WO2005001127A1

WO2005001127A1 - P53 as an indicator of cancer risk in different ethnic groups

Info

Publication number: WO2005001127A1
Application number: PCT/SG2004/000189
Authority: WO
Inventors: Kanaga Sabapathy
Original assignee: Kanaga Sabapathy
Priority date: 2003-06-27
Filing date: 2004-06-25
Publication date: 2005-01-06
Also published as: AU2003903274A0

Abstract

The present application provides a method for the determination of the risk of a subject having or developing cancer or other condition associated with the expression of a particular polymorphism of the p53 allele, of its homolog or ortholog. The preferred polymorphisms are associated with codons 72 and 80. Furthermore, the present invention provides epidemiological data relating the presence of a particular expressed p53 allele to its association with cancers in different ethnic human groups including Caucasians, Chinese, Indians and Malaysians. The epidemiological data are based on skin color and/or latitude of the region of origin of the ethnic group. Kits comprising primers and/or probes or immunological reagents for the detection of particular expressed p53 alleles in biological samples are also provided. The present invention further provides vectors and both gene therapy and protein replacement methods for prophylactic or therapeutic treatment of cancers.

Description

METHOD OF ASSESSING CANCER RISK

BACKGROUND OF THE INVENTION

FIELD OF THE INVENTION

The present invention provides a method for the determination of the risk of a subject having or developing cancer or other condition associated with the expression of a particular polymorphism of the p53 allele of its homolog or ortholog. Furthermore, the present invention provides epidemiological data relating the presence of a particular expressed p53 allele to its association with cancers in different subject groups including Caucasian and different ethnic human groups. The epidemiological data provided by the present invention enables development of a method for the assessment of the risks of a subject including members of different Caucasian or ethnic groups developing cancer. This information is important for health planning purposes as well as risk management for employers and insurance companies. The epidemiological data are based on skin color and/or latitude of the region of origin of the ethnic group. Kits comprising primers and/or probes or immunological reagents for the detection of particular expressed p53 alleles in biological samples are also provided. The present invention further provides vectors and a gene therapy method for the replacement of one p53 allele with another for prophylactic or therapeutic treatment of cancers. Protein replacement therapy as well as other non-genetic therapies are also contemplated.

DESCRIPTION OF THE PRIOR ART

Bibliographic details of the publications referred to in this specification are also collected at the end ofthe description.

Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in any country. Mutations in the p53 gene are considered to represent the most common genetic alteration associated with human cancers. These mutations (mostly missense mutations) may disrupt the normal function of p53 as a transcription factor, and hence, the induction of DNA- repair or apoptosis may be abolished. Consequently, other genetic alterations may accumulate in the cell (Oren, Cell Death Differ. 10(4): 431-442, 2003). In breast cancer, the p53 gene is mutated in ~20-30% of the tumors, whereas in colorectal cancer, 50-60% of the tumors carry a mutant p53 gene (Hainaut and Hollstein, Adv. Cancer Res. 77: 81- 137, 2000). Most mutations are predominantly found in the DNA-binding domain (DBD) of p53 and mutations outside the DBD of p53 are relatively rare (Vousden and Lu, Nat. Rev. Cancer 2(8): 594-604, 2002). In cancers without a mutation in the p53 gene, the function of p53 is often compromised by over-expression of its negative regulator, Mdm2, or by cytoplasmic sequestration of p53 (Moll et al., Proc. Natl. Acad. Sci. USA 92(10): 4407-4411, 1995; Chene, Nαt. Rev. Cancer 3(2): 102-109, 2003).

In addition to gene mutations, several reports have focused on p53 genetic sequence and p53 polypeptide sequence polymorphisms as risk factors for malignant disease. Two of 14 known polymorphisms located in the p53 gene alter the amino acid (International Agency for Research on Cancer TP53 Mutation Database). The alleles of the polymorphism in codon 72, exon 4, encode an arginine amino acid (Arg) with a positive-charged basic side chain and a proline residue (Pro) with a non-polar-aliphatic side chain. The Arg/Pro polymorphism is located in a proline-rich region (residues 64-92) ofthe p53 protein, where the Pro72 amino acid constitutes one of five PXXP motifs resembling a SH3 binding domain. The region is required for the growth suppression and apoptosis mediated by p53 but not for cell cycle arrest (Walker and Levine, Proc. Natl. Acad. Sci. USA 93(26): 15335- 15340, 1996). The two polymorphic variants of wild-type p53 have been shown to have some different biochemical and biological properties such as differential binding to components ofthe transcriptional machinery, but they did not differ in their ability to bind DNA (Thomas et al, Mol. Cell Biol. 19: 1092-1100, 1999). Moreover, previous reports have also suggested that the Arg p53 variant is much more susceptible to degradation by the HPN E6 protein (Storey et al, Nature 393(6682): 229-234, 1998) and that mutant Pro p53 could suppress transformation by the EJ-ras oncogene more efficiently than the Arg polymorphic variant (Marin et al., Nat. Genet. 25: 47-54, 2000). In addition, recent analysis has shown that the Arg variant form is more efficient in inducing cell death than the Pro variant (Dumont et al, Nat. Genet. 33(3): 357-365, 2003).

Significant association between the polymorphism at codon 72 and the risk of cancer had been reported, although the results with regard to most cancer diseases, including breast, remain inconclusive (Sjalander et al, Carcinogenesis (Lond.) 17: 1313-1316, 1996; Weston and Godbold, Environ. Health Perspect. 105: 919-926, 1997; Papadakis et al, Mol. Cell. Biol. Res. Commun. 3: 389-392, 2000). Following the first report of an increased risk of cervical cancer in Arg72 homozygous individuals (Storey et al., 1998, supra), many studies have been published showing both a positive (Kawajiri et al, Carcinogenesis 14: 1085-1089; 1993; Jin et al, Carcinogenesis 16: 2205-2208, 1995; Murata et al., Carcinogenesis 17: 261-264, 1996; Sjalander et al, 1996, supra) and negative (Weston et al, Carcinogensis 15: 583-587, 1994; Rosenthal et al, Lancet 352: 871-872, 1998; Dunning et al, Cancer Epidemiol. Biomarkers Prev. 8(10): 843-854, 1999; Hainaut and Hollstein, 2000, supra; Suspitsin et al, Int. J. Cancer 103(3): 431-433, 2003) correlation between p53 polymorphic status and cancer occurrence. At present, the significance of the p53 codon 72 polymorphism remains controversial in terms of cancer epidemiology. Nonetheless, it is possible that the differences between various reports can reflect the populations that were analyzed, as there are inherent differences in the expression of this polymorphism in various populations (Beckman et al, Hum. Hered. 44(5): 266-270, 1994).

There appears to be a strong correlation between the p53 codon 72 polymorphism and ethnicity with the frequency of the arg allele being more predominant in populations who are further away from the Equator and who are of lighter skin color (Beckman et al, 1994, supra). Although the p53 codon 72 polymorphism may be a subject of natural selection by the level of sunlight exposure, the causal relationship between the p53 polymorphic status and distance away from Equator is at present not well understood.

Accordingly, in order to truly evaluate the contribution of a specific p53 allele to cancer risk in an individual or ethnic group, there is a need to examine the association of particular p53 alleles with cancer risk in experimental groups wherein racial and/or genetic heritage is taken into account.

Singapore, which is one degree North (1°N) ofthe Equator, is a multi-racial, city-state that consists predominantly of Chinese, Indian and Malay populations who have settled more than 200 yeas ago. The composition ofthe population is unique as far as ethnicity and skin color is concerned. The composition of the Singapore population, therefore, is ideal to under an examination ofthe p53 polymorphic status in the healthy Singaporean population, compared with cancer patients.

SUMMARY OF THE INVENTION

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other elements or integers.

Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond numerically to the sequence identifiers <400>1 (SEQ ID NO:l), <400>2 (SEQ ID NO:2), etc. A summary of the sequence identifiers is provided in Table 1. A sequence listing is provided after the claims.

The present invention provides a method for assessing the risk of a subject having or developing cancer on the basis of the expression of a particular polymorphism of the p53 allele by a subject. Furthermore, the present invention provides epidemiological data with respect to the frequency of the expression of a particular expressed ρ53 allele in various human Caucausian and ethnic groups. These data allow generalizations to be drawn as to the relative propensity for the development of cancers between human groups and enables an individual to be assessed as to the relative risk of developing cancer in their lifetime. This information is useful for medical planning, insurance companies and employers.

p53 is italicized herein when it refers to a genetic sequence. Non-italicized p53 is used for the p53 protein.

The present invention is exemplified with respect to three p53 alleles, the p53 arg allele, the p53 pro allele and the p53 ser allele, and their association with cancer. The p53 arg allele encodes a p53 polypeptide comprising an arginine residue at residue position number 72. The p53 pro allele encodes a p53 polypeptide comprising a proline residue at residue number position 72. The p53 ser allele is ia mutation (not a polymorphism) and encodes a p53 polypeptide comprising a serine residue at position 80. The amino acid sequence of ρ53 is set forth in SEQ ID NO:2. The present invention determines the status of the expressed p53 allele in healthy and cancer patients or cancer susceptible patients in order to evaluate the functional significance of the codon 72 polymorphism or codon 80 mutation in carcinogenesis. The present invention extends, however, to other codon polymorphisms or mutations such as at codon position numbers 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75, 76, 77, 78, 79, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392 or 393.

The present invention provides insights to the uniqueness of population-based expression of the p53 tumor suppressor gene and demonstrates a strong correlation between the expression of the p53 arg allele and the p53 ser allele and susceptibility to cancer development. Thus, it is demonstrated that p53 polymorphic or mutant status can be used as a predictive tool for evaluating predisposition to cancers. In addition, the status of expression of The p53 allele may also be used as a prognostic indicator ofthe disease. Accordingly, the present invention provides a method for assessing whether a subject has cancer or has a risk of developing cancer or other disease condition associated with p53 expression or its homolog or ortholog, said method comprising determining the presence or absence of a polymorphic variation in a genomic p53 polynucleotide sequence, ρ53 mRNA transcript sequence and/or p53 amino acid sequence in said subject wherein the presence of a polymorphic variation which is associated with a greater risk of cancer or susceptibility of cancer in a particular population is indicative of the subject having cancer or a predisposition for development of cancer.

In a preferred embodiment, cancer risk is evaluated by examining the proline rich region(s) of the p53 genetic sequence, p53 mRNA transcript sequence and/or p53 polypeptide amino acid sequence. A particularly preferred polymorphism includes the p53 arg allele. A particularly useful mutation is p53 ser allele.

Accordingly, the present invention contemplates that a subject has cancer or an increased risk of developing cancer when said subject comprises a mutation including a polymorphism in one or more amino acids within the proline-rich regions of the p53 polypeptide.

In a more preferred embodiment, cancer risk is evaluated by examining the p53 genomic polynucleotide sequence, p53 mRNA transcript sequence and/or the p53 polypeptide amino acid sequence at codon 72 or 80. The presence of an arginine or serine at codons 72 and/or 80, respectively is indicative of a p53 which is associated with cancer or an increased risk of cancer development.

Further in accordance with the present invention, it is surprisingly determined that all germline heterozygotes in the study expressed the p53 pro allele. This surprising result identifies that polymorphic p53 alleles are expressed in a monoallelic manner.

Accordingly, in a preferred embodiment ofthe present invention, cancer or a risk of cancer development is evaluated at the level of p53 expression. The present invention discloses that in humans, a significant difference exists in p53 allelic frequencies between different Caucasian and ethnic groups. Furthermore, the present invention has led to the discovery that fairer skin color is associated with gentotypes comprising p53 arg allele homozygotes whereas populations with darker skin ta tend to have a larger proportion of p53 pro allele homozygotes. Lighter skin colour is correlated with an increased frequency of expression of ap53 allele encoding an arginine at codon 72 and this is associated with an overall increased cancer risk within the Caucasian or ethnic group.

In addition, increased latitude ofthe region of origin ofthe ethnic group is correlated with an increased frequency of a p53 allele encoding an arginine at codon 72 and this is associated with an overall increased cancer risk within the ethnic group.

Again, the present invention extends to any other polymorphism or mutation at any other codon within p53.

The present invention applies to any condition associated with p53 variation. Particularly relevant conditions are cancer or cancer-like disorders. Most particularly, the cancers are breast cancers. The present invention is also useful for forensic analysis where the presence of an expressed p53 αrg allele would provide a likelihood of the ethnicity of a person identified during forensic analysis.

The present invention further provides a vector for use in mammalian gene therapy. In one particularly useful example, mammalian cells, including stem cells, are engineered to express ap53 allele which is not associated with cancer such as the p53pro allele.

In a preferred embodiment, the present invention provides a vector for use in gene therapy comprising a p53 polynucleotide sequence, or part of a p53 polynucleotide sequence comprising a p53 allele which is not associated with cancer. The preferred allele carries a proline residue at codon 72. In addition, the present invention provides a method for the treatment and/or prophylaxis of a subject with cancer or a risk of developing cancer, said method comprising introducing into cells expressing a polymorphic variant of the p53 allele which is not associated with cancer.

Alternatively, protein replacement therapy is contemplated.

The present invention further provides a kit useful in determining the p53 allele expressed in a cell. The kit is conveniently in a multi-compartment form wherein a first compartment is adopted to comprise one or more isolated polynucleotide probes or primer sets specific for a codon sequence within aρ53 allele or mRNA transcript thereof. A third compartment may also be adopted to comprise reagents for the reverse transcription and/or amplification of the p53 allele transcript using the primer set. In addition to these components, instructions for the use ofthe kit may also included.

In one embodiment of he present invention, the primers and/or probes ofthe kit can detect and differentiate between the p53 pro allele, Thep53 αrg allele and/or the p53 ser allele.

The kit may alternatively comprises reagents for detecting p53 proteins. Such kits conveniently contain antibodies or other p53 -binding agents which are capable of discriminating between p53 protein polymorphic variants.

A summary of sequence identifiers used throughout the subject specification is provided in Table 1.

TABLE 1 Summary of sequence identifiers

Single and three letter abbreviations used throughout the specification are provided in Table 2.

TABLE 2 Single and three letter amino acid abbreviations

A list of abbreviations used herein is provided in Table 3.

TABLE 3 Abbreviations

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 is a representation showing preferential expression of the p53 pro allele in germline heterozygotes. (A) Restriction digest analysis of the p53 genotypes. Exon 2 to exon 4 of p53 from genomic DNA from the indicated samples were PCR amplified and subjected to BstUl restriction enzyme digestion. The uncleaved 800 bp band represents the pro allele (*) and the cleaved products of 600 and 200 bp (") represent the arg allele. The presence of all three bands indicates the heterozygotes. (B) Sequence analysis of the expressing allele. Electrophenograms of sequence analysis for determination of the codon 72 sequence using genomic DNA from the heterozygote sample and RNA from the Pro and Arg homozygotes as well as the heterozygotes are shown. The presence of both the C (pro allele) and G (arg allele) nucleotides in the genomic DNA of heterozygotes are indicated with arrows and underscores. The arrows indicate only the presence of a single nucleotide in the heterozygotes (C) and the homozygotes RNA samples (C or G). (C) Sensitivity of the DNA digestion method to determine the presence of the arg and pro allele. Reconstituition experiments were carried out with the indicated amounts of RNA from both the Pro and Arg samples. The mixed samples were subjected to PCR and then to BstUl restriction enzyme digestion. The Pro band of 500 bp is indicated with and * and the arg allele gives rise to the indicated doublets of 220 and 280 bp ("). The internal control band spanning exons 5 to 11 gives rise to a 750 bp band (^Λ), which serves as a loading control. (D) Determination of sensitivity of the sequencing method. The above mixed samples were also subjected to sequence analysis for elucidation of codon 72 of p53. The electrophenogram shows the presence of the C nucleotide as blue peaks and the G nucleotide as black peaks. The arrows indicate the presence ofthe different peaks. Both the peaks are detectable even at the lowest ratio, indicating the sensitivity of this method in revealing the presence of both alleles expressed at various allelic ratios. (E) Germline and expressing allele status. The frequency (percentage in the population) of the various genotypes (determined at the genomic DNA level) in the Chinese population is indicated on the left panel. The frequency of the expressing allele (determined at the RNA level) in the same population is indicated on the right panel. The number of people expressing the pro allele is significantly higher than the Arg expressers (p < 0.001, χ² test). Sample size: Germline Status: Arg/Arg-46, Arg/Pro-61, Pro/Pro-33; Expressing allele: Arg-46, Pro-94. Figure 2 is a graphical representation showing that the Arg allele is more common but is less frequently mutated in Chinese breast cancer patients. (A) Comparison of the percentage of Arg or Pro expressers in the Chinese normal and breast cancer patients. The proportion ofthe cancer patients expressing the arg allele is significantly greater than those expressing the pro allele (p=***0.0003). Sample size: normal: 140 - Arg-46, Pro-94; cancer: 94 - Arg-52, Pro-42. (B) Comparison ofthe number of Pro or Arg expressing breast cancer samples with (+) or without (-) a mutation in Thep53 gene. The number of Arg expressing patients without a mutation in the p53 gene is significantly greater than those with a mutation (p*=0J69). Samples size: Pro: 42 - without mutation-20, with mutation-22; Arg: 52 - without mutation-36, with mutation-16.

Figure 3 is a diagrammatic representation showing the distribution of p53 mutations in breast cancers. The diagram indicates the p53 protein with the different domains. The top part indicates the arg allele in the breast cancer samples and the frequency of mutations are indicated as length ofthe bars on the diagram. The lower part indicates The pro allele in the breast cancers and the frequency of mutations in the various regions. The data are derived from Table 6.

Figure 4 is a diagrammatic representation providing a summary of p53 status with respect to geographical location. The summary depicts the status of p53 polymorphism and mutation frequency in the arg allele in healthy and breast cancer subjects with respect geographical location. The people away from the Equator tend to predominantly express the arg allele whereas those near the Equator express the pro allele of p53. Mutations in the arg allele are more frequent and found in the DNA-binding domain of p53 in those away from the Equator. The model implies that Thep53 pro allele is stronger than the arg allele, with regard to tumor supressor function. In addition, it is proposed that the p53 αrg allele is probably functionally stronger in Caucasians living further from the Equator when compared to p53 αrg tumor supressor activity in Asians. Figure 5 is a representation showing that Chinese heterozygotes (arg/pro) preferentially express the ro allele whereas the Caucasian heterozygotes express the αrg allele. Peripblood bllod samples from healty donors from each group of αrg/pro heterbzgotes were used to obtain RNA, which was subjected to PCR and then restriction digest with BstUl enzyme (A) or sequence analysis (B). It is clear that the most of the Chinese heterozygotes express the pro allele (80% of analysed) whereas the remaining people express both alleles equally (C). By contracts, about 60% of the healthy Caucasian heterozygotes express the arg allele and the remaining express both alleles (C). This indicates that the Chinese (Asians) selectively express the pro allele compared to the Caucasians, and hence less likely to succumb to cancer.

Figure 6 is a representation showing that RNA from breast tumor samples of Chinese heterozygote patients express the arg allele, probably due to activation of this allele during carcinogenesis (A- restriction digest and B- sequence analysis). This leads to about 64% of the heterozygotes expressing the arg allele (compared to none in a normal person) and the remaining patients expressing the pro allele. These data indicate that the re-activation of the silent arg allele during cancer development, which is used as a marker for cellular transformation.

Figure 7 is a representation showing that the adjacent normal tissue from all (100%) Chinese heterozygote breast cancer patients also express the arg allele (compared to pro in healthy persons' peripheral blood), indicating that the histologically normal tissues have also undergone the cellular transformation process. By contrast, normal breast tissues from a healthy heterozygote person (who has undergone cosmetic surgery) expresses the pro allele (similar to that found in the peripheral blood). These data indicate that the status of the p53 codon 72 polymorphic allele expression can be used as a diagnostic marker for cancer development.

Figure 8 is a graphical representation showing ELISA test using p53 codon 72-proline- specific antibody.

Figure 9 is a graphical representation showing 72-arginine-specific antibody. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

The present invention provides a method for assessing the presence of cancer or a predisposition to the development of cancer or other disorder or condition in a subject based on the presence of a particular expressed p53 allele. The present invention identifies particular expressed p53 alleles which are associated with a cancer or an increased risk of development of cancer and p53 alleles which are associated with an absence of cancer or a decreased risk of cancer development. In addition, the present invention provides the frequency of these alleles in particular ethnic groups, thereby allowing general levels of cancer risk to be assigned to particular Caucasian or ethnic groups or members therein. Although the present invention is particularly associated with cancer, it extends to other conditions associated with p53. Reference herein to "cancer" includes all other p53-related conditions or disorders. The present invention enables, therefore, subjects to be assessed for the likelihood or otherwise of developing cancer or related condition. The methods of the present invention are useful in risk management such as in health planning by Governments, insurance companies and employers. It is also useful for family planning.

Before describing the present invention in detail, it is to be understood that unless otherwise indicated, the subject invention is not limited to specific formulations of agents, manufacturing methods, dosage regimens, or the like, as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

It must be noted that, as used in the subject specification, the singular forms "a", "an" and "the" include plural aspects unless the context clearly dictates otherwise. Thus, for example, reference to "an allele" includes a single agent, as well as two or more alleles.

In describing and claiming the present invention, the following terminology is used in accordance with the definitions set forth below. The term "effective level" with specific regard to allelic expression means a level of expression of the allele which correlates directly, or indirectly, to an elevated or reduced risk of cancer development or to diagnose this risk level.

The terms "treating" and "treatment" as used herein refer to reduction in severity and/or amelioration of symptoms of cancer or elimination of these symptoms or the prevention of the occurrence of cancer symptoms or the improvement or remediation of a subject with cancer or a risk of developing cancer. Thus, for example, "treating" a patient involves the reduction of cancer or cancer risk associated with a particular p53 allele as well as treatment of existing cancers by increasing p53 tumor supressor activity. Thus, for example, the present method of "treating" a patient with cancer or with a subject having a propensity for cancer to develop due to the expression of a particular p53 allele, encompasses both prevention of cancer as well as treating cancer or symptoms thereof. In any event, the present invention contemplates the treatment and/or prophylaxis of cancers.

A "subject" or "patient" as used herein refers to an animal, preferably a mammal (e.g. livestock animal, primate, laboratory test animal, companion animal) and more preferably a primate including a lower primate (e.g. a marmosset, baboon, orangutang, tupia) and even more preferably a human who can benefit from the formulations and methods of the present invention. A subject regardless of whether a human or non-human animal may be referred to as an individual, patient, animal, host or recipient. The compounds and methods ofthe present invention have applications in human medicine, veterinary medicine as well as in general, domestic or wild animal husbandry. Most preferably, however, the present invention relates to the treatment, prophylaxis and/or diagnosis of cancers in humans.

Examples of laboratory test animals include mice, rats, rabbits, guinea pigs and hamsters. Rabbits and rodent animals, such as rats and mice, provide a convenient test system or animal model. Livestock animals include sheep, cows, pigs, goats, horses and donkeys. Non-mammalian animals such as avian species, zebrafish, amphibians (including cane toads) and Drosophila species such as Drosophila melanogaster are also contemplated. Instead of a live animal model, a test system may also comprise a tissue culture system. Human p53 is a phosphoprotein of 393 amino acids which can be subdivided into four domains: a highly charged acidic region of about 75 to 80 residues; a hydrophobic proline- rich domain (residues 80 to 150); a central region (from residues 150 to about 300); and a highly basic C-terminal region. The amino acid sequence of p53 is well conserved in vertebrate species such as human, African green monkey, golden hamster, rat, chicken, mouse, rainbow trout and Xenopus laevis but there have been no proteins homologous to p53 identified in lower eukaryotic organisms.

The function of p53 primarily relates to tumor suppression activity. Without limiting the present invention in any way, p53 is thought to suppress progression through the cell cycle in response to DNA damage, thereby allowing DNA repair to occur before replicating the genome. Hence, p53 prevents the transmission of damaged genetic information from one cell generation to the next. If damage to a given cell is severe, p53 can initiate apoptosis. This protects the organism from the growth of damaged cells, and so loss of p53 function is a key step in the neoplastic cascade.

Mutations in the p53 gene can cause cells to become oncogenically transformed and transfection studies have shown that p53 acts as a potent transdominant tumor suppressor, able to restore some level of normal growth to cancerous cells in vitro. p53 is also a potent transcription factor and once activated, it represses transcription of one set of genes, several of which are involved in stimulating cell growth, while stimulating expression of other genes involved in cell cycle control.

Accordingly, p53, as used herein is to be understood as reference to any p53 polypeptide, while p53 is to be understood to be a polynucleotide sequence, including both DNA and/or RNA, encoding a p53 polypeptide or part thereof. The terms "polypeptide" and "protein" are used herein interchangeably.

For the purposes ofthe present invention the term "allele" is to be understood as one ofthe different forms of a gene or DNA sequence which can exist at a single locus. The genetic alleles can also lead to the production of allelic forms of a protein. For example, a specific p53 allele may encode a different amino acid sequence from another p53 allele. The present invention extends to a mutation in any nucleotide within the nucleotide sequence of p53. The coding sequence for human p53 is set forth in SEQ ID NO:l and corresponds to nucleotides 252 to 1433 of SEQ ID NO:3. Any nucleotide may vary in SEQ ID NO: 3 and such a variation is encompassed by the present invention. A example of a particular variation is a nucleotide variation within a region comprising the coding region such as at positions 252, 253, 254, 254, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 883, 984, 885, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 902, 903, 904, 905, 906, 907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919, 920, 921, 922, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, 953, 954, 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 965, 966, 967, 968, 969, 970, 971, 972, 973, 974, 975, 976, 977, 978, 979, 980, 981, 982, 983, 984, 985, 986, 987, 988, 989, 990, 991, 992, 993, 994, 995, 996, 997, 998, 999, 1001, 1002, 1003, 1004, 1005, 1006, 1007, 1008, 1009, 1010, 1011, 1012, 1013, 1014, 1015, 1016, 1017, 1018, 1019, 1020, 10021, 1022, 1023, 1024, 1025, 1026, 1027, 1028, 1029, 1030, 1031, 1032, 1033, 1034, 1035, 1036, 1037, 1038, 1039, 1040, 1041, 1042, 1043, 1044, 1045, 1046, 1047, 1048, 1049, 1050, 1051, 1052, 1053, 1054, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 1077, 1078, 1079, 1080, 1081, 1082, 1083, 1084, 1085, 1086, 1087, 1088, 1089, 1090, 1091, 1092, 1093, 1094, 1095, 1096, 1097, 1098, 1099, 1100, 1101, 1102, 1103, 1104, 1105, 1106, 1107, 1108, 1109, 1110, llll, 1112, 1113, 1114, 1115, 1116, 1117, 1118, 1119, 1120, 1121, 1122, 1123, 1124, 1125, 1126, 1127, 1128, 1129, 1130, 1131, 1132, 1133, 1134, 1135, 1136, 1137, 1138, 1139, 1140, 1141, 1142, 1143, 1144, 1145, 1146, 1147, 1148, 1149, 1150, 1151, 1152, 1153, 1154, 1155, 1156, 1157, 1158, 1159, 1160, 1161, 1162, 1163, 1164, 1165, 1166, 1167, 1168, 1169, 1170, 1171, 1172, 1173, 1174, 1175, 1176, 1177, 1178, 1179, 1180, 1181, 1182, 1183, 1184, 1185, 1186, 1187, 1188, 1189, 1190, 1191, 1192, 1193, 1194, 1195, 1196, 1197, 1198, 1199, 1200, 1201, 1202, 1203, 1204, 1205, 1206, 1207, 1208, 1209, 1210, 1211, 1212, 1213, 1214, 1215, 1216, 1217, 1218, 1219, 1220, 1221, 1222, 1223, 1224, 1225, 1226, 1227, 1228, 1229, 1230, 1231, 1232, 1233, 1234, 1235, 1236, 1237, 1238, 1239, 1240, 1241, 1242, 1243, 1244, 1245, 1246, 1247, 1248, 1249, 1250, 1251, 1252, 1253, 1254, 1255, 1256, 1257, 1258, 1259, 1260, 1261, 1262, 1263, 1264, 1265, 1266, 1267, 1268, 1269, 1270, 1271, 1272, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1286, 1287, 1288, 1289, 1290, 1291, 1292, 1293, 1294, 1295, 1296, 1297, 1298, 1299, 1300, 1301, 1302, 1303, 1304, 1305, 1306, 1307, 1308, 1309, 1310, 1311, 1312, 1313, 1314, 1315, 1316, 1317, 1318, 1319, 1320, 1321, 1322, 1323, 1324, 1325, 1326, 1327, 1328, 1329, 1330, 1331, 1332, 1333, 1334, 1335, 1336, 1337, 1338, 1339, 1340, 1341, 1342, 1343, 1344, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394, 1395, 1396, 1397, 1398, 1399, 1400, 1401, 1402, 1403, 1404, 1405, 1406, 1407, 1408, 1409, 1410, 1411, 1412, 1413, 1414, 1415, 1416, 1417, 1418, 1419, 1420, 1421, 1422, 1423, 1424, 1425, 1426, 1427, 1428, 1429, 1430, 1431, 1432 or 1433. Preferred mutations are those within a codon encoding an amino acid residue such as codons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392 and 393. These codons in contiguous sequence correspond to the amino acid sequence of p53 which is set forth in SEQ ID NO:2.

Such mutations within the codon generally result in an amino acid substitution. However, amino acid additions and deletions are also contemplated.

Furthermore, a mutation may occur outside the coding region such as within a nucleotide set forth in SEQ ID NO:3. Nucleotides 252 to 1433 in SEQ ID NO:3 comprise to the protein-coding sequence.

Preferably, useful polymorphisms contemplated herein are at codon positions 21, 36, 46, 47, 72 and 213. A mutation at codon 80 is also contemplated. These contain single nucleotide polymorphisms (SNPs) as follows:-

* mutation

In a preferred embodiment, the p53 allele particularly contemplated by the present invention comprises an alteration to codon 72 or 80. In this regard, the p53 arg allele encodes a p53 polypeptide comprising an arginine residue at residue position number 72. The p53 pro allele encodes a p53 polypeptide comprising a proline residue at residue position number 72. The p53 ser allele is a mutation which encodes a p53 polynucleotide comprising a serine residue at residue number 80.

The present invention extends to any SNP at any nucleotide within codon 72. Polymorphisms at codon 72 include cgc (Arg), ggc (Gly), age (Ser), tgc (Cys), ccc (Pro), cac (His), etc (Leu), egg (Arg), cga (Arg) and/or cgt (Arg).

Similarly, mutations at codon 80 include cct (Pro), get (Ala), act (Thr), tct (Ser), cgt (Arg), cat (His), ctt (Leu), cca (Pro), ccc (Pro) and or ccg (Pro).

It is proposed herein, in a particular embodiment, that the p53 arg allele and/or p53 ser allele predisposes an individual to cancer.

Cancer is a generic term used to define a group of malignant neoplasms or group of diseases, occurring in all human and animal populations and arising in all tissues composed of potentially dividing cells. The basic characteristic of cancer is the transmissible abnormality of cells that is manifested by reduced control over growth and function leading to serious adverse effects on the host through invasive growth and metastases. Cancers of particular relevance to the present invention include leukemias, lymphomas (Hodgkins and non-Hodgkins), sarcomas, melanomas, adenomas, carcinomas of solid tissue, hypoxic tumors, squamous cell carcinomas, genitourinary cancers such as cervical and bladder cancer, hematopoetic cancers, head and neck cancers, nervous system cancers and benign lesions such as papillomas and the like.

In accordance with the present invention, allelic variation in p53 is deemed to be predictive or diagnostic with respect to cancer or a risk of developing cancer. An individual can be assessed for a level of risk of developing cancer by screening for expression of a particular p53 allele such as ap53 arg allele and/or p53 ser allele.

In a pre-diagnosis setting, a "risk" of developing cancer is defined as the probability of a particular individual developing a particular cancer. For example, in a pre-diagnosis screening, the identification of an individual expressing the p53 arg allele or p53 ser allele or both would be at a relatively higher cancer risk than an individual expressing the p53 pro allele. In the same way, the methods ofthe present invention may be applied in a post- diagnosis or prognostic method. For example, cancers in patients expressing the p53 arg allele are more likely to be aggressive due to these patients expressing a "weaker" p53 allele with regard to tumor suppressant function when compared to patients expressing the p53 pro allele. In this way, the methods of the present invention can be used to assess the cancer risk in a patient in both a diagnostic and prognostic manner to determine the potential for a cancer to develop, grow and/or metastasize. It may also be useful therapeutically to monitor the reduction in a cancer during or following treatment.

Using the status ofthe expressed p53 allele (at the RNA level) at codon 72 as an indicator, exemplifies the findings that there is a selection pressure against the expression of certain cancer-associated alleles such as the codon 72 p53 arg allele in the healthy germline heterozygotes as all these heterozygous individuals express only the pro allele at the RNA level. Detailed analysis indicated that the p53 arg allele is the "weaker" tumor suppressor allele compared to the pro allele as individuals who are p53 αrg expressers appear to be more susceptible to breast cancers than their p53 pro expressing counterparts. There is a large increase in the number of p53 αrg expressers in breast cancer samples. Approximately 60% of all breast cancer patients were p53 αrg expressers, suggesting that the p53 αrg allele probably predisposes women to breast cancer development. Comparatively, fewer ρ53 pro subjects were in the breast cancer cohort. Thus, the present inventors have identified that there is a clear and significant increase in the number of p53 αrg expressers among cancer patients, reflecting a positive correlation between the expression of the p53 αrg allele and cancer predisposition. This finding applies, however, to any polymorphism associated with the presence or absence of cancer.

Additionally, the proline residue at amino acid 80 in the proline-rich domain of p53 was of particular interest as it was found to be often mutated in p53 αrg expressing tumors. This mutation results in the loss of yet another proline residue in the proline-rich domain which has been shown to be essential for the induction of apoptosis, thereby further compromising the apoptotic potential of p53. The present invention provides insights to the uniqueness of population-based expression of the p53 tumor suppressor gene and demonstrates a strong correlation between the expression of the p53 arg allele and susceptibility to cancer development. Thus, it is demonstrated that p53 polymorphic status can be used as a predictive tool for evaluating the presence of a cancer or a predisposition to cancer. In addition, the status of the expressing p53 allele may also be used as a prognostic indicator ofthe disease.

Accordingly, the present invention provides a method for assessing whether a subject has cancer or has a risk of developing cancer or other disease condition associated with p53 expression or its homolog or ortholog, said method comprising determining the presence or absence of a polymorphic variation in p53 which is associated with a predisposition to a cancer or other disease condition.

In a preferred embodiment ofthe present invention, cancer or a risk of developing cancer is evaluated by examining the genomic polynucleotide sequence, mRNA transcript sequence and/or polypeptide amino acid sequence(s) of the proline rich region(s) of The p53 genetic sequence, p53 mRNA transcript sequence and/or p53 polypeptide amino acid sequence.

According to this preferred embodiment, an increased risk of cancer development is indicated by mutations to the p53 genetic sequence manifest as one or more substitutions of proline residues in one or more proline-rich regions ofthe p53 polypeptide.

In a more preferred embodiment of the present invention, cancer risk is evaluated by examining the genomic polynucleotide sequence, mRNA transcript sequence and/or polypeptide amino acid sequence(s) for a polymorphism at codon 72 or mutation at codon 80 wherein a p53 arg allele and/or p53 ser allele, respectively at codons 72 and 80 is indicative of an elevated risk of cancer development.

The present invention further unexpectedly discovered that all germline heterozygotes in the study expressed the pro allele suggesting that there has been an ecological adaptation for the protection of this population who are exposed to higher amounts of sunlight near the Equator. This surprising result identifies that polymorphic p53 alleles are expressed in a monoallelic manner. In this respect, it is noteworthy that several other tumor suppressor genes such as neurofibromatosis type 1 (NF1) and type 2 (NF2) have also been shown to be unequally expressed (Hoffmeyer et al, Hum. Mol Genet. 4(8): 1267-1272, 1995; Jacoby et al, Neurogenetics 2(2): 101-108, 1999). In addition, Ϊheρ53 related gene, ρ73, is imprinted and monoallelically expressed (Kaghad et al, Cell 90(4): 809-819, 1997). p53 may, therefore, be imprinted, resulting in silencing of the p53 arg allele in healthy individuals, although the mechanism remains to be elucidated.

The present invention is applicable to any subject but is particularly applicable to any human subjects such as subjects of Asian descent. Examples ofthe latter include such as of Chinese, Malaysian or Indian subjects.

It will be readily ascertained by those of skill in the art what constitutes the genetic or racial descent of a subject. For example, a subject of Asian descent would be considered a subject wherein one or both the parents of the subject were genetically related to humans originating in Asia. In a similar manner, it is possible to define persons of Chinese,

Malaysian or Indian descent by the genetic similarity of one or both parents of the person or persons originating in China, Malaysia or India, respectively. As will be apparent to those of skill in the art, the place of actual birth or residence of the individual does not impact on the p53 alleles carried by the individual. Hence, for the purposes of the present invention, place of birth or residence of a particular individual is not relevant to assess cancer risk. The present invention, however, extends to human subjects of any Caucasian or ethnic origin. The methods herein are also useful for forensic analysis, i.e. determining the likely nationality of a victim or perpetrator.

For the purposes of the present invention, Asia is defined as the land mass falling within the latitudes of 80 degrees North (80°N) to 10 degrees South (10°S) and the longtitudes of 40 degrees East (40°E) to 140 degrees East (140°E). However, these co-ordinates are to be taken as an example only as individuals or groups of individuals may be considered of Asian descent even when living outside these co-ordinates, possibly for several generations. Therefore, the present invention in no way limits the definition of Asian to this region ofthe world or persons living within the above-defined region.

In accordance with the present invention, a significant difference in the allelic frequencies was identified between the Chinese subjects and the Malaysian/Indian subjects whereas there was no difference between the Malaysian and Indian subjects. Comparison of the data with the previously published data on Caucasians and Africans indicate that the distribution of genotype and allelic frequencies in the three Asian populations are significantly different from the Caucasians (p<0.001). However, only the Chinese were found to have a statistically significant difference in the genotype and allelic frequencies when compared to the Africans (p<0.001). Hence, the present invention has led to the surprising discovery that fairer skin color is associated with genotypes comprising p53 arg allele homozygotes whereas populations with darker skin tan tend to have a larger proportion of p53 pro allele homozygotes.

Accordingly, the present invention provides a method of determining the relative cancer risk of a Caucasian or ethnic group or a member of a Caucasian or ethnic group, said method comprising examining the skin color and/or latitude of the place of origin of said Caucasian or ethnic group wherein lighter skin color is correlated with an increased frequency of a p53 allele encoding an arginine at codon 72 which is associated with an overall increased cancer risk for a member ofthe said Caucasian or ethnic group.

In a further preferred embodiment ofthe present invention, increased latitude ofthe region of origin of the ethnic group is correlated with an increased frequency of a p53 allele encoding an arginine at codon 72 which is associated with an overall increased cancer risk for said ethnic group.

Once a polymorphism is identified in p53 such as p53 arg or the mutation p53 ser, genetic and protein-based assays may then be developed to screen individual subjects for the presence of the particular polymorphism associated with a condition or phenotype. One particularly useful method is denaturing HPLC (dHPLC). Although dHPLC may be used to screen genetic polymorphisms, once identified, primer based assays provide a particularly convenient screening protocol to identify the presence or absence of a particular polymorphism.

The method of the present invention is also useful in developing a diagnostic kit for use ter alia in risk assessment for cancer development.

The kits may detect polymorphisms at the genetic or protein level.

In relation to, for example, genetic testing, a sample of cells may be collected and hybridization and/or sequencing studies conducted to identify the presence of a particular nucleotide at a defined location.

The genetic detection of single nucleotide variation, i.e. polymorphisms, may be amplified in any number of ways including competitive hybridization and/or priming or different hybridization methods. One particularly useful method involves solid phase amplification (SPA) and competitive priming. One particular form of the latter method is referred to as solid phase cascade rolling circle amplification (SPCRCA), as disclosed in International Patent Application No. PCT/AU01/00527 [WO 00/85988]. Reference herein to a "nucleic acid molecule" or "target nucleic acid molecule" includes reference to DNA (e.g. cDNA or genomic DNA) or RNA (e.g. mRNA).

Accordingly, another aspect of the present invention provides a method for detecting a polymorphic form of a p53 allele or part thereof said method comprising contacting said p53 allele or part thereof with at least two solution phase nucleic acid primers wherein the nucleotide sequence of at least one of the primers is complementary to a target nucleotide sequence within or on Thep53 allele or part thereof and wherein the nucleotide sequence of at least another primer differs from said target p53 sequence by at least one nucleotide mismatch and wherein at least one of said at least two primers is labeled with a reporter molecule capable of providing an identifiable signal, wherein said contact is for a time and under conditions sufficient for the nucleic acid primer which is complementary to the target sequence to hybridize to said target sequence with greater efficiency and/or specificity compared to the nucleic acid primer which contains a mis-match and then detecting the relative presence of a signal wherein the relative presence of said signal is indicative of which primer has hybridized to the target sequence depending on which primer has been labeled and the relative presence of a signal is indicative ofthe identity of the polymorphic form ofthe nucleic acid molecule.

This method is conveniently practiced using solid phase, i.e. a primer immobilized to a solid phase. A ρ53 allele may then be immobilized via hybridization to the immobilized primer.

Reference herein to a "primer" is not to be taken as any limitation as to structure, size or function. The primer may be used as an amplification molecule or may be used as a probe for hybridization purposes. The preferred form of the molecule is as a primer for amplification.

Reference herein to a "nucleic acid primer" includes reference to a sequence of deoxyribonucleotides or ribonucleotides comprising at least 3 nucleotides. Generally, the nucleic acid primer comprises from about 3 to about 100 nucleotides, preferably from about 5 to about 50 nucleotides and even more preferably from about 5 to about 25 nucleotides. Examples of primer lengths include 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 and/or 100 nucleotides. A primer having less than 50 nucleotides may also be referred to herein as an "oligonucleotide primer". The primers of the present invention may be synthetically produced by, for example, the stepwise addition of nucleotides or maybe fragments, parts, portions or extension products of other nucleotide acid molecules. The term "primer" is used in its most general sense to include any length of nucleotides which, when used for amplification purposes, can provide a free 3' hydroxyl group for the initiation of DNA synthesis by a DNA polymerase. DNA synthesis results in the extension of the primer to produce a primer extension product complementary to the nucleic acid strand to which the primer has hybridized. Importantly, with respect to the primers, differential washing is employed to remove unextended primers which could anneal to an immobilized amplimer. In essence, unextended primers are removed such as by washing at a temperature that melts a primer-single-stranded amplimer complexes but does not substantially disrupt fully double-stranded amplimers.

Reference to greater efficiency or specificity includes reference to a greater likelihood of hybridization in a complementary primer compared to a mis-matched primer. Conveniently, efficiency and/or specificity can be measured following post-amplification primer interrogation where the complementary primer allows significant extension compared to a mis-matched primer.

Reference to "relative presence" includes reference to "relative absence".

In a preferred embodiment, one of the at least two solution phase nucleic acid primers is involved in an amplification reaction to amplify a target sequence. If this primer is also labeled with a reporter molecule, the amplification reaction will result in incorporation of the label in the amplified product. The terms "amplification product" and "amplimer" may be used interchangably.

The extension of the hybridized primer to produce an extension product is included herein by the term "amplification". Amplification generally occurs in cycles of denaturation followed by primer hybridization and extension. The present invention encompasses from about 1 cycle to about 120 cycles, preferably from about 2 to about 70 cycles and even more preferably from about 5 to about 40 cycles including 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119 and/or 120 cycles.

The nucleic acid primers having single or multiple base differences are also referred to herein as "competitive primers". Generally, the competitive primers are nucleic acid molecules of the same length but differ by at least one base mis-match. In one aspect, by manipulating hybridization and stringency conditions, the primers compete with each other for the ability to hybridize to the target sequence. Under particular stringency conditions, only the primer having the most complementarity to the target sequence will hybridize. The primer with the least one complementarity will, under these conditions, substantially not hybridize. More particularly, however, the difference between a complementary and mis-matched primer is determined by the efficiency and/or specificity of elongation. Accordingly, complementary primers will elongate more preferentially relative to mismatched primers. In this aspect, the conditions are manipulated to induced preferential extension ofthe 3' terminus ofthe primer. As stated above, unextended primers are washed away at temperatures which melt primer-single-stranded amplimer complexes but which does not disrupt fully double-stranded amplimers.

A base mis-match occurs when two nucleotide sequence are aligned with substantial complementarity but at least one base aligns to a base which would result in an "abnormal" binding pair. An abnormal binding pair occurs if thymine (T) were to bind to a base other than adenine (A), if A were to bind to a base other than T, if guanine (G) were to bind to a base other than cytosine (C) or if C were to bind to a base other than G.

In accordance with the present invention, primers are selected to identify a polymorphism.

In accordance with this aspect of the present invention, a sample of nucleic acid to be tested is added to a chamber, well or other receptacle comprising an immobilized nucleic acid capture molecule. The capture molecules comprises a nucleotide sequence substantially complementary to a portion of either the target p53 nucleotide sequence or a nucleotide sequence within a nucleic acid molecule comprising the target sequence. The terms "captive molecule" and "primer" may be used interchangably.

The capture molecule may be immobilized to the solid phase by any convenient means. The solid phase may be any structure having a surface which can be derivatized to anchor a nucleic acid primer or other capture molecule. Preferably, the solid phase is a planar material such as the side of a microtitre well or the side of a dipstick. The anchored nucleic acid molecule generally needs to be able to capture a target p53 nucleic acid molecule by hybridization and optionally participate in an amplification reaction. Alternatively, the anchored nucleic acid molecule will capture amplified nucleic acid molecules. The former, however, is preferred.

Methods for linking nucleic acid molecules to solid supports are well known in the art. Processes for linking the primer to the solid phase include amide linkage, amidate linkage, thioether linkage and the introduction of amino groups on to the solid phase. Examples of linkage to a solid phase can be found in International Patent Application No. PCT/AU92/00587 [WO 93/09250].

The anchored primer may participate with one of the solution phase primers for amplification. Alternatively, a "generic" primer is anchored to the solid support in order to amplify the nucleic acid molecule comprising a target sequence. Specific amplification of the target sequence can then be achieved by solution phase primers. In relation to the latter embodiment, the solution would contain at least three solution phase primers wherein at least two primers would exhibit substantially complementarity with each other but differ by at least one mis-match.

The method of the present invention provides an efficient, cost effective and accurate means of detecting a particular polymorphism.

In another embodiment, the competitive priming step can be undertaken after amplification with a generic primer. In this embodiment, a non-allele specific amplification is undertaken using an unlabeled primer. The amplimer is then interrogated using competitive priming on a solid phase. The use of a large amount of amplimer means that other minimal amplification is necessary.

In another embodiment, the present invention contemplates conducting post-amplification interrogation using non-allele-specific primers with a high T_m and allele-specific primers with a low T_m. The initial amplification cycles are conducted under high annealing temperatures rendering the allelic specific primers inactive. The later cycles are conducted at a lower temperature thus activating the allele-specific primers. This embodiment has the convenience of the primers all being added at the beginning of the reaction. For particular convenience, the different annealing temperatures are programmed into the thermocycler. The T_m ofthe first set of primers (T_m(i)) is greater than the T_m of the second set of primers (T_m(₂₎) such that at the temperature employed for the amplification of the first set of primers, the second set of primers are inactive. Accordingly, the difference between T_m(i) and T_m(₂₎ may be from about 3°C to about 50°C and more preferably from about 5°C to about 20°C.

The methods of the present invention may be used with respect to any form of amplification including polymerase chain reaction, ligation chain reaction, nucleic acid sequence based amplification, Qβ replicase based amplification, strand displacement method, rolling circle amplification and recirculating allele-specific primer extension.

In a further embodiment, a thermostable ligase may be employed with the non-allele specific amplification reaction. This results in the multimerization ofthe amplimer and this may improve the interrogation step. Preferably, a thermostable polymerase is also employed which does not put A-tails onto the amplimer. Alternatively, a T-tailed linker is used in the reaction. Either approach ensures that the amplimer monomers are ligatable. Although not wishing to limit the present invention to any one theory or mode of action, it is proposed that in certain circumstances, multimeric amplimers are more efficaciously interrogated compared to monomeric amplimers. The present invention extends to these modifications to the methodology but is not limited to these embodiments.

A range of labels providing a detectable signal may be employed. The label may be associated with a particular nucleic acid molecule or nucleotide or it may be attached to an intermediate which subsequently binds to a nucleic acid molecule or nucleotide.

The label may be selected from a group including a chromogen, a catalyst, an enzyme, a fluorophore, a luminescent molecule, a chemiluminescent molecule, a lanthanide ion such as Europium (Eu³⁴), a radioisotope and a direct visual label. In the case of a direct visual label, use may be made of a colloidal metallic or non-metallic particular, a dye particle, an enzyme or a substrate, an organic polymer, a latex particle, a liposome, or other vesicle containing a signal producing substance and the like. A large number of enzymes suitable for use as labels is disclosed in United States Patent Nos. 4,366,241, 4,843,000 and 4,849,338. Suitable enzyme labels useful in the present invention include alkaline phosphatase, horseradish peroxidase, luciferase, β-galactosidase, glucose oxidase, lysozyme, malate dehydrogenase and the like. The enzyme label may be used alone or in combination with a second enzyme which is in solution. Alternatively, a fluorophore which may be used as a suitable label in accordance with the present invention includes, but is not limited to, fluorescein, rhodamine, Texas red, Lucifer yellow or R-phycoerythrin.

Another aspect ofthe present invention extends to the use of arrays of nucleic acid primers immobilized to a solid support such as a microchip, microtitre well, dipstick, microscope slide or other suitable surface. The primers may be the same or may differ by one or more nucleotides. The array is useful for screening large numbers of subjects for a single or multiple polymoφhisms. The immobilized primers may be used to amplify different regions of a nucleic acid molecule comprising a target sequence or may be directed to a range of different polymoφhic target sequences. The latter is useful in diagnosis of cancer, genetic diseases or for pathogen identification. Reference herein to "arrays" is not to imply any particular order or arrangement and the "arrays" may comprise an ordered arrangement and/or a random arrangement of primers. These arrays may be used to rapidly screen for polymoφhisms.

The immobilized primers are non-allele specific whereas the solution phase primers are p53 allele specific.

The present invention is applicable to any DNA diagnostic format that relies, upon competitive primer extension. The primers may also be used as PCR primers so that amplification and discrimination are carried out in a single step. Alternatively, amplified material can be interrogated using this method.

The nucleotide sequence of a p53 allele in a subject may be determined by a number of other means. Many methods are commonly used in the art and appropriate methods for the cloning or amplification of the gene followed by determination of the sequence will be readily ascertained by those of skill in the art.

Exemplary methods for the isolation of the p53 allele may include, but are not limited to:

(i) PCR using p53 sequence specific primers to amplify part or all of the p53 allele carried by the subject; or

(ii) Alternatively, a library of the genomic DNA from the patient may be created. The library may then be probed with ap53 specific probe to identify particular clones carrying Thep53 polynucleotide sequence.

The procedure of PCR is well known to those of skill in the art. Briefly, the reaction involves the cyclic synthesis of new polynucleotides from a template sequence from oligonucleotide primers that bind to the template at the 5' and 3' ends ofthe sequence to be amplified. The reaction is typically catalyzed by a thermostable DNA polymerase, a common example of which is the DNA polymerase from Thermus αquαticus (Tαq polymerase). Typically, PCR reactions also comprise free nucleotide bases, a buffer solution suitable for the activity of the polymerase, and a salt such as magnesium chloride to assist template/primer annealing. However, it is to be understood that the present invention is in no way limited by the particulars of any given PCR method.

Many methods will be known to the skilled artisan for the construction of a genetic library. A typical example of the construction of a genomic DNA library involves the following basic steps:-

(i) Physical or enzymatic digestion ofthe genomic DNA of the subject into fragments of a suitable size for ligation into a cloning vector. Examples of physical digestion of DNA include Hydroshear treatment and aspiration through a syringe needle. Typically techniques such as needle aspiration yield DNA fragments of approximately 20 to 40 kilobases. With regard to enzymatic digestion, the choice of enzyme will be determined according to the %G+C in the genome ofthe organism and the frequency of cutting required. For example in high %G+C organisms, enzymes with specificities for AT rich regions such as Dral will cut less frequently than enzymes with sequence specificities including G/C residues. In addition, six- base cutters, i.e. restriction enzymes with a sequence specificity of six bases will cut more infrequently than four-base cutters, i.e. restriction enzymes with a sequence specificity of four bases. Accordingly, it would be easy to determine for the skilled artisan to identify an appropriate enzyme for library construction based on the %G+C content of subject organism and the desired insert size for library construction, with minimal experimentation.

(ii) Ligation of the DNA fragments generated according to step (1) into a suitable cloning vector such as, but not limited to, an artificial chromosome (e.g. HACs, BACs and YACs), a cosmid, or a plasmid. The choice of vector will be determined by the choice of host cell for the library and the size of the insert. Particularly useful vectors include BAC vectors, that are able to accommodate DNA inserts of up to 100 kilobases, although the present invention is in no way limited to vectors of this type. Further sub-libraries for sequencing may be constructed in bacterial plasmid vectors from larger constructs such as BACs or cosmids.

(iii) The organism used for the maintenance ofthe library may be any organism capable of replicating the vector used for the generation of the library. A particularly preferred organism is the bacterium E. coli. Methods for the culture, transformation, and isolation of plasmid/cosmid/BAC DNA are well established for this organism and will be well known to those of skill in the art.

(iv) Libraries may be screened for the sequence of interest, in this case the p53 genetic sequence, using any convenient method. Examples of library screening methods that in no way limit the invention, but are particularly convenient include colony hybridisation and colony PCR. For the colony PCR method, a complete bacterial colony carrying a library construct comprising a DNA insert is used in a PCR reaction with primers specific for the gene of interest, eg. p53. Bacterial colonies carrying the sequence of interest are positively identified by the production of an amplicon of the expected size. Colony hybridizations involve the hybridisation of a polynucleotide probe specific for the sequence of interest (e.g. p53) to a number of bacterial colonies arrayed on growth medium. Typically, the probe is labeled with a radioactive tag such that the positive colonies may be identified with autoradiography. However, other tags such as ezymatic or flourescent tags may be used for the identification of p53 positive colonies and the present invention is in no way limited to the tag used.

Once a p53 genetic sequence has been amplified with PCR, identified from a library or otherwise isolated, the allelic variant of the p53 polynucleotide may be identified in a number of ways. First, direct elucidation of the p53 sequence may be achieved via automated DNA sequencing from the PCR product or library vector. Sequencing methods are well known to those of skill in the art and need not be described in detail here. Sequencing may be initiated from within the p53 sequence itself, including the 5' end 3' and various positions within the polynucleotide sequence, as would be typically done for a PCR amplified polynucleotide. Alternatively, sequencing may be initiated from primers specific to insert-flanking sequences on a vector, as would typically be done for a cloned p53 polynucleotide sequence.

Indirect methods for determining ap53 allele polynucleotide sequence would include inter alia restriction fragment length polymoφhism (RFLP) techniques. Useful enzymes for the present invention are typically those enzymes that have sequence specificities for nucleotide sequences within the p53 polynucleotide where nucleotide sequence polymoφhism exists. In this way, the polymoφhism leads to the generation or deletion of a restriction site for a given enzyme and, hence, would lead to the generation or polymoφhic restriction fragment lengths. For example, in the case of the present invention, the polynucleotide sequence of the p53 pro allele after PCR amplification and subsequent digestion with the restriction endonuclease, BstUl, led to the production of 750 and 500 bp nucleotide products. However, the p53 arg allele subjected to the same amplification and digestion procedure led to the production of 750, 280 and 220 bp products. The present invention is in no way limited to RFLP based methods using this enzyme and other enzymes useful for the detection of other p53 allelic variants will be readily identified by the skilled artisan.

In addition to the analysis of genomic DNA, the methods described supra have equal application to the analysis of other polynucleotide sequences such as cDNA. Analysis of cDNA is particularly preferred, as analysis of this polynucleotide species using the methods described supra allows the analysis of p53 allelic variant that is actually expressed by the subject.

Another aspect ofthe present invention provides an antibody which specifically binds to a p53 protein having at least one amino acid difference from another p53 protein due to a polymoφhism but substantially not to the other form of the protein having a different polymoφhism. The antibodies are, therefore, discriminatory of different p53 alleles. Such antibodies are useful in development of an immunoassay.

The present invention provides, therefore, an immunoassay.

The use of monoclonal antibodies in an immunoassay is particularly preferred because of the ability to produce them in large quantities and the homogeneity of the product. The preparation of hybridoma cell lines for monoclonal antibody production derived by fusing an immortal cell line and lymphocytes sensitized against the immunogenic preparation can be done by techniques which are well known to those who are skilled in the art. (See, for example, Douillard and Hoffman, Basic Facts about Hybridomas, in Compendium of Immunology Vol. II, ed. by Schwartz, 1981; Kohler and Milstein, Nature 256: 495-499, 1975; Kohler and Milstein, European Journal of Immunology 6: 511-519, 1976).

The present invention contemplates, therefore, a method for detecting a p53 protein, said method comprising contacting a biological sample from a subject with an antibody specific for said p53 protein for a time and under conditions sufficient for an antibody-protein complex to form, and then detecting said complex. The presence of a particular protein may be accomplished in a number of ways such as by Western blotting and ELISA procedures. A wide range of immunoassay techniques is available as can be seen by reference to U.S. Patent Nos. 4,016,043, 4,424,279 and 4,018,653. Arrays of antibodies each to different p53 polymoφhic variant proteins or to the same polymoφhism are contemplated by the present invention.

Sandwich assays are among the most useful and commonly used assays. A number of variations of the sandwich assay technique exist, and all are intended to be encompassed by the present invention. Briefly, in a typical forward assay, an unlabeled antibody is immobilized on a solid substrate and the sample to be tested brought into contact with the bound molecule. After a suitable period of incubation, for a period of time sufficient to allow formation of an antibody-protein complex, a second antibody specific to the protein, labeled with a reporter molecule capable of producing a detectable signal is then added and incubated, allowing time sufficient for the formation of another complex of antibody- protein-labeled antibody. Any unreacted material is washed away, and the presence of the protein is determined by observation of a signal produced by the reporter molecule. The results may either be qualitative, by simple observation of the visible signal, or may be quantified by comparing with a control ample containing known amounts of hapten. Variations on the forward assay include a simultaneous assay, in which both sample and labeled antibody are added simultaneously to the bound antibody. These techniques are well known to those skilled in the art, including any minor variations as will be readily apparent. In accordance with the present invention, the sample is one which might contain the protein including cell extract, tissue biopsy or serum, saliva, mucosal secretions, lymph, tissue fluid and respiratory fluid. The sample is, therefore, generally a biological sample comprising biological fluid but also extends to fermentation fluid and supernatant fluid such as from a cell culture.

In a typical forward sandwich assay, a first antibody having specificity for the protein or antigenic parts thereof comprising the polymoφhic significant amino acid, is either covalently or passively bound to a solid surface. The solid surface is typically glass or a polymer, the most commonly used polymers being cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene. The solid supports may be in the form of tubes, beads, discs or microplates, or any other surface suitable for conducting an immunoassay. The binding processes are well known in the art and generally consist of cross-linking covalently binding or physically adsorbing, the polymer-antibody complex to the solid surface which is then washed in preparation for the test sample. An aliquot ofthe sample to be tested is then added to the solid phase complex and incubated for a period of time sufficient (e.g. 2-40 minutes or overnight if more convenient) and under suitable conditions (e.g. from room temperature to about 37°C including 25°C) to allow binding of any subunit present in the antibody. Following the incubation period, the antibody subunit solid phase is washed and dried and incubated with a second antibody specific for a portion of the protein. The second antibody is linked to a reporter molecule which is used to indicate the binding ofthe second antibody to the protein.

An alternative method involves immobilizing the target molecules in the biological sample and then exposing the immobilized target to specific antibody which may or may not be labeled with a reporter molecule. Depending on the amount of target and the strength ofthe reporter molecule signal, a bound target may be detectable by direct labeling with the antibody.

Alternatively, a second labeled antibody, specific to the first antibody is exposed to the target-first antibody complex to form a target-first antibody-second antibody tertiary complex. The complex is detected by the signal emitted by the reporter molecule.

By "reporter molecule", as used in the present specification, is meant a molecule which, by its chemical nature, provides an analytically identifiable signal which allows the detection of antigen-bound antibody. Detection may be either qualitative or quantitative. The most commonly used reporter molecules in this type of assay are either enzymes, fluorophores or radionuclide containing molecules (i.e. radioisotopes) and chemiluminescent molecules.

In the case of an enzyme immunoassay, an enzyme is conjugated to the second antibody, generally by means of glutaraldehyde or periodate. As will be readily recognized, however, a wide variety of different conjugation techniques exist, which are readily available to the skilled artisan. Commonly used enzymes include horseradish peroxidase, glucose oxidase, β-galactosidase and alkaline phosphatase, amongst others. The substrates to be used with the specific enzymes are generally chosen for the production, upon hydrolysis by the corresponding enzyme, of a detectable color change. Examples of suitable enzymes include alkaline phosphatase and peroxidase. It is also possible to employ fluorogenic substrates, which yield a fluorescent product rather than the chromogenic substrates noted above. In all cases, the enzyme-labeled antibody is added to the first antibody hapten complex, allowed to bind, and then the excess reagent is washed away. A solution containing the appropriate substrate is then added to the complex of antibody-antigen- antibody. The substrate will react with the enzyme linked to the second antibody, giving a qualitative visual signal, which may be further quantified, usually spectrophotometrically, to give an indication of the amount of hapten which was present in the sample. "Reporter molecule" also extends to use of cell agglutination or inhibition of agglutination such as red blood cells on latex beads, and the like.

Alternately, fluorescent compounds, such as fluorescein and rhodamine, may be chemically coupled to antibodies without altering their binding capacity. When activated by illumination with light of a particular wavelength, the fluorochrome-labeled antibody absorbs the light energy, inducing a state to excitability in the molecule, followed by emission of the light at a characteristic colour visually detectable with a light microscope. The fluorescent-labeled antibody is allowed to bind to the first antibody-hapten complex. After washing off the unbound reagent, the remaining tertiary complex is then exposed to the light ofthe appropriate wavelength, the fluorescence observed indicates the presence of the hapten of interest. Lnmunofluorescence techniques are both very well established in the art and are particularly preferred for the present method. However, other reporter molecules, such as radioisotope, chemiluminescent or bioluminescent molecules, may also be employed.

There are many variations to protein assays including competitive antibody binding in cases where the polymoφhic variants of the proteins bind to the same antibody with differing affinities. Furthermore, p53-binding agents other than antibodies may also be employed. The ρ53 allelic variant that is expressed by a subject may also be determined by analysis of the sequence ofthe expressed p53 protein itself. The present method contemplates both N- terminal and C-terminal sequencing methods although N-terminal sequencing is preferred.

Methods for the N-terminal sequencing of proteins will be well known to those of skill in the art. Briefly, protein sequencing involves the sequential cleavage of amino acids from the N-terminal end of a protein using a process known as Edman degradation, and the subsequent identification of the amino acids through microbore HPLC. One cycle of protein sequencing represents the identification of one amino acid.

In the case where N-terminal and/or C-terminal sequencing does not cover a region where an amino acid polymoφhism is suspected to exist, internal amino acids sequences can be determined. Sequencing of internal regions of the protein may be achieved by digestion of the protein using proteases. Proteins may be digested with enzymes such as trypsin (cleaves after Lys or Arg), V-8 protease (cleaves after Glu) or CnBr (cleaves after Met). Digestion with the protease cleaves the protein into peptide fragments, which may then be separated using HPLC. These fragments may then be individually sequenced from the N- terminal and/or C-terminal and, hencek provide amino acid sequence from the internal regions ofthe protein of interest, e.g. p53.

The present invention further contemplates a method of treatment of cancer, said method comprising identifying a polymoφhism in a p53 gene or p53 protein associated with said cancer, screening an individual subject for the particular polymoφhism and subjecting said subject to protein replacement therapy or gene therapy to alter the gene or protein to generate a p53 not associated with the cancer.

In this method, gene therapy may be recommended when a particular polymoφhism conferring, for example, a predisposition to cancer is identified in an embryo. Genetically modified stem cells may then be used to alter the genotype of the developing cells. Where an embryo has developed into a fetus or for post-natal subjects, localized gene therapy may still be accomplished although it may be more convenient to undertake protein- replacement therapy or to identify a chemical molecule or agent (e.g. from natural product screening or the screening of a chemical library) which effectively masks a particular undesired polymoφhic variant of the p53 protein or which influences the expression of a more desired phenotype.

Screening of natural products (e.g. from coral, plants, river beds, microorganisms) or of chemical libraries is a useful source of molecules. Alternatively, recombinant forms ofthe more desired proteins may be administered.

It is to be understood that the present invention has application for the evaluation of the cancer risk of an individual with respect to all cancers for which increased risk is associated with a particular p53 phenotypes. Illustrative, and in no way limiting, examples of cancers include breast cancer, prostate cancer, skin cancers (including melanoma), colorectal cancers, brain tumors and the like. This list is in no way exhaustive and it will be readily ascertained by one of skill in the art to which cancers the methods of the present invention can be applied.

In a particularly preferred embodiment ofthe present invention, the methods ofthe present invention have application in the assessment of cancer risk with regard to breast cancer.

The present invention further provides a vector for use in mammalian gene therapy. In one particularly useful example, mammalian cells are engineered to express the p53 pro allele or other alleles not associated with cancer.

The present invention contemplates gene or genetic therapy to provide a p53 allele not associated with cancer or to replace a p53 allele which is associated with cancer. A gene encoding a non-cancer associated p53 (e.g. with a proline at codon 72) may be introduced into the cell in a human artificial chromosome (HAC) vector such that the gene remains extrachromosomal. In such a situation, the gene is expressed by the cell from the extrachromosomal location. If a gene portion is introduced and expressed in a cell carrying a mutant p53 target allele, the gene portion should encode a part of the p53. Vectors for introduction of genes both for recombination and for extrachromosomal maintenance are known in the art and any suitable vector may be used. Methods for introducing DNA into cells such as electroporation calcium phosphate co-precipitation and viral transduction are known in the art.

Gene transfer systems known in the art may be useful in the practice of genetic manipulation. These include viral and non-viral transfer methods. A number of viruses have been used as gene transfer vectors or as the basis for preparing gene transfer vectors, including papovaviruses (e.g. SV40, Madzak et al, J. Gen. Virol. 73: 1533-1536, 1992), adenovirus (Berkner, Curr. Top. Microbiol. Immunol. 158: 39-66, 1992; Berkner et al, BioTechniques 6; 616-629, 1988; Gorziglia and Kapikian, J. Virol. 66: 4407-4412, 1992; Quantin et al, Proc. Natl. Acad. Sci. USA 89: 2581-2584, 1992; Rosenfeld et al, Cell 68: 143-155, 1992; Wilkinson et al, Nucleic Acids Res. 20: 2233-2239, 1992; Stratford- Perricaudet et al, Hum. Gene Ther. 1: 241-256, 1990; Schneider et al, Nature Genetics 18: 180-183, 1998), vaccinia virus (Moss, Curr. Top. Microbiol. Immunol 158: 25-38, 1992; Moss, Proc. Natl. Acad. Sci. USA 93: 11341-11348, 1996), adeno-associated virus (Muzyczka, Curr. Top. Microbiol. Immunol. 158: 97-129, 1992; Ohi et al, Gene 89: 279- 282, 1990; Russell and Hirata, Nature Genetics 18: 323-328, 1998), heφesviruses including HSV and EBV (Margolskee, Curr. Top., Microbiol. Immunol. 158: 67-95, 1992; Johnson et al., J. Virol. 66: 2952-2965, 1992; Fink et al, Hum. Gene Ther. 3: 11-19, 1992; Breakefield and Geller, Mol. Neurobiol 1: 339-371, 1987; Freese et al, Biochem. Pharmacol. 40: 2189-2199, 1990; Fink et al, Ann. Rev. Neurosci. 19: 265-287, 1996), lentiviruses (Naldini et al, Science 272: 263-267, 1996), Sindbis and Semliki Forest virus (Berglund et al, Biotechnology 11: 916-920, 1993) and retroviruses of avian (Bandyopadhyay and Temin, Mol. Cell Biol. 4: 749-754, 1984; Petropoulos et al, J. Viol. 66: 3391-3397, 1992), murine (Miller, Curr. Top. Microbiol. Immunol. 158: 1-24, 1992; Miller et al, Mol. Cell. Biol 5: 431-437, 1985; Sorge et al, Mol. Cell. Biol. 4: 1730-1737, 1984; and Baltimore, J. Virol. 54: 401-407, 1985; Miller et al, J. Virol 62: 4337-4345, 1988) and human (Shimada et al, J. Clin. Invest. 88: 1043-1047, 1991; Helseth et al, J. Virol 64: 2416-2420, 1990; Page et al, J. Virol. 64: 5270-5276, 1990; Buchschacher and Panganiban, J. Virol 66: 2731-2739, 1982) origin.

Non-viral gene transfer methods are known in the art such as chemical techniques including calcium phosphate co-precipitation, mechanical techniques, for example, microinjection, membrane fusion-mediated transfer via liposomes and direct DNA uptake and receptor-mediated DNA transfer. Viral-mediated gene transfer can be combined with direct in vivo gene transfer using liposome delivery, allowing one to direct the viralvectors to particular cells. Alternatively, the retroviral vector producer cell line can be injected into particular tissue. Injection of producer cells would then provide a continuous source of vector particles.

In an approach which combines biological and physical gene transfer methods, plasmid DNA of any size is combined with a polylysine-conjugated antibody specific to the adenovirus hexon protein and the resulting complex is bound to an adenovirus vector. The trimolecular complex is then used to infect cells. The adenovirus vector permits efficient binding, intemalization and degradation of the endosome before the coupled DNA is damaged. For other techniques for the delivery of adenovirus based vectors, see U.S. Patent No. 5,691,198.

Liposome/DNA complexes have been shown to be capable of mediating direct in vivo gene transfer. While in standard liposome preparations the gene transfer process is non-specific, localized in vivo uptake and expression may occur, for example, following direct in situ administration.

In an alternative embodiment, antisense- or sense-mediated gene silencing may be employed to down-regulate ap53 allele which is associated with cancer.

Antisense polynucleotide sequences are particularly useful in preventing or diminishing the expression of a cancer p53 allele. Polynucleotide vectors, for example, containing all or a portion of a p53 allele associated with cancer may be placed under the control of a promoter in an antisense orientation and introduced into a cell. Expression of such an antisense construct within a cell interferes with p53 transcription and/or translation.

Furthermore, co-suppression and mechanisms to induce RNAi (i.e. siRNA) may also be employed. Alternatively, antisense or sense molecules may be administered directly. In this latter embodiment, the antisense or sense molecules may be formulated in a composition and then administered by any number of means to target cells. Antisense polynucleotide sequences are useful in preventing or diminishing the expression of a p53 allele associated with cancer. Polynucleotide vectors, for example, containing all or a portion of the target p53 locus may be placed under the control of a promoter in an antisense orientation and introduced into a cell. Expression of such an antisense construct within a cell will interfere with p53 transcription and/or translation. Furthermore, co- suppression and mechanisms to induce RNAi (i.e. siRNA) may also be employed. Such techniques may be useful to inhibit genes which positively promote p53 expression. Alternatively, antisense or sense molecules may be directly administered. In this latter embodiment, the antisense or sense molecules may be formulated in a composition and then administered by any number of means to target cells.

A variation on antisense and sense molecules involves the use of moφholinos, which are oligonucleotides composed of moφholine nucleotide derivatives and phosphorodiamidate linkages (for example, Summerton and Weller, Antisense and Nucleic Acid Drug Development 7: 187-195, 1997). Such compounds are injected into embryos and the effect of interference with mRNA is observed.

In one embodiment, the present invention employs compounds such as oligonucleotides and similar species for use in modulating the function or effect of nucleic acid molecules encoding p53, i.e. the oligonucleotides induce transcriptional or post-transcriptional gene silencing. This is accomplished by providing oligonucleotides which specifically hybridize with one or more nucleic acid molecules encoding p53. As used herein, the terms "target nucleic acid" and "nucleic acid molecule encoding p53" have been used for convenience to encompass DNA encoding p53, RNA (including pre-mRNA and mRNA or portions thereof) transcribed from such DNA, and also cDNA derived from such RNA. The hybridization of a compound of the subject invention with its target nucleic acid is generally referred to as "antisense". Consequently, the preferred mechanism believed to be included in the practice of some preferred embodiments of the invention is referred to herein as "antisense inhibition." Such antisense inhibition is typically based upon hydrogen bonding-based hybridization of oligonucleotide strands or segments such that at least one strand or segment is cleaved, degraded, or otherwise rendered inoperable. In this regard, it is presently preferred to target specific nucleic acid molecules and their functions for such antisense inhibition.

Antisense oligonucleotides are particularly preferred such as those comprising from about 8 to about 80 nucleobases (i.e. from about 8 to about 80 linked nucleosides). One of ordinary skill in the art will appreciate that the present invention embodies compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleobases in length.

The open reading frame (ORF) or "coding region" which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is a region which may be targeted effectively. Within the context of the present invention, one region is the intragenic region encompassing the translation initiation or termination codon ofthe open reading frame (ORF) of a gene.

Other target regions include the 5' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA (or corresponding nucleotides on the gene), and the 3' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA (or corresponding nucleotides on the gene). The 5' cap site of an mRNA comprises an N7-methylated guanosine residue joined to the 5 '-most residue of the mRNA via a 5 '-5' triphosphate linkage. The 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap site. It is also preferred to target the 5' cap region.

Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as "introns", which are excised from a transcript before it is translated. The remaining (and, therefore, translated) regions are known as "exons" and are spliced together to form a continuous mRNA sequence. Targeting splice sites, i.e. intron- exon junctions or exon-intron junctions, may also be particularly useful in situations where aberrant splicing is implicated in disease, or where an oveφroduction of a particular splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred target sites. mRNA transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources are known as "fusion transcripts". It is also known that introns can be effectively targeted using antisense compounds targeted to, for example, DNA or pre-mRNA.

As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion ofthe nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound, however, linear compounds are generally preferred. In addition, linear compounds may have internal nucleobase complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.

Preferred modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 '-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3 '-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more intemucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Preferred oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3 '-most intemucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.

Many of the preferred features described above are appropriate for sense nucleic acid molecules.

The present invention further provides a kit useful in determining the p53 allele expressed in a cell. The kit is conveniently in a multi-compartment form wherein a first compartment is adopted to comprise one or more isolated polynucleotide probes or primer sets specific for a codon sequence within ap53 allele or mRNA transcript thereof. A third compartment may also be adopted to comprise reagents for the reverse transcription and/or amplification of the p53 allele transcript using the primer set. In addition to these components, instructions for the use ofthe kit may also included.

Accordingly, in one preferred aspect, the present invention provides a diagnostic kit for detecting aρ53 allele expressed by a cell, said kit comprising:-

(i) one or more isolated polynucleotide probes or primer sets specific for the mRNA transcript of a p53 allele;

(ii) reagents for detecting the specific hybridization between said polynucleotide probes and/or primer sets and saidp53 allele transcript;

(iii) reagents for the reverse transcription and/or amplification of said p53 allele transcript using said primer set; and

(iv) instructions for the use of said kit. In a preferred embodiment of the present invention, the primers and/or probes of the kit can detect and differentiate between the p53 pro allele and the p53 αrg allele or p53 ser allele.

The present invention is further described by the following non-limiting examples.

EXAMPLE 1 Materials

The present study included 380 Asian healthy subjects (140 Chinese, 96 Malay and 144 Indian) and about 94 Chinese breast cancer samples. The latter were obtained from the National Cancer Center tissue repository upon written approval from the repository management. DNA and RNA from blood cells from the healthy subjects were obtained from another study described in Balram et al, Pharmacogenetics 12(1): 81-83, 2002). DNA from tumor tissues were isolated using chloroform/phenol extraction followed by ethanol precipitation (Nucleic Acid Extractor 340 A; Applied Biosystems) according to standard procedures. Immunohistological assessment of estrogen receptor and ERBB2 receptor status along with breast cancer staging data were provided by Department of Pathology at Singapore General Hospital. EXAMPLE 2 Genotyping

DNA from blood samples was analyzed for the genetic variation in codon 72 in exon 4 of the p53 gene. This genomic DNA (0.5 μg) was used in 25 μl PCR reactions in thermal cycler (PTC-100, MJ Research Inc). Exon 2 to exon 4 of p53 was amplified using 15 pmol of each primer: NS 11584 5'- TCAGACACTGGCATGGTGTT - 3' (SEQ ID NO:4) and NS 12403 5' - AAGCCTAAGGGTGAAGAGGA - 3' (SEQ ID NO:5), 10X PCR buffer, Taq DNA polymerase (Qiagen) and dNTP mix. A 800 bp fragment was amplified using PCR program starting with denaturation for 3 min at 94°C, followed by 30 cycles of 30 sec at 94°, 40 sec at 68°C and 1 min at 72°C with a final extension at 72°C for 8 min. The PCR product was then run on a 1.2% w/v agarose gel and a 800 bp band which is specific for exon 2 to exon 4 was excised and purified from the gel using QIAquick Gel Extraction Kit. This gel purified PCR product was used for restriction digestion and also for sequencing to confirm the results. Restriction analysis was performed using 10 μl of PCR product, 7 μl of dH₂O, 2 μl of NEB Buffer (10X) and 1 μl (10 units/μl) of BstUI (New England BioLabs) and incubated at 60°C for 3 hours. The digested product was then run on a 1.5% w/v agarose gel to visualize the banding pattern. The p53 arg allele has a unique BstUI site (cgcg) and it produces two bands (200 bp and 600 bp). This site is absent in the pro allele and, hence, this allele remains uncut (800 bp band). The heterozygotes give rise to three bands (800 bp, 200 bp and 600 bp).

To determine the sensitivity of the analysis, various amounts of p53 pro or p53 arg RNA were mixed and used these mixtures as templates for PCR and subsequent BstUl restriction analysis and sequencing. PCR analysis was performed using the Hp53Ex-2 and Hp53Ex-l 1 primers (see below) and conditions as described above. The BstUl restriction digest results in two bands for the pro allele (750 and 500) and three bands for the arg allele (750, 280 and 220).

EXAMPLE 3 Mutational analysis and sequencing

RNA was extracted from the breast tumor tissues using TRIZOL Reagent. p53 status was detected by RT-PCR using QIA One-Step RT-PCR Kit with ρ53 specific primers (Hp53Ex-2-For 5'-ATGGAGGAGCCGCAGTCAGATCCTA- 3' 9 (SEQ ID NO: 6) and Hp53Ex-ll-Rev 5'-GTCTGAGTCAGGCCCTTCTGTCTTGA- 3' (SEQ ID NO:7)). RT- PCR conditions employed was as follows: 30 min and 30 sec at 51°C, 15 min at 95°C, followed by 36 cycles of 40 sec at 94°C, 1 min at 53°C, 1 min 30 sec at 72°C. The reaction mix was incubated for final extension at 72°C for 8 min. RT-PCR product was run on an agarose gel and the band for p53 cDNA was extracted as described above and used for sequencing. Sequencing reactions were done using Big Dye Terminator version 3 (Applied Biosystems) and ABI 377 DNA sequencer (Applied Biosystems) according to the manufacturer's instruction. Following primers which amplify in an overlapping manner in the p53 gene were used to confirm the sequence: Hp53Ex-2 5'- ATGGAGGAGCCGCAGTCAGATCCTA-3' (SEQ ID NO:6), p53(400) 5'- TTGCCAACTGGCCAAGAC-3' (SEQ ID NO:8) , p53(600) 5'- CTTATCCGAGTGGAAGGA-3' (SEQ ID NO:9) and p53(800) 5'- AACAGCTTTGAGGTGCGT-3' (SEQ ID NOJO). p53 status was analyzed using BLAST 2 Sequence program from NCBI website. EXAMPLE 4 Statistical Analysis

Inter-ethnic comparisons of genotype and allelic frequencies and assessment of Hardy- Weinberg equilibrium were performed using Pearson chi-square goodness-of-fit test. A Normal test was used to test the null hypothesis that the proportion of breast cancer patients expressing the arg allele is the same as those expressing the pro allele. EXAMPLE 5 Analysis of the p53 polymorphic status in the Asian population

The germline status of the p53 polymoφhic alleles with variation at codon 72 was examined in a sample of the healthy Asian population in Singapore, which consisted of subjects from Chinese (n = 140), Malaysian (n = 96) and Indian (n = 144) ancenstry. PCR analysis followed by both restriction digestion and sequencing, as described in Examples 2 and 3, was used to identify p53 polymoφhisms. The frequencies ofthe polymoφhic alleles are shown in Table 4. The genotype frequencies in all three ethnic groups were not significantly different from that predicted by the Hardy- Weinberg equation. The genotype frequency ofthe homozygous Ar^Arg genotype was highest in the Chinese group (32.9%) - who had the lightest skin tan among the three populations - but similar in the Malay and Indian groups (24.0% and 20.8%, respectively) (Table 4). In contrast, a higher proportion of the Indian and Malaysian groups were found to be Pro/Pro homozygotes compared to the Chinese group. Similarly, the frequency of the arg allele was highest in the Chinese group whilst that of the pro allele was highest in the Malaysian and Indian groups (Table 4). All three populations had roughly similar levels of heterozygotes (about 45%).

There was a significant difference in the allelic frequencies between the Chinese subjects and the Malaysian/Indian subjects whereas there was no difference between the Malaysian and Indian subjects (Table 5). Comparison of these data with the previously published data on Caucasians and Africans indicate that the distribution of genotype and allelic frequencies in the three Asian populations are significantly different from Caucasians (p<0.001) (Table 6). However, only the Chinese group was found to have a statistically significant difference in the genotype and allelic frequencies when compared to Africans (pO.OOl). Hence, the data confirm and extend previous reports that populations with fairer skin color tend to consist of Arg homozygotes whereas populations with darker skin tan tend to have a larger proportion of Pro homozygotes.

TABLE 4 Genotype and allele frequencies at codon 72 ofthep53 gene in Asian population

TABLE 5 Significance (p-values) in Chi-square test of differences in genotype frequencies between pairs of study populations

* from Beckman et al, 1994, supra

Those frequencies in parenthesis are P-values using exact test.

TABLE 6 P-values) in Chi-square test of differences in allele frequencies between the Asians and other populations

* from Beckman et al, 1994, supra

Those frequencies in parenthesis are P-values using exact test.

EXAMPLE 6 Preferential expression ofthep53pro allele inp53 heterozygotes

It was hypothesized that the Chinese population that had settled around the Equator would be better adapted to sunlight than Caucasians. Hence, an investigation into whether there is a preference for a specific allele to be expressed in the p53 germline heterozygotes (Arg/Pro), who make up almost half of the total population. To this end, RNA was extracted from healthy germline heterozygote samples and the expressed allele was determined both by sequencing and restriction enzyme digestion as shown in Figures 1A and IB. Strikingly, all the heterozygote samples analyzed showed the expression of only the pro allele sequence (representative samples shown in Figures 1A and IB). The presence of minute amounts of the G nucleotide encoding for an Arg was not detectable (see arrows, Figure IB). In order to rule out a lack of sensitivity that might have led to the preferential detection of the pro allele (C nucleotide), reconstitution experiments were performed to verify the data. Varying ratios of p53 pro RNA and p53 arg RNA were mixed and used as template for sequencing and restriction enzyme analysis (Figures 1C and ID). It was found that the presence of 10% of either ro or arg RNA in the total template mixture could be detected by restriction digestion analysis (Figure 1C) and by sequencing (Figure ID, see arrows pointing to traces ofthe peaks), indicating that unequal and varying expression of both alleles can be detected by the methods employed in this study. Hence, all germline heterozygotes expressed only the pro allele at the RNA level, thus skewing the number of p53 pro expressers (together with the Pro homozygotes) to about 67% ofthe total population (p < 0.003) (Figure IE). Thus, there appears to be a bias in the selection of the pro allele to be preferentially expressed in the germline heterozygotes in the Chinese population.

EXAMPLE 7 Preferential expression ofthep53 arg allele in breast cancer

As there is a selective preference for the expression of the p53 pro allele in the healthy Chinese population, an investigation was undertaken to determine if there is a correlation between susceptibility to cancer and the expression status of a p53 polymoφhism at codon 72. A total of 94 breast cancer samples were obtained from Chinese patients and screened extensively for mutations in the entire coding region of the p53 gene as well as for the expression status of the polymoφhic variants at codon 72. More than half of the tumor samples (about 57%) that were analyzed expressed the arg allele at the RNA level, compared with 33% in healthy subjects (Figure 2A). Concomitantly, the number of pro allele expressers in the breast cancer population was reduced compared to healthy subjects (Figure 2A). The difference between the number of p53 arg andp53 pro expressers in the breast cancer samples is a statistically significant (p=0.0003). Thus, the αrg allele is significantly over-expressed in cancers compared to its germline frequency in the Chinese population, suggesting that the αrg allele expressing group of people are more susceptible to breast cancer. EXAMPLE 8 Mutations associated with breast cancer in patients carrying thep53 arg allele compared to patients carrying the p53 pro allele

An evaluation was carried out to investigate the role of the p53 codon 72 polymoφhism with respect to mutations found in the p53 gene in the breast cancer samples. No mutations were detected in 69% of tumor samples carrying the arg allele (Figure 2B). In contrast, about 55% of The p53 pro allele expressing cancer samples had a mutation in the p53 gene. Detailed analysis revealed that 63% of all the mutations in the Arg samples were recessive mutations that were predominantly found outside the DBD of p53 (Figure 3). This suggests that the presence of the arg allele might not require a strong inactivating mutation in p53, as the arg allele itself might be a "weaker" p53 variant, thus contributing to the development of cancer. Ofthe mutations found outside the DBD, about 25% of them were on codon 80, which is in the proline-rich region, resulting in the substitution of a proline to serine residue (Figure 3). The others were spread in the transactivation domain, tetramerization domain and the C-terminus. It was found that two new previously unreported mutation in amino acids 27 (Pro to Ser) and 37 (Ser to Pro). By contrast, the pro allele expressing tumors almost always carried a mutation in the DBD, which accounted for about 92% of all mutations (Figure 3). This suggests that there is a strong genetic pressure to selectively mutate the p53 gene at the DBD in the presence of a pro allele at codon 72 as compared to the arg allele (p = 0.017).

EXAMPLE 9 Breast cancer in Chinese heterozygotes

Figures 5 through 7 relate to Chinese individuals who are heterozygotes for arg/pro. Caucasian heterozygotes generally express the arg allele. The results in Figure 5 show that Chinese heterozygotes preferentially express The pro allele. Consequently, Chinese Asians are less likely to succumb to cancer. Figure 6 shows that Chinese heterozygote patients which do express the arg allele probably do so due to activation of this allele during carcinogenesis. Consequently, re-activation of the silent arg allele during cancer development can be used as a marker for cellular transformation. Figure 7 shows the status of the p53 and 72 polymoφhic allele can be used as a diagnostic marker for cancer development.

EXAMPLE 10 Generation ofp53 codon 72 polymorphic-specific antibodies

Both polyclonal and monoclonal antibodies have been generated specific for either the p53 codon 72-arg form or the p53 codon 72-pro form, which can be used to distinguish between the expression ofthe two forms ofthe p53 alleles.

The results indicate that the antibodies are specific to the respective forms and the cross- reactivity is minimal.

A ELISA based titration of the antibodies against both the proline or arginine peptides were performed.

The representative result using the p53 codon 72-Proline-specific antibody (polyclonal) is shown in Figure 8.

The antibody was diluted as indicated at various ratios and used in an ELISA test against either the proline peptide or the arginine peptide. The results clearly indicate that the antibody is specific for the proline form , and the limited cross-reactivity against the arginine form diminishes when the antibody is used at larger dilutions.

Similarly, the p53 codon72-arginine-specific antibody was tested against both the arginine or proline peptides.

The representative result using the p53 codon 72-Arginine-specific antibody (polyclonal) is shown in Figure 9.

The antibody was diluted as indicated at various ratios and used in an ELISA test against either the arginine peptide or the proline peptide. The results clearly indicate that the antibody is specific for the arginine form , and the limited cross-reactivity against the proline form diminishes at dilutions of around 1:6000.

Hence, both p53 codon 72-allele-specific antibodies can be used for the detection of expression ofthe different alleles in all types of human samples, including tumor samples.

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

BIBLIOGRAPHY

Balram et al, Pharmacogenetics 12(1): 81-83, 2002

Baltimore, . Virol. 54: 401-407, 1985

Bandyopadhyay and Temin, Mol. Cell. Biol. 4: 749-754, 1984

Beckman et al, Hum. Hered.44(5): 266-270, 1994

Berglund et al, Biotechnology 11: 916-920, 1993

Berkner et al, BioTechniques 6; 616-629, 1988

Berkner, Curr. Top. Microbiol. Immunol 158: 39-66, 1992

Breakefield and Geller, Mol. Neurobio 1: 339-371, 1987

Buchschacher and Panganiban, . Virol. 66: 2731-2739, 1982

Chene, Nat. Rev. Cancer 3(2): 102-109, 2003

Douillard and Hoffman, Basic Facts about Hybridomas, in Compendium of Immunology

Vol. π, ed. by Schwartz, 1981

Dumont etal, Nat. Genet. 33(3): 357-365, 2003

Dunning et al, Cancer Epidemiol. Biomarkers Prev. 8(10): 843-854, 1999

Fink et al, Ann. Rev. Neurosci. 19: 265-287, 1996

Fink et /., Hwm. Gene Ther. 3: 11-19, 1992

Freese et al, Biochem. Pharmacol. 40: 2189-2199, 1990

Gorziglia and Kapikian, /. Virol 66: 4407-4412, 1992

Hainaut and Hollstein, Adv. Cancer Res. 77: 81-137, 2000

Helseth etal, J. Virol. 64: 2416-2420, 1990

Hoffineyer et α/., Hwm. Mol Genet. 4(8): 1267-1272, 1995

Jacoby et al, Neurogenetics 2(2): 101-108, 1999

Jin et al, Carcinogenesis 16: 2205-2208, 1995 Johnson et al, J. Virol. 66: 2952-2965, 1992

Kaghad etα ., Cell 90(4): 809-819, 1997

Kawajiri etal., Carcinogenesis 14: 1085-1089, 1993

Kohler and Milstein, European Journal of Immunology 6: 511-519, 1976

Kohler and Milstein, Nature 256: 495-499, 1975

Madzak et al., J. Gen. Virol. 73: 1533-1536, 1992

Margolskee, Curr. Top., Microbiol. Immunol. 158: 67-95, 1992

Marin et al, Nat. Genet. 25: 47-54, 2000

Miller et al, J. Virol. 62: 4337-4345, 1988

Miller et al, Mol Cell Biol 5: 431-437, 1985

Miller, Curr. Top. Microbiol. Immunol. 158: 1-24, 1992

Moll et al, Proc. Natl. Acad. Sci. USA 92(10): 4407-4411, 1995

Moss, Curr. Top. Microbiol. Immunol 158: 25-38, 1992

Moss, Proc. Natl. Acad. Sci. USA 93: 11341-11348, 1996

Murata et al, Carcinogenesis 17: 261-264, 1996

Muzyczka, Curr. Top. Microbiol. Immunol. 158: 97-129, 1992

Naldini et al, Science 272: 263-267, 1996

Ohi et al, Gene 89: 279-282, 1990

Oren, Cell Death Differ. 10(4): 431-442, 2003

Page et al, J. Virol. 64: 5270-5276, 1990

Papadakis et al, Mol. Cell. Biol. Res. Commun. 3: 389-392, 2000

Petropoulos etal, J. Viol 66: 3391-3397, 1992

Quantin et al, Proc. Natl. Acad. Sci. USA 89: 2581-2584, 1992

Rosenfeld et al, Cell 68: 143-155, 1992 Rosenthal et al, Lancet 352: 871-872, 1998

Russell and Hirata, Nature Genetics 18: 323-328, 1998

Schneider et al, Nature Genetics 18: 180-183, 1998

Shimada et al, J. Clin. Invest. 88: 1043-1047, 1991

Sjalander et al, Carcinogenesis (Lond.) 17: 1313-1316, 1996 -

Sorge etβ/., Mol. Cell. Biol 4: 1730-1737, 1984

Storey et al, Nature 393(6682): 229-234, 1998

Sfratford-Perricaudet et α/., HMm. Gene Ther. 1: 241-256, 1990

Summerton and Weller, Antisense and Nucleic Acid Drug Development 7: 187-195, 1997

Suspitsin et al, Int. J. Cancer 103(3): 431-433, 2003

Thomas etal. Mol. Cell Biol. 19: 1092-1100, 1999

Vousden and Lu, Nat. Rev. Cancer 2(8): 594-604, 2002

Walker and Levine, Proc. Natl. Acad. Sci USA 93(26): 15335-15340, 1996

Weston et al, Carcinogensis 15: 583-587, 1994

Wilkinson et al, Nucleic Acids Res. 20: 2233-2239, 1992

SEQUENCE LISTING

<110> SABAPATHY, Kanaga

<120> Method of assessing cancer risk

<130> 12464450/EJH

<150> AU 2003903274 <151> 2004-06-25

<160> 10

<170> Patentln version 3.1

<210> 1

<211> 1182

<212> DNA

<213> homosapien

<400> 1 atggaggagc cgcagtcaga tcctagcgtc gagccccctc tgagtcagga aacattttca 60

gacctatgga aactacttcc tgaaaacaac gttctgtccc ccttgccgtc ccaagcaatg 120

gatgatttga tgctgtcccc ggacgatatt gaacaatggt tcactgaaga cccaggtcca 180

gatgaagctc ccagaatgcc agaggctgct ccccgcgtgg cccctgcacc agcagctcct 240

acaccggcgg cccctgcacc agccccctcc tggcccctgt catcttctgt cccttcccag 300

aaaacctacc agggcagcta cggtttccgt ctgggcttct tgcattctgg gacagccaag 360

tctgtgactt gcacgtactc ccctgccctc aacaagatgt tttgccaact ggccaagacc 420

tgccctgtgc agctgtgggt tgattccaca cccccgcccg gcacccgcgt ccgcgccatg 480

gccatctaca agcagtcaca gcacatgacg gaggttgtga ggcgctgccc ccaccatgag 540

cgctgctcag atagcgatgg tctggcccct cctcagcatc ttatccgagt ggaaggaaat 600 ttgcgtgtgg agtatttgga tgacagaaac acttttcgac atagtgtggt ggtgccctat 660

gagccgcctg aggttggctc tgactgtacc accatccact acaactacat gtgtaacagt 720

tcctgcatgg gcggcatgaa ccggaggccc atcctcacca tcatcacact ggaagactcc 780

agtggtaatc tactgggacg gaacagcttt gaggtgcgtg tttgtgcctg tcctgggaga 840

gaccggcgca cagaggaaga gaatctccgc aagaaagggg agcctcacca cgagctgccc 900

ccagggagca ctaagcgagc actgcccaac aacaccagct cctctcccca gccaaagaag 960

aaaccactgg atggagaata tttcaccctt cagatccgtg ggcgtgagcg cttcgagatg 1020

ttccgagagc tgaatgaggc cttggaactc aaggatgccc aggctgggaa ggagccaggg 1080

gggagcaggg ctcactccag ccacctgaag tccaaaaagg gtcagtctac ctcccgccat 1140

aaaaaactca tgttcaagac agaagggcct gactcagact ga 1182

<210> 2

<211> 393

<212> PRT

<213> homosapien

<400> 2

Met Glu Glu Pro Gin Ser Asp Pro Ser Val Glu Pro Pro Leu Ser Gin 1 5 10 15

Glu Thr Phe Ser Asp Leu Trp Lys Leu Leu Pro Glu Asn Asn Val Leu 20 25 30

Ser Pro Leu Pro Ser Gin Ala Met Asp Asp Leu Met Leu Ser Pro Asp 35 40 45

Asp lie Glu Gin Trp Phe Thr Glu Asp Pro Gly Pro Asp Glu Ala Pro 50 55 ^' 60 Arg Met Pro Glu Ala Ala Pro Arg Val Ala Pro Ala Pro Ala Ala Pro 65 70 75 80

Thr Pro Ala Ala Pro Ala Pro Ala Pro Ser Trp Pro Leu Ser Ser Ser 85 90 95

Val Pro Ser Gin Lys Thr Tyr Gin Gly Ser Tyr Gly Phe Arg Leu Gly 100 105 110

Phe Leu His Ser Gly Thr Ala Lys Ser Val Thr Cys Thr Tyr Ser Pro 115 120 125

Ala Leu Asn Lys Met Phe Cys Gin Leu Ala Lys Thr Cys Pro Val Gin 130 135 140

Leu Trp Val Asp Ser Thr Pro Pro Pro Gly Thr Arg Val Arg Ala Met 145 150 155 160

Ala He Tyr Lys Gin Ser Gin His Met Thr Glu Val Val Arg Arg Cys 165 170 175

Pro His His Glu Arg Cys Ser Asp Ser Asp Gly Leu Ala Pro Pro Gin 180 185 190

His Leu He Arg Val Glu Gly Asn Leu Arg Val Glu Tyr Leu Asp Asp 195 200 205

Arg Asn Thr Phe Arg His Ser Val Val Val Pro Tyr Glu Pro Pro Glu 210 215 220

Val Gly Ser Asp Cys Thr Thr He His Tyr Asn Tyr Met Cys Asn Ser 225 230 235 240

Ser Cys Met Gly Gly Met Asn Arg Arg Pro He Leu Thr He He Thr 245 250 255 Leu Glu Asp Ser Ser Gly Asn Leu Leu Gly Arg Asn Ser Phe Glu Val 260 265 270

Arg Val Cys Ala Cys Pro Gly Arg Asp Arg Arg Thr Glu Glu Glu Asn 275 280 285

Leu Arg Lys Lys Gly Glu Pro His His Glu Leu Pro Pro Gly Ser Thr 290 295 300

Lys Arg Ala Leu Pro Asn Asn Thr Ser Ser Ser Pro Gin Pro Lys Lys 305 310 315 320

Lys Pro Leu Asp Gly Glu Tyr Phe Thr Leu Gin He Arg Gly Arg Glu 325 330 335

Arg Phe Glu Met Phe Arg Glu Leu Asn Glu Ala Leu Glu Leu Lys Asp 340 345 350

Ala Gin Ala Gly Lys Glu Pro Gly Gly Ser Arg Ala His Ser Ser His 355 360 365

Leu Lys Ser Lys Lys Gly Gin Ser Thr Ser Arg His Lys Lys Leu Met 370 375 380

Phe Lys Thr Glu Gly Pro Asp Ser Asp 385 390

<210> 3

<211> 2629

<212> DNA

<213> homosapien

<400> 3 acttgtcatg gcgactgtcc agctttgtgc caggagcctc gcaggggttg atgggattgg 60

ggttttcccc tcccatgtgc tcaagactgg cgctaaaagt tttgagcttc tcaaaagtct 120 agagccaccg tccagggagc aggtagctgc tgggctccgg ggacactttg cgttcgggct 180

gggagcgtgc tttccacgac ggtgacacgc ttccctggat tggcagccag actgccttcc 240

gggtcactgc catggaggag ccgcagtcag atcctagcgt cgagccccct ctgagtcagg 300

aaacattttc agacctatgg aaactacttc ctgaaaacaa cgttctgtcc cccttgccgt 360

cccaagcaat ggatgatttg atgctgtccc cggacgatat tgaacaatgg ttcactgaag 420

acccaggtcc agatgaagct cccagaatgc cagaggctgc tccccgcgtg gcccctgcac 480

cagcagctcc tacaccggcg gcccctgcac cagccccctc ctggcccctg tcatcttctg 540

tcccttccca gaaaacctac cagggcagct acggtttccg tctgggcttc ttgcattctg 600

ggacagccaa gtctgtgact tgcacgtact cccctgccct caacaagatg ttttgccaac 660

tggccaagac ctgccctgtg cagctgtggg ttgattccac acccccgccc ggcacccgcg 720

tccgcgccat ggccatctac aagcagtcac agcacatgac ggaggttgtg aggcgctgcc 780

cccaccatga gcgctgctca gatagcgatg gtctggcccc tcctcagcat cttatccgag 840

tggaaggaaa tttgcgtgtg gagtatttgg atgacagaaa cacttttcga catagtgtgg 900

tggtgcccta tgagccgcct gaggttggct ctgactgtac caccatccac tacaactaca 960

tgtgtaacag ttcctgcatg ggcggcatga accggaggcc catcctcacc atcatcacac 1020

tggaagactc cagtggtaat ctactgggac ggaacagctt tgaggtgcgt gtttgtgcct 1080

gtcctgggag agaccggcgc acagaggaag agaatctccg caagaaaggg gagcctcacc 1140

acgagctgcc cccagggagc actaagcgag cactgcccaa caacaccagc tcctctcccc 1200

agccaaagaa gaaaccactg gatggagaat atttcaccct tcagatccgt gggcgtgagc 1260 gcttcgagat gttccgagag ctgaatgagg ccttggaact caaggatgcc caggctggga 1320

aggagccagg ggggagcagg gctcactcca gccacctgaa gtccaaaaag ggtcagtcta 1380

cctcccgcca taaaaaactc atgttcaaga cagaagggcc tgactcagac tgacattctc 1440

cacttcttgt tccccactga cagcctccca cccccatctc tccctcccct gccattttgg 1500

gttttgggtc tttgaaccct tgcttgcaat aggtgtgcgt cagaagcacc caggacttcc 1560

atttgctttg tcccggggct ccactgaaca agttggcctg cactggtgtt ttgttgtggg 1620

gaggaggatg gggagtagga cataccagct tagattttaa ggtttttact gtgagggatg 1680

tttgggagat gtaagaaatg ttcttgcagt taagggttag tttacaatca gccacattct 1740

aggtaggtag gggcccactt caccgtacta accagggaag ctgtccctca tgttgaattt 1800

tctctaactt caaggcccat atctgtgaaa tgctggcatt tgcacctacc tcacagagtg 1860

cattgtgagg gttaatgaaa taatgtacat ctggccttga aaccaccttt tattacatgg 1920

ggtctaaaac ttgaccccct tgagggtgcc tgttccctct ccctctccct gttggctggt 1980

gggttggtag tttctacagt tgggcagctg gttaggtaga gggagttgtc aagtcttgct 2040

ggcccagcca aaccctgtct gacaacctct tggtcgacct tagtacctaa aaggaaatct 2100

caccccatcc cacaccctgg aggatttcat ctcttgtata tgatgatctg gatccaccaa 2160

gacttgtttt atgctcaggg tcaatttctt ttttcttttt tttttttttt tttctttttc 2220

tttgagactg ggtctcgctt tgttgcccag gctggagtgg agtggcgtga tcttggctta 2280

ctgcagcctt tgcctccccg gctcgagcag tcctgcctca gcctccggag tagctgggac 2340

cacaggttca tgccaccatg gccagccaac ttttgcatgt tttgtagaga tggggtctca 2400 cagtgttgcc caggctggtc tcaaactcct gggctcaggc gatccacctg tctcagcctc 2460

ccagagtgct gggattacaa ttgtgagcca ccacgtggag ctggaagggt caacatcttt 2520

tacattctgc aagcacatct gcattttcac cccacccttc ccctccttct ccctttttat 2580

atcccatttt tatatcgatc tcttatttta caataaaact ttgctgcca 2629

<210> 4

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> NS 11584 primer

<400> 4 tcagacactg gcatggtgtt 20

<210> 5

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> NS 12403 primer

<400> 5 aagcctaagg gtgaagagga 20 <210> 6

<211> 25

<212> DNA

<213> artificial sequence

<220>

<223> Hp53 Ex-2-for ard primer

<400> 6 atggaggagc cgcagtcaga tccta 25

<210> 7

<211> 26

<212> DNA

<213> artificial sequence

<220>

<223> Hp53 Ex-11 reverse primer

<400> 7 gtctgagtca ggcccttctg tcttga 26

<210> 8

<211> 18

<212> DNA

<213> artificial sequence

<220>

<223> p53 (400) primer

<400> 8 ttgccaactg gccaagac 18 <210> 9

<211> 18

<212> DNA

<213> artificial sequence

<220>

<223> p53 (600) primer

<400> 9 cttatccgag tggaagga 18

<210> 10

<211> 18

<212> DNA

<213> artificial sequence

<220>

<223> p53 (800) primer

<400> 10 aacagctttg aggtgcgt 18

1. A method for assessing whether a subject has cancer or has a risk of developing cancer or other disease condition associated with p53 expression or its homolog or ortholog, said method comprising determining the presence or absence of a polymoφhic variation or mutation in a genomic p53 polynucleotide sequence, p53 mRNA transcript sequence and/or p53 amino acid sequence in said subject wherein the presence of a polymoφhic variation or mutation which is associated with a greater risk of cancer or susceptibility of cancer in a particular population is indicative ofthe subject having cancer or a predisposition for development of cancer.

2. The method of Claim 1 wherein the condition associated with p53 is cancer.

3. The method of Claim 2 wherein the cancer is selected from eukemias, lymphomas (Hodgkins and non-Hodgkins), sarcomas, melanomas, adenomas, carcinomas of solid tissue, hypoxic tumors, squamous cell carcinomas, genitourinary cancers such as cervical and bladder cancer, hematopoetic cancers, head and neck cancers, nervous system cancers and benign lesions such as papillomas and the like.

4. The method of Claim 3 wherein the cancer is breast cancer.

5. The method of any one of Claims 1 to 4 wherein the polymoφhism or mutation comprises a single nucleotide variation at a nucleotide selected from 252, 253, 254, 254, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415,

Claims

416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523,' 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 883, 984, 885, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 902, 903, 904, 905, 906, 907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919, 920, 921, 922, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, 953, 954, 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 965, 966, 967, 968, 969, 970, 971, 972, 973, 974, 975, 976, 977, 978, 979, 980, 981, 982, 983, 984, 985, 986, 987, 988, 989, 990, 991, 992, 993, 994, 995, 996, 997, 998, 999, 1001, 1002, 1003, 1004, 1005, 1006, 10071008, 1009, 1010, 1011, 1012, 1013, 1014, 1015, 1016, 1017, 1018, 1019, 1020, 10021 1022,

1023, 1024_: 1025 1026, 1027 1028, 1029 1030, 1031 1032, 1033, 1034, 1035 1036, 1037, 1038 1039 1040, 1041 1042, 1043 1044, 1045 1046, 1047, 1048, 1049_: 1050, 1051, 1052 1053 1054, 1055 1056, 1057 1058, 1059 1060, 1061, 1062, 1063 1064, 1065, 1066 1067 1068, 1069_; 1070, 1071 1072, 1073 1074, 1075, 1076, 1077 1078, 1079, 1080_: 1081 1082, 1083 1084, 1085 1086, 1087. 1088, 1089, 1090, 1091 1092, 1093, 1094 1095 1096, 1097 1098, 1099_: 1100, 1101 1102, 1103, 1104, 1105 1106, 1107, 1108 1109_: 1110, llll 1112, 1113 1114, 1115 1116, 1117, 1118, 1119 1120, 1121, 1122 1123 1124, 1125 1126, 1127 1128, 1129 1130, 1131, 1132, 1133 1134, 1135, 1136 1137 1138, 1139 1140, 1141 1142, 1143 1144, 1145, 1146, 1147 1148, 1149, 1150_: 1151 1152, 1153 1154, 1155 1156, 1157 1158, 1159, 1160, 1161 1162, 1163, 1164 1165 1166, 1167 1168, 1169 1170, 1171 1172, 1173, 1174, 1175 1176, 1177, 1178 1179_; 1180, 1181 1182, 1183 1184, 1185 1186, 1187, 1188, 1189_: 1190, 1191, 1192 1193 1194, 1195 1196, 1197 1198, 1199_: 1200, 1201, 1202, 1203 1204, 1205, 1206 1207 1208, 1209_: 1210, 1211 1212, 1213 1214, 1215, 1216, 1217 1218, 1219, 1220_: 1221 1222, 1223 1224, 1225 1226, 1227 1228, 1229, 1230, 1231 1232, 1233, 1234 1235 1236, 1237 1238, 1239_: 1240, 1241 1242, 1243, 1244, 1245 1246, 1247, 1248 1249_: 1250, 1251 1252, 1253 1254, 1255 1256, 1257, 1258, 1259_; 1260, 1261, 1262 1263 1264, 1265 1266, 1267 1268, 1269 1270, 1271, 1272, 1273 1274, 1275, 1276 1277 1278, 1279 1280, 1281 1282, 1283_: 1284, 1285, 1286, 1287 1288, 1289, 1290_; 1291 1292, 1293 1294, 1295 1296, 1297 1298, 1299, 1300, 1301 1302, 1303, 1304 1305 1306, 1307 1308, 1309 1310, 1311 1312, 1313, 1314, 1315 1316, 1317, 1318 1319 1320, 1321 1322, 1323 1324, 1325 1326, 1327, 1328, 1329 1330, 1331, 1332 1333 1334, 1335 1336, 1337 1338, 1339 1340, 1341, 1342, 1343 1344, 1345, 1346 1347 1348, 1349_: 1350, 1351 1352, 1353 1354, 1355, 1356, 1357 1358, 1359, 1360_; 1361 1362, 1363 1364, 1365 1366, 1367 1368, 1369, 1370, 1371 1372, 1373, 1374 1375 1376, 1377 1378, 1379_; 1380, 1381 1382, 1383, 1384, 1385 1386, 1387, 1388 1389_; 1390, 1391 1392, 1393 1394, 1395 1396, 1397, 1398, 1399_; 1400, 1401, 1402 1403 1404, 1405 1406, 1407 1408, 1409_; 1410, 1411, 1412, 1413 1414, 1415, 141 1417 1418, 1419_: 1420, 1421 1422, 1423 1424, 1425, 1426, 1427 1428,

1429, 1430, 1431, 1432 and 1433 ofSEQ ID NO:l.

6. The method of Claim 5 wherein the polymoφhism or mutation changes a codon selected from amino acid numbers 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40_: 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235_: 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289_: 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392 and 393 of SEQ ID NO:2.

7. The method of Claim 6 wherein the polymoφhism or mutation changes a codon selected from amino acid numbers 21, 36, 46, 47, 72, 80 and 213 of SEQ ID NO:2.

8. The method of Claim 7 wherein the mutation changes a codon at position number 72.

9. The method of Claim 7 wherein the polymoφhism changes a codon at position number 80.

10. The method of Claim 8 wherein the codon at position 72 associated with cancer is selected from Arg, Gly, Ser, Cys, His and Leu.

11. The method of Claim 10 wherein the codon at position 72 associated with cancer is Arg.

12. The method of Claim 9 wherein the codon at position 80 associated with cancer is selected from Ala, Thr, Ser, Arg, His and Leu.

13. The method of Claim 12 wherein the codon at position 80 associated with cancer is Ser.

14. The method of Claim 1 wherein the subject is a human.

15. A method for assessing whether a subject has cancer or has a risk of developing cancer or other disease condition associated with p53 expression or its homolog or ortholog, said method comprising determining the presence or absence of expressed p53 arg 72 and/or p53 ser 80, wherein the presence of a proline and/or serine residue at positions 72 and 80, respectively, is indicative of a greater risk of a subject developing cancer.

16. The method of Claim 15 wherein the subject is a human.

17. The method of Claim 14 or 16 wherein the human subject is of Caucasian or Asian descent.

18. The method of Claim 17 wherein the human subject is of Chinese, Malaysian or Indian descent.

19. A method for determining the relative cancer risk of a Caucasian or ethnic group or a Caucasian or member of an ethnic group, said method comprising examining the skin color and/or latitude of the place of origin of said Caucasian or ethnic group wherein lighter skin color is correlated with an increased frequency of expression of a p53 allele encoding an arginine at codon 72 which is associated with an overall increased cancer risk for a member ofthe said Caucasian or ethnic group.

20. The method of Claim 19 wherein the member is of Asian descent.

21. The method of Claim 19 wherein the member is of Chinese, Malaysian or Indian descent.

22. A method for detecting a polymoφhic or mutant form of a p53 allele or part thereof said method comprising contacting said p53 allele or part thereof with at least two solution phase nucleic acid primers wherein the nucleotide sequence of at least one of the primers is complementary to a target nucleotide sequence within or on the p53 allele or part thereof and wherein the nucleotide sequence of at least another primer differs from said target p53 sequence by at least one nucleotide mis-match and wherein at least one of said at least two primers is labeled with a reporter molecule capable of providing an identifiable signal, wherein said contact is for a time and under conditions sufficient for the nucleic acid primer which is complementary to the target sequence to hybridize to said target sequence with greater efficiency and/or specificity compared to the nucleic acid primer which contains a mis-match and then detecting the relative presence of a signal wherein the relative presence of said signal is indicative of which primer has hybridized to the target sequence depending on which primer has been labeled and the relative presence of a signal is indicative of the identity of the polymoφhic or mutant form of the nucleic acid molecule.

23. The method of Claim 22 wherein the p53 allele is immobilized to a solid support.

24. The method of Claim 22 wherein the polymoφhism or mutation comprises a single nucleotide variation at a nucleotide selected from 252, 253, 254, 254, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 883, 984, 885, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 902, 903, 904, 905, 906, 907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919, 920, 921, 922, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, 953, 954, 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 965, 966, 967, 968, 969, 970, 971, 972, 973, 974, 975, 976, 977, 978, 979, 980, 981, 982, 983, 984, 985, 986, 987, 988, 989, 990, 991, 992, 993, 994, 995, 996, 997, 998, 999, 1001, 1002, 1003, 1004, 1005, 1006, 1007, 1008, 1009, 1010, 1011, 1012, 1013, 1014, 1015, 1016, 1017, 1018, 1019, 1020, 10021, 1022, 1023, 1024, 1025, 1026,

1027 1028, 1029 1030, 1031, 1032 1033, 1034, 1035, 1036, 1037, 1038, 1039, 1040,

1041 1042, 1043 1044, 1045 1046_; 1047, 1048, 1049, 1050, 1051, 1052, 1053, 1054,

1055 1056, 1057 1058, 1059 1060 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068,

1069_: 1070, 1071 1072, 1073 1074, 1075, 1076, 1077, 1078, 1079, 1080, 1081, 1082,

1083 1084, 1085 1086, 1087 1088 1089, 1090, 1091, 1092, 1093, 1094, 1095, 1096,

1097 1098, 1099_: 1100, 1101 1102 1103, 1104, 1105, 1106, 1107, 1108, 1109, 1110, llll 1112, 1113 1114, 1115 1116 1117, 1118, 1119, 1120, 1121, 1122, 1123, 1124,

1125 1126, 1127 1128, 1129, 1130. 1131, 1132, 1133, 1134, 1135, 1136, 1137, 1138,

1139 1140, 1141 1142, 1143 1144 1145, 1146, 1147, 1148, 1149, 1150, 1151, 1152,

1153 1154, 1155 1156, 1157 1158 1159, 1160, 1161, 1162, 1163, 1164, 1165, 1166,

1167 1168, 1169 1170, 1171 1172 1173, 1174, 1175, 1176, 1177, 1178, 1179, 1180,

1181 1182, 1183 1184, 1185 1186_; 1187, 1188, 1189, 1190, 1191, 1192, 1193, 1194,

1195 1196, 1197 1198, 1199 1200_: 1201, 1202, 1203, 1204, 1205, 1206, 1207, 1208,

1209. 1210, 1211 1212, 1213 1214 1215, 1216, 1217, 1218, 1219, 1220, 1221, 1222,

1223 1224, 1225 1226, 1227 1228 1229, 1230, 1231, 1232, 1233, 1234, 1235, 1236,

1237 1238, 1239_: 1240, 1241 1242 1243, 1244, 1245, 1246, 1247, 1248, 1249, 1250,

1251 1252, 1253 1254, 1255 1256_; 1257, 1258, 1259, 1260, 1261, 1262, 1263, 1264,

1265 1266, 1267 1268, 1269_: 1270_; 1271, 1272, 1273, 1274, 1275, 1276, 1277, 1278,

1279 1280, 1281 1282, 1283 1284 1285, 1286, 1287, 1288, 1289, 1290, 1291, 1292,

1293 1294, 1295 1296, 1297 1298 1299, 1300, 1301, 1302, 1303, 1304, 1305, 1306,

1307 1308, 1309_: 1310, 1311 1312 1313, 1314, 1315, 1316, 1317, 1318, 1319, 1320,

1321 1322, 1323 1324, 1325 1326 1327, 1328, 1329, 1330, 1331, 1332, 1333, 1334, 1335, 1336, 1337, 1338, 1339, 1340, 1341, 1342, 1343, 1344, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394, 1395, 1396, 1397, 1398, 1399, 1400, 1401, 1402, 1403, 1404, 1405, 1406, 1407, 1408, 1409, 1410, 1411, 1412, 1413, 1414, 1415, 1416, 1417, 1418, 1419, 1420, 1421, 1422, 1423, 1424, 1425, 1426, 1427, 1428, 1429, 1430, 1431, 1432 and 1433ofSEQIDNO:l.

25. The method of Claim 24 wherein the polymoφhism or mutation changes a codon selected from amino acid numbers 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392 and 393 ofSEQ ID NO:2.

26. The method of Claim 25 wherein the polymoφhism or mutation changes a codon selected from amino acid numbers 21, 36, 46, 47, 72, 80 and 213 of SEQ ID NO:2.

27. The method of Claim 26 wherein the polymoφhism or mutation changes a codon at position number 72.

28. The method of Claim 26 wherein the polymoφhism or mutation changes a codon at position number 80.

29. The method of Claim 27 wherein the codon at position 72 associated with cancer is selected from Arg, Gly, Ser, Cys, His and Leu.

30. The method of Claim 29 wherein the codon at position 72 associated with cancer is Arg.

31. The method of Claim 28 wherein the codon at position 80 associated with cancer is selected from Ala, Thr, Ser, Arg, His and Leu.

32. The method of Claim 31 wherein the codon at position 80 associated with cancer is Ser.

33. The method of Claim 23 wherein the p53 allele is immobilized in an array.

34. A method for detecting a p53 protein, said method comprising contacting a biological sample from a subject with an antibody specific for said p53 protein for a time and under conditions sufficient for an antibody-protein complex to form and then detecting said complex.

35. The method of Claim 34 wherein the polymoφhism or mutation comprises a single nucleotide variation at a nucleotide selected from 252, 253, 254, 254, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 883, 984, 885, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 902, 903, 904, 905, 906, 907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919, 920, 921, 922, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, 953, 954, 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 965, 966, 967, 968, 969, 970, 971, 972, 973, 974, 975, 976, 977, 978, 979, 980, 981, 982, 983, 984, 985, 986, 987, 988, 989, 990, 991, 992, 993, 994, 995, 996, 997, 998, 999, 1001, 1002, 1003, 1004, 1005, 1006, 1007, 1008, 1009, 1010, 1011, 1012, 1013, 1014, 1015, 1016, 1017, 1018, 1019, 1020, 10021, 1022, 1023, 1024, 1025, 1026, 1027, 1028, 1029, 1030, 1031, 1032, 1033, 1034, 1035, 1036, 1037, 1038, 1039, 1040, 1041, 1042, 1043, 1044, 1045, 1046, 1047, 1048, 1049, 1050, 1051, 1052, 1053, 1054, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 1077, 1078, 1079, 1080, 1081, 1082, 1083, 1084, 1085, 1086, 1087, 1088, 1089, 1090, 1091, 1092, 1093, 1094, 1095, 1096, 1097, 1098, 1099, 1100, 1101, 1102, 1103, 1104, 1105, 1106, 1107, 1108, 1109, 1110, llll, 1112, 1113, 1114, 1115, 1116, 1117, 1118, 1119, 1120, 1121, 1122, 1123, 1124, 1125, 1126, 1127, 1128, 1129, 1130, 1131, 1132, 1133, 1134, 1135, 1136, 1137, 1138, 1139, 1140, 1141, 1142, 1143, 1144, 1145, 1146, 1147, 1148, 1149, 1150, 1151, 1152, 1153, 1154, 1155, 1156, 1157, 1158, 1159, 1160, 1161, 1162, 1163, 1164, 1165, 1166, 1167, 1168, 1169, 1170, 1171, 1172, 1173, 1174, 1175, 1176, 1177, 1178, 1179, 1180, 1181, 1182, 1183, 1184, 1185, 1186, 1187, 1188, 1189, 1190, 1191, 1192, 1193, 1194, 1195, 1196, 1197, 1198, 1199, 1200, 1201, 1202, 1203, 1204, 1205, 1206, 1207, 1208, 1209, 1210, 1211, 1212, 1213, 1214, 1215, 1216, 1217, 1218, 1219, 1220, 1221, 1222, 1223, 1224, 1225, 1226, 1227, 1228, 1229, 1230, 1231, 1232, 1233, 1234, 1235, 1236, 1237, 1238, 1239, 1240, 1241, 1242, 1243, 1244, 1245, 1246, 1247, 1248, 1249, 125.0, 1251, 1252, 1253, 1254, 1255, 1256, 1257, 1258, 1259, 1260, 1261, 1262, 1263, 1264, 1265, 1266, 1267, 1268, 1269, 1270, 1271, 1272, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1286, 1287, 1288, 1289, 1290, 1291, 1292, 1293, 1294, 1295, 1296, 1297, 1298, 1299, 1300, 1301, 1302, 1303, 1304, 1305, 1306, 1307, 1308, 1309, 1310, 1311, 1312, 1313, 1314, 1315, 1316, 1317, 1318, 1319, 1320, 1321, 1322, 1323, 1324, 1325, 1326, 1327, 1328, 1329, 1330, 1331, 1332, 1333, 1334, 1335, 1336, 1337, 1338, 1339, 1340, 1341, 1342, 1343, 1344, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360 1361, 1362,

1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394, 1395, 1396, 1397, 1398, 1399, 1400, 1401, 1402, 1403, 1404, 1405, 1406, 1407, 1408, 1409, 1410, 1411, 1412, 1413, 1414, 1415, 1416, 1417, 1418, 1419, 1420, 1421, 1422, 1423, 1424, 1425, 1426, 1427, 1428, 1429, 1430, 1431, 1432 and 1433ofSEQIDNO:l.

36. The method of Claim 35 wherein the polymoφhism or mutation changes a codon selected from amino acid numbers 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392 and 393 of SEQ ID NO:2.

37. The method of Claim 36 wherein the polymoφhism or mutation changes a codon selected from amino acid numbers 21, 36, 46, 47, 72, 80 and 213 of SEQ ID NO:2.

38. The method of Claim 37 wherein the polymoφhism or mutation changes a codon at position number 72.

39. The method of Claim 37 wherein the polymoφhism or mutation changes a codon at position number 80.

40. The method of Claim 38 wherein the codon at position 72 associated with cancer is selected from Arg, Gly, Ser, Cys, His and Leu.

41. The method of Claim 40 wherein the codon at position 72 associated with cancer is Arg.

42. The method of Claim 39 wherein the codon at position 80 associated with cancer is selected from Ala, Thr, Ser, Arg, His and Leu.

43. The method of Claim 42 wherein the codon at position 80 associated with cancer is Ser.

44. A method of treatment of cancer, said method comprising identifying a polymoφhism or mutation in a p53 gene or p53 protein associated with said cancer, screening an individual subject for the particular polymoφhism or mutation and subjecting said subject to protein replacement therapy or gene therapy to alter the gene or protein to generate a p53 not associated with the cancer.

45. The method of Claim 44 wherein the polymoφhism or mutation comprises a single nucleotide variants at a nucleotide selected from 252, 253, 254, 254, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 883, 984, 885, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 902, 903, 904, 905, 906, 907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919, 920, 921, 922, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, 953, 954, 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 965, 966, 967, 968, 969, 970, 971, 972, 973, 974, 975, 976, 977, 978, 979, 980, 981, 982, 983, 984, 985, 986, 987, 988, 989, 990, 991, 992, 993, 994, 995, 996, 997, 998, 999, 1001, 1002, 1003, 1004, 1005, 1006, 1007, 1008, 1009, 1010, 1011, 1012, 1013, 1014, 1015, 1016, 1017, 1018, 1019, 1020, 10021, 1022, 1023, 1024, 1025, 1026, 1027, 1028, 1029, 1030, 1031, 1032, 1033, 1034, 1035, 1036, 1037, 1038, 1039, 1040, 1041, 1042, 1043, 1044, 1045, 1046, 1047, 1048, 1049, 1050, 1051, 1052, 1053, 1054, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 1077, 1078, 1079, 1080, 1081, 1082, 1083, 1084, 1085, 1086, 1087, 1088, 1089, 1090, 1091, 1092, 1093, 1094, 1095, 1096, 1097, 1098, 1099, 1100, 1101, 1102, 1103, 1104, 1105, 1106, 1107, 1108, 1109, 1110, llll, 1112, 1113, 1114, 1115, 1116, 1117, 1118, 1119, 1120, 1121, 1122, 1123, 1124, 1125, 1126, 1127, 1128, 1129, 1130, 1131, 1132, 1133, 1134, 1135, 1136, 1137, 1138, 1139, 1140, 1141, 1142, 1143, 1144, 1145, 1146, 1147, 1148, 1149, 1150, 1151, 1152, 1153, 1154, 1155, 1156, 1157, 1158, 1159, 1160, 1161, 1162, 1163, 1164, 1165, 1166, 1167, 1168, 1169, 1170, 1171, 1172, 1173, 1174, 1175, 1176, 1177, 1178, 1179, 1180, 1181, 1182, 1183, 1184, 1185, 1186, 1187, 1188, 1189, 1190, 1191, 1192, 1193, 1194, 1195, 1196, 1197, 1198, 1199, 1200, 1201, 1202, 1203, 1204, 1205, 1206, 1207, 1208, 1209, 1210, 1211, 1212, 1213, 1214, 1215, 1216, 1217, 1218, 1219, 1220, 1221, 1222, 1223, 1224, 1225, 1226, 1227, 1228, 1229, 1230, 1231, 1232, 1233, 1234, 1235, 1236, 1237, 1238, 1239, 1240, 1241, 1242, 1243, 1244, 1245, 1246, 1247, 1248, 1249, 1250, 1251, 1252, 1253, 1254, 1255, 1256, 1257, 1258, 1259, 1260, 1261, 1262, 1263, 1264, 1265, 1266, 1267, 1268, 1269, 1270, 1271, 1272, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1286, 1287, 1288, 1289, 1290, 1291, 1292, 1293, 1294, 1295, 1296, 1297, 1298, 1299, 1300, 1301, 1302, 1303, 1304, 1305, 1306, 1307, 1308, 1309, 1310, 1311, 1312, 1313, 1314, 1315, 1316, 1317, 1318, 1319, 1320, 1321, 1322, 1323, 1324, 1325, 1326, 1327, 1328, 1329, 1330, 1331, 1332, 1333, 1334, 1335, 1336, 1337, 1338, 1339, 1340, 1341, 1342, 1343, 1344, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394, 1395, 1396, 1397, 1398, 1399, 1400, 1401, 1402, 1403, 1404, 1405, 1406, 1407, 1408, 1409, 1410, 1411, 1412, 1413, 1414, 1415, 1416, 1417, 1418, 1419, 1420, 1421, 1422, 1423, 1424, 1425, 1426, 1427, 1428, 1429, 1430, 1431, 1432 and 1433 of SEQ ID NO:l.

46. The method of Claim 45 wherein the polymoφhism or mutation changes a codon selected from amino acid numbers 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392 and 393 of SEQ ID NO:2.

47. The method of Claim 46 wherein the polymoφhism or mutation changes a codon selected from amino acid numbers 21, 36, 46, 47, 72, 80 and 213 of SEQ ID NO:2.

48. The method of Claim 47 wherein the polymoφhism or mutation changes a codon at position number 72.

49. The method of Claim 47 wherein the polymoφhism or mutation changes a codon at position number 80.

50. The method of Claim 48 wherein the codon at position 72 associated with cancer is selected from Arg, Gly, Ser, Cys, His and Leu.

51. The method of Claim 50 wherein the codon at position 72 associated with cancer is Arg.

52. The method of Claim 49 wherein the codon at position 80 associated with cancer is selected from Ala, Thr, Ser, Arg, His and Leu.

53. The method of Claim 52 wherein the codon at position 80 associated with cancer is Ser.

54. A diagnostic kit for detecting a p53 allele expressed by a cell, said kit comprising:-

(ii) reagents for detecting the specific hybridization between said polynucleotide probes and/or primer sets and said p53 allele transcript;

(iv) instructions for the use of said kit.

55. A diagnostic kit for detecting a p53 allele expressed by a cell, said kit comprising:-

(i) one or more p53 -binding agents;

(ii) reagents for detecting binding of a p53-binding agent; and

(iii) instructions for use ofthe agent.

56. The kit of Claim 55 wherein the p53-binding agent is an antibody.

57. An isolated immunointeractive molecule which is specific for a p53 protein selected from the list consisting of codon 72-arg and codon 72-pro.

58. The immunointeractive molecule of Claim 57 wherein the molecule is specific for codon 72-arg.

59. The immunointeractive molecule of Claim 57 wherein the molecule is specific for codon 72-pro.

60. The immunointeractive molecule of Claim 57, 58 or 59 wherein the molecule is a polyclonal antibody.

61. The immunointeractive molecule of Claim 57, 58 or 59 wherein the molecule is a monoclonal antibody.