WO2005001045A2

WO2005001045A2 - Materials and methods for production of fruit-free, pollen-free plants with large showy flowers

Info

Publication number: WO2005001045A2
Application number: PCT/US2004/017358
Authority: WO
Inventors: Xuemei Chen
Original assignee: Rutgers, The State University Of New Jersey
Priority date: 2003-05-29
Filing date: 2004-06-01
Publication date: 2005-01-06
Also published as: WO2005001045A3

Abstract

The present invention relates to the fields of plant and molecular biology. Specifically, the invention presented herein provides methods of producing plants with large flowers, in which the reproductive organs have been replaced by additional petals. Additionally, these plants do not produce pollen and fruit.

Description

Materials and Methods for Production of Fruit-Free, Pollen-Free Plants with Large Showy Flowers By Xuemei Chen

Pursuant to 35 U.S.C. §202 (c) , it is acknowledged that the U.S. Government has certain rights in the invention described, which was made in part with funds from the National Institutes of Health, grant number 1R01 GM61146.

This application claims priority to US Provisional Application No. 60/474,289 filed May 29, 2003, the entire disclosure of which is incorporated by reference herein.

FIELD OF THE INVENTION The present invention relates to the fields of plant and molecular biology. Specifically, the invention presented herein provides methods of producing plants with large flowers, in which the reproductive organs have been replaced by additional petals . Additionally, these plants do not produce pollen and fruit.

BACKGROUND OF THE INVENTION Several publications and patent documents are cited throughout the specification in order to describe the state of the art to which this invention pertains. Each of these references is incorporated herein as though set forth in full. microRNAs (miRNAs) , single stranded RNAs of approximately 22 nucleotides (nt) in length, are encoded in the genomes of many multicellular organisms such as C. elegans, D. melanogaster, mouse, humans, and plants. miRNAs are processed from longer transcripts that can form hairpin structures, by an RNAse III enzyme known as Dicer in metazoan species. In Arabidopsis, the accumulation of miRNAs requires a Dicer homolog, DCL1, and a novel protein, HEN1. Lin-4 and let-7, the two founding members of the C. elegans miRNAs, serve as regulators of developmental timing and inhibit the translation of their target mRNAs through imperfect base- pairing interactions with their targets. Arabidopsis miRNAs, however, appear to show a higher degree of sequence complementarity to their potential targets, leading to the postulation that plant microRNAs act similarly to small interfering RNAs in RNA silencing in that they guide the cleavage of their target RNAs . Indeed, several plant miRNAs have been shown to direct the cleavage of their target RNAs, although these studies did not rule out a role of these miRNAs in translational regulation. Many plant miRNAs show sequence complementarity to mRNAs of transcription factors, some of which are known to regulate growth and differentiation. Therefore, it is likely that some plant miRNAs play key roles in plant development. Several miRNAs have been implicated, but none has been shown, to act in plant development . Large, ornamental flowers are highly desirable in the plant and flower industry. Additionally, since 40% of Americans have allergies, the production of pollen free flowers and ornamental trees is also highly desirable. Therefore a need exists in the art for means of increasing flower size and inhibiting pollen and fruit production.

SUMMARY OF THE INVENTION In accordance with the present invention, provided herein are modified AP2 sequences which mediate production of larger flower size in plants comprising the same . Also in accordance with the invention are methods of generating plants having increased flower size and in which pollen and fruit production has been eliminated.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a diagram of the AP2 coding region showing the nucleotides that can potentially base-pair with miRNA172. The two AP2 domains are represented by hatched rectangles, and the miRNA172-binding site is in black. The wild-type and mutant nucleotide sequences in the miRNA-binding site are shown, with the six mutant nucleotides in AP2ml and AP2m3 circled. The three different miRNA172 sequences are shown below the AP2 sequences, with the bold letters representing nucleotides that can base-pair with AP2. The GenBank accession for AP2 cDNA is U12546. The Arabidopsis gene ID for AP2 is At4g36920. While AP2ml causes a F-to-L amino acid substitution, (underlined codon) , AP2m3 does not change the amino acid sequence.

Figures 2A-I show floral and leaf phenotypes of 35S::MIR172, 35S::AP2, and 35S::AP2ml plants. Figure 2A is a wild-type flower with four types of organs, sepal

(not visible in this picture), petal, stamen, and carpel. Figure 2B is an ap2-9 flower with first whorl organs transformed into carpels and absence of petals. Figure 2C is a 35S : :MIRl72a-l flower that closely resembles flowers with loss-of-function mutations in AP2. Figures 2D and 2E show a cauline and a rosette leaf from a 35S::MIR172 plant. The cauline leaf has stigmatic tissue, which is normally found on carpels, along the edge of the organ. The rosette leaf is curled upward, resembling strains in which AGAMOUS is ectopically expressed in leaves, such as curly leaf mutants or 35S::AG plants. Figure 2F is a type I 35S::AP2ml flower with numerous petals and loss floral determinacy. Aspects of these phenotypes resemble those of loss-of-function mutations in AG, as shown in 2G. Figure 2G shows an ag-3 flower. Figure 2H is a type II 35S::AP2ml flower with many staminoid organs and an enlarged floral meristem in the center. Figure 21 is a 35S::AP2 flower that has a larger number of stamens.

Figure 3 provides the sequences for putative miRl72 binding sites in AP2 homologs from various dicots, monocots, and gymnosperms . The nucleotides that can base pair with miRl72 are in bold.

DETAILED DESCRIPTION OF THE INVENTION Most dicot plants produce flowers consisting of perianth organs (sepals and petals) and reproductive organs (stamens and gynoecia.) The flowers of any one species are also of a fixed size. The four organ types, sepal, petal, stamen, and carpel, are each generated in whorls from the floral meristem consisting of initially undifferentiated cells . The identities of the four types of organs are specified by the combinatorial actions of three classes of transcription factors, known as the floral A, B, and C genes. In addition to specifying perianth and reproductive organ identities respectively, APETALA2 (AP2, a class A gene) and AGAMOUS (AG, a class C gene) act antagonistically to restrict the activities of each other to their proper domains of action within the floral meristem. In previous studies aimed at identifying new genes that act in the class C pathway, a sensitized genetic screen in the hual-1 hua2-l background, which is partially compromised in class C activity, was carried out. A new gene, HENl, was identified in this screen to be required for class C activity in the flower since recessive mutations in HENl result in reproductive-to- perianth organ transformation in the hual-1 hua2-l background. Since HENl was determined to be required for the accumulation of miRNAs, it was postulated that the absence of a miRNA(s) is responsible for the floral homeotic transformation in hual-1 hua2-l henl flowers. Consistent with this hypothesis, a recessive mutation in DCL1, dcll-9, also resulted in similar homeotic defects in the hual-1 hua2-l background. One iRNA, miRNAl72, is highly complementary to a region in the mRNAs of a few Arabidopsis genes including AP2 and three other genes (At2g28550, At5g60120, and At5g67180) encoding proteins with AP2 domains. The putative mirl72 RNA binding sites are located within the coding regions of the genes but are outside of the conserved AP2 domains. The high degree of sequence conservation within but not outside of the putative miRNA172 binding sites suggests that either the nucleotide or the amino acid sequence is important for the function of these genes. By expressing an altered form of a transcription factor APETALA2 (AP2) in Arabidopsis, the reproductive organs were replaced with numerous petals and floral meristem size increased, thus producing larger flowers. Since the female and male reproductive organs were turned into petals, the flowers do not produce pollen or fruit. This technology also applies to monocots and dicots, since the underlying principle is conserved between them. Accordingly, the present invention provides miRNAs which modulate AP2 expression levels in a variety of plant species and method of use thereof for the production of fruit-free, pollen-free plants with large showy flowers .

I . The following definitions are provided to facilitate an understanding of the present invention. "Nucleic acid" or a "nucleic acid molecule" as used herein refers to any DNA or RNA molecule, either single or double stranded and, if single stranded, the molecule of its complementary sequence in either linear or circular form. In discussing nucleic acid molecules, a sequence or structure of a particular nucleic acid molecule may be described herein according to the normal convention of providing the sequence in the 5' to 3' direction. With reference to nucleic acids of the invention, the term "isolated nucleic acid" is sometimes used. This term, when applied to DNA, refers to a DNA molecule that is separated from sequences with which it is immediately contiguous in the naturally occurring genome of the organism in which it originated. For example, an

"isolated nucleic acid" may comprise a DNA molecule inserted into a vector, such as a plasmid or virus vector, or integrated into the genomic DNA of a prokaryotic or eukaryotic cell or host organism. When applied to RNA, the term "isolated nucleic acid" may refer to an RNA molecule encoded by an isolated DNA molecule as defined above. Alternatively, the term may refer to an RNA molecule that has been sufficiently separated from other nucleic acids with which it would be associated in its natural state (i.e., in cells or tissues) . An isolated nucleic acid (either DNA or RNA) may further represent a molecule produced directly by biological or synthetic means and separated from other components present during its production. With respect to single stranded nucleic acids, particularly oligonucleotides, the term "specifically hybridizing" refers to the association between two single-stranded nucleotide molecules of sufficiently complementary sequence to permit such hybridization under pre-determined conditions generally used in the art (sometimes termed "substantially complementary") . In particular, the term refers to hybridization of an oligonucleotide with a substantially complementary sequence contained within a single-stranded DNA molecule of the invention, to the substantial exclusion of hybridization of the oligonucleotide with single-stranded nucleic acids of non-complementary sequence. Appropriate conditions enabling specific hybridization of single stranded nucleic acid molecules of varying complementarity are well known in the art. For instance, one common formula for calculating the stringency conditions required to achieve hybridization between nucleic acid molecules of a specified sequence homology is set forth below (Sambrook et al . , 1989) :

Tm = 81.5°C + 16.6Log [Na+] + 0.41 (% G+C) - 0.63 (% formamide) - 600/#bp in duplex

As an illustration of the above formula, using [Na+] =

[0.368] and 50% formamide, with GC content of 42% and an average probe size of 200 bases, the Tm is 57°C. The Tm of a DNA duplex decreases by 1 - 1.5°C with every 1% decrease in homology. Thus, targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42°C. The stringency of the hybridization and wash depend primarily on the salt concentration and temperature of the solutions. In general, to maximize the rate of annealing of the probe with its target, the hybridization is usually carried out at salt and temperature conditions that are 20-25°C below the calculated Tm of the hybrid. Wash conditions should be as stringent as possible for the degree of identity of the probe for the target. In general, wash conditions are selected to be approximately 12-20°C below the Tm of the hybrid. In regards to the nucleic acids of the current invention, a moderate stringency hybridization is defined as hybridization in 6X SSC, 5X Denhardt's solution, 0.5% SDS and 100 μg/ml denatured salmon sperm DNA at 42 °C, and washed in 2X SSC and 0.5% SDS at 55°C for 15 minutes. A high stringency hybridization is defined as hybridization in 6X SSC, 5X Denhardt's solution, 0.5% SDS and 100 μg/ml denatured salmon sperm DNA at 42 °C, and washed in IX SSC and 0.5% SDS at 65°C for 15 minutes. A very high stringency hybridization is defined as hybridization in 6X SSC, 5X Denhardt's solution, 0.5% SDS and 100 μg/ml denatured salmon sperm DNA at 42 °C, and washed in 0. IX SSC and 0.5% SDS at 65°C for 15 minutes. The term "probe" as used herein refers to an oligonucleotide, polynucleotide or DNA molecule, whether occurring naturally as in a purified restriction enzyme digest or produced synthetically, which is capable of annealing with or specifically hybridizing to a nucleic acid with sequences complementary to the probe. A probe may be either single stranded or double stranded. The exact length of the probe will depend upon many factors, including temperature, source of probe and use of the method. For example, for diagnostic applications, depending on the complexity of the target sequence, the oligonucleotide probe typically contains 15-25 or more nucleotides, although it may contain fewer nucleotides. The probes herein are selected to be complementary to different strands of a particular target nucleic acid sequence. This means that the probes must be sufficiently complementary so as to be able to "specifically hybridize" or anneal with their respective target strands under a set of pre-determined conditions. Therefore, the probe sequence need not reflect .the exact complementary sequence of the target. For example, a non complementary nucleotide fragment may be attached to the 5' or 3 ' end of the probe, with the remainder of the probe sequence being complementary to the target strand. Alternatively, non complementary bases or longer sequences can be interspersed into the probe, provided that the probe sequence has sufficient complementarity with the sequence of the target nucleic acid to anneal therewith specifically. The term "primer" as used herein refers to a DNA oligonucleotide, either single stranded or double stranded, either derived from a biological system, generated by restriction enzyme digestion, or produced synthetically which, when placed in the proper environment, is able to functionally act as an initiator of template-dependent nucleic acid synthesis. When presented with an appropriate nucleic acid template, suitable nucleoside triphosphate precursors of nucleic acids, a polymerase enzyme, suitable cofactors and conditions such as a suitable temperature and pH, the primer may be extended at its 3' terminus by the addition of nucleotides by the action of a polymerase or similar activity to yield a primer extension product. The primer may vary in length depending on the particular conditions and requirement of the application. For example, in diagnostic applications, the oligonucleotide primer is typically 15-25 or more nucleotides in length. The primer must be of sufficient complementarity to the desired template to prime the synthesis of the desired extension product, that is, to be able anneal with the desired template strand in a manner sufficient to provide the 3' hydroxyl moiety of the primer in appropriate juxtaposition for use in the initiation of synthesis by a polymerase or similar enzyme. It is not required that the primer sequence represent an exact complement of the desired template. For example, a non complementary nucleotide sequence may be attached to the 5 ' end of an otherwise complementary primer. Alternatively, non complementary bases may be interspersed within the oligonucleotide primer sequence, provided that the primer sequence has sufficient complementarity with the sequence of the desired template strand to functionally provide a template primer complex for the synthesis of the extension product. Polymerase chain reaction (PCR) has been described in U.S. Patent Nos : 4,683,195, 4,800,195, and 4,965,188, the entire disclosures of which are incorporated by reference herein. The terms "percent similarity", "percent identity" and "percent homology" when referring to a particular sequence are used as set forth in the University of Wisconsin GCG software program. The term "functional" as used herein implies that the nucleic or amino acid sequence is functional for the recited assay or purpose. The phrase "consisting essentially of" when referring to a particular nucleotide or amino acid means a sequence having the properties of a given SEQ ID NO: . For example, when used in reference to an amino acid sequence, the phrase includes the sequence per se and molecular modifications that would not affect the basic and novel characteristics of the sequence. A "replicon" is any genetic element, for example, a plasmid, cosmid, bacmid, phage or virus, that is capable of replication largely under its own control. A replicon may be either RNA or DNA and may be single or double stranded. A "vector" is a replicon, such as a plasmid, cosmid, bacmid, phage or virus, to which another genetic sequence or element (either DNA or RNA) may be attached so as to bring about the replication of the attached sequence or element. An "expression operon" refers to a nucleic acid segment that may possess transcriptional and translational control sequences, such as promoters, enhancers, translational start signals (e.g., ATG or AUG codons) , polyadenylation signals, terminators, and the like, and which facilitate the expression of a polypeptide coding sequence in a host cell or organism. The term "oligonucleotide," as used herein refers to sequences, primers and probes of the present invention, and is defined as a nucleic acid molecule comprised of two or more ribo or deoxyribonucleotides, preferably more than three. The exact size of the oligonucleotide will depend on various factors and on the particular application and use of the oligonucleotide. The phrase "microRNA" (miRNA) refers to a short (typically less than 30 nucleotides long) double stranded RNA molecule. Typically, the miRNA modulates the expression of a gene to which the miRNA is targeted. The term "substantially pure" refers to a preparation comprising at least 50 60% by weight of a given material (e.g., nucleic acid, oligonucleotide, protein, etc.). More preferably, the preparation comprises at least 75% by weight, and most preferably 90 95% by weight of the given compound. Purity is measured by methods appropriate for the given compound (e.g. chromatographic methods, agarose or polyacrylamide gel electrophoresis, HPLC analysis, and the like) . The term "gene" refers to a nucleic acid comprising an open reading frame encoding a polypeptide, including both exon and (optionally) intron sequences. The nucleic acid may also optionally include non coding sequences such as promoter or enhancer sequences . The term "intron" refers to a DNA sequence present in a given gene that is not translated into protein and is generally found between exons . The phrase "operably linked", as used herein, may refer to a nucleic acid sequence placed into a functional relationship with another nucleic acid sequence. Examples of nucleic acid sequences that may be operably linked include, without limitation, promoters, transcription terminators, enhancers or activators and heterologous genes which when transcribed and, if appropriate to, translated will produce a functional product such as a protein, ribozyme or RNA molecule. The phrase "operably linked" may also refer to a nucleic acid sequence placed in functional relationship with a ribozyme such that the catalytic cleavage activity of the ribozyme leads to the release of the operably linked nucleic acid sequence. The following non-limiting examples are provided to further illustrate the present invention.

EXAMPLES

Example I - Effect of Low Levels of miRNA 172 To test whether AP2 is regulated by mirRNA172, AP2 expression in genotypes in which mil72RNA accumulates to low levels was studied. Despite the low levels of mirl72 RNA in henl-1, henl-2, and dcll-9 inflorescences, AP2 RNA abundance in these genotypes is similar to that in wild- type. AP2 protein levels in henl-1, henl-2, and dcll-9 inflorescences, however, were approximately 3-4 fold higher than that in wild-type inflorescences, suggesting that AP2 is regulated at the translational or post- translational levels by a miRNA (s).

Example II - Effect of Elevated Levels of miRNA 172 To determine whether AP2 is regulated by miRNAl72, the effect of elevated miRNAl72 level on AP2 expression was tested. Four genes in the Arabidopsis genome can potentially give rise to three miRNAl72 RNAs with one nucleotide difference from one another. Since all three miRNAs can base pair with AP2 RNA with no or one mismatch, the effect of over expression of each of the four potential MIR172 genes, named MIRl72a-l, a-2, b, and c was tested. See Figure 1. Each MIR172 gene was fused to two copies of the 35S enhancer, which drives high level and near ubiquitous expression in the plant, and was introduced into wild-type plants by Agrobacteria-mediated transformation . At least 20 independent transgenic lines were obtained for each 35S::MIR172 constructs. Most Tl transgenic lines from each construct displayed accelerated floral transition as compared to those transformed with only the vector. In addition, plants harboring 35S : :MIR172al, a2, b, but not 35S : :MIRl72c, the vector DNA, or an unrelated miRNA (miRNA173) driven by the 35S enhancer, showed floral homeotic phenotypes similar to those of ap2 loss-of-function mutants, such as ap2-2 or ap2-l. Lateral sepals were missing and medial sepals were transformed to carpelloid structures with stigmatic tissues along the edges of the organs. Second whorl petals were either missing or reduced in number. These phenotypes are consistent with AP2 being down- regulated, which results in ectopic AG expression in the outer two whorls leading to ectopic carpel character on the sepals and absence of petals. In many 35S::MIR172 lines, cauline leaves also had stigmatic tissues, suggesting ectopic AG expression in cauline leaves. Some rosette leaves were curled upward, a phenotype found in plants expressing AG in leaves. Indeed, AG RNA was detected in cauline and rosette leaves from 35S::MIR172 lines but not from control transgenic lines. RNA filter hybridization showed that these transgenic lines indeed had higher levels of mirl72 RNA. Despite the presence of ap2-like phenotypes in these lines, AP2 RNA accumulation was similar to that in control transgenic plants. AP2 protein, while readily detectable in control transgenic lines, was undetectable or much reduced in abundance in 35S::mirl72 lines. This indicates that mirl72RNA regulates AP2 expression at the translation level.

Example III - Expression of MJRNA172 in Normal Plants While expressing MIR172 with the 35S enhancers demonstrated the ability of MIR172 to regulate AP2 expression in vivo, whether miRNAl72 normally plays a role in flower development remained to be addressed. A modified in situ hybridization procedure was employed to examine whether mirl72 is normally found in developing flowers. While the sense probe did not give any hybridization signals, the antisense probe gave strong signals in stage 1 floral primordia on the flanks of the inflorescence meristem. The signal persists in all four floral whorls until stage 7, when miRNA172 appears to be concentrated in the inner two floral whorls . Theoretically the antisense probe is able to hybridize to both the microRNA and its precursor such that the in situ hybridization signals may represent the precursor, the mature miRNA, or both. Studies from several labs showed that microRNA precursors in Arabidopsis are at levels undetectable by RNA filter hybridization where total RNA was resolved on 15% acrylamide gels. To ensure detection, low percentage acrylamide gels and agarose gels were used to resolve total RNAs, which were then blotted and hybridized to the an mirl72 antisense probe. While the microRNA can be readily detected under all conditions, no larger precursor RNAs were detected in wild-type infloresences . Therefore, the in situ hybridization signals represent the mature miRNAl72. The presence of mirl72 RNA in developing flowers indicates that mirl72 can regulate AP2 during flower development. In fact, the later concentration of mirl72 RNA in the inner two whorls may cause AP2 expression to be concentrated to the outer two floral whorls, where AP2 acts to specify perianth identities.

Example IV - mir!72 RNA keeps Ap2 expression low The ability of mirl72 RNA to repress AP2 expression and the presence of mirl72 RNA in the flower suggest that mirl72 normally keeps AP2 expression level low during flower development. To assess the significance of this regulation in flower development and to determine whether this regulation is direct, wild-type (WT) AP2 and mutated AP2 (AP2ml) were over expressed. To generate mutant AP2, mutations were introduced into the putative miRNA172 binding site of AP2 cDNA, such that 6 mismatches to miRNA172 were introduced without affecting the amino acid sequence of the protein. Approximately 100 independent 35S::AP2 and 35S::AP2ml transgenic plants were obtained. Dramatic differences were found in the severity and frequency of floral defects between the two transgenic Tl populations. 35S::AP2ml plants exhibited five types of floral phenotypes. Type 1 plants had flowers composed of many whorls of petals or staminoid petals and an enlarged, apparently undifferentiated floral meristem in the center (Figure 2) . These floral phenotypes resemble those of ag mutants, but are more severe in terms of the floral deter inacy defects. Type 2 plants had flowers with many whorls of staminoid organs surrounding an abnormally large floral meristem in the center. Type 3 plants had flowers showing mild floral defects such that only the first few flowers had more stamens or carpels, or resembled hual hua2 flowers such that the gynoecia are enlarged at the apical end. Some of these weak phenotypes, such as increased carpel number and enlarged ovary, resemble partial loss of AG activity in the flower. Type 4 flowers appeared essential normal, while type 5 plants had ap2 like flowers, probably due to cosuppression. Type 1 and 2 flowers had higher level of AP2 RNA and protein as compared to plants transformed with the cloning vector alone. Therefore, elevated AP2 protein level in the floral meristem leads to severe consequences, the enlargement of the floral meristem, defects in floral determinacy, and the transformation of reproductive organs into petals. While some of the floral defects, such as loss of floral determinacy and homeotic transformation of stamens to petals can be explained by reduced AG expression as a result of AP2 over-expression, other defects, such as enlargement of the floral meristem and the extreme excess of stamens indicate that AP2, when over-expressed, can affect other floral patterning genes, possibly CLV genes or SUPERMAN. Contrary to 35S::AP2ml plants, the great majority of 35S::AP2 plants had normal flowers. RNA filter hybridization showed that these plants had elevated AP2 RNA level comparable to those in 35S::AP2ml type 1 or 2 plants. However, AP2 protein abundance in 35S::AP2 is much lower. Since the two AP2 cDNAs only differ at the miRNA172 biding site and would result in identical proteins, the difference in expression levels of the two transgenes is most likely due to the regulation, or the lack of, by miRNAl72. The similar levels of AP2 RNA and different levels of AP2 protein indicate that miRNA172 regulates AP2 RNA at the translational level. Many 35S::AP2 and 35S::AP2ml plants also showed defects in leaf shape and in floral transition. The rosette and cauline leaves are longer and wider than those from wild type. In addition, these plants exhibit delayed transition to flowering. Interestingly, 35S::AP2 plants, although not exhibiting the floral patterning defects, were significantly later flowering than 35S::AP2ml plants, including those with severe (type 1 and 2) floral patterning defects. AP2 does not appear to function in floral transition, since severe loss of function ap2 mutants display normal flowering behavior. An AP2 homolog, RAP2.7, however, acts as a repressor of flowering. In fact RAP2.7, like AP2, contains a sequence complementary to mirl72. It is believed that AP2, when over-expressed, may act similarly to RAP2.7 in delaying floral transition. The sequence similarity between AP2 and RAP2.7 may allow AP2 to act through the RAP2.7 pathway. This would explain why many 35S::AP2ml plants with elevated AP2 protein levels are moderately late- flowering. However, many 35S::AP2 plants, although severely late-flowering, showed high levels of AP2 RNA but low levels of AP2 protein. It is believed that the high level of AP2 RNA in 35S::AP2 lines may sequester mirl72 RNA through direct base-pairing interactions, thus alleviating the inhibitory effect of mirl72 RNA on RAP2.7 to cause late-flowering. Alternatively, the high level of AP2 RNA competes with endogenous RAP2.7 RNA for mirl72 regulation. Figure 3 provides sequences that can base pair with miR172 present in AP2 homologs from diverse species. The high degree of sequence conservation in the miR172 binding site among AP2 genes indicates that AP2 homologs are regulated by miR172. Indeed, previous studies have revealed the presence of the MiR172 sequence in such diverse species as rice and tobacco. In conclusion, it is demonstrated herein that miRNA172 represses the expression of AP2 in flowers. This regulation is critical for the proper development of the reproductive organs and for the timely termination of floral stem cells. Furthermore, evidence presented herein indicates that this regulation is mediated by direct sequence complementarity between AP2 mRNA and miRNAl72, and is at the level of translation rather than RNA stability. Although cleaved AP2 RNA products at the mirl72 biding site can be detected by PCR~based methods, the regulation at the level of translation appears to be predominant . The following materials and methods are provided to facilitate the practice of the present invention. Materials and Methods

Plasmids and transgenic lines Plasmids for over-expression of miRNA172 were generated by cloning 1.5 - 2.2 kb DNA fragments encompassing the miRNAs from each of MIR172a-l, a-2, b, c, and MIR173 genes into a plant expression vector at restriction sites between the Cauliflower Mosaic Virus 35S promoter and the nopaline synthase 3' terminator. MiRNA genes were amplified from genomic DNA from the

Columbia ecotype with Ex-Taq (Promega) . The primers for the PCR reactions were- mirl72alBamHIFl (5' tgttctggatcccaccacgtctttctctggtt 3' ) / mirl72alBamHIR2 (5' tgttttggatccaagtttgggaggttgtcgtcataa 3' ) , mirl72a2SacIFl (5' gatgatgagctcatataacaaacatcgtattctttt 3' ) / mirl72a2SacIRl (5' gttcatgagctcaccaatagaagtgtacttactcaa 3' ) , mirl72bBamHIFl (5' tatttggatcctggcttaagataagttgtaggtaaa 3') / mirl72bBamHIRl (5' ccagatggatccgaacataaaacaacagacatatac 3' ) , mirl72cHindIIIFl (5' aatctgaagcttgattggctgttatgaaaaccaaac 3') / mirl72cHindIIIRl (5' catcgttctttacttgttaaaaagcttacaaatg 3' ) , and mirl73BamHIF2 (5' ataataggatcccaaaattatgatatttgtcaatca 3') / mirl73BamHIR2 (5' tagcttggatccgagtgtagtggcgtgactgtaaca 3' ) , with the restriction sites underlined. The PCR fragments were digested with the enzymes as indicated in the primers, and ligated to the binary expression vector pMAT137Hm linearized with Bglll (for MIR172a-l, MIR172b, and MIR173), Sad (for MIRl72a-2) , or Hindlll (for MIR172c) . pMATl37Hm is a derivative of pMAT037 (Matsuoka et al., 1988) and contains a Cauliflower Mosaic Virus 35S promoter with two copies of the enhancer sequence. An Agrobacterium strain, ASE, was transformed with the resulting plasmids or the pMAT137Hm vector alone and transformants were selected with Hygromycin (25 ug/ml) and used to transform wild-type Arabidopsis plants of the Landsburg erecta ecotype by vacuum infiltration. Transgenic plants were selected on solid medium containing 50 ug/ml Kanamycin. Plasmids for over-expression of AP2 were also in pMAT137Hm. A full-length AP2 cDNA clone was obtained from Dr. Beth Krizek at the University of South Carolina. Site-directed mutagenesis of the AP2 cDNA was first performed to alter the nucleotide sequence of the miRNA172-binding site. 25 ng of the plasmid was used in a DNA synthesis reaction with Pfu polymerase (Stratagene) in which the two primers,

AP2pl9 (5' gttgacaaatgcagctgcttcctccggtttatctcctcatcatcacaa tcaga3' ) and AP2p20 (5 ' gtgatgatgaggagataaaccggaggaagcagctgcatttgtcaacacttggt3 ' ) in opposite orientations, carry the desired mutations in the miRNA172-binding site. After 18 rounds of DNA synthesis, the resulting DNA were digested with Dpnl to eliminate the methylated, nonmutated parental DNA. The resulting DNA was then used to transform E. coli DH5a cells. Colony PCR was carried out with AP2p26 - (5' ggctggatcccaccggtttgatggtcgggcctcgac) / AP2p5 (5' aatgaaatgaccaagaacatgtgggg 3 ^r ) , and the PCR products were digested with PvuII, an enzyme whose recognition site was introduced by the mutations, to identify the colonies that contained the mutant AP2 cDNA, AP2ml . The AP2ml plasmid was then sequenced to confirm the presence of the desired mutations and the absence of mutations elsewhere in the DNA. Both the wild-type AP2 cDNA and AP2ml were used as templates for PCR with Pfu polymerase with primers AP2p30 (5' ctttagatcttttttttttgttttcattaaagttttta 3') and AP2p31 (5' aacctctagagggaaaaagatttccattaattttttttg 3' ) to amplify the full-length cDNAs . The PCR products were digested with Bglll and Xbal, and cloned into pMATl37Hm digested with the same enzymes to result in pMAT137Hm-35S : :AP2 and pMAT137Hm-35S: :AP2ml . The constructs were delivered into wild-type Arabidopsis plants of the Landsburg erecta ecotype by vacuum infiltration.

RNA isolation and RNA filter hybridiza tion Total RNA and polyA+ RNA were isolated from tissue frozen and ground to powder in liquid nitrogen as described (Li et al . , 2001). For the detection of miRNA172, 50 ug of total RNA from various genotypes was resolved in 15% polyacrylamide/urea gels, electro- transferred to Zeta Probe membranes, and hybridized to an antisense oligonucleotide probe as described (Park et al . , 2002) . For the detection of any precursors of miRNA172, 40 ug of total RNA was resolved in a 12% agarose formaldehyde gel, transferred to a Nylon membrane, and hybridized to an antisense oligonucleotide probe under conditions as described (Park et al., 2002). For the detection of AP2 RNA, polyA+ RNA was isolated from 150 ug of total RNA, resolved in 12% agarose formaldehyde gels, transferred to Nylon membranes, and hybridized to a randomly labeled AP2 cDNA fragment corresponding to 500 bp of the 3' portion of AP2 cDNA. This probe contains approximately 200 bp and 300 bp of DNA upstream and downstream respectively, of the miRNA172-binding site, and therefore should detect both the 5' and the 3' cleavage products, should miRNA172 mediate the cleavage of AP2 RNA. Radioactive signals were quantified using a Phosphoimager .

Analysis of AP2 protein abundance To ensure that the exact tissues were used for the measurement of AP2 RNA and AP2 protein abundance, tissues were ground to powder in liquid nitrogen, and aliquots were taken for RNA isolation as described above and for Western blotting to detect AP2 protein. The tissue powder was mixed with 1 volume of 2XSDS sample buffer and boiled for 5 minutes to extract proteins. The proteins were resolved in 15% SDS/acrylamide gels and electro- transferred to nitrocellulose membranes. The membranes were then incubated with 5% milk in TBS () for 1 hour at room temperature and then in anti-AP2 antisera (1:125 diluted in TBS/0.05% Tween 20) overnight at 4°C. After three washes in TBST, the membranes were incubated with the secondary antisera conjugated to HRP for 1 hour at room temperature . The membrane was washed again in TBST and signals were detected with the ECL Plus Western blotting detection system (Amersham) . After being exposed to X-ray films, the membranes were scanned in a Phosphorimager in order to quantify the signals.

In situ hybridiza tion Previously established in situ hybridization methods using digoxigenin-labeled probes (Jackson 1991) were modified to detect miRNAl72. The modifications are as follows : 1. Four concatamers of sense or antisense sequences were synthesized as oligonucleotides and cloned into pGEM-3z or pBSSK. The clones were used for in vitro transcription to generate digoxigenin-labeled probes. The probes were used directly without hydrolysis . 2. Hybridization was carried out at 42 °C overnight. 3. After hybridization were washed twice at 40 °C for 30 min each. The RNAse treatment was done at room temp. All subsequent DIG detection steps were done at 4°C. The previous examples and description set forth certain embodiments of the invention. It should be appreciated that not all components or method steps of a complete implementation of a practical system are necessarily illustrated or described in detail. Rather, only those components or method steps necessary for a thorough understanding of the invention have been illustrated and described in detail. Actual implementations may utilize more steps or components or fewer steps or components. Thus, while certain of the preferred embodiments of the present invention have been described and specifically exemplified above, it is not intended that the invention be limited to such embodiments . Various modifications may be made thereto without departing from the scope and spirit of the present invention, as set forth in the following claims.

Claims

What is claimed is:

1. An altered, isolated polynucleotide encoding an AP2 protein having a silent mutation, wherein said alteration inhibits or prevents miRNA 172 from binding to said polynucleotide .

2. The polynucleotide of claim 1, which is miRNA172a-l, - 2.

3. The polynucleotide of claim 1, which is miRNA172b-l- 2.

4. The polynucleotide of claim 1, which is miRNA172c.

5. The polynucleotide of claim 1, selected from the group of sequences shown in Figure 3.

6. The altered polynucleotide of claim 1, which comprises AP2ml .

7. A method of producing a plant having increased flower size comprising transforming a plant with the polynucleotide of claim 1 and generating a transgenic plant therefrom.

8. A transgenic plant produced by the method of claim 7.

9. A method of producing a plant having increased flower size comprising transforming a plant with the polynucleotide of claim 5, and generating a transgenic plant therefrom.

10. A transgenic plant produced by the method of claim 9.

11. The polynucleotide of claim 1, operably linked to a promoter which drives constitutive expression in plants.

12. The polynucleotide of claim 11, wherein said promoter is the 35S promoter.

13. The polynucleotide of claim 5, operably linked to a promoter which drives constitutive expression in plants.

14. The polynucleotide of claim 13, wherein said promoter is the 35S promoter.

15. The polynucleotide of claim 1, operably linked to an inducible promoter.

16. The polynucleotide of claim 5, operably linked to an inducible promoter.

17. A vector comprising the polynucleotide of claim 11.

18. A vector comprising the polynucleotide of claim 13.