not I, Ascl and Pl-Scel.

49. The tianscription cassette according to claim 44, wherein said transcription promoting element comprises an enhanced CMV (eCMV) promoter sequence.

50. The transcription cassette according to claim 44 wherein said transcription promoting element comprises an enhancer sequence.

51. The tianscription cassette according to claim 44 wherein said tianscription termination mediating element comprises a polyadenylation sequence.

52. The transcription cassette according to claim 44 wherein arrangement of the cassette is 5' -TPE-LRl -TP-LR2-TTM-3'.

53. The transcription cassette according to claim 44 wherein arrangement of the cassette is 5'-TTM-LRl-TP-LR2-TPE-3'.

54. The tianscription cassette according to claim 44, further comprising a polynucleotide sequence encoding an epitope tag (ET).

55. The transcription cassette according to claim 54 wherein arrangement of the cassette is 5'-TPE-LRl-TP-ET-LR2-TTM-3'.

56. The tianscription cassette according to claim 54 wherein arrangement of the cassette is 5' -TPE-LRl -TP-LR2-ET-TTM-3'.

57. A viral vector comprising the tianscription cassette of claim 44.

58. The viral vector according to claim 57, wherein said viral vector is a replication- defective viral vector.

59. The viral vector according to claim 58, wherein said viral vector is an adenoviral vector.

60. The viral vector according to claim 59, wherein said transcription cassette is located in the El region of said adenoviral vector.

61. The viral vector of claim 60, wherein the tianscription cassette is linked to a left arm of an adenovirus genome (LAAd) and a right arm of an adenovirus genome (RAAd) and the arrangement of the adenoviral vector is 5'-LAAd-TPE-LRl-TP-LR2-TTM-RAAd-3'.

62. A plasmid vector comprising a replication-defective adenoviral genome, wherein said replication-defective adenoviral genome comprises a tianscription cassette comprising a transcription promoting element (TPE) linked via a multiple-cloning site (MCS) to a transcription termination mediating element (TTM), wherein said MCS comprises a first linking region (LRl) comprising a first restriction endonuclease site (REl) and a second linking region (LR2) comprising a second restriction endonuclease site (RE2) and wherein REl and RE2 are different from one another and each comprise at least eight nucleotides.

63. A plasmid vector comprising the transcription cassette of claim 44.

64. A polynucleotide comprising: (a) a heterologous transcription promoting element (TPE); (b) a multiple cloning site (MCS) comprising a first restriction endonuclease recognition site and a second restriction endonuclease recognition site; and (c) a transcription termination mediating element (TTM), wherein said first and second restriction endonuclease recognition sites are different from one another and each comprise a recognition sequence comprising at least 8 specific nucleotide residues.

65. The polynucleotide according to claim 64, wherein the MCS further comprises at least one additional restriction endonuclease recognition site, wherein the at least one additional restriction endonuclease recognition site is different from said first and second restriction endonuclease recognition sites and the at least one additional restriction endonuclease recognition site comprises a recognition sequence of at least 8 nucleotide residues.

66. The polynucleotide according to claim 64, further comprising a polynucleotide sequence encoding an epitope tag (ET).

67. The polynucleotide according to claim 66, wherein arrangement of the polynucleotide is 5'-TPE-MCS-ET-TTM-3'.

68. The polynucleotide of claim 64, wherein the polynucleotide is in a plasmid vector.

69. The polynucleotide of claim 64, wherein the polynucleotide is in a viral vector.

70. The polynucleotide of claim 69, wherein the viral vector is an adenoviral vector.

71. A recombinant polynucleotide comprising: (a) a left arm of an adenovirus genome vector (LAAd); (b) a transcription promoting element (TPE); (c) a linking region (LR), comprising at least a first restriction endonuclease recognition site comprising at least 8 specific nucleotide residues, wherein the polynucleotide is arranged 5'-LAAd-TPE-LR-3'.

72. A recombinant polynucleotide comprising: (a) a right arm of an adenovirus genome vector (RAAd); (b) a transcription promoting element (TPE); and (c) a linking region, comprising at least a first restriction endonuclease recognition site comprising at least 8 specific nucleotide residues, wherein the polynucleotide is arranged 5'-LR-TPE-RAAd-3'.

73. A recombinant polynucleotide comprising: (a) a right arm of an adenovirus genome vector (RAAd); (b) a transcription termination mediating element (TTM); (c) a linking region (LR), comprising at least a first restriction endonuclease recognition site comprising at least 8 specific nucleotide residues, wherein the polynucleotide is arranged 5'-LR-TTM-RAAd-3'.

74. The polynucleotide of claim 73, further comprising a polynucleotide sequence encoding an epitope tag (ET), wherein the nucleotide is arranged 5'-LR-ET-TTM-RAAd-3'.

75. A recombinant polynucleotide comprising: (a) a left arm of an adenovirus genome vector (LAAd); (b) a transcription termination mediating element (TTM); (c) a linking region (LR), comprising at least a first restriction endonuclease recognition site comprising at least 8 specific nucleotide residues, wherein the polynucleotide is arranged 5'-LAAd-TTM-LR-3'.

76. The polynucleotide of claim 75, further comprising a polynucleotide sequence encoding an epitope tag (ET), wherein the polynucleotide is arranged 5'-LAAd-TTM-ET-LR-

3'.

77. The plasmid vector of claim 62 wherein the MCS comprises six different restriction endonuclease sites and wherein each restriction endonuclease site comprises at least eight nucleotides.

78. The plasmid vector of either of claims 62 or 77 wherein the TPE comprises an eCMV promoter and the TTM comprises a BGHpolyA sequence.

79. The plasmid vector of any of claims 62, 77 or 78 further comprising a transcriptional polynucleotide within the MCS.

80. The plasmid vector of any of claims 62 or 77-79, wherein said replication- defective adenoviral genome lacks El region sequences and wherein said tianscription cassette is located in the El region of said genome.