WO2005000899A2 - Modified binding molecules comprising connecting peptides - Google Patents

Modified binding molecules comprising connecting peptides Download PDF

Info

Publication number
WO2005000899A2
WO2005000899A2 PCT/US2004/020945 US2004020945W WO2005000899A2 WO 2005000899 A2 WO2005000899 A2 WO 2005000899A2 US 2004020945 W US2004020945 W US 2004020945W WO 2005000899 A2 WO2005000899 A2 WO 2005000899A2
Authority
WO
WIPO (PCT)
Prior art keywords
ofthe
domain
binding
composition
antibody
Prior art date
Application number
PCT/US2004/020945
Other languages
French (fr)
Other versions
WO2005000899A3 (en
Inventor
Scott Glaser
Mitchell Reff
Tzung-Horng Yang
Xiufeng Wu
Paul Chinn
Original Assignee
Biogen Idec Ma Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biogen Idec Ma Inc. filed Critical Biogen Idec Ma Inc.
Priority to AU2004252171A priority Critical patent/AU2004252171B2/en
Priority to CA002530388A priority patent/CA2530388A1/en
Priority to EP04777279A priority patent/EP1641827A2/en
Priority to NZ544924A priority patent/NZ544924A/en
Priority to CN200480024454.7A priority patent/CN1842538B/en
Priority to JP2006517785A priority patent/JP5068072B2/en
Publication of WO2005000899A2 publication Critical patent/WO2005000899A2/en
Publication of WO2005000899A3 publication Critical patent/WO2005000899A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2896Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/02Nasal agents, e.g. decongestants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/02Drugs for disorders of the urinary system of urine or of the urinary tract, e.g. urine acidifiers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • A61P15/08Drugs for genital or sexual disorders; Contraceptives for gonadal disorders or for enhancing fertility, e.g. inducers of ovulation or of spermatogenesis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/04Antipruritics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/14Drugs for dermatological disorders for baldness or alopecia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • A61P21/04Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/08Antiepileptics; Anticonvulsants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/10Antimycotics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/14Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06Antianaemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/14Vasoprotectives; Antihaemorrhoidals; Drugs for varicose therapy; Capillary stabilisers
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2851Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the lectin superfamily, e.g. CD23, CD72
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • C07K2317/53Hinge
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/624Disulfide-stabilized antibody (dsFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Definitions

  • Antibodies are dimeric molecules; each monomer making up the dimer comprises one light and one heavy chain. Solutions of antibody molecules exist in two forms associated with hinge heterogeneity. Using SDS-PAGE analysis of purified Mab MAb, typically the two forms are observed as two protein bands, a major band (MW approximately 150-160 kDa) and a minor band (MW approximately 75-80 kDa). This latter form is typically observed after SDS-PAGE analysis of purified IgG4 preparations, but can be identified at much lower frequencies in all IgG isotypes, including purified, recombinant MAbs (Angal et al. 1993. Mol. Immunol. 30:105; Norderhaug et al. 1990. Eur.
  • Form A contains covalent interchain disulfide bonds at positions corresponding to 239 and 242, Kabat numbering system (positions 226 and 229, EU numbering system) (Kabat, E, Wu, TT, Perry, HM, Gottesman, KS, Foeller, C: Sequences of Proteins of Immunological Interest. Bethesda, US Department of Health and Human Services, NIH, 1991).
  • the second isoform, Form B is thought to contain no covalent linkages between the two heavy chains and an intrachain disulfide bond between the two neighboring cysteine residues as evidenced by the 75-80 kDa seen in non-reducing SDS-PAGE electrophoresis.
  • the two heavy chains of Form B are presumably held together by strong non-covalent (e.g., ionic) interactions associated with the CH3 domain region of the molecule.
  • These mixtures of A and B forms are not present in solutions of MAb fragments that contain an intact hinge, but lack a CH3 domain, such as, for example, F(ab) 2 fragments.
  • genetically engineered or enzymatically digested F(ab) 2 MAb preparations lack the B-form, since the molecule lacks the necessary domains for maintaining non-covalent interactions (e.g., hydrogen bonding). However, they are present in MAb preparations that do contain a CH3 domain, such as IgG4, CH2 domain deleted MAb fragments (e.g., as described in 02/060955 A2) and minibodies (see, e.g., Hu et al. 1996. Cancer Research 56:3055). l
  • the application of protein engineering techniques to therapeutic antibody design has also produced a number of antibody formats that have been shown to have altered, and in some cases, improved pharmacodynamic, biodistribution, and activity profiles.
  • Some altered antibody molecules have been made in which the number of cysteine residues in the hinge region is reduced to one to facilitate assembly of antibody molecules as it is only necessary to form a single disulfide bond. This also provides a specific target for attaching the hinge region either to another hinge region or to an effector or reporter molecule (U.S. Patent 5,677,425). The number of cysteine residues in the antibody hinge has also been increased (U.S. Patent 5,677,425).
  • Other mutated antibodies have been constructed in which the IgGl hinge region and the CH2 domain have been replaced with the human IgG3 hinge region. (WO 97/11370). These molecules contain 11 sulfhydryl groups for substitution of multiple haptens via thiol groups.
  • CH2 domain deleted antibodies have a molecular mass of approximately 120 kDa and have been shown to penetrate tumors significantly better than full length IgG.
  • Minibodies which also have deletion ofthe CH2 domain, have similar characteristics. These domain deleted molecules accumulate at tumor sites more efficiently than other MAb fragments, such as F(ab)' 2 s, but without the unfavorable pharmacodynamic profiles seen with intact IgG antibody.
  • CH2 domain deleted antibodies consist of a VLCL light chain and a VH1 heavy chain domain and a portion ofthe hinge region (e.g., the upper and middle hinge) genetically fused (either directly or through a modified peptide spacer) to a CH3 domain.
  • the biosynthesis of recombinant CH2 domain deleted ddCC49 produces the A and B isoforms in approximately 50:50 distribution in cell cultures.
  • Cells engineered to express alternative forms of CH2 domain deleted antibodies for example, tetravalent CH2 domain deleted antibodies, minibodies, or tetravalent minibodies also express a mixture consisting of A and B isoforms and/or monomeric half-mer molecules.
  • Form A and Form B are extremely difficult to separate even after MAb purification, since they are composed of identical amino acids and, therefore, have identical molecular weight and similar physical and chemical properties.
  • the invention is based, at least in part, on the finding that in a composition comprising a mixture of dimeric polypeptide molecules comprising different isoforms (molecules comprising two heavy chain portions in which a fraction ofthe molecules comprise two heavy chain portions that are linked via at least one interchain disulfide linkage (Form A) and a portion ofthe molecules comprise two heavy chain portions that are not linked via at least one interchain disulfide linkage (Form B)) one form or the other can be preferentially obtained, e.g., by separation using hydrophobic interaction chromatography or by inclusion of synthetic connecting peptides which result in the preferential biosynthesis of either Form A or Form B.
  • the binding molecules ofthe invention are tetravalent.
  • the connecting peptides ofthe invention can be included in any dimeric molecule that tends to form both Form A and Form B, e.g., antibody molecules, domain deleted antibody molecules (e.g., lacking all or part of a CH2 domain), minibodies, diabodies, fusion proteins, etc.
  • Form A is enhanced.
  • the invention pertains to a composition comprising polypeptide dimers comprising at least four binding sites and at least two polypeptide chains, wherein said at least two polypeptide chains comprise at least one heavy chain portion and a synthetic connecting peptide, and wherein greater than about 50% ofthe dimers are linked via at least one interchain disulfide linkage.
  • the dimers are linked via at least one interchain disulfide linkage.
  • at least one ofthe polypeptide chains comprises a CH3 domain linked to a VL, VH or CHI domain via the connecting peptide.
  • the polypeptide chains lack all or part of a CH2 domain.
  • the dimers are linked via two or more interchain disulfide linkages.
  • the heavy chain portion is derived from an antibody of an isotype selected from the group consisting of: IgGl, IgG2, IgG3, and IgG4.
  • the heavy chain portion comprises an amino acid sequence derived from a hinge region selected from the group consisting of: a ⁇ l hinge, a ⁇ 2 hinge, a ⁇ 3 hinge, and a ⁇ 4 hinge.
  • the molecules are bispecific.
  • the molecules comprise at least one binding site specific for a soluble ligand.
  • the molecules comprise at least one binding site specific for a cell surface molecule.
  • the molecules comprise two binding sites specific for a tumor cell antigen and two binding sites specific for a prodrug.
  • the binding sites specific for the prodrug are catalytic.
  • the synthetic connecting peptide comprises a proline residue at position 243, Kabat numbering system.
  • the synthetic connecting peptide further comprises an alanine residue at position 244 and a proline residue at position 245, Kabat numbering system.
  • the heavy chain portion comprises a chimeric hinge.
  • the synthetic connecting peptide comprises at least a portion of an IgGl hinge domain, at least a portion of an IgG3 hinge domain.
  • the connecting peptide comprises an amino acid sequence selected from the group consisting of: SEQ ID NOs: 8-15 and 48.
  • the invention provides a method of treating a subject that would benefit from treatment with an antigen binding molecule comprising administering to the subject a composition comprising a mixture of dimeric polypeptide molecules comprising different isoforms, wherein one isoform or the other is preferentially obtained, such that treatment occurs.
  • the subject is suffering from cancer.
  • the subject is suffering from lymphoma.
  • the subject is suffering from an autoimmune disease or disorder.
  • the subject is suffering from an inflammatory disease or disorder.
  • the invention provides a nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide molecule comprising different isoforms (molecules comprising two heavy chain portions in which a fraction ofthe molecules comprise two heavy chain portions that are linked via at least one interchain disulfide linkage (Form A) and a portion ofthe molecules comprise two heavy chain portions that are not linked via at least one interchain disulfide linkage (Form B)) such that one form or the other can be preferentially obtained.
  • the polypeptide dimers comprise four polypeptide chains and wherein two ofthe polypeptide chains comprise at least one heavy chain portion and a synthetic connecting peptide.
  • the nucleic acid molecule comprises a nucleotide sequence shown in Figure 8B (SEQ ID NO: 17). In another embodiment, the nucleic acid molecule comprises a nucleotide sequence shown in Figure 8C (SEQ ID NO: 18). In another embodiment, the nucleic acid molecule comprises a nucleotide sequence shown in Figure 10B (SEQ ID NO: 23). In another embodiment, the nucleic acid molecule comprises a nucleotide sequence shown in Figure 12A (SEQ ID NO:26). In another embodiment, the nucleic acid molecule comprises a nucleotide sequence shown in Figure 12B (SEQ JD NO:27).
  • the nucleic acid molecule comprises a nucleotide sequence shown in Figure 14 (SEQ ID NO:30).
  • the nucleic acid molecule comprises a nucleotide sequence shown in Figure 15 (SEQ ID NO:31).
  • the nucleic acid molecule is in a vector.
  • the vector is in a host cell.
  • the invention provides binding molecules comprising an amino acid sequence encoding a polypeptide molecule comprising different isoforms (molecules comprising two heavy chain portions in which a fraction ofthe molecules comprise two heavy chain portions that are linked via at least one interchain disulfide linkage (Form A) and a portion ofthe molecules comprise two heavy chain portions that are not linked via at least one interchain disulfide linkage (Form B)) such that one form or the other can be preferentially obtained.
  • the binding molecule comprises the amino acid sequence of Figure 9B (SEQ ID NO: 20).
  • the binding molecule comprises the amino acid sequence of Figure 9C (SEQ ID NO: 21).
  • the binding molecule comprises the amino acid sequence of Figure 11B (SEQ ID NO: 25). In another embodiment, the binding molecule comprises the amino acid sequence of Figure 13 A (SEQ ID NO: 28). In another embodiment, the binding molecule comprises the amino acid sequence of Figure 13B (SEQ ID NO: 29). In another embodiment, the binding molecule comprises the amino acid sequence of Figure 16 (SEQ ID NO: 32). In another embodiment, the binding molecule comprises the amino acid sequence of Figure 17 (SEQ ID NO: 33).
  • the invention provides a composition comprising a mixture of dimeric polypeptide molecules comprising different isoforms (molecules comprising two heavy chain portions in which a fraction ofthe molecules comprise two heavy chain portions that are linked via at least one interchain disulfide linkage (Form A) and a portion ofthe molecules comprise two heavy chain portions that are not linked via at least one interchain disulfide linkage (Form B)) one form or the other can be preferentially obtained, and wherein said binding sites are individually selected from the group consisting of: an antigen binding site, a ligand binding portion of a receptor, and a receptor binding portion of a ligand.
  • the polypeptide chains have at least one binding site derived from an antibody selected from the group consisting of: 2B8, Lym 1, Lym 2, LL2, Her2, Bl, MB1, BH3, B4, B72.3, CC49, 5E8, B3F6, and 5E10.
  • the polypeptide dimers are tetravalent minibody molecules.
  • the polypeptide dimers are tetravalent domain deleted antibody molecules.
  • the polypeptide dimers are diabodies.
  • the invention provides a composition comprising minibody molecules comprising two polypeptide chains, wherein the polypeptide chains comprise a heavy chain portion and a synthetic connecting peptide, wherein the polypeptide chains lack all or part of a CH2 domain, and wherein greater than about 50% ofthe molecules are present in a form in which one ofthe polypeptide chains are linked via at least one interchain disulfide linkage. In one embodiment, greater than about 90% ofthe dimers are linked via at least one interchain disulfide linkage. In another embodiment, at least one ofthe polypeptide chains comprises a CH3 domain genetically fused to a VL, VH or CHI domain via the connecting peptide. In another embodiment, the polypeptide chains lack the entire CH2 domain.
  • the dimers are linked via two or more interchain disulfide linkages.
  • the heavy chain portion is derived from an antibody of an isotype selected from the group consisting of: IgGl, IgG2, IgG3, and IgG4.
  • the heavy chain portion comprises an amino acid sequence is derived firom a hinge region selected from the group consisting of: a ⁇ l hinge, a ⁇ 2 hinge a ⁇ 3 hinge, and a ⁇ 4 hinge.
  • the binding sites are individually selected from the group consisting of: an antigen binding site, a ligand binding portion of a receptor, and a receptor binding portion of a ligand.
  • the molecules are bispecific.
  • the connecting peptide comprises a proline residue at position 243, Kabat numbering system.
  • the synthetic connecting peptide comprises a chimeric hinge.
  • the synthetic connecting peptide comprises at least a portion of an IgGl hinge domain, at least a portion of an IgG3 hinge domain.
  • the invention provides a method of treating a subject that would benefit from treatment with an antigen binding molecule comprising admimstering to the subject a composition comprising minibody molecules comprising two polypeptide chains, wherein the polypeptide chains comprise a heavy chain portion and a synthetic connecting peptide, wherein the polypeptide chains lack all or part of a CH2 domain, and wherein greater than about 50% ofthe molecules are present in a form in which one ofthe polypeptide chains are linked via at least one interchain disulfide linkage, such that treatment occurs.
  • the invention provides a nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide chain comprising a heavy chain portion and a synthetic connecting peptide, wherein the polypeptide chains lack all or part of a CH2 domain, and wherein greater than about 50% ofthe molecules are present in a form in which one ofthe polypeptide chains are linked via at least one interchain disulfide linkage.
  • the invention provides a composition comprising polypeptide dimers having at least four binding sites and at least two polypeptide chains, wherein said at least two polypeptide chains comprise at least one heavy chain portion and lacks all or part of a CH2 domain, wherein greater than 50% ofthe polypeptide dimers are linked via at least one interchain disulfide linkage.
  • Figure 1 shows Form A which appears as a 120kDa dimer and Form B which appears as a 60kDa monomer in domain deleted antibodies.
  • Figure 2 shows a schematic diagram of an exemplary two chain dimeric minibody and an exemplary two chain dimeric tetravalent minibody each comprising a hinge connecting peptide (HCP).
  • HCP hinge connecting peptide
  • the two chain dimeric tetravalent minibody comprising a connecting peptide (HCP) can also be constructed to be bispecific.
  • the orientation ofthe VH and VL domains in the scFv may be changed.
  • Figure 3 shows a schematic diagram of a four chain dimeric diabody comprising a hinge connecting peptide (HCP).
  • HCP hinge connecting peptide
  • the four chain dimeric diabody comprising a hinge connecting peptide (HCP) can also be constructed to be bispecific. The orientation ofthe VH and VL domains may be changed.
  • Figure 4 shows a schematic diagram of a four chain dimeric tetravalent scFv antibody (C-scFv tetravalent antibody) and a four chain tetravalent scFv CH2 domain deleted antibody (C-scFv tetravalent CH2 domain deleted antibody) each comprising a scFv appended to the carboxyl terminus of CH3 and a hinge connecting peptide.
  • the orientation ofthe VH and VL domains in the scFv may be changed.
  • Figure 5 shows a schematic diagram of a four chain dimeric CH2 domain deleted tetravalent (N -SCFV CH2 domain deleted tetravalent) antibody comprising a hinge connecting peptide (HCP).
  • the four chain dimeric CH2 domain deleted tetravalent antibody comprising a connecting peptide (HCP) can also be constructed to be bispecific. The orientation ofthe VH and VL domains in the scFv appended to the light chain may be changed.
  • Figure 6 shows a schematic diagram of a four chain dimeric CH2 domain deleted tetiavalent (N H -SCFV CH2 domain deleted tetravalent) antibody comprising a hinge connecting peptide (HCP).
  • the four chain dimeric CH2 domain deleted tetravalent antibody comprising a connecting peptide (HCP) can also be constructed to be bispecific.
  • the orientation ofthe VH and VL domains in the scFv appended to the heavy chain may be changed.
  • Figure 7 shows a schematic diagram of a two chain dimeric tetravalent minibody (C- scFv tetravalent minibody) comprising a hinge connecting peptide (HCP).
  • the two chain dimeric tetravalent minibody comprising a connecting peptide (HCP) can also be constructed to be bispecific. The orientation ofthe VH and VL domains in both scFvs may be changed.
  • Figure 8 A shows the single-stranded DNA sequence of heavy chain CH2 domain-deleted sc(Fv)2 tetravalent (C-scFv tetiavalent CH2 domain deleted) huCC49 gene.
  • Figure 8B shows the single-stranded DNA sequence of heavy chain tetravalent CH2 domain-deleted sc(Fv)2 tetravalent (C-scFv tetravalent CH2 domain deleted) huCC49 gene containing the synthetic
  • Figure 8C shows the single-stranded DNA sequence of light chain CH2 domain- deleted sc(Fv)2 tetravalent (C-scFv tetravalent CH2 domain deleted) huCC49.
  • Figure 9A shows the amino acid sequence of heavy chainCH2 domain-deleted sc(Fv)2 tetravalent (C-scFv tetravalent CH2 domain deleted) huCC49.
  • Figure 9B shows the amino acid sequence of heavy chain CH2 domain-deleted sc(Fv)2 tetravalent (C-scFv tetravalent CH2 domain deleted) huCC49 containing the synthetic Gl/G3/Pro243 Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 9C shows the amino acid sequence of light chain CH2 domain-deleted sc(Fv)2 tetravalent (C-scFv tetiavalent CH2 domain deleted) huCC49
  • Figure 10A shows the single-stranded DNA sequence of CH2 domain- deleted huCC49 tetravalent (N- scFv tetravalent) minibody gene.
  • Figure 10B shows the single-stranded DNA sequence of tetiavalent CH2 domain-deleted (N- scFv tetiavalent) huCC49 tetravalent minibody gene containing the synthetic Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 11 A shows the amino acid sequence of tetravalent CH2 domain-deleted (N- scFv tetravalent) huCC49 minibody.
  • Figure 1 IB shows the amino acid sequence of tetravalent CH2 domain-deleted (N- scFv tetravalent) huCC49 minibody containing the synthetic G1/G3/ Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 12A shows the single-stranded DNA sequence of heavy chain tetravalent CH2 domain-deleted PRLMATIZED® ⁇ 5E8 sc(Fv)2 (C-scFv tetravalent CH2 domain deleted) antibody gene containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 12B shows the single-stranded DNA sequence of light chain tetravalent CH2 domain-deleted (C-scFv tetravalent CH2 domain deleted) PRIMATIZED® p5E8 sc(Fv)2 gene.
  • Figure 13A shows the amino acid sequence of heavy chain tetravalent CH2 domain-deleted (C-scFv tetravalent CH2 domain deleted) PRIMATIZED® p5E8 sc(Fv)2 antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 13B shows the amino acid sequence of light chain tetravalent
  • Figure 14 shows the single-stranded DNA sequence of CH2 domain- deleted PRIMATIZED® p5E8 VL/VH minibody gene containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 15 shows the single-stranded DNA sequence of CH2 domain- deleted PRIMATIZED® p5E8 VH/VL minibody gene containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 16 shows the amino acid sequence of CH2 domain-deleted PRIMATIZED® p5E8 VL/VH minibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 17 shows the amino acid sequence of CH2 domain-deleted PRIMATIZED® p5E8 VH/VL minibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 18 shows a Western Blot of supematants from five independent clones producing huCC49 domain-deleted sc(Fv)2 tetravalent (C-scFv tetiavalent CH2 domain deleted) antibody. Each supernatant was electiophoresed under both reducing and non-reducing conditions.
  • Figure 19 shows a Coomassie Blue stained gel of purified Forms A and B huCC49 domain-deleted sc(Fv)2 tetiavalent (C-scFv tetiavalent CH2 domain deleted) antibodies. Each antibody was electiophoresed under reducing and non-reducing conditions.
  • Figure 20 shows that purified Form A huCC49 domain-deleted sc(Fv)2 tetiavalent (C- scFv tetravalent CH2 domain deleted) antibody predominantly elutes as a single peak by HPLC size-exclusion chromatography.
  • Figure 21 shows the results of a competitive binding assay of Form A huCC49 domain- deleted sc(Fv)2 tetravalent (C-scFv tetravalent CH2 domain deleted) antibody to bovine submaxillary mucine, a source ofthe TAG-72 antigen, by time-resolved fluorometic immunoassay using a Delphia fluorimeter (Wallac Inc, Gaithersburg, MD).
  • Figure 22 shows a Western Blot of supernatant from a representative clone producing huCC49 CH2 domain-deleted sc(Fv)2 tetiavalent (C-scFv tetiavalent CH2 domain deleted) antibody containing the Gl/G3/Pro243 Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 23 shows a Coomassie Blue stained gel of purified Form A huCC49 CH2 domain-deleted sc(Fv)2 tetiavalent G1/G3/PAP (C-scFv tetravalent CH2 domain deleted) antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 24 shows that purified Form A huCC49 CH2 domain-deleted sc(Fv)2 tetravalent G1/G3/PAP (C-scFv tetiavalent CH2 domain deleted) antibody containing the
  • Figure 25 shows the results of a competitive binding assay of Form A huCC49 CH2 domain-deleted sc(Fv)2 tetiavalent G1/G3/PAP (C-scFv tetravalent CH2 domain deleted) antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide to bovine submaxillary mucine, a source ofthe TAG-72 antigen, by time-resolved fluorometic immunoassay using a Delphia fluorimeter (Wallac Inc, Gaithersburg, MD).
  • Figure 26 shows Western Blots of supematants from representative clones producing huCC49 minibody, huCC49 2 sc(Fv)2 tetravalent antibody (N-scFv tetiavalent huCC49 minibody), and huCC49 CH2 domain deleted antibody.
  • a Western Blot was performed on supematants that were electiophoresed under reducing and non-reducing conditions.
  • Figure 27 shows a Western Blot of supematants from representative clones producing huCC49 2 sc(Fv)2 tetravalent antibody (N-scFv tetiavalent huCC49 mimbody) and huCC49 2 sc(Fv)2 tetiavalent antibody (N-scFv tetiavalent huCC49 minibody) containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 28 shows a Coomassie Blue stained gel of purified Form A huCC49 domain- deleted sc(Fv)2 tetravalent antibody (N-scFv tetiavalent mimbody) containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 29 shows purified Form A huCC49 domain-deleted sc(Fv)2 tetiavalent antibody (N-scFv tetravalent minibody) containing the Gl/G3/Pro243 Ala244Pro245 + [Gly/Ser] hinge connecting peptide predominantly elutes as a single peak by HPLC size-exclusion chromatography.
  • Figure 30 shows the results of a competitive binding assay of huCC49 domain-deleted sc(Fv)2 tetravalent antibody (N-scFv tetiavalent minibody) containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide, huCC49 mimbody, huCC49 CH2 domain-deleted sc(Fv)2 tetravalent antibody (C-scFv tetiavalent antibody) containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide, and contiol parent CH2 domain-deleted huCC49 (referred to as HuCC49 or IDEC 159) to bovine submaxillary mucine, a source ofthe TAG-72 antigen, by time-resolved fluorometic immunoassay using a Delphia fluorimeter (Wallac Inc, Gaithersburg, MD).
  • Figure 31 shows a Western Blot of supernatant from a cell line producing tetravalent CH2 domain-deleted (C-scFv tetravalent CH2 domain deleted) PRIMATIZED® p5E8 sc(Fv)2 antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 32 shows a Western Blot of supematants from five independent cell lines producing CH2 domain-deleted huCC49 VL/VH minibody. Minibody samples were analyzed under non-reducing, denaturing conditions revealing the presence of Form A and Form B isoforms.
  • Figure 33 show the results of an ELISA binding assay of PR ⁇ MATLZED® p5E8 VH/VL and VL/VH minibodies containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide binding to the CD23 antigen.
  • p5E8Gl is intact full length PRIMATIZED® IgGl.
  • Figure 34 shows a Western Blot of supernatant from cell lines producing PRIMATIZED® p5E8 VH/VL and VL/VH minibodies containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide.
  • Figure 35 A shows tumor retention for control parent huCC49 and huCC49 CH2 domain-deleted sc(Fv)2 tetravalent antibody as measured by %ID/gm.
  • Figure 35 B shows the same tumor retention data normalized to peak antibody accumulation.
  • Human immunoglobulins can exist in two forms that are associated with hinge heterogeneity. In native solutions, both of these forms are present as dimeric proteins (each monomer comprising one heavy chain and one light chain).
  • One immunoglobulin molecule comprises a stable four chain construct of approximately 150-160 kDa in which the dimers are held together by an interchain heavy chain disulfide bond (Form A) and one comprises form in which the dimers are not linked via interchain disulfide bonds (Form B).
  • Form B also fomis a stable dimer under native conditions, but can be identified under denaturing, non-reducing conditions, in which the heavy chains dissociate yielding a 75-80 kDa molecule. These forms have been extremely difficult to separate, even after MAb affinity purification.
  • the frequency of appearance ofthe B form in various intact IgG isotypes is due to, but not limited to, structural differences associated with the hinge region isotype ofthe MAb molecule.
  • a single amino acid substitution in the hinge region ofthe human IgG4 hinge can significantly reduce the appearance ofthe B form (Angal et al. 1993. Molecular hnmunology 30:105) to levels typically observed using a human IgGl hinge.
  • the instant invention advances the state ofthe art by providing methods of, e.g., separating a first dimeric polypeptide from a second dimeric polypeptide wherein the first and second polypeptides comprise at least two polypeptide chains and at least two ofthe polypeptide chains comprise at least one heavy chain portion.
  • the polypeptides of the invention lack all or part of a CH2 domain.
  • the monomers are linked via at least one interchain disulfide linkage (referred to herein as "Form A") and the monomers ofthe second polypeptide are not linked via at least one interchain disulfide linkage (referred to herein as "Form B”).
  • These forms can be separated from each other using hydrophobic interaction chromatography.
  • the invention pertains to polypeptides that comprise connecting peptides. The inclusion of certain connecting peptides results in the preferential biosynthesis of polypeptide dimers comprising polypeptide chains that are linked via at least one interchain disulfide linkage or that are not linked via at least one interchain disulfide linkage.
  • the polypeptides ofthe invention are binding molecules, i.e., polypeptide molecules or the nucleic acid molecules that encode them, that comprise at least one binding domain which comprises a binding site that specifically binds to a target molecule (such as an antigen or binding partner).
  • a binding molecule ofthe invention comprises an immunoglobulin antigen binding site or the portion of a receptor molecule responsible for ligand binding or the portion of a ligand molecule that is responsible for receptor binding.
  • the binding molecules ofthe invention are polypeptides or the nucleic acid molecules which encode them.
  • the binding molecules comprise at least two binding sites, hi one embodiment, the binding molecules comprise two binding sites. In one embodiment, the binding molecules comprise three binding sites.
  • the binding molecules comprise four binding sites.
  • the polypeptides ofthe invention are multimers.
  • the polypeptides ofthe invention are dimers.
  • the dimers ofthe invention are homodimers, comprising two identical monomeric subunits.
  • the dimers ofthe invention are heterodimers, comprising two non-identical monomeric subunits.
  • the subunits ofthe dimer may comprise one or more polypeptide chains.
  • the dimers comprise at least two polypeptide chains.
  • the dimers comprise two polypeptide chains.
  • the dimers comprise four polypeptide chains (e.g., as in the case of antibody molecules).
  • polypeptides ofthe invention comprise at least one amino acid sequence derived from an immunoglobulin domain.
  • a polypeptide or amino acid sequence "derived from" a designated protein refers to the origin ofthe polypeptide.
  • the polypeptide or aniino acid sequence which is derived from a particular starting polypeptide or amino acid sequence has an amino acid sequence that is essentially identical to that ofthe starting sequence, or a portion thereof wherein the portion consists of at least 10-20 amino acids, preferably at least 20-30 amino acids, more preferably at least 30-50 amino acids, or which is otherwise identifiable to one of ordinary skill in the art as having its origin in the starting sequence.
  • Preferred binding polypeptides comprise an amino acid sequence derived from a human aniino acid sequence.
  • binding polypeptides may comprise one or more amino acids from another mammalian species.
  • a primate heavy chain portion, hinge portion, or binding site may be included in the subj ect binding polypeptides and/or connecting polypeptides.
  • one or more murine amino acids may be present in a binding polypeptide, e.g., in an antigen binding site of a binding molecule.
  • Preferred binding molecules ofthe invention are not immunogenic. It will also be understood by one of ordinary skill in the art that the binding molecules ofthe invention (e.g., the heavy chain or light chain portions or binding portions ofthe subject polypeptides) may be modified such that they vary in amino acid sequence from the naturally occurring immunoglobulin molecule from which they were derived.
  • nucleotide or amino acid substitutions leading to conservative substitutions or changes at "non-essential" amino acid residues may be made.
  • An isolated nucleic acid molecule encoding a non-natural variant of a polypeptide derived from an immunoglobulin e.g., an immunoglobulin heavy chain portion or light chain portion
  • an immunoglobulin e.g., an immunoglobulin heavy chain portion or light chain portion
  • Mutations may be introduced by standard techniques, such as site- directed mutagenesis and PCR-mediated mutagenesis.
  • conservative amino acid substitutions are made at one or more non-essential amino acid residues.
  • a "conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phen
  • a nonessential amino acid residue in an immunoglobulin polypeptide is preferably replaced with another amino acid residue from the same side chain family.
  • a string of amino acids can be replaced with a structurally similar string that differs in order and/or composition of side chain family members.
  • mutations may be introduced randomly along all or part ofthe immunoglobulin coding sequence, such as by saturation mutagenesis, and the resultant mutants can be inco ⁇ orated into polypeptides ofthe invention and screened for their ability to bind to the desired antigen.
  • the term "heavy chain portion" includes aniino acid sequences derived from an immunoglobulin heavy chain.
  • a polypeptide comprising a heavy chain portion comprises at least one of: a CHI domain, a hinge (e.g., upper, middle, and/or lower hinge region) domain, a CH2 domain, a CH3 domain, or a variant or fragment thereof.
  • a polypeptide ofthe invention comprises a polypeptide chain comprising a CHI domain, at least a portion of a hinge domain, and a CH2 domain.
  • a polypeptide ofthe invention comprises a polypeptide chain comprising a CHI domain and a CH3 domain
  • a polypeptide ofthe invention comprises a polypeptide chain comprising a CHI domain, at least a portion of a hinge domain, and a CH3 domain.
  • a polypeptide ofthe invention comprises a polypeptide chain comprising a CH3 domain.
  • a polypeptide ofthe invention lacks at least a portion of a CH2 domain (e.g., all or part of a CH2 domain).
  • a polypeptide ofthe invention comprises a complete lg heavy chain. As set forth above, it will be understood by one of ordinary skill in the art that these domains (e.g., the heavy chain portions) may be modified such that they vary in amino acid sequence from the naturally occurring immunoglobulin molecule.
  • At least two ofthe polypeptide chains of a binding molecule ofthe invention comprise at least one heavy chain portion derived from an antibody or immunoglobulin molecule
  • at least two heavy chain portions of a polypeptide ofthe invention are present on different polypeptide chains and interact, e.g., via at least one disulfide linkage (Form A) or via non-covalent interactions (Form B) to form a dimeric polypeptide, each monomer ofthe dimer comprising at least one heavy chain portion.
  • the heavy chain portions of one polypeptide chain of a dimer are identical to those on a second polypeptide chain ofthe dimer.
  • the monomers (or half-mers) of a dimer ofthe invention are identical to each other. In another embodiment, they are not identical. For example, each monomer may comprise a different target binding site.
  • a dimer ofthe invention is held together by covalent interactions, e.g., disulfide bonds. In one embodiment, a dimer ofthe invention is held together by one or more disulfide bonds. In another embodiment, a dimer ofthe invention is held together by one or more, preferably two disulfide bonds. In another embodiment, a dimer ofthe invention is held together by one or more, preferably three disulfide bonds. In another embodiment, a dimer ofthe invention is held together by one or more, preferably four disulfide bonds.
  • a dimer ofthe invention is held together by one or more, preferably five disulfide bonds. In another embodiment a dimer ofthe invention is held together by one or more, preferably six disulfide bonds, hi another embodiment, a dimer ofthe invention is held together by one or more, preferably seven disulfide bonds. In another embodiment, a dimer ofthe invention is held together by one or more, preferably eight disulfide bonds. In another embodiment, a dimer ofthe invention is held together by one or more, preferably nine disulfide bonds.
  • a dimer ofthe invention is held together by one or more, preferably ten disulfide bonds, hi a further embodiment, a dimer ofthe invention is not held together by disulfide bonds, but is held together, e.g., by non- covalent interactions.
  • the heavy chain portions of a polypeptide may be derived from different immunoglobulin molecules.
  • a heavy chain portion of a polypeptide may comprise a CHI domain derived from an IgGl molecule and a hinge region derived from an IgG3 molecule.
  • a heavy chain portion can comprise a hinge region derived, in part, from an IgGl molecule and, in part, from an IgG3 molecule.
  • a heavy chain portion can comprise a chimeric hinge derived, in part, from an IgGl molecule and, in part, from an IgG4 molecule.
  • the term "light chain portion" includes amino acid sequences derived from an immunoglobulin light chain.
  • the light chain portion comprises at least one of a VL or CL domain.
  • a polypeptide ofthe invention comprises an amino acid sequence or one or more moieties not derived from an lg molecule. Exemplary modifications are described in more detail below.
  • a polypeptide ofthe invention may comprise a flexible linker sequence.
  • a polypeptide may be modified to add a functional moiety (e.g., PEG, a drug, or a label).
  • a binding polypeptide ofthe invention is a fusion protein. Fusion proteins are chimeric molecules which comprise a binding domain comprising at least one target binding site and at least one heavy chain portion, hi one embodiment, a fusion protein further comprises a synthetic connecting peptide.
  • a "chimeric" protein comprises a first amino acid sequence linked to a second amino acid sequence with which it is not naturally linked in nature. The amino acid sequences may normally exist in separate proteins that are brought together in the fusion polypeptide or they may normally exist in the same protein but are placed in a new arrangement in the fusion polypeptide.
  • a chimeric protein may be created, for example, by chemical synthesis, or by creating and translating a polynucleotide in which the peptide regions are encoded in the desired relationship.
  • Exemplary chimeric polypeptides include fusion proteins and the chimeric hinge connecting peptides ofthe invention.
  • the term "heterologous" as applied to a polynucleotide or a polypeptide means that the polynucleotide or polypeptide is derived from a genotypically distinct entity from that ofthe rest ofthe entity to which it is being compared. For instance, a heterologous polynucleotide or antigen may be derived from a different species origin, different cell type, or the same type of cell of distinct individuals.
  • ligand binding domain or "ligand binding portion of a receptor” as used herein refers to any native receptor (e.g., cell surface receptor) or any region or derivative thereof retaining at least a qualitative ligand binding ability, and preferably the biological activity of a corresponding native receptor.
  • receptor binding domain or “receptor binding portion of a ligand” as used herein refers to any native ligand or any region or derivative thereof retaining at least a qualitative receptor binding ability, and preferably the biological activity of a conesponding native ligand.
  • a binding molecule ofthe invention is a fusion protein.
  • a fusion protein ofthe invention is a chimeric molecule that comprises a binding domain (which comprises at least one binding site) and a dimerization domain (which comprises at least one heavy chain portion).
  • the heavy chain portion may be from any immunoglobulin, such as IgGl, IgG2, IgG3, or IgG4 subtypes, IgA, IgE, IgD orlgM.
  • a binding molecule is an "antibody-fusion protein chimera.”
  • Such molecules comprise a molecule which combines at least one binding domain of an antibody with at least one fusion protein.
  • the interface between the two polypeptides is a CH3 domain of an immunoglobulin molecule.
  • the binding molecules ofthe invention are "antibody” or "immunoglobulin” molecules, e.g., naturally occurring antibody or immunoglobulin molecules or genetically engineered antibody molecules that bind antigen in a manner similar to antibody molecules.
  • immunoglobulin includes a polypeptide having a combination of two heavy and two light chains whether or not it possesses any relevant specific immunoreactivity.
  • Antibodies refers to such assemblies which have significant known specific immunoreactive activity to an antigen of interest (e.g. a tumor associated antigen).
  • Antibodies and immunoglobulins comprise light and heavy chains, with or without an interchain covalent linkage between them. Basic immunoglobulin structures in vertebrate systems are relatively well understood.
  • immunoglobulin comprises five distinct classes of antibody that can be distinguished biochemically. All five classes of antibodies are clearly within the scope ofthe present invention, the following discussion will generally be directed to the IgG class of immunoglobulin molecules.
  • immunoglobulins comprise two identical light polypeptide chains of molecular weight approximately 23,000 Daltons, and two identical heavy chains of molecular weight 53,000-70,000. The four chains are joined by disulfide bonds in a "Y" configuration wherein the light chains bracket the heavy chains starting at the mouth ofthe "Y” and continuing through the variable region. Both the light and heavy chains are divided into regions of structural and functional homology. The terms “constant” and “variable” are used functionally.
  • variable domains of both the light (VL) and heavy (VH) chain portions determine antigen recognition and specificity.
  • the constant domains ofthe light chain (CL) and the heavy chain (CHI, CH2 or CH3) confer important biological properties such as secretion, tiansplacental mobility, Fc receptor binding, complement binding, and the like.
  • the N-terminus is a variable region and at the C-terminus is a constant region; the CH3 and CL domains actually comprise the carboxy-terminus ofthe heavy and light chain, respectively.
  • Light chains are classified as either kappa or lambda (K, ⁇ ).
  • Each heavy chain class may be bound with either a kappa or lambda light chain, hi general, the light and heavy chains are covalently bonded to each other, and the "tail" portions ofthe two heavy chains are bonded to each other by covalent disulfide linkages or non-covalent linkages when the immunoglobulins are generated either by hybridomas, B cells or genetically engineered host cells.
  • the amino acid sequences run from an N-terminus at the forked ends ofthe Y configuration to the C-terminus at the bottom of each chain.
  • heavy chains are classified as gamma, mu, alpha, delta, or epsilon, ( ⁇ , ⁇ , ⁇ , ⁇ , ⁇ ) with some subclasses among them (e.g., ⁇ l- ⁇ 4). It is the nature of this chain that determines the "class" ofthe antibody as IgG, IgM, IgA IgG, or IgE, respectively.
  • the immunoglobulin subclasses e.g., IgG IgG 2 , IgG 3 , IgG , IgAi, etc. are well characterized and are known to confer functional specialization.
  • variable region allows the antibody to selectively recognize and specifically bind epitopes on antigens. That is, the V domain and V H domain of an antibody combine to form the variable region that defines a three dimensional antigen binding site.
  • This quaternary antibody structure forms the antigen binding site present at the end of each arm ofthe Y. More specifically, the antigen binding site is defined by three complementary determining regions (CDRs) on each of the VH and V L chains.
  • binding site comprises a region of a polypeptide which is responsible for selectively binding to a target molecule of interest (e.g. an antigen, ligand, receptor, substrate or inhibitor).
  • exemplary binding domains include an antibody variable domain, a receptor binding domain of a ligand, a ligand binding domain of a receptor or an enzymatic domain.
  • the binding molecules have at least one binding site specific for a molecule targeted for reduction or elimination, e.g., a cell surface antigen or a soluble antigen.
  • the binding domain is an antigen binding site.
  • An antigen binding site is formed by variable regions that vary from one polypeptide to another.
  • the polypeptides ofthe invention comprise at least two antigen binding sites.
  • the term "antigen binding site” includes a site that specifically binds (immunoreacts with) an antigen (e.g., a cell surface or soluble antigen).
  • the antigen binding site includes an immunoglobulin heavy chain and light chain variable region and the binding site formed by these variable regions determines the specificity ofthe antibody.
  • an antigen binding molecule ofthe invention comprises at least one heavy or light chain CDR of an antibody molecule (e.g., the sequence of which is known in the art or described herein).
  • an antigen binding molecule ofthe invention comprises at least two CDRs from one or more antibody molecules.
  • an antigen binding molecule ofthe invention comprises at least three CDRs from one or more antibody molecules. In another embodiment, an antigen binding molecule ofthe invention comprises at least four CDRs from one or more antibody molecules. In another embodiment, an antigen binding molecule ofthe invention comprises at least five CDRs from one or more antibody molecules. In another embodiment, an antigen binding molecule ofthe invention comprises at least six CDRs from one or more antibody molecules. Exemplary antibody molecules comprising at least one CDR that can be included in the subject antigen binding molecules are known in the art and exemplary molecules are described herein.
  • polypeptides comprising two heavy chain portions disclosed herein may be linked to form two associated Ys so there will be four binding sites forming a "tetravalent” molecule (see e.g., WO02/096948A2)).
  • tetravalent minibodies or domain deleted antibodies can be made.
  • the term "specificity" includes the number of potential binding sites which specifically bind (e.g., immunoreact with) a given target.
  • a polypeptide may be monospecific and contain one or more binding sites which specifically bind a target or a polypeptide may be multispecific and contain two or more binding sites which specifically bind the same or different targets.
  • a binding molecule ofthe invention is a bispecific molecule (e.g., antibody, mimbody, domain deleted antibody, or fusion protein having binding specificity for more than one molecule, e.g., more than one antigen or more than one epitope on the same antigen.
  • the bispecific molecules have at least one target binding site specific for a molecule targeted for reduction or elimination and a targeting molecule on a cell.
  • the bispecific molecules have at least one target binding site specific for a molecule targeted for reduction or elimination and at least one target binding site specific for a drug.
  • the bispecific molecules have at least one target binding site specific for a molecule targeted for reduction or elimination and at least one target binding site specific for a prodrug.
  • the bispecific molecules are tetravalent antibodies that have two target binding sites specific for one target and two target binding sites specific for the second target.
  • a tetravalent bispecific molecule may be bivalent for each specificity. Further description of bispecific molecules is provided below.
  • valency refers to the number of potential target binding sites in a polypeptide. Each target binding site specifically binds one target molecule or specific site on a target molecule. When a polypeptide comprises more than one target binding site, each target binding site may specifically bind the same or different molecules (e.g., may bind to different ligands or different antigens, or different epitopes on the same antigen).
  • the six CDRs present on each monomeric antibody are short, non-contiguous sequences of aniino acids that are specifically positioned to form the antigen binding site as the antibody assumes its three dimensional configuration in an aqueous environment.
  • the remainder ofthe heavy and light variable domains show less inter-molecular variability in amino acid sequence and are termed the framework regions.
  • the framework regions largely adopt a ⁇ -sheet conformation and the CDRs form loops which connect, and in some cases form part of, the ⁇ -sheet justifycture. Thus, these framework regions act to form a scaffold that provides for positioning the six CDRs in correct orientation by inter-chain, non-covalent interactions.
  • the antigen binding site formed by the positioned CDRs defines a surface complementary to the epitope on the immunoreactive antigen. This complementary surface promotes the non-covalent binding ofthe antibody to the immunoreactive antigen epitope.
  • the position of CDRs can be readily identified by one of ordinary skill in the art. As previously indicated, the subunit structures and three dimensional configuration ofthe constant regions of he various immunoglobulin classes are well known.
  • VH domain includes the amino terminal variable domain of an immunoglobulin heavy chain and the term "CHI domain” includes the first (most amino terminal) constant region domain of an immunoglobulin heavy chain.
  • the CHI domain is adjacent to the VH domain and is amino terminal to the hinge region of an immunoglobulin heavy chain molecule.
  • CH2 domain includes the portion of a heavy chain molecule that extends, e.g., from about residue 244 to residue 360 of an antibody using conventional numbering schemes (residues 244 to 360, Kabat numbering system; and residues 231-340, EU numbering system,; and Kabat EA et al. Sequences of Proteins of Immunological Interest. Bethesda, US Department of Health and Human Services, NJJL 1991).
  • the CH2 domain is unique in that it is not closely paired with another domain. Rather, two N-linked branched carbohydrate chains are interposed between the two CH2 domains of an intact native IgG molecule.
  • a binding molecule ofthe invention comprises a connecting peptide.
  • the connecting peptides ofthe invention are synthetic.
  • polypeptides which comprise an amino acid sequence that is not naturally occurring.
  • non- naturally occurring polypeptides which are modified forms of naturally occurring polypeptides (e.g., comprising a mutation such as an addition, substitution or deletion) or which comprise a first amino acid sequence (which may or may not be naturally occurring) that is linked in a linear sequence of amino acids to a second amino acid sequence (which may or may not be naturally occurring) to which it is not naturally linked in nature.
  • Connecting peptides ofthe invention connect two domains (e.g., a binding domain and a dimerization domain) of a binding molecule ofthe invention.
  • connecting peptides connect a heavy chain portion to a binding domain comprising a binding site.
  • a connecting peptide connects two heavy chain constant region domains, such as CHI and CH2 domains; CHI and CH3 domains; hinge and CHI domains; hinge and CH3 domains; VH and hinge domains, or a CH3 domain and a non-immunoglobulin polypeptide) in a linear amino acid sequence of a polypeptide chain.
  • connecting peptides provide flexibility to the polypeptide molecule and facilitate dimerization via disulfide bonding
  • the connecting peptides ofthe invention are used to replace one or more heavy chain domains (e.g., at least a portion of a constant region domain (e.g., at least a portion of a CH2 domain) and/or at least a portion ofthe hinge region (e.g., at least a portion ofthe lower hinge region domain) in a domain deleted construct).
  • a VH domain is fused to a CH3 domain via a connecting peptide (the C-terminus ofthe connecting peptide is attached to the N-terminus ofthe CH3 domain and the N-terminus ofthe connecting peptide is attached to the C-terminus of the VH domain)
  • a VL domain is fused to a CH3 domain via a connecting peptide (the C-terminus ofthe connecting peptide is attached to the N- terminus ofthe CH3 domain and the N-terminus ofthe connecting peptide is attached to the C-terminus ofthe VL domain
  • a CHI domain is fused to a CH3 domain via a connecting peptide (the C-terminus ofthe connecting peptide is attached to the N-terminus ofthe CH3 domain and the N-terminus ofthe connecting peptide is attached to the C-terminus ofthe CHI domain).
  • a synthetic connecting peptide comprises a portion of a constant region domain.
  • a connecting peptide that replaces a CH2 domain can comprise a portion ofthe CH2 domain.
  • a connecting peptide comprises or consists of a gly- ser linker.
  • gly-ser linker refers to a peptide that consists of glycine and serine residues
  • An exemplary gly/ser linker comprises the amino acid sequence GGGSSGGGSG (SEQ ID NO.T).
  • a connecting peptide of the invention comprises at least a portion of an upper hinge region (e.g., derived from an IgGl, IgG3, or IgG4 molecule), at least a portion of a middle hinge region(e.g., derived from an IgGl, IgG3, or IgG4 molecule) and a series of gly/ser amino acid residues (e.g., a gly/ser linker such as GGGSSGGGSG (SEQ ID NO:l)).
  • the connecting peptide comprises a substitution of one or more amino acids as compared to naturally occurring IgGl or IgG3 hinge regions.
  • a connecting peptide comprises an amino acid sequence such as described in WO 02/060955. Connecting peptides are described in more detail below.
  • the term "disulfide bond” includes the covalent bond formed between two sulfur atoms.
  • the amino acid cysteine comprises a thiol group that can form a disulfide bond or bridge with a second thiol group.
  • the CHI and CL regions are linked by a disulfide bond and the two heavy chains are linked by two disulfide bonds at positions corresponding to 239 and 242 using the Kabat numbering system (position 226 or 229, EU numbering system). It is known in the art that the constant region mediates several effector functions.
  • binding ofthe Cl component of complement to antibodies activates the complement system.
  • Activation of complement is important in the opsonisation and lysis of cell pathogens.
  • the activation of complement also stimulates the inflammatory response and may also be involved in autoimmune hypersensitivity.
  • antibodies bind to cells via the Fc region, with a Fc receptor site on the antibody Fc region binding to a Fc receptor (FcR) on a cell.
  • Fc receptors There are a number of Fc receptors which are specific for different classes of antibody, including IgG (gamma receptors), IgE (epsilon receptors), IgA (alpha receptors) and IgM (mu receptors).
  • the Fc portion may be mutated to decrease effector function using techniques known in the art. For example, the deletion or inactivation (through point mutations or other means) of a constant region domain may reduce Fc receptor binding ofthe circulating modified antibody thereby increasing tumor localization.
  • constant region modifications consistent with the instant invention moderate compliment binding and thus reduce the serum half life and nonspecific association of a conjugated cytotoxin.
  • modifications ofthe constant region may be used to modify disulfide linkages or oligosaccharide moieties that allow for enhanced localization due to increased antigen specificity or antibody flexibility.
  • antibodies modified as described herein may exert a number of subtle effects that may or may not be readily appreciated.
  • the resulting physiological profile, bioavailability and other biochemical effects ofthe modifications such as tumor localization, biodistribution and serum half-life, may easily be measured and quantified using well know immunological techniques without undue experimentation.
  • modified forms of antibodies can be made from a whole precursor or parent antibody using techniques known in the art. Exemplary techniques are discussed in more detail below.
  • both the variable and constant regions of polypeptides ofthe invention are human, i one embodiment, fully human antibodies can be made using techniques that are known in the art.
  • fully human antibodies against a specific antigen can be prepared by administering the antigen to a transgenic animal which has been modified to produce such antibodies in response to antigenic challenge, but whose endogenous loci have been disabled.
  • Exemplary techniques that can be used to make antibodies are described in US patents: 6,150,584; 6,458,592; 6,420,140. Other techniques are known in the art.
  • a polypeptide comprising a heavy chain portion may or may not comprise other amino acid sequences or moieties not derived from an immunoglobulin molecule. Such modifications are described in more detail below.
  • a polypeptide ofthe invention may comprise a flexible linker sequence.
  • a polypeptide may be modified to add a functional moiety such as PEG.
  • the polypeptides ofthe instant invention comprise at least two binding sites that provide for the association ofthe polypeptide with the selected target molecule, hi one embodiment, a binding molecule ofthe invention comprises an antibody molecule, e.g., an intact antibody molecule, or a fragment of an antibody molecule. In another embodiment, binding molecule ofthe invention is a modified or synthetic antibody molecule.
  • a binding molecule ofthe invention comprises all or a portion of (e.g., at least one antigen binding site from, at least one CDR from, or at least one heavy chain portion from) a monoclonal antibody, a humanized antibody, a chimeric antibody, or a recombinantly produced antibody.
  • the binding molecule is an antibody or modified antibody
  • the antigen binding site and the heavy chain portions need not be derived from the same immunoglobulin molecule.
  • the variable region may or be derived from any type of animal that can be induced to mount a humoral response and generate immunoglobulins against the desired antigen.
  • variable region of the polypeptides may be, for example, of mammalian origin e.g., may be human, murine, non-human primate (such as cynomolgus monkeys, macaques, etc.), lupine, camelid (e.g., from camels, llamas and related species), hi another embodiment, the variable region may be condricthoid in origin (e.g., from sharks).
  • Polypeptides ofthe invention can be made using techniques that are known in the art.
  • the polypeptides ofthe invention are antibody molecules that have been "recombinantly produced," i.e., are produced using recombinant DNA technology.
  • the polypeptides ofthe invention are modified antibodies.
  • modified antibody includes synthetic forms of antibodies which are altered such that they are not naturally occurring, e.g., antibodies that comprise at least two heavy chain portions but not two complete heavy chains (such as, domain deleted antibodies or minibodies); multispecific forms of antibodies (e.g., bispecific, trispecific, etc.) altered to bind to two or more different antigens or to different epitopes on a single antigen); heavy chain molecules joined to scFv molecules and the like. ScFv molecules are known in the art and are described, e.g., in US patent 5,892,019.
  • a binding molecule ofthe invention is a fusion protein comprising at least one heavy chain portion lacking a CH2 domain and comprising a binding domain of a polypeptide comprising the binding portion of one member of a ligand and its receptor.
  • the term, "modified antibody” according to the present mvention includes immunoglobulins, antibodies, or immunoreactive fragments or recombinants thereof, in which at least a fraction of one or more ofthe constant region domains has been deleted or otherwise altered so as to provide desired biochemical characteristics such as the ability to non-covalently dimerize, increased ability to localize at the site of a tumor, or reduced serum half-life when compared with a whole, unaltered antibody of approximately the same immunogenicity.
  • the polypeptides ofthe present invention are domain deleted antibodies which comprise a polypeptide chain similar to an immunoglobulin heavy chain, but which lack at least a portion of one or more heavy chain domains.
  • one entire domain ofthe constant region ofthe modified antibody will be deleted and even more preferably all or part ofthe CH2 domain will be deleted.
  • a polypeptide ofthe invention will not elicit a deleterious immune response in a human.
  • Modifications to the constant region compatible with the instant invention comprise additions, deletions or substitutions of one or more amino acids in one or more domains. That is, the polypeptides ofthe invention disclosed herein may comprise alterations or modifications to one or more of the three heavy chain constant domains (CHI, CH2 or CH3) and/or to the light chain constant region domain (CL).
  • the invention pertains to a modified antibody molecule comprising at least one CC49 binding site (specific for Tag72).
  • Figure 8A shows the single-stranded DNA sequence of sc(Fv)2 heavy chain tetiavalent CH 2 domain-deleted huCC49 gene.
  • Figure 8B shows the single-stranded DNA sequence of sc(Fv)2 heavy chain tetravalent CH 2 domain-deleted huCC49 gene containing the synthetic Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 8C shows the single- stranded DNA sequence of sc(Fv)2 light chain CH 2 domain-deleted huCC49.
  • Figure 9 A shows the amino acid sequence of heavy chain sc(Fv)2 tetravalent CH 2 domain-deleted huCC49.
  • Figure 9B shows the amino acid sequence of heavy chain tetravalent CH domain-deleted sc(Fv)2 huCC49 containing the synthetic Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 9C shows the amino acid sequence of light chain CH 2 domain-deleted sc(Fv)2 huCC49.
  • Figure 10A shows the single-stranded DNA sequence of tetiavalent CH 2 domain-deleted 2sc(Fv)2 huCC49 minibody gene.
  • Figure 10B shows the single-stranded DNA sequence of tetravalent CH 2 domain-deleted sc(Fv)2 huCC49 mimbody gene containing the synthetic Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 11 A shows the amino acid sequence of tetravalent CH 2 domain-deleted sc(Fv)2 huCC49 mimbody.
  • Figure 1 IB shows the amino acid sequence of tetravalent CH 2 domain-deleted sc(Fv)2 huCC49 minibody containing the synthetic Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • the invention pertains to a modified antibody molecule comprising at least one p5E8 binding site (specific for CD23).
  • Figure 12A shows the single-stranded DNA sequence of heavy chain tetravalent CH2 domain-deleted PRIMATIZED® p5E8 sc(Fv)2 antibody gene containing the Gl/G3 Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 12B shows the single-stranded DNA sequence of light chain tetravalent CH2 domain-deleted PRIMATIZED® ⁇ 5E8 sc(Fv)2 gene.
  • Figure 13A shows the amino acid sequence of heavy chain tetravalent CH2 domain-deleted
  • FIG. 13B shows the amino acid sequence of light chain tetiavalent CH2 domain-deleted PRIMATIZED® p5E8 sc(Fv)2 antibody.
  • Figure 14 shows the single-stranded DNA sequence of CH2 domain-deleted PRIMATIZED® p5E8 VL VH minibody gene contaimng the
  • FIG. 15 shows the single-stranded DNA sequence of CH2 domain-deleted PRIMATIZED® p5E8 VH/VL minibody gene containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 16 shows the amino acid sequence of CH2 domain-deleted Pl ⁇ JMATLZED® ⁇ 5E8 VL/VH minibody containing the Gl/G3 Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • Figure 17 shows the amino acid sequence of CH2 domain-deleted PRIMATIZED® p5E8 VH/VL minibody containing the Gl/G3 Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
  • the polypeptides ofthe invention may be modified to reduce their immunogenicity using art-recognized techniques.
  • antibodies or polypeptides ofthe invention can be humanized, deimmunized, or chimeric antibodies can be made. These types of antibodies are derived from a non-human antibody, typically a murine antibody, that retains or substantially retains the antigen-binding properties ofthe parent antibody, but which is less immunogenic in humans.
  • CDRs complementarity determining regions
  • De-immunization can also be used to decrease the irnmunogerricity of an antibody.
  • the term "de-immunization'' includes alteration of an antibody to modify T cell epitopes (see, e.g., WO9852976A1, WO0034317A2).
  • VH and VL sequences from the starting antibody are analyzed and a human T cell epitope "map" from each V region showing the location of epitopes in relation to complementarity-determining regions (CDRs) and other key residues within the sequence
  • CDRs complementarity-determining regions
  • Individual T cell epitopes from the T cell epitope map are analyzed in order to identify alternative amino acid substitutions with a low risk of altering activity ofthe final antibody.
  • a range of alternative VH and VL sequences are designed comprising combinations of amino acid substitutions and these sequences are subsequently incorporated into a range of polypeptides ofthe invention that are tested for function. Typically, between 12 and 24 variant antibodies are generated and tested.
  • the binding molecule comprises a chimeric antibody.
  • chimeric antibodies will be held to mean any antibody wherein the immunoreactive region or site is obtained or derived from a first species and the constant region (which may be intact, partial or modified in accordance with the instant invention) is obtained from a second species.
  • the target binding region or site will be from a non-human source (e.g. mouse) and the constant region is human.
  • variable domains in both the heavy and light chains are altered by at least partial replacement of one or more CDRs and, if necessary, by partial framework region replacement and sequence changing.
  • the CDRs may be derived from an antibody ofthe same class or even subclass as the antibody from which the framework regions are derived, it is envisaged that the CDRs will be derived from an antibody of different class and preferably from an antibody from a different species. It may not be necessary to replace all ofthe CDRs with the complete CDRs from the donor variable region to transfer the antigen binding capacity of one variable domain to another. Rather, it may only be necessary to transfer those residues that are necessary to maintain the activity ofthe target binding site. Given the explanations set forth in U. S. Pat. Nos.
  • the temi "properly folded polypeptide” includes polypeptides (e.g., antigen binding molecules such as antibodies) in which all ofthe functional domains comprising the polypeptide are distinctly active.
  • the term "improperly folded polypeptide” includes polypeptides in which at least one ofthe functional domains ofthe polypeptide is not active.
  • a properly folded polypeptide comprises polypeptide chains linked by at least one disulfide bond and, conversely, an improperly folded polypeptide comprises polypeptide chains not linked by at least one disulfide bond.
  • malignancy refers to a non-benign tumor or a cancer.
  • cancer includes a malignancy characterized by deregulated or uncontrolled cell growth. Exemplary cancers include: carcinomas, sarcomas, leukemias, and lymphomas.
  • a binding molecule ofthe invention binds to a tumor cell.
  • Exemplary antibodies which comprise antigen binding sites that bind to antigens expressed on tumor cells are known in the art and one or more CDRs from such antibodies can be included in a binding molecule ofthe invention.
  • a polypeptide ofthe invention is a C2B8 antibody which binds to CD20.
  • a polypeptide ofthe invention is a CC49 antibody which recognizes TAG72.
  • a binding molecule ofthe invention binds to a molecule which is useful in treating an autoimmune or inflammatory disease or disorder.
  • autoimmune disease or disorder refers to disorders or conditions in a subject wherein the immune system attacks the body's own cells, causing tissue destruction.
  • Autoimmune diseases include general autoimmune diseases, i.e., in which the autoimmune reaction takes place simultaneously in a number of tissues, or organ specific autoimmune diseases, i.e. , in which the autoimmune reaction targets a single organ.
  • autoimmune diseases that can be diagnosed, , prevented or treated by the methods and compositions of the present invention include, but are not limited to, Crohn's disease; Inflammatory bowel disease (JJ3D); systemic lupus erythematosus; ulcerative colitis; rheumatoid arthritis; goodpasture's syndrome; Grave's disease; Hashimoto's thyroiditis; pemphigus vulgaris; myasthenia gravis; scleroderma; autoimmune hemolytic anemia; autoimmune thrombocytopenic purpura; polymyositis and dermatomyositis; pernicious anemia; Sj ⁇ gren's syndrome; ankylosing spondylitis; vasculitis; type I diabetes mellit
  • inflammatory disease or disorder includes diseases or disorders which are caused, at least in part, or exacerbated by inflammation, e.g., increased blood flow, edema, activation of immune cells (e.g., proliferation, cytokine production, or enhanced phagocytosis).
  • inflammation e.g., increased blood flow, edema, activation of immune cells (e.g., proliferation, cytokine production, or enhanced phagocytosis).
  • Exemplary disorders include those in which inflammation or inflammatory factors (e.g., matrix metalloproteinases (MMPs), nitric oxide (NO), TNF, interleukins, plasma proteins, cellular defense systems, cytokines, lipid metabolites, proteases, toxic radicals, mitochondria, apoptosis, adhesion molecules, etc.) are involved or are present in an area in aberrant amounts, e.g., in amounts which may be advantageous to alter, e.g., to benefit the subject.
  • MMPs matrix metalloproteinases
  • NO nitric oxide
  • TNF interleukins
  • plasma proteins e.g., plasma proteins
  • cellular defense systems e.g., cytokines, lipid metabolites, proteases, toxic radicals, mitochondria, apoptosis, adhesion molecules, etc.
  • cytokines e.g., cytokines, lipid metabolites, proteases, toxic radicals, mitochondria, apopto
  • Inflammatory disorders include acute inflammatory disorders, chronic inflammatory disorders, and recurrent inflammatory disorders.
  • Acute inflammatory disorders are generally of relatively short duration, and last for from about a few minutes to about one to two days, although they may last several weeks.
  • the main characteristics of acute inflammatory disorders include increased blood flow, exudation of fluid and plasma proteins (edema) and emigration of leukocytes, such as neutiophils.
  • Chronic inflammatory disorders generally, are of longer duration, e.g., weeks to months to years or even longer, and are associated histologically with the presence of lymphocytes and macrophages and with proliferation of blood vessels and connective tissue.
  • Recurrent inflammatory disorders include disorders which recur after a period of time or which have periodic episodes.
  • recurrent inflammatory disorders include asthma and multiple sclerosis. Some disorders may fall within one or more categories. Inflammatory disorders are generally characterized by heat, redness, swelling, pain and loss of function.
  • causes of inflammatory disorders include, but are not limited to, microbial infections (e.g., bacterial, viral and fungal infections), physical agents (e.g., burns, radiation, and trauma), chemical agents (e.g., toxins and caustic substances), tissue necrosis and various types of immunologic reactions.
  • inflammatory disorders include, but are not limited to, osteoarthritis, rheumatoid arthritis, acute and chronic infections (bacterial, viral and fungal); acute and chronic bronchitis, sinusitis, and other respiratory infections, including the common cold; acute and chronic gastroenteritis and colitis; acute and chronic cystitis and urethritis; acute respiratory distress syndrome; cystic fibrosis; acute and chronic dermatitis; acute and chronic conjunctivitis; acute and chronic serositis (pericarditis, peritonitis, synovitis, pleuritis and tendinitis); uremic pericarditis; acute and chronic cholecystis; acute and chronic vaginitis; acute and chronic uveitis; drug reactions; and burns (thermal, chemical, and electrical).
  • the term “medium that separates polypeptides based on hydrophobic interaction” includes a medium comprising hydrophobic ligands (e.g., alkyl or aryl groups) covalently attached to a matrix. Such a medium can be used to separate polypeptides based on interaction between a solvent and accessible non-polar groups on the surface ofthe polypeptides and the hydrophobic ligands ofthe medium.
  • An exemplary medium is Phenyl 5PW-HR available from Tosoh Bioscience.
  • the term “conductivity” includes electrical conductivity of a solution as measured in microSiemens/cm (formerly micromhos/cm).
  • the separation methods ofthe invention can be used with solutions having a pH ranging from acid to neutral, e.g., from about pH 3.5 to approximately neutral.
  • the term "approximately neutral pH” includes pH values of approximately 7.
  • a separation method ofthe invention can be performed using a solution (e.g., a buffer) having a pH of about 3, about 4, about 5, about 6, about 7, or about 8.
  • the pH ofthe solution is about 6 or about 7.
  • the pH ofthe solution is about 4.0, about 4.1, about 4.2, about 4.3, about 4.4, about 4.5, about 4.6, about 4.7, about 4.8, about 4.9, about 5.0, about 5.1, about 5.2, about 5.3, about 5.4, about 5.5, about 5.6, about 5.7, about 5.8, about 5.9, about 6.0, about 6.1, about 6.2, about 6.3, about 6.4, about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, about 7.0, about 7.1, about 7.2, about 7.3, about 7.4, about 7.5, about 7.6, about 7.7, about 7.8, about 7.9, or about 8.0.
  • affinity matrix includes a matrix, such as agarose, controlled pore glass, or poly (styrenedivinyl) benzene to which an affinity ligand is attached.
  • the affinity ligand binds to the desired polypeptide and the contaminating polypeptides are not bound to the affinity ligand.
  • the desired polypeptide can be eluted from the affinity matrix using known protocols.
  • engineered includes manipulation of nucleic acid or polypeptide molecules by synthetic means (e.g. by recombinant techniques, in vitro peptide synthesis, by enzymatic or chemical coupling of peptides or some combination of these techniques).
  • the binding molecules ofthe invention are engineered, e.g., to express a connecting peptide ofthe invention.
  • the terms “linked,” “fused” or “fusion” are used interchangeably. These terms refer to the joining together of two more elements or components, by whatever means including chemical conjugation or recombinant means.
  • An “in-frame fusion” refers to the joining of two or more open reading frames (ORFs) to form a continuous longer ORF, in a manner that maintains the correct reading frame of the original ORFs.
  • the resulting recombinant fusion protein is a single protein containing two ore more segments that correspond to polypeptides encoded by the original ORFs (which segments are not normally so joined in nature.) Although the reading frame is thus made continuous throughout the fused segments, the segments may be physically or spatially separated by, for example, in-frame linker sequence.
  • a "linear sequence" or a “sequence” is an order of amino acids in a polypeptide in an amino to carboxyl terminal direction in which residues that neighbor each other in the sequence are contiguous in the primary structure ofthe polypeptide.
  • the phrase "subject that would benefit from administration of a binding molecule” includes subjects, such as mammalian subjects, that would benefit from administration of a binding molecule used, e.g., for detection of an antigen recognized by a binding molecule (e.g., for a diagnostic procedure) and/or from treatment with a binding molecule to reduce or eliminate the target recognized by the binding molecule.
  • the subject may benefit from reduction or elimination of a soluble or particulate molecule from the circulation or serum (e.g., a toxin or pathogen) or from reduction or elimination of a population of cells expressing the target (e.g., tumor cells).
  • the binding molecule can be used in unconjugated form or can be conjugated, e.g., to a drug, prodrug, or an isotope.
  • At least one polypeptide chain of a dimer ofthe invention can comprise a synthetic connecting peptide ofthe invention.
  • at least two chains of a dimer ofthe invention comprise a connecting peptide.
  • two chains of a dimer of the invention comprise a connecting peptide.
  • connecting peptides can be used to join two heavy chain portions in frame in a single polypeptide chain.
  • a connecting peptide ofthe invention can be used to fuse a CH3 domain (or synthetic CH3 domain) to a hinge region (or synthetic hinge region).
  • a connecting peptide ofthe invention can be used to fuse a CH3 domain (or synthetic CH3 domain) to a CHI domain (or synthetic CHI domain).
  • a connecting peptide can act as a peptide spacer between the hinge region (or synthetic hinge region) and a CH2 domain (or a synthetic CH2 domain).
  • a CH3 domain can be fused to an extracellular protein domain (e.g., a VL domain (or synthetic domain), a VH domain (or synthetic domain), a CHI domain (or synthetic domain), a hinge domain (or synthetic hinge), or to the ligand binding portion of a receptor or the receptor binding portion of a ligand).
  • a VH or VL domain is fused to a CH3 domain via a connecting peptide (the C-terminus ofthe connecting peptide is attached to the N- terminus ofthe CH3 domain and the N-terminus ofthe connecting peptide is attached to the C-terminus ofthe VH or VL domain),
  • a CHI domain is fused to a CH3 domain via a connecting peptide (the C-terminus ofthe connecting peptide is attached to the N-terminus ofthe CH3 domain and the N-terminus ofthe connecting peptide is attached to the C-terminus ofthe CHI domain),
  • a connecting peptide ofthe invention can be used to fuse a CH3 domain (or synthetic CH3 domain) to a hinge region (or synthetic hinge region) or portion thereof.
  • a connecting peptide can act as a peptide spacer between the hinge region (or synthetic hinge region) and a CH2 domain (or a synthetic CH2 domain).
  • a connecting peptide can comprise or consist of a gly/ser spacer.
  • a domain deleted CC49 construct having a short amino acid spacer GGSSGGGGSG (SEQ. ID No. 1) substituted for the CH2 domain and the lower hinge region (CC49. ⁇ CH2 [gly/ser]) can be used, hi another embodiment, a connecting peptide comprises the amino acid sequence IGKTISKKAK (SEQ ID NO:36).
  • connecting peptide can comprise at least a portion of an immunoglobulin hinge region.
  • chimeric hinge domains can be constructed which combine hinge elements derived from different antibody isotypes.
  • a connecting peptide comprises at least a portion of an IgGl hinge region.
  • a connecting peptide can comprise at least a portion of an IgG3 hinge region.
  • a connecting peptide can comprise at least a portion of an IgGl hinge region and at least a portion of an IgG3 hinge region.
  • a connecting peptide can comprise an IgGl upper and middle hinge and a single IgG3 middle hinge repeat motif.
  • connecting peptides comprising an amino acid sequence derived from an immunoglobulin hinge region
  • the numbering of amino acid positions in these molecules is given using Kabat numbering see, e.g., Table 2).
  • Table 1 shows naturally occurring hinge sequence for IgGl, IgG3, and IgG4 molecules.
  • Table 2 shows Kabat numbering for portions of these hinge molecules and also shows Kabat numbering for connecting peptide amino acid residues presented in that table.
  • a connecting peptide ofthe invention comprises a non-naturally occurring immunoglobulin hinge region domain, e.g., a hinge region domain that is not naturally found in the polypeptide comprising the hinge region domain and/or a hinge region domain that has been altered so that it differs in amino acid sequence from a naturally occurring immunoglobulin hinge region domain.
  • mutations can be made to binge region domains to make a connecting peptide ofthe invention.
  • a connecting peptide ofthe invention comprises a hinge domain which does not comprise a naturally occurring number of cysteines, i.e., the connecting peptide comprises either fewer cysteines or a greater number of cysteines than a naturally occurring hinge molecule.
  • a connecting peptide e.g., comprising a non-naturally occurring number of cysteines
  • a connecting peptide comprises hinge region domain comprising a proline residue at an amino acid position corresponding to amino acid position 243 in the Kabat numbering system (position 230, EU numbering system).
  • a connecting peptide comprises an alanine residue at an amino acid position conesponding to position 244, Kabat numbering system (position 246, EU numbering system).
  • a connecting peptide ofthe invention comprises a proline residue at an amino acid position conesponding to position 245 (Kabat numbering system; position 247, EU numbering system)).
  • a connecting peptide comprises a cysteine residue at an amino acid position conesponding to position 239, Kabat numbering system (position 226, EU numbering system), hi one embodiment, a connecting peptide comprises a serine residue at an amino acid position corresponding to position 239, Kabat numbering system (position 226, EU numbering system).
  • a connecting peptide comprises a cysteine residue at an amino acid position conesponding to position 242, Kabat numbering system (position 229, EU numbering system). In one embodiment, a connecting peptide comprises a serine residue at an amino acid position corresponding to position 242, Kabat numbering system (position 229, EU numbering system). In one embodiment, the connecting peptide can be chosen to result in the preferential synthesis of a particular isoform of polypeptide, e.g., in which the two heavy chain portions are linked via disulfide bonds or are not linked via disulfide bonds.
  • the Gl/G3/Pro243 + [gly/ser] linker (SEQ ID NO: 8), Gl/G3/Pro243Ala244Pro245 + [gly/ser] linker (SEQ ID NO: 9), Pro243 + [gly/ser] linker (SEQ ID NO: 15), and Pro243 Ala244Pro245 + [gly/ser] linker (SEQ JD NO: 14), connecting peptides resulted in the production of only Form A CH2 domain- deleted antibody with no detectable Form B.
  • connecting peptide ofthe invention comprises a hinge region domain followed by a flexible gly/ser linker.
  • Exemplary connecting peptides are shown in Table 2 and in SEQ 3D NOs: 8-15, 48, and 49.
  • variant forms of these exemplary connecting peptides can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence encoding a connecting peptide such that one or more amino acid substitutions, additions or deletions are introduced into the connecting peptide.
  • mutations may be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis.
  • conservative amino acid substitutions are made at one or more non-essential amino acid residues such that the ability ofthe connecting peptide to preferentially enhance synthesis of Form A or Form B is not altered.
  • a "conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
  • Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
  • basic side chains e.g., lysine, arginine, histidine
  • acidic side chains e.g., aspartic acid
  • a nonessential amino acid residue in an immunoglobulin polypeptide is preferably replaced with another amino acid residue from the same side chain family
  • a string of amino acids can be replaced with a potentiallycturally similar string that differs in order and/or composition of side chain family members.
  • Connecting peptides ofthe invention can be of varying lengths. In one embodiment, a connecting peptide ofthe invention is from about 15 to about 50 amino acids in length, hi another embodiment, a connecting peptide ofthe invention is firom about 20 to about 45 amino acids in length. In another embodiment, a connecting peptide ofthe invention is from about 25 to about 40 amino acids in length. 3h another embodiment, a connecting peptide ofthe invention is from about 30 to about 35 amino acids in length.
  • a connecting peptide ofthe invention is from about 24 to about 27amino acids in length. In another embodiment, a connecting peptide ofthe invention is from about 40 to about 42 amino acids in length.
  • Connecting peptides can be introduced into polypeptide sequences using techniques known in the art. For example, in one embodiment, the Splicing by Overlap Extension (SOE) method (Horton, R.M. 1993 Methods in Molecular Biology, Vol 15:PCR Protocols: Cunent Methods and applications. Ed. B.A. White) can be used. Modifications can be confirmed by DNA sequence analysis. Plasmid DNA can be used to transform host cells for stable production ofthe polypeptides produced.
  • SOE Splicing by Overlap Extension
  • incorporation of one ofthe subject connecting peptides into a polypeptide yields a composition comprising polypeptide molecules having at least two binding sites and at least two polypeptide chains, wherein at least two ofthe polypeptide chains comprise a synthetic connecting peptide and wherein greater than 50% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage.
  • greater than 60% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage.
  • greater than 70% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage.
  • greater than 80% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage. In another embodiment, greater than 90% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage. In one embodiment, incorporation of one ofthe subject connecting peptides into an IgG4 molecule yields a composition in which greater than 95% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage.
  • the polypeptides ofthe invention comprise at least two binding sites which bind to a target molecule of interest.
  • Exemplary binding sites include, e.g., sites which bind to an antigen (antigen binding sites), sites which bind to a receptor (receptor binding sites), or sites which bind to a ligand (ligand binding sites).
  • the binding molecules comprise at least two binding sites.
  • the binding molecules comprise two binding sites.
  • the binding molecules comprise three binding sites.
  • the binding molecules comprise four binding sites.
  • the binding molecules have at least one target binding site specific for a molecule which mediates a biological effect (e.g., which modulates cellular activation (e.g., by binding to a cell surface receptor and resulting in transmission or inhibition of an activating or inhibitory signal), which results in death of the cell (e.g., by complement fixation or exposure to a payload present on the binding molecule), or which modulates a disease or disorder in a subject (e.g., by promoting lysis of a fibrin clot or promoting clot formation, or by modulating the amount of a substance which is bioavailable (e.g., by enhancing or reducing the amount of a ligand such as TNF ⁇ in the subject)).
  • a biological effect e.g., which modulates cellular activation (e.g., by binding to a cell surface receptor and resulting in transmission or inhibition of an activating or inhibitory signal), which results in death of the cell (e.g., by complement fixation or exposure to a payload
  • the binding molecules have at least one target binding site specific for an molecule targeted for reduction or elimination, e.g., a cell surface antigen or a soluble antigen.
  • binding ofthe binding molecule to the target results in reduction or elimination ofthe target, e.g., from a tissue or from the circulation.
  • the binding molecules have at least one binding site specific for a molecule that can be used to detect the presence of a target molecule (e.g., to detect a contaminant or diagnose a condition or disorder).
  • a binding molecule ofthe invention comprises at least one binding site that targets the binding molecule to a specific site in a subject (e.g., to a tumor cell or blood clot).
  • Exemplary binding sites that can be included in the binding domain of a binding molecule ofthe invention include: the receptor binding portion of a ligand, the ligand binding portion of a receptor, the substrate binding portion of an enzyme, the enzyme binding portion of a substrate, or one or more antigen binding portions of an antibody.
  • at least one target binding site of a binding molecule include: the receptor binding portion of a ligand, the ligand binding portion of a receptor, the substrate binding portion of an enzyme, the enzyme binding portion of a substrate, or one or more antigen binding portions of an antibody.
  • a heavy chain variable portion and a light chain variable portion of a binding molecule are present in the same polypeptide, e.g., as in a single chain antibody or a mimbody (see e.g., US patent 5,837,821 or WO 94/09817A1).
  • the heavy chain portion and the light chain portion of a polypeptide are present in different polypeptide chains, e.g., as in antibody molecules.
  • the target binding polypeptides ofthe invention are multimeric molecules.
  • the target binding polypeptides are dimers. 3h one embodiment, the dimers ofthe invention are homodimers, comprising two identical monomeric subunits. In another embodiment, the dimers ofthe invention are heterodimers, comprising two non-identical monomeric subunits.
  • the dimers comprise at least two polypeptide chains.
  • the binding molecules comprise two polypeptide chains. In another embodiment, the binding molecules comprise three polypeptide chains. In another embodiment, the binding molecules comprise four polypeptide chains.
  • a binding molecule ofthe invention comprises at least one CDR of an antibody, e.g., an antibody known in the art to bind to a target of interest.
  • a binding molecule ofthe invention comprises at least two CDRs. In another embodiment, a binding molecule ofthe invention comprises at least three CDRs. In another embodiment, a binding molecule of the invention comprises at least four CDRs. In another embodiment, a binding molecule ofthe invention comprises at least five CDRs. hi another embodiment, a binding molecule ofthe invention comprises at least six CDRs. In a prefened embodiment, a binding molecule ofthe invention comprises at least one VH domain of an antibody, e.g., an antibody known in the art to bind to a target of interest. In a preferred embodiment, a binding molecule ofthe invention comprises at least one VL domain.
  • a binding molecule of the invention comprises at least one VH domain and one VL domain of an antibody.
  • an antigen binding site consists of a VH domain, e.g., derived from camelids, which is stable in the absence of a VL chain (Hamers- Casterman et al. 1993. Nature 363. -446; Desmyter et al. 1996. Nat. Struct. Biol. 3:803; Desmyter, A., 1996. Nat. Struct. Biol. 3:803; Decanniere, K., et al. 1999. Structure 7:361; Davies et al. 1996. Protein Eng. 9:531; Kortt et al. 1995. J. Protein Chem. 14:167).
  • the invention also pertains to binding molecules which comprise one or more immunoglobulin domains.
  • the fusion proteins ofthe invention comprise a binding domain (which comprises at least one binding site) and a dimerization domain (which comprises at least one heavy chain portion).
  • the subject fusion proteins may be bispecific (with one binding site for a first target and a second binding site for a second target) or may be multivalent (with two binding sites for the same target).
  • Exemplary fusion proteins reported in the literature include fusions ofthe T cell receptor (Gascoigne et al., Proc. Natl. Acad. Sci.
  • CD4 Capon et al., Nature 337:525-531 (1989); Traunecker et al., Nature 339:68-70 (1989); Zettmeissl et al., DNA Cell Biol. USA 9:347-353 (1990); and Bym et al., Nature 344:667-670 (1990)); L-selectin (homing receptor) (Watson et al., J. Cell. Biol.
  • CD44 (Aruffo et al., Cell 61:1303-1313 (1990)); CD28 and B7 (Linsley et al., J. Exp. Med. 173:721-730 (1991)); CTLA-4 (Lisley et al., J. Exp. Med. 174:561-569 (1991)); CD22 (Stamenkovic et al., Cell 66:1133-1144 (1991)); TNF receptor (Ashkenazi et al., Proc. Natl. Acad. Sci.
  • a fusion protein combines the binding domain(s) of the ligand or receptor (e.g. the extracellular domain (ECD) of a receptor) with at least one heavy chain domain and a synthetic connecting peptide.
  • the ligand or receptor e.g. the extracellular domain (ECD) of a receptor
  • nucleic acid encoding the binding domain ofthe ligand or receptor will be fused C-terminally to nucleic acid encoding the N-terminus of an immunoglobulin constant domain sequence. N-terminal fusions are also possible.
  • a fusion protein includes a CH2 and a CH3 domain. Fusions may also be made to the C-terminus ofthe Fc portion of a constant domain, or immediately N-terminal to the CHI ofthe heavy chain or the conesponding region of the light chain.
  • sequence ofthe ligand or receptor domain is fused to the N-terminus ofthe Fc domain of an immunoglobulin molecule.
  • fusion proteins are assembled as multimers, and particularly as heterodimers or heterotetramers.
  • a basic four chain structural unit is the form in which IgG, IgD, and IgE exist.
  • a four chain unit is repeated in the higher molecular weight immunoglobulins; IgM generally exists as a pentamer of four basic units held together by disulfide bonds.
  • IgA globulin, and occasionally IgG globulin may also exist in multimeric form in serum. In the case of multimer, each of the four units may be the same or different.
  • Additonal exemplary ligands and their receptors that may be included in the subject fusion proteins include the following:
  • Cytokines and Cytokine Receptors have pleiotropic effects on the proliferation, differentiation, and functional activation of lymphocytes.
  • Various cytokines, or receptor binding portions thereof, can be utilized in the fusion proteins ofthe invention.
  • Exemplary cytokines include the interleukins (e.g. IL-1, IL-2, 3L-3, IL-4, IL-5, IL-6, 3L-7, IL-8, IL- 10, IL-11, LL-12, IL-13, and IL-18), the colony stimulating factors (CSFs) (e.g.
  • G-CSF granulocyte CSF
  • GM-CSF granulocyte-macrophage CSF
  • M-CSF monocyte macrophage CSF
  • TNF tumor necrosis factor alpha and beta
  • interferons such as interferon- ⁇ , ⁇ , or ⁇ (US Patent Nos. 4,925,793 and 4,929,554).
  • Cytokine receptors typically consist of a ligand-specific alpha chain and a common beta chain.
  • Exemplary cytokine receptors include those for GM-CSF, IL-3 (US Patent No. 5,639,605), IL-4 (US Patent No. 5,599,905), IL-5 (US Patent No.
  • TNF ⁇ e.g. TNFR-1 (EP 417, 563), TNFR-2 (EP 417,014) lymphotoxin beta receptor.
  • Adhesion proteins are membrane-bound proteins that allow cells to interact with one another.
  • Various adhesion proteins including leukocyte homing receptors and cellular adhesion molecules, of receptor binding portions thereof, can be inco ⁇ orated in a fusion protein ofthe invention.
  • Leucocyte homing receptors are expressed on leucocyte cell surfaces during inflammation and include the ⁇ -1 integrins (e.g. VLA-1, 2, 3, 4, 5, and 6) which mediate binding to extracellular matrix components, and the j32-integrins (e.g. LFA-1, LPAM-1, CR3, and CR4) which bind cellular adhesion molecules (CAMs) on vascular endothelium.
  • exemplary CAMs include ICAM-1, ICAM-2, VCAM-1, and MAdCAM-1.
  • Other CAMs include those of the selectin family including E-selectin, L-selectin, and P-selectin.
  • Chemokines Chemokines, chemotactic proteins which stimulate the migration of leucocytes towards a site of infection, can also be inco ⁇ orated into a fusion protein of the invention.
  • exemplary chemokines include Macrophage inflammatory proteins (MIP-l-o- and MIP-l-j8), neutiophil chemotactic factor, and PvANTES (regulated on activation normally T-cell expressed and secreted).
  • Growth Factors and Growth Factor Receptors may be inco ⁇ orated in the fusion proteins ofthe invention.
  • Exemplary growth factors include Vascular Endothelial Growth Factor (VEGF) and its isoforms (U.S. Pat. No. 5,194,596 ; Fibroblastic Growth Factors (FGF), including aFGF and bFGF; atrial natriuretic factor (ANF); hepatic growth factors (HGFs; US Patent Nos.
  • neurotiophic factors such as bone-derived neurotrophic factor (BDNF), neurotro ⁇ hin-3, -4, -5, or -6 (NT-3, NT-4, NT-5, or NT-6), or a nerve growth factor such as NGF- ⁇ platelet-derived growth factor (PDGF) (U.S. Pat. Nos. 4.889,919. 4.845,075.
  • BDNF bone-derived neurotrophic factor
  • PDGF NGF- ⁇ platelet-derived growth factor
  • TGF transforming growth factors
  • BMP bone mo ⁇ hogenetic protein
  • IGF-I and IGF-II insulin-like growth factors-I and -II
  • EPO Erythropoietin
  • SCF stem-cell factor
  • c-Mpl ligand thrombopoietin
  • Wnt polypeptides US Patent No. 6,159,462.
  • Exemplary growth factor receptors which may be used as targeting receptor domains of the invention include EGF receptors; VEGF receptors (e.g.
  • Fltl or Flkl/KDR Fltl or Flkl/KDR
  • PDGF receptors WO 90/14425
  • HGF receptors US Patent Nos. 5,648,273, and 5,686,292
  • neurotrophic receptors including the low affinity receptor (LNGFR), also termed as p75 NTR or p75, which binds NGF, BDNF, and NT-3, and high affinity receptors that are members ofthe trk family ofthe receptor tyrosine kinases (e.g. trkA, trkB (EP 455,460), trkC (EP 522,530)).
  • LNGFR low affinity receptor
  • p75 NTR or p75 which binds NGF, BDNF, and NT-3
  • high affinity receptors that are members ofthe trk family ofthe receptor tyrosine kinases (e.g. trkA, trkB (EP 455,460), trkC (
  • Exemplary growth hormones for use as targeting agents in the fusion proteins ofthe invention include renin, human growth hormone (HGH; US Patent No. 5,834,598), N-methionyl human growth hormone; bovine growth hormone; growth hormone releasing factor; parathyroid hormone (PTH); thyroid stimulating hormone (TSH); thyroxine; proinsulin and insulin (US Patent Nos.
  • HGH human growth hormone
  • PTH parathyroid hormone
  • TSH thyroid stimulating hormone
  • thyroxine proinsulin and insulin
  • FSH follicle stimulating hormone
  • LH luteinizing hormone
  • leptin leptin
  • glucagons bombesin
  • somatropin mullerian-inhibiting substance
  • relaxin and prorelaxin gonadotiopin-associated peptide
  • prolactin placental lactogen
  • OB protein mullerian-inhibiting substance
  • Clotting Factors for use as targeting agents in the fusion proteins ofthe invention include the clotting factors (e.g. , factors V, VII, VIII, X, IX, XI, XII and Xfll, von Willebrand factor); tissue factor (U.S. Pat. Nos. 5,346,991, 5,349,991, 5,726,147, and 6,596,84); thrombin and prothrombin; fibrin and fibrinogen; plasmin and plasminogen; plasminogen activators, such as urokinase or human urine or tissue-type plasminogen activator (t-PA).
  • clotting factors e.g. , factors V, VII, VIII, X, IX, XI, XII and Xfll, von Willebrand factor
  • tissue factor U.S. Pat. Nos. 5,346,991, 5,349,991, 5,726,147, and 6,596,84
  • thrombin and prothrombin fibrin and fibrinogen
  • exemplary fusion proteins are taught, e.g., in WO0069913A1 and WO0040615 A2.
  • Another exemplary molecule that may be included in a fusion protein ofthe invention is IGSF9. Fusion proteins can be prepared using methods that are well known in the art (see for example US Patent Nos. 5,116,964 and 5,225,538). Ordinarily, the ligand or receptor domain is fused C-terminally to the N-terminus ofthe constant region ofthe heavy chain (or heavy chain portion) and in place ofthe variable region. Any tiansmembrane regions or lipid or phospholipids anchor recognition sequences of ligand binding receptor are preferably inactivated or deleted prior to fusion.
  • DNA encoding the ligand or receptor domain is cleaved by a restriction enzyme at or proximal to the 5' and 3 'ends ofthe DNA encoding the desired ORF segment.
  • the resultant DNA fragment is then readily inserted into DNA encoding a heavy chain constant region.
  • the precise site at which the fusion is made may be selected empirically to optimize the secretion or binding characteristics ofthe soluble fusion protein.
  • DNA encoding the fusion protein is then transfected into a host cell for expression.
  • a binding molecule e.g., antigen bmding molecule
  • a binding molecule e.g., antigen bmding molecule
  • antibodies are preferably raised in mammals by multiple subcutaneous or intraperitoneal inj ections ofthe relevant antigen (e.g., purified tumor associated antigens or cells or cellular extracts comprising such antigens) and an adjuvant. This immunization typically elicits an immune response that comprises production of antigen-reactive antibodies from activated splenocytes or lymphocytes.
  • lymphocytes may be obtained from the spleen.
  • lymphocytes are obtained from the spleen.
  • an immortal tumor cell line e.g.
  • hybrid cells or "hybridomas" which are both immortal and capable of producing the genetically coded antibody ofthe B cell.
  • the resulting hybrids are segregated into single genetic strains by selection, dilution, and regrowth with each individual strain comprising specific genes for the formation of a single antibody. They produce antibodies which are homogeneous against a desired antigen and, in reference to their pure genetic parentage, are termed "monoclonal.”
  • Hybridoma cells thus prepared are seeded and grown in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival ofthe unfused, parental myeloma cells.
  • reagents, cell lines and media for the formation, selection and growth of hybridomas are commercially available from a number of sources and standardized protocols are well established.
  • culture medium in which the hybridoma cells are growing is assayed for production of monoclonal antibodies against the desired antigen.
  • the binding specificity ofthe monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or by an in vitro assay, such as a radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA).
  • RIA radioimmunoassay
  • ELISA enzyme-linked immunoabsorbent assay
  • the clones may be subcloned by limiting dilution procedures and grown by standard methods (Goding, Monoclonal Antibodies: Principles and Practice, pp 59-103 (Academic Press, 1986)). It will further be appreciated that the monoclonal antibodies secreted by the subclones may be separated from culture medium, ascites fluid or serum by conventional purification procedures such as, for example, protein- A, hydroxylapatite chromatography, gel electrophoresis, dialysis or affinity chromatography.
  • DNA encoding a desired monoclonal antibodies may be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies).
  • the isolated and subcloned hybridoma cells serve as a prefened source of such DNA.
  • the DNA may be placed into expression vectors, which are then transfected into prokaryotic or eukaryotic host cells such as E. coli cells, simian COS cells, Chinese Hamster Ovary (CHO) cells or myeloma cells that do not otherwise produce immunoglobulins.
  • the isolated DNA (which may be modified as described herein) maybe used to clone constant and variable region sequences for the manufacture antibodies as described in Newman et al, U.S. Pat. No.. 5,658,570, filed January 25, 1995, which is inco ⁇ orated by reference herein. Essentially, this entails extraction of RNA from the selected cells, conversion to cDNA, and amplification by PCR using lg specific primers. Suitable primers for this pu ⁇ ose are also described in U.S. Pat. No. 5,658,570. As will be discussed in more detail below, transformed cells expressing the desired antibody may be grown up in relatively large quantities to provide clinical and commercial supplies ofthe immunoglobulin.
  • DNA encoding antibodies or antibody fragments may also be derived from antibody phage libraries, e.g., using pd phage or Fd phagemid technology. Exemplary methods are set forth, for example, in EP 368 684 Bl; U.S. patent. 5,969,108, Hoogenboom, H.R. and Chames. 2000. Immunol.
  • Ribosomal display can be used to replace bacteriophage as the display platform (see, e.g., Hanes et al. 2000. Nat. Biotechnol. 18:1287; Wilson et al. 2001. Proc. Natl. Acad. Sci. USA 98:3750; orutz et al. 2001 J. Immunol. Methods 248:31.
  • cell surface libraries can be screened for antibodies (Boder et al. 2000. Proc. Natl. Acad. Sci. USA 97:10701; Daugherty et al. 2000 J. Immunol. Methods 243 :211.
  • Such procedures provide alternatives to traditional hybridoma techniques for the isolation and subsequent cloning of monoclonal antibodies.
  • Yet other embodiments ofthe present invention comprise the generation of human or substantially human antibodies in transgenic animals (e.g., mice) that are incapable of endogenous immunoglobulin production (see e.g., U.S. Pat. Nos. 6,075,181, 5,939,598, 5,591,669 and 5,589,369 each of which is inco ⁇ orated herein by reference).
  • transgenic animals e.g., mice
  • transgenic animals e.g., mice
  • 6,075,181, 5,939,598, 5,591,669 and 5,589,369 each of which is inco ⁇ orated herein by reference.
  • lymphocytes can be selected by micromanipulation and the variable genes isolated.
  • peripheral blood mononuclear cells can be isolated from an immunized mammal and cultured for about 7 days in vitro. The cultures can be screened for specific IgGs that meet the screening criteria. Cells from positive wells can be isolated.
  • Individual Ig-producing B cells can be isolated by FACS or by identifying them in a complement-mediated hemolytic plaque assay. Ig-producing B cells can be micromanipulated into a tube and the Vh and VI genes can be amplified using, e.g., RT-PCR.
  • VH and VL genes can be cloned into an antibody expression vector and transfected into cells (e.g., eukaryotic or prokaryotic cells) for expression.
  • genetic sequences useful for producing the polypeptides ofthe present invention may be obtained from a number of different sources. For example, as discussed extensively above, a variety of human antibody genes are available in the form of publicly accessible deposits. Many sequences of antibodies and antibody-encoding genes have been published and suitable antibody genes can be chemically synthesized from these sequences using art recognized techniques. Oligonucleotide synthesis techniques compatible with this aspect ofthe invention are well known to the skilled artisan and may be carried out using any of several commercially available automated synthesizers.
  • DNA sequences encoding several types of heavy and light chains set forth herein can be obtained through the services of commercial DNA synthesis vendors. The genetic material obtained using any ofthe foregoing methods may then be altered or modified to provide obtain polypeptides ofthe present invention.
  • antibody-producing cell lines may be selected and cultured using teclrrniques well known to the skilled artisan. Such techniques are described in a variety of laboratory manuals and primary publications, hi this respect, techniques suitable for use in the invention as described below are described in Current Protocols in Immunology, Coligan et al., Eds., Green Pubhshing Associates and Wiley-Interscience, John Wiley and Sons, New York (1991) which is herein inco ⁇ orated by reference in its entirety, including supplements.
  • RNA may be isolated from the original hybridoma cells or from other transformed cells by standard techniques, such as guanidinium isothiocyanate extraction and precipitation followed by centrifugation or chromatography. Where desirable, mRNA may be isolated from total RNA by standard techniques such as chromatography on oligo dT cellulose. Suitable techniques are familiar in the art. Variable and constant region domains can be obtained from any source and be inco ⁇ orated into a modified antibody ofthe invention.
  • mRNA can be isolated from hybridoma, spleen, or lymph cells, reverse transcribed into DNA, and antibody genes amplified by PCR.
  • PCR may be imtiated by consensus constant region primers or by more specific primers based on the published heavy and light chain DNA and amino acid sequences.
  • PCR also may be used to isolate DNA clones encoding the antibody light and heavy chains.
  • the libraries may be screened by consensus primers or larger homologous probes, such as mouse constant region probes.
  • Numerous primer sets suitable for amplification of antibody genes are known in the art (e.g., 5' primers based on the N-terminal sequence of purified antibodies (Benhar and Pastan. 1994.
  • Constant region domains can be selected having a particular effector function (or lacking a particular effector function) or with a particular modification to reduce immunogenicity.
  • Variable and constant domains can be cloned, e.g., using the polymerase chain reaction and primers which are selected to amplify the domain of interest. PCR amplification methods are described in detail in U.S. Pat. Nos.
  • V domains can be obtained from libraries of V gene sequences from an animal of choice. Libraries expressing random combinations of domains, e.g., VH and VL domains, can be screened with a desired antigen to identify elements which have desired binding characteristics. Methods of such screening are well known in the art.
  • antibody gene repertoires can be cloned into a ⁇ bacteriophage expression vector (Huse, WD et al. 1989. Science 2476:1275).
  • cells (Boder and Wittrup. 1997. Nat. Biotechnol. 15:553; Daugtherty, P. et al. 2000. J. hnmunol. Methods. 243:211; Francisco et al. 1994. Proc. Natl. Acad. Sci. USA 90:10444; Georgiou et al. 1997. Nature Biotechnology 15:29) or viruses (e.g., Hoogenboom, HR. 1998 lmmunotechnology 4:1 Winter et al. 1994. Annu. Rev. Immunol.
  • Ribosomal display can also be used to screen antibody libraries (Hanes J., et al. 1998. Proc. Natl. Acad. Sci. USA 95:14130; Hanes, J. and Pluckthun. 1999. Curr. Top. Microbiol. Immunol. 243:107; He, M. and Taussig. 1997. Nucleic Acids Research 25:5132).
  • Prefened libraries for screening are human V gene libraries. VL and VH domains from a non-human source may also be used.
  • non- human V domains can be altered to reduce their immunogenicity using art recognized techniques.
  • Libraries can be na ⁇ ve, from immunized subjects, or semi-synthetic (Hoogenboom, H.R. and Winter. 1992. J. Mol. Biol. 227:381; Griffiths, AD, et al. EMBO J. 13:3245; de I ruif, J. et al. 1995. J. Mol. Biol. 248:97; Barbas, C.F., et al. 1992. Proc. Natl. Acad. Sci. USA 89:4457).
  • sequences of many antibody V and C domains are known and such domains can be synthesized using methods well known in the art.
  • mutations can be made to immunoglobulin domains to create a library of nucleic acid molecules having greater heterogeneity (Thompson, J., et al. 1996. J. Mol. Biol. 256:77; Lamminmaki, U. et al. 1999. J. Mol. Biol. 291:589; Caldwell, R.C. and Joyce GF. 1992. PCR Methods Appl. 2:28; Caldwell RC and Joyce GF. 1994. PCR Methods Appl. 3:S136. Standard screening procedures can be used to select high affinity variants, hi another embodiment, changes to VH and VL sequences can be made to increase antibody avidity, e.g., using information obtained from crystal structures using techniques known in the art.
  • Modified Antibodies Exemplary constructs include, e.g., minibodies, diabodies, diabodies fused to CH3 molecules, tetiavalent antibodies, intradiabodies (e.g., Jendreyko et al.
  • bispecific antibodies e.g., antibody cytokine fusion proteins, proteins fused to at least a portion of an Fc receptor
  • fusion proteins e.g., antibody cytokine fusion proteins, proteins fused to at least a portion of an Fc receptor
  • Other immunoglobulins (lg) and certain variants thereof are described, for example in U.S. Pat. No. 4,745,055; EP 256,654; Faulkner et al., Nature 298:286 (1982); EP 120,694; EP 125,023; Morrison, J. Immun. 123:793 (1979); Kohler et al., Proc. Natl. Acad. Sci. USA 77:2197 (1980); Raso et al., Cancer Res.
  • a polypeptide ofthe invention comprises an immunoglobulin heavy chain having deletion or substitution of at least one amino acid.
  • the mutation of one or more single amino acid in selected areas ofthe CH2 domain may be enough to substantially reduce Fc binding and thereby increase tumor localization.
  • Such partial deletions ofthe constant regions may improve selected characteristics ofthe antibody (serum half-life) while leaving other desirable functions associated with the subject constant region domain intact.
  • a bmding molecule ofthe invention lacks all or part of a CH2 domain.
  • the constant regions ofthe disclosed antibodies maybe modified through the mutation or substitution of one or more amino acids that enhances the profile ofthe resulting construct, hi this respect it may be possible to disrupt the activity provided by a conserved binding site (e.g. Fc binding) while substantially maintaining the configuration and immunogenic profile ofthe modified antibody.
  • a conserved binding site e.g. Fc binding
  • Yet other prefened embodiments may comprise the addition of one or more amino acids to the constant region to enhance desirable characteristics such as effector function or provide for more cytotoxin or carbohydrate attachment. In such embodiments it may be desirable to insert or replicate specific sequences derived from selected constant region domains.
  • mutations to naturally occurring hinge regions can be made.
  • polypeptides ofthe invention comprise modified constant regions wherein one or more domains are partially or entirely deleted ("domain deleted antibodies").
  • domain deleted antibodies modified antibodies
  • compatible modified antibodies will comprise domain deleted constructs or variants wherein the entire CH2 domain has been removed.
  • a variety of modified antibody constructs are described in more detail below.
  • Minibodies the modified antibodies ofthe invention are minibodies.
  • Minibodies are dimeric molecules made up of two polypeptide chains each comprising an ScFv molecule (a single polypeptide comprising one or more antigen binding sites, e.g., a VL domain linked by a flexible linker to a VH domain fused to a CH3 domain via a connecting peptide.
  • An exemplary minibody construct is shown in Figure 2.
  • a CH3 domain is fused at its N-terminus to a connecting peptide which is fused at its N-terminus to a VH domain which is fused via its N-terminus to a flexible linker which is fused at its N-terminus to a VL domain.
  • ScFv molecules can be constructed in a VH-linker-VL orientation or VL- linker-VH orientation.
  • the flexible hinge that links the VL and VH domains that make up the antigen binding site preferably comprises from about 10 to about 50 amino acid residues.
  • An exemplary connecting peptide for this pvurpose is (Gly4Ser)3 (SEQ 3D NO:35) (Huston et al. . 1988. Proc. Natl. Acad. Sci. USA 85:5879).
  • Other connecting peptides are known in the art. Methods of making single chain antibodies are well known in the art, e.g., Ho et al. 1989. Gene 77:51; Bird et al.
  • Minibodies can be made by constructing an ScFv component and connecting peptide-CH3 component using methods described in the art (see, e.g., US patent 5,837,821 or WO 94/09817A1). These components can be isolated from separate plasmids as restriction fragments and then ligated and recloned into an appropriate vector. Appropriate assembly can be verified by restriction digestion and DNA sequence analysis.
  • a minibody ofthe invention comprises a connecting peptide.
  • the connecting peptide comprises a gly/ser linker, e.g., GGGSSGGGSGG (SEQ ID NO: 1).
  • a tetravalent minibody can be constructed. Tetiavalent minibodies can be constructed in the same manner as minibodies, except that two ScFv molecules are linked using a flexible linker, e.g., having an amino acid sequence (G4S) G3AS (SEQ 3D NO: 36). An exemplary tetravalent minibody is illustrated in Figure 2.
  • the modified antibodies ofthe invention are CH2 domain deleted antibodies.
  • Domain deleted constructs can be derived from a vector (e.g., from -DEC Pharmaceuticals, San Diego) encoding an IgGi human constant domain (see, e.g., WO 02/060955A2 and WO02/096948A2). Essentially, the vector was engineered to delete the CH2 domain and provide a modified vector expressing a domain deleted IgGi constant region. Genes encoding the murine variable region ofthe C2B8 antibody, 5E8 antibody, B3F6 antibody, or the variable region ofthe humanized CC49 antibody were then inserted in the modified vector and cloned.
  • these vectors When expressed in transformed cells, these vectors provided C2B8. ⁇ CH2, 5E8. ⁇ CH2, B3F6. ⁇ CH2 or huCC49. ⁇ CH2 or respectively. These constructs exhibit a number of properties that make them particularly attractive candidates for monomeric subunits. Besides the deletion of whole constant region domains, it will be appreciated that the antibodies ofthe present invention can be engineered to partially delete or substitute of a few amino acids or even a single amino acid. For example, the mutation of a single amino acid in selected areas ofthe C H 2 domain may be enough to substantially reduce Fc binding and thereby increase tumor localization. Similarly, it may be deshable to simply delete that part of one or more constant region domains that control the effector function (e.g. complement C1Q binding).
  • the effector function e.g. complement C1Q binding
  • Such partial deletions ofthe constant regions may improve selected characteristics of the antibody (serum half-life) while leaving other desirable functions associated with the subject constant region domain intact.
  • Creation of a C H 2 domain deleted version can be accomplished by way of overlapping PCR mutagenesis.
  • the gamma 1 constant domain begins with a plasmid encoded Nhe I site with is in translational reading frame with the immunoglobulin sequence.
  • a 5' PCR primer was constructed encoding the Nhe I site as well as sequence immediately downstream.
  • a 3 ' PCR primer mate was constructed such that it anneals with the 3 ' end to the immunoglobulin hinge region and encodes in frame the first several amino acids ofthe gamma 1 CH3 domain.
  • a second PCR primer pair consisted ofthe reverse complement ofthe 3' PCR primer from the first pair (above) as the 5' primer and a 3' primer that anneals at a loci spanning the BsrG I restriction site within the C H 3 domain.
  • the resultant products were utilized as template with the Nhe I and BsrG 15' and 3', respectively primers.
  • the amplified product was then cloned back into N5KG1 to create the plasmid N5KG1 ⁇ C H 2. This construction places the intact CH3 domain immediately downstream and in frame with the intact hinge region.
  • a similar procedure can be used to create a domain deleted constiruct in which the CH3 domain is immediately downstream of a connecting peptide.
  • tetravalent domain-deleted antibodies can be produced by combining a DNA sequence encoding a domain deleted antibody with a ScFv molecule.
  • these sequences are combined such that the ScFv molecule is linked at its N-terminus to the CH3 domain ofthe domain deleted antibody via a flexible linker (e.g., a gly/ser linker such as (Gly4Ser) 3 (SEQ 3D NO: 35).
  • a tetravalent antibody in another embodiment can be made by fusing an ScFv molecule to a connecting peptide, which is fused to a CHI domain to construct an ScFv - Fab tetravalent molecule.
  • a binding molecule ofthe invention is a diabody fused to at least one heavy chain portion. In a prefened embodiment, a binding molecule ofthe invention is a diabody fused to a CH3 domain.
  • a modified antibody ofthe invention a binding molecule comprisies a tetravalent or bispecific tetravalent CH2 domain-deleted antibody with a scFv appended to the N-terminus ofthe light chain.
  • a binding molecule comprises a a tetiavalent or bispecific tetravalent CH2 domain-deleted antibody with a scFv appended to the N-terminus ofthe heavy chain.
  • the attachment ofthe scFv to the N-terminus results in reduced aggregation ofthe molecules as compared to molecules in which the scFv is attached at the carboxy-terminus.
  • less than about 30% aggregates are present in a composition of binding molecules produced by cells expressing a N-terminal fusion constiruct. i one embodiment, less than about 20% aggregates are present in a composition of binding molecules produced by cells expressing a N-terminal fusion construct. In one embodiment, less than about 10% aggregates are present in a composition of binding molecules produced by cells expressing a N-terminal fusion constiruct. In one embodiment, less than about 5% aggregates are present in a composition of binding molecules produced by cells expressing a N-terminal fusion construct.
  • modified antibodies are also within the scope ofthe instant invention (e.g., WO 02/02781 Al; 5,959,083; 6,476,198 Bl; US 2002/0103345 Al; WO 00/06605; Bym et al. 1990. Nature. 344:667-70; Chamow and Ashkenazi. 1996. Trends Biotechnol. 14:52).
  • Catalytic antibodies In one embodiment, at least one binding specificity of a modified antibody molecule ofthe invention is catalytic.
  • Catalytic binding specificities can be made using art recognized techniques (see, e.g., U.S. Pat. No. 6,590,080, U.S. Pat. No. 5,658,753). Catalytic binding specificities can work by a number of basic mechanisms similar to those identified for enzymes to stabilize the transition state, thereby reducing the free energy of activation.
  • acid and base residues can be optimally positioned for participation in catalysis within catalytic active sites; covalent enzyme-substiate intermediates can be formed; catalytic antibodies can also be in proper orientation for reaction and increase the effective concentration of reactants by at least seven orders of magnitude (Fersht, A. R., et al., Am. Chem. Soc. 90 (1968):5833) and thereby greatly reduce the entropy of a chemical reaction. Finally, catalytic antibodies can convert the energy obtained upon substrate binding to distort the reaction towards a structure resembling the transition state.
  • acid or base residues can be brought into the binding site by using a complementary charged molecule as an immunogen.
  • antibodies can be elicited to stable compounds that resemble the size, shape, and charge ofthe tiansition state of a desired reaction (i.e., transition state analogs). See U.S. Pat. No. 4,792,446 and U.S. Pat. No. 4,963,355 which describe the use of tiansition state analogues to iinmunize animals and the production of catalytic antibodies. Both of these patents are hereby inco ⁇ orated by reference.
  • such molecules can be admimstered as part of an immunoconjugate, e.g., with an immunogenic carrier molecule, such as KLH.
  • an immunogenic carrier molecule such as KLH.
  • Exemplary catalytic binding specificities can have, e.g., esterase activity
  • catalytic B cells can be selected, e.g., as described in US patent 6,590,080 using a molecule can be constructed which facilitates selection of catalytic B cells.
  • catalytic binding specificities can be developed as part of a two step process.
  • Catalytic antibodies can be selected only if displaying the following binding features: binding both the substrate and a reactive group in such a way that the two groups are in a reactive position towards each other. Second, the selected antibodies can be chemically engineered by covalently binding a reactive group into the binding pocket ofthe antibody. J Immunol Methods. 2002. 269:81-98. hi one embodiment, a catalytic binding specificity is specific for a prodrug. Such a binding specificity can be used to catalyze the conversion of a prodrug into a drug which is effective in vivo. Preferably, the reaction catalyzed is one that cannot be accomplished by natural enzymes in vivo.
  • a modified antibody molecule ofthe invention comprises at least one binding specificity for a target cell and at least one binding specificity for a prodrug.
  • an modified antibody molecule ofthe invention comprises at least one binding specificity for a tumor cell and at least one binding specificity for a prodrug which can be converted to cytotoxic drug.
  • a modified antibody ofthe invention comprises a binding specificity for a carbamate prodrug 4-[N,N,-bis(2-chloroethyl)]aminophenyl-N- [(lS-(l,3-dicarboxy)propyl]carbamate and generates the conesponding cytotoxic nitrogen mustard (Wentworth et al. 1996. Proc Natl. Acad. Sci. USA. 93:799).
  • the modified antibody is admimstered prior to admimstration ofthe prodrug to allow accumulation at the site ofthe target cell.
  • Exemplary prodrugs are known in the art.
  • Prodrugs can also be synthesized by inco ⁇ orating a portion designed to be released by catalytic action, e.g., by sequential retro-aldol/retro-Michael reactions catalyzed by an antibody with aldolase activity.
  • Such drug masking portions can be made, e.g., by modification of hydroxyl or thiol groups of drugs.
  • a binding molecule ofthe invention is multispecific, i.e., has at least one binding site that binds to a first molecule or epitope of a molecule and at least one second binding site that binds to a second molecule of epitope of a molecule.
  • a binding molecule ofthe invention is bispecific.
  • Bispecific molecules can bind to two different target sites, e.g., on the same target molecule or on different target molecules.
  • bispecific molecules can bind to two different epitopes, e.g., on the same antigen or on two different antigens.
  • Bispecific molecules can be used, e.g., in diagnostic and therapeutic applications. For example, they can be used to immobilize enzymes for use in immunoassays. They can also be used in diagnosis and treatment of cancer, e.g., by binding both to a tumor associated molecule and a detectable marker (e.g., a chelator which tightly binds a radionuclide.
  • a detectable marker e.g., a chelator which tightly binds a radionuclide.
  • Bispecific molecules can also be used for human therapy, e.g., by directing cytotoxicity to a specific target (for example by binding to a pathogen or tumor cell and to a cytotoxic trigger molecule, such as the T cell receptor or the Fc ⁇ receptor.
  • a cytotoxic trigger molecule such as the T cell receptor or the Fc ⁇ receptor.
  • Bispecific antibodies can also be used, e.g., as fibrinolytic agents or vaccine adjuvants.
  • bispecific binding molecules include those with at least two arms directed against tumor cell antigens; bispecific binding molecules with at least one arm directed against a tumor cell antigen and the at least one arm directed against a cytotoxic trigger molecule (such as anti-Fc.gamma.RI/anti-CD 15, anti- pl85.sup.HER2/Fc.gamma.R ⁇ i (CD16), anti-CD3/anti-malignant B-cell (1D10), anti- CD3/anti-pl85.sup.HER2, anti-CD3/anti-p97, anti-CD3/anti-renal cell carcinoma, anti- CD3/anti-OVCAR-3, anti-CD3/L-Dl (anti-colon carcinoma), anti-CD3/anti-melanocyte stimulating hormone analog, anti-EGF receptor/anti-CD3, anti-CD3/anti-CAMAl, anti- CD3/anti-CD19, anti-CD3/MoV18, anti-neural cell adhesion molecule (NCAMVanti- CD3, anti-folate binding protein (FBP)/anti-
  • bispecific binding molecules for use in therapy of infectious diseases such as anti-CD3/anti-he ⁇ es simplex vims (HSV), anti-T-cell receptor:CD3 complex/anti-influenza, anti-Fc.gamma.R/anti-HIV; bispecific binding molecules for tumor detection in vitro or in vivo such as anti-CEA/anti- EOTUBE, anti-CEA/anti-DPTA, anti-pl 85HER2/anti- -hapten); bispecific binding molecules as vaccine adjuvants (see Fanger et al., supra); and bispecific binding molecules as diagnostic tools (such as anti-rabbit IgG/anti-ferritin, anti-horse radish peroxidase (HRP)/anti-hormone, anti-somatostatin/anti-substance P, anti-HRP/anti- FITC, anti-CEA/anti-.
  • infectious diseases such as anti-CD3/anti-he ⁇ es simplex vims (HSV), anti-T-cell receptor:
  • bispecific molecules ofthe invention binds to CPJPTO-I.
  • Bispecific molecules may be monovalent for each specificity or be multivalent for each specificity.
  • an antibody molecule or fusion protein may comprise one binding site that reacts with a first target molecule and one binding site that reacts with a second target molecule or it may comprise two binding sites that react with a first target molecule and two binding sites that react with a second target molecule. Methods of producing bispecific molecules are well known in the art.
  • bispecific molecules e.g., diabodies, single-chain diabodies, tandem scFvs, etc.
  • Exemplary techniques for producing bispecific molecules are known in the art (e.g., Kontermann et al. Methods in Molecular Biology Vol. 248: Antibody Engineering: Methods and Protocols. Pp 227- 242 US 2003/0207346 Al and the references cited therein; ).
  • a multimeric bispecific molecules are prepared using methods such as those described e.g., in US 2003/0207346 Al or US patent 5,821,333, or US2004/0058400.
  • multispecific fusion protein designates fusion proteins (as hereinabove defined) having at least two binding specificities (i.e. combining two or more binding domains of a ligand or receptor).
  • Multispecific fusion proteins can be assembled as heterodimers, heterotrimers or heterotetiamers, essentially as disclosed in WO 89/02922 (published Apr. 6, 1989), in EP 314, 317 (published May 3, 1989), and in U.S. Pat. No. 5,116,964 issued May 2, 1992.
  • Prefened multispecific fusion proteins are bispecific. Examples of bispecific fusion proteins include CD4- IgG/TNFreceptor-IgG and CD4-IgG/L-selectin-IgG.
  • exemplary binding sites include one or more epitopes of a tumor antigen.
  • Other exemplary target molecules include one or more epitopes of, e.g., heparin sulfate, growth factors or their receptors (e.g., epidermal growth factor receptor, insulin-like growth factor receptor, hepatocyte growth factor (HGF/SF) receptor, MORE
  • the invention pertains to bispecific molecules, e.g., antibodies, which inco ⁇ orate at least one binding site that binds to a known target and at least one binding site which recognizes an unknown target (for example, in one embodiment, the bispecific molecule inco ⁇ orates binding sites selected from a semi- synthetic antibody phage display library).
  • bispecific molecules e.g., antibodies, which inco ⁇ orate at least one binding site that binds to a known target and at least one binding site which recognizes an unknown target (for example, in one embodiment, the bispecific molecule inco ⁇ orates binding sites selected from a semi- synthetic antibody phage display library).
  • one of ordinary skill in the art could start with a single chain antibody of known specificity and build a Fab library using techniques known in the art or, alternatively, the skilled artisan could start with an Fab fragment of known specificity and build a single chain library using techniques known in the art.
  • libraries from nonimmunized sources and prepared by synthetic recombination of V-gene sequences preferably recombination of VH with, DH and JH, and VL with JL sequences
  • VH with, DH and JH, and VL with JL sequences can be used to isolate antibodies to any antigen.
  • patent application WO92/01047 teaches that antibody fragments can be displayed on the surface of bacteriophage and that they will bind antigen.
  • Antibody fragments can be directly selected using this characteristic.
  • Other methods known in the art include those taught, e.g., in U.S. patent 5,698,426; 6,291,159; 5,658,727; 5,667,988; and 5,969,108.
  • scFv which recognize a known target can be dimerized with scFv isolated from a semi-synthetic human phage antibody display library, (see, e.g., Kruif and Logtenberg 1996. J. Biol. Chem. 271:7630).
  • the subject bispecific molecule is expressed in any expression system used to express antibody molecules, for example mammalian cells, yeast such as Picchia, E. coli, Bacculovirus, etc.
  • the subject bispecific molecule is expressed in the NEOSPLA vector system (see, e.g., U.S. patent 6,159,730). This vector contains the cytomegalovirus promoter/enhancer, the mouse beta globin major promoter, the SV40 origin of replication, the bovine growth hormone polyadenylation sequence, neomycin phosphotiansferase exon 1 and exon 2, the dihydrofolate reductase gene and leader sequence.
  • the subject bispecific molecules comprise a synthetic connecting peptide.
  • bispecific molecules have one or more binding sites for a known target and express a library at one or more binding sites.
  • Such bispecific molecules can be used, e.g., to identify molecules in close proximity to or associated with the known target.
  • the skilled artisan could use the subject bispecific molecules in an assay to select for those that induce a particular response, e.g., apoptosis or cellular activation, using screening methods well known in the art.
  • the bispecific molecule identified as producing the response screened for can then be identified and its specificity determined. Using such methods it is possible to identify molecules in close association with particular targets of interest, e.g., T cell markers or other signaling molecules (such as CRIPTO-I, death domain molecules, or molecules involved in apoptosis).
  • the proximity ofthe known target and the molecule newly identified as a "nearest neighbor” can be confirmed using immunoprecipitation or other techniques known to those of skill in the art. Using these methods it is possible to identify molecules as targets for modulating a particular cellular response.
  • a polypeptide molecule ofthe invention comprises an amino acid sequence encoded by a nucleic acid molecule comprising a nucleic acid sequence shown in Figure 8A (SEQ ID NO:16), Figure 8B (SEQ 3D NO:17), Figure 8C (SEQ ID NO: 18), Figure 10A (SEQ 3D NO:22), Figure 10B (SEQ 3D NO:23).
  • a nucleic acid molecule ofthe invention comprises a nucleotide sequence shown in Figure 8A (SEQ 3D NO: 16), Figure 8B (SEQ ID NO: 17), Figure 8C (SEQ ID NO: 18), Figure 10A (SEQ 3D NO:22), Figure 10B (SEQ 3D NO:23).
  • a polypeptide ofthe invention comprises an amino acid sequence shown in Figure 9A (SEQ 3D NO: 19), Figure 9B (SEQ 3D NO:20), Figure 9C (SEQ ID NO:21), Figure 11 A (SEQ 3D NO:24), or Figure 1 IB (SEQ 3D NO:25).
  • a polypeptide ofthe invention is encoded by a nucleic acid molecule comprising the nucleotide sequence shown in Figure 12A (SEQ 3D NO:26), Figure 12B (SEQ 3D NO:27), Figure 14 (SEQ 3D NO:30), or Figure 15 (SEQ ID NO:31).
  • a nucleic acid molecule of the invention comprises a nucleotide sequence shown in Figure 12A (SEQ 3D NO:26), Figure 12B (SEQ ID NO:27), Figure 14 (SEQ ID NO:30), or Figure 15 (SEQ ID NO:31).
  • a polypeptide molecule ofthe invention comprises an amino acid sequence shown in Figure 13A (SEQ 3D NO:28), Figure 13B (SEQ ID NO:29), Figure 16 (SEQ 3D NO:32), or Figure 17 (SEQ 3D NO:33).
  • the other nucleic acid and amino acid sequences disclosed herein in the sequence listing and Figures are also embraced by the invention.
  • vectors are typically inserted in an expression vector for introduction into host cells that may be used to produce the desired quantity of modified antibody that, in turn, provides the claimed polypeptides.
  • vector or "expression vector” is used herein for the pturposes of the specification and claims, to mean vectors used in accordance with the present invention as a vehicle for introducing into and expressing a desired gene in a cell.
  • vectors may easily be selected from the group consisting of plasmids, phages, viruses and retroviruses.
  • vectors compatible with the instant invention will comprise a selection marker, appropriate restriction sites to facihtate cloning ofthe desired gene and the ability to enter and/or replicate in eukaryotic or prokaryotic cells.
  • numerous expression vector systems may be employed.
  • one class of vector utilizes DNA elements which are derived from animal viruses such as bovine papilloma virus, polyoma virus, adenovirus, vaccinia virus, baculovirus, retroviruses (RSV, MMTV or MOMLV) or SV40 vims.
  • Others involve the use of polycistronic systems with internal ribosome binding sites.
  • Exemplary vectors include those taught in U.S. patent no.
  • cells which have integrated the DNA into their chromosomes may be selected by introducing one or more markers which allow selection of transfected host cells.
  • the marker may provide for prototrophy to an auxotiophic host, biocide resistance (e.g., antibiotics) or resistance to heavy metals such as copper.
  • the selectable marker gene can either be directly linked to the DNA sequences to be expressed, or introduced into the same cell by cotransformation.
  • an inducible expression system can be employed. Additional elements may also be needed for optimal synthesis of nrRNA. These elements may include signal sequences, splice signals, as well as transcriptional promoters, enhancers, and termination signals.
  • a secretion signal e.g., any one of several well characterized bacterial leader peptides (e.g., pelB, phoA, or ompA), can be fused in- frame to the N terminus of a polypeptide ofthe invention to obtain optimal secretion of the polypeptide.
  • a secretion signal e.g., any one of several well characterized bacterial leader peptides (e.g., pelB, phoA, or ompA)
  • pelB e.g., pelB, phoA, or ompA
  • a vector can be used which comprises a nucleic acid sequence encoding a peptide linker
  • the cloned variable region genes are inserted into an expression vector along with the heavy and light chain constant region genes (preferably human) modified as discussed above.
  • this is effected using a proprietary expression vector of -DEC, hie, refened to as NEOSPLA see U.S.
  • patent 6,159,730 This vector contains the cytomegalovirus promoter/enhancer, the mouse beta globin major promoter, the SV40 origin of replication, the bovine growth hormone polyadenylation sequence, neomycin phosphotiansferase exon 1 and exon 2, the dihydrofolate reductase gene and leader sequence. As seen in the examples below, this vector has been found to result in very high level expression of antibodies upon inco ⁇ oration of variable and constant region genes, transfection in CHO cells, followed by selection in G418 containing medium and methotrexate amplification. Vector systems are also taught in U.S. Pat. Nos.
  • IRES internal ribosome entry site
  • a monomeric subunit ofthe polypeptide e.g. a modified antibody
  • the expression vector may be introduced into an appropriate host cell. That is, the host cells may be transformed. Introduction ofthe plasmid into the host cell can be accomplished by various techniques well known to those of skill in the art.
  • transfection including electrophoresis and electroporation
  • protoplast fusion including electrophoresis and electroporation
  • calcium phosphate precipitation cell fusion with enveloped DNA, microinjection, and infection with intact vims.
  • Exemplary assay techniques include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), or flourescence-activated cell sorter analysis (FACS), immunohistochemistry and the like.
  • ELISA enzyme-linked immunosorbent assay
  • RIA radioimmunoassay
  • FACS flourescence-activated cell sorter analysis
  • immunohistochemistry immunohistochemistry and the like.
  • transformation shall be used in a broad sense to refer to any introduction of DNA into a recipient host cell that changes the genotype and consequently results in a change in the recipient cell.
  • host cells refers to cells that have been transformed with vectors constructed using recombinant DNA techniques and encoding at least one heterologous gene
  • the terms “cell” and “cell culture” are used interchangeably to denote the source of antibody unless it is clearly specified otherwise, hi other words, recovery of polypeptide from the “cells” may mean either from spun down whole cells, or from the cell culture containing both the medium and the suspended cells.
  • the host cell line used for protein expression is most preferably of mammalian origin; those skilled in the art are credited with ability to preferentially determine particular host cell lines which are best suited for the desired gene product to be expressed therein.
  • Exemplary host cell lines include, but are not limited to, DG44 and DUXBl 1 (Chinese Hamster Ovary lines, DHFR minus), HELA (human cervical carcinoma), CVI (monkey kidney line), COS (a derivative of CVI with SV40 T antigen), R1610 (Chinese hamster fibroblast) BALBC/3T3 (mouse fibroblast), HAK (hamster kidney line), SP2/O (mouse myeloma), P3.times.63-Ag3.653 (mouse myeloma), BFA- lclBPT (bovine endothelial cells), RAJI (human lymphocyte) and 293 (human kidney). CHO cells are particularly prefened.
  • a host cell is a prokaryotic cell, e.g., a strain which allows the formation of disulfide bonds (Derrnan, AI, et al. 1993. Science. 262:1744; Bessette, PH. Et al. 1999. Proc. Natl. Acad. Sci. USA 96:13703).
  • a prokaryotic cell e.g., a strain which allows the formation of disulfide bonds
  • In vitro production allows scale-up to give large amounts ofthe desired polypeptides.
  • Techniques for mammalian cell cultivation under tissue culture conditions are known in the art and include homogeneous suspension culture, e.g.
  • the solutions of polypeptides can be purified by the customary chromatography methods, for example gel filtration, ion-exchange chromatography, chromatography over DEAE-cellulose or (immuno-)affinity chromatography, e.g., after preferential biosynthesis of a modified hinge region polypeptide or prior to or subsequent to the HIC chromatography step described herein.
  • Genes encoding the polypeptide ofthe invention can also be expressed non-mammalian cells such as bacteria or yeast or plant cells.
  • Bacteria which are susceptible to transformation, include members ofthe enterobacteriaceae, such as strains of Escherichia coli or Salmonella; Bacillaceae, such as Bacillus subtilis; Pneumococcus; Streptococcus, and Haemophilus influenzae.
  • enterobacteriaceae such as strains of Escherichia coli or Salmonella
  • Bacillaceae such as Bacillus subtilis
  • Pneumococcus Pneumococcus
  • Streptococcus Streptococcus
  • Haemophilus influenzae Haemophilus influenzae
  • eukaryotic microbes may also be used. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used among eukaryotic microorganisms although a number of other strains are commonly available.
  • Saccharomyces cerevisiae or common baker's yeast
  • the plasmid YRp7 for example, (Stinchcomb et al., Nature, 282:39 (1979); Kingsman et al., Gene, 7:141 (1979); Tschemper et al., Gene, 10:157 (1980)) is commonly used.
  • This plasmid already contains the TRP1 gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No.44076 or PEP4-1 (Jones, Genetics, 85:12 (1977)).
  • the presence ofthe tipl lesion as a characteristic ofthe yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.
  • the invention pertains to separation of molecules having two heavy chain portions from a mixture, where a fraction ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage and a fraction ofthe molecules comprise heavy chain portions that are not linked via at least one disulfide linkage by hydrophobic interaction chromatography. Hydrophobic interaction chromatography was first developed following the observation that proteins could be retained on affinity gels which comprised hydrocarbon spacer arms but lacked the affinity ligand.
  • Elution from HIC supports can be effected by alterations in solvent, pH, ionic strength, or by the addition of chaotropic agents or organic modifiers, such as ethylene or propylene glycol.
  • a description ofthe general principles of hydrophobic interaction chromatography can be found e.g., in U. S. Patent 3,917,527 and in U. S. Patent 4,000,098.
  • HIC in the context of high performance liquid chromatography (HPLC) has been used to separate antibody fragments lacking heavy chain portions (e.g., F(ab') 2 ) from intact antibody molecules in a single step protocol. (Morimoto, K. et al., L Biochem. Biophvs. Meth. 24: 107 (1992)).
  • the separation method ofthe invention can be performed on an unpurified population of polypeptides (e.g., culture supematants or preparations or preparations of polypeptides isolated from prokaryotic inclusion bodies).
  • the instant separation methods can be used on polypeptide mixtures obtained after one or more initial purification steps, e.g., after a preparation comprising forms A and B has been eluted from an affinity matrix.
  • the binding molecules subjected to HIC chromatography comprise a connecting peptide ofthe invention.
  • HIC can be applied to mixtures that have been partially purified by other protein purification procedures.
  • partially purified includes a protein preparation in which the protein of interest is present in at least 5 % by weight, more preferably at least 10% and most preferably at least 45%.
  • Initial or subsequent purification steps can be used to remove, e.g., immunoglobulin aggregates, misfolded species, host cell protein, residue material from preceding chromatographic steps (such as Protein A when employed).
  • HIC can be performed on polypeptides comprising a connecting peptide of the invention. Accordingly, the application of HIC can also be appreciated in the context of an overall purification protocol.
  • Exemplary purification steps that can be used prior to or subsequent to HIC include: affinity chromatography (for example, PROSEP-A® (BioProcessing Ltd., U.K.) which consists of Protein A covalently coupled to controlled pore glass or Protein A SEPHAROSE® Fast Flow (Pharmacia) or TOYOPEARL 650M Protein A (TosoHaas)). Protein A is prefened for human ⁇ l, ⁇ 2, or ⁇ 4 heavy chains and protein G for mouse isotypes. Bakerbond ABXtm resin can be used if the molecule comprises a CH3 domain.
  • ion exchange chromatography may be employed. In this regard various anionic or cationic substituents.
  • Anionic exchange substituents include diethylaminoethyl(DEAE), quaternary aminoethyl(QAE) and quaternary amine(Q) groups.
  • Cationic exchange substituents include carboxymethyl (CM), sulfoethyl(SE), sulfopropyl(SP), phosphate(P) and sulfonate(S).
  • Cellulose ion exchange resins such as DE23, DE32, DE52, CM-23, CM-32 and CM-52 are available from Whatman Ltd. Maidstone, Kent, U.K.
  • SEPHADEX®-based and -locross-linked ion exchangers are also known.
  • DEAE-, QAE-, CM-, and SP- SEPHADEX® and DEAE-, Q-, CM-and S- SEPHAROSE® and SEPHAROSE® Fast Flow are all available from Pharmacia AB.
  • DEAE and CM derivitized ethylene glycol-methacrylate copolymer such as TOYOPEARL DEAE-650S or M and TOYOPEARL CM-650S or M are available firom Toso Haas Co., Philadelphia, Pa.
  • HIC ionic exchange chromatographic step or other salt mediated purification step
  • Additional purification protocols may be added including but not necessarily limited to: further ionic exchange chromatography, size exclusion chromatography, viral inactivation, concentration and freeze drying, hydroxylapatite chromatography, gel electrophoresis, dialysis, ethanol precipitation, reverse phase HPLC, chromatography on silica, chromatography on heparin SEQHAROSETM, chromatofocusing, or ammom ' um sulfate precipitation.
  • the composition comprising the mixture of polypeptides to be separated will preferably be placed in a buffer of acidic or approximately neutial pH. This can be done, for example, by adding concentrated buffer, resuspending the sample in the buffer, exchanging the buffer (e.g., using dialysis or ultrafiltiation). Alternatively, the pH ofthe sample buffer can simply be adjusted to be within the desired range. Hydrophobic interactions are strongest at high ionic strength, therefore, this form of separation is conveniently performed following salt precipitations or ion exchange procedures. Adso ⁇ tion ofthe proteins to a HIC column is favored by high salt concentrations, but the actual concentrations can vary over a wide range depending on the nature ofthe protein and the particular HIC ligand chosen. Various ions can be ananged in a so-called soluphobic series depending on whether they promote hydrophobic interactions (salting-out effects) or disrupt the structure of water
  • Salts may be formulated that influence the strength ofthe interaction as given by the following relationship: (NH ) 2 SO 4 >; Na SO >; NaCl >;NH C1 >; NaBr >; NaSCN.
  • salt concentrations of between about 0.75 and about 2M ammonium sulfate or between about 1 and 4M NaCl are useful.
  • a number of chromatographic supports may be employed in the preparation of HIC columns, the most extensively used are agarose, silica and organic polymer or co-polymer resins.
  • the hydrophobic interaction material is generally a base matrix (e.g., a hydrophilic carbohydrate (such as cross-linked agarose) or synthetic copolymer material) to which hydrophobic ligands (e.g., alkyl or aryl groups) are . coupled.
  • the prefened HIC material comprises an agarose resin substituted with phenyl groups.
  • Exemplary HIC material includes: phenyl SEPHAROSETM, FAST FLOW with low or high substitution (Pharmacia LKB Biotechnology, AB, Sweden); phenyl SEPHAROSETM High Performance column; phenyl or butyl-SEPHAROSE® CL-4B, butyl- SEPHAROSE® FF, octyl-SEPHAROSE® FF and phenyl-SEPHAROSE® FF (Pharmacia LKB Biotechnology AB, Sweden); FractogelTM EMD Propyl or
  • HIC materials are also available from Tosoh Co ⁇ oration, Tokyo, Japan under the product names TOYOPEARL ether 650, phenyl 650, butyl 650 (Fractogel), ether-5PW-HR, or phenyl-5PW-HR; Miles-Yeda, Rehovot, Israel under the product name alkyl-agarose, wherein the alkyl group contains from 2-10 carbon atoms, and J.T. Baker, Phillipsburg, NJ. under the product name Bakerbond WP-HI-propyl. It is also possible to prepare the desired HIC column using conventional chemistry. (Sa: for example, Er-el. Z. gl all , Biochem. Biophys. Res. Comm.
  • a particular gel can be determined by the skilled artisan, hi general the strength ofthe interaction ofthe protein and the HIC ligand increases with the chain length ofthe alkyl ligands but ligands having from about 4 to about 8 carbon atoms are suitable for most separations.
  • a phenyl group has about the same hydrophobicity as a pentyl group, although the selectivity can be different owing to the possibility of pi-pi orbital interaction with aromatic groups on the protein. Selectively may also be affected by the chemistry ofthe supporting resin.
  • Ligand density is an important parameter in that it influences not only the strength ofthe interaction but the capacity ofthe column as well.
  • the ligand density of the commercially available phenyl or octyl phenyl gels is on the order of 40 pmoles/ml gel bed.
  • Gel capacity is a function ofthe particular protein in question as well as pH, temperature and salt type and concentration but generally can be expected to fall in the range of 3-20 mg ml of gel.
  • a decrease in temperature decreases the interaction with HIC material.
  • any benefit that would accrue by increasing the temperature must also be weighed against -adverse effects such an increase may have on the stability ofthe protein.
  • the polypeptides ofthe invention can be eluted isocratically.
  • isocratic elution all compounds begin migration through the column at onset. However, each migrates at a different rate, resulting in faster or slower elution rate.
  • form A can be eluted with the flow through of the column.
  • one or more polypeptides ofthe invention can be bound to the column and eluted, e.g., using stepwise elution or gradient elution.
  • Elution whether stepwise or in the form of a gradient, can be accomplished in a variety of ways: (a) by changing the salt concentration, (b) by changing the polarity ofthe solvent or (c) by adding detergents. By decreasing salt concentration adsorbed proteins are eluted in order of increasing hydrophobicity.
  • Changes in polarity may be affected by additions of solvents such as ethylene or propylene glycol or (iso)propanol, thereby decreasing the strength ofthe hydrophobic interactions.
  • Detergents function as displacers of proteins and have been used primarily in connection with the purification of membrane proteins
  • the polypeptide mixture can be contacted with the HIC material e.g., using a batch purification technique or using a column.
  • HIC purification Prior to HIC purification it may be desirable to remove any chaotropic agents or very hydrophobic substances, e.g., by passing the mixture through a precolumn.
  • HIC material is prepared in or equilibrated to the desired starting buffer.
  • a slurry ofthe HIC material is obtained.
  • the polypeptide solution is contacted with the slurry to adsorb at least one ofthe polypeptides to be separated to the HIC material.
  • the solution containing the polypeptides that do not bind to the HIC material is separated from the slurry, e.g., by allowing the slurry to settle and removing the supernatant.
  • the slurry can be subjected to one or more washing steps. If desired, the slurry can be contacted with a solution of lower conductivity to desorb polypeptides that have bound to the HIC material. In order to elute bound polypeptides, the salt concentiation can be decreased.
  • the HIC material can be packed in a column.
  • a mixture comprising the polypeptides to be separated can be applied to the column allowing at least one ofthe polypeptides to be separated to adsorb to the column.
  • the polypeptides that do not adsorb to the column pass through and can be collected.
  • the salt concentiation can be decreased, e.g., in a step- wise fashion or using a salt gradient. Since form B is more hydrophobic than form A, it adsorbs ineversibly to the stationary phase using approximately 0.7 M (e.g., 0.73M)Ammonium Sulfate / 20 mM Sodium Phosphate, pH 4.0 to pH 8.0 as the mobile phase.
  • Form A binds to a lesser extent to the stationary phase under these conditions and is therefore eluted isocratically, i.e. it leaves the column with the flowthrough fraction. Subsequent to the isocratic elution of form A, omitting Ammonium sulfate from the mobile phase desorbs form B.
  • the HIC material is equilibrated in a buffer comprising a salt concentration yielding a conductivity of from between about 160 to about 110, preferably from between about 140 to about 115, even more preferably from between about 130 or about 120 to about 117 mS/cm.
  • an exemplary starting solution comprises a salt concentration of approximately IM to 0.7M, e.g., IM to 0.7M ammonium sulfate.
  • the solution comprising the mixture of polypeptides to be separated is also brought to the same, or approximately the same conductivity (e.g., using a concentrated stock solution of salt).
  • Form A is eluted from the column at a conductivity of about 120mS/cm.
  • a stepwise or linear gradient of reducing ammonium sulfate content can be applied to the column.
  • Form B elutes at a conductivity of approximately 115 to approximately lOOmS/cm.
  • the subject purification method yields a composition comprising polypeptide molecules having at least two target binding sites and two heavy chain portions, wherein the heavy chain portions lack CH2 domains and wherein greater than about 50% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage.
  • greater than about 60% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage.
  • greater than about 70% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage.
  • the subject purification method yields a composition comprising recombinant polypeptide molecules having at least two target binding sites and two heavy chain portions, wherein greater than about 99% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage.
  • the subject purification method yields a composition comprising polypeptide molecules having at least two target binding sites and two heavy chain portions, wherein greater than about 95% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage, and wherein the heavy chain portions ofthe polypeptides are derived from an antibody of the IgG4 isotype.
  • the subject purification method yields a composition comprising polypeptide molecules having two light chain portions and two heavy chain portions, wherein the heavy chain portions lack CH2 domains and wherein greater than about 80% ofthe molecules are present in a form in which the two heavy chain portions are not linked via at least one interchain disulfide linkage.
  • the instant invention also provides methods for momtoring the results of purification and/or preferential biosynthesis comprising measuring the relative amounts of Form A and Form B in a composition.
  • Form A and Form B can be measured, e.g., as described herein using non-reducing SDS polyacrylamide gel electrophoresis or mass spectrometry.
  • V. Labeling or Conjugation of Polypeptides The polypeptide molecules ofthe present invention may be used in non- conjugated form or may conjugated to at least one of a variety of molecules, e.g., to facilitate antigen detection or for imaging or therapy ofthe patient.
  • the polypeptides of the invention can be labeled or conjugated either before or after purification, when purification is performed.
  • polypeptides ofthe present invention may be conjugated to cytotoxins (such as radioisotopes, cytotoxic drugs, or toxins) therapeutic agents, cytostatic agents, biological toxins, prodrugs, peptides, proteins, enzymes, vimses, lipids, biological response modifiers, pharmaceutical agents, irnmunologically active ligands (e.g., lymphokines or antibodies wherein the resulting molecule binds to both the neoplastic cell and an effector cell such as a T cell), or PEG.
  • cytotoxins such as radioisotopes, cytotoxic drugs, or toxins
  • therapeutic agents such as radioisotopes, cytotoxic drugs, or toxins
  • cytostatic agents such as radioisotopes, cytotoxic drugs, or toxins
  • biological toxins such as radioisotopes, cytotoxic drugs, or toxins
  • prodrugs such as prodrugs
  • peptides such as prodrugs
  • peptides such as pro
  • compositions may comprise polypeptides ofthe invention coupled to drugs or prodrugs.
  • Still other embodiments ofthe present invention comprise the use of polypeptides ofthe invention conjugated to specific biotoxins or their cytotoxic fragments such as ricin, gelonin, pseudomonas exotoxin or diphtheria toxin.
  • cytotoxic fragments such as ricin, gelonin, pseudomonas exotoxin or diphtheria toxin.
  • the selection of which conjugated or unconjugated polypeptide to use will depend on the type and stage of cancer, use of adjunct treatment (e.g., chemotherapy or external radiation) and patient condition. It will be appreciated that one skilled in the art could readily make such a selection in view ofthe teachings herein.
  • radioisotopes include: 90 Y, 125 1, 131 1, 123 I, m In, 105 Rh, 153 Sm, 67 Cu, 67 Ga, 166 Ho, 177 Lu, 186 Re and 188 Re.
  • the radionuclides act by producing ionizing radiation which causes multiple strand breaks in nuclear DNA, leading to cell death.
  • the isotopes used to produce therapeutic conjugates typically produce high energy - or ⁇ -particles which have a short path length.
  • radionuclides kill cells to which they are in close proximity, for example neoplastic cells to which the conjugate has attached or has entered. They have little or no effect on non-localized cells. Radionuclides are essentially non-immunogenic.
  • polypeptides ofthe invention may be directly labeled (such as through iodination) or may be labeled indirectly through the use of a chelating agent.
  • the phrases "indirect labeling” and "indirect labeling approach” both mean that a chelating agent is covalently attached to a molecule and at least one radionuclide is associated with the chelating agent.
  • Such chelating agents are typically refened to as bifunctional chelating agents as they bind both the polypeptide and the radioisotope.
  • Particularly prefened chelating agents comprise l-isothiocycmatobenzyl-3- methyldiothelene triaminepentaacetic acid ("MX-DTPA”) and cyclohexyl diethylenetriamine pentaacetic acid (“CHX-DTPA”) derivatives.
  • Other chelating agents comprise P-DOTA and EDTA derivatives.
  • Particularly prefened radionuclides for indirect labeling include m In and 90 Y.
  • direct labeling and “direct labeling approach” both mean that a radionuclide is covalently attached directly to a polypeptide (typically via an aniino acid residue). More specifically, these linking technologies include random labeling and site-directed labeling. In the latter case, the labeling is directed at specific sites on the polypeptide, such as the N-linked sugar residues present only on the Fc portion ofthe conjugates. Further, various direct labeling techniques and protocols are compatible with the instant invention.
  • Technetium-99m labeled polypeptides may be prepared by ligand exchange processes, by reducing pertechnate (TcO 4 " ) with stannous ion solution, chelating the reduced technetium onto a Sephadex column and applying the polypeptides to this column, or by batch labeling techniques, e.g. by incubating pertechnate, a reducing agent such as SnCl , a buffer solution such as a sodium-potassium phthalate-solution, and the molecules.
  • a reducing agent such as SnCl
  • a buffer solution such as a sodium-potassium phthalate-solution
  • Polypeptides according to the invention may be derived, for example, with radioactive sodium or potassium iodide and a chemical oxidizing agent, such as sodium hypochlorite, chloramine T or the like, or an enzymatic oxidizing agent, such as lactoperoxidase, glucose oxidase and glucose.
  • a chemical oxidizing agent such as sodium hypochlorite, chloramine T or the like
  • an enzymatic oxidizing agent such as lactoperoxidase, glucose oxidase and glucose.
  • the indirect labeling approach is particularly prefened.
  • Patents relating to chelators and chelator conjugates are known in the art.
  • U.S. Patent No. 4,831,175 of Gansow is directed to polysubstituted diethylenetriaminepentaacetic acid chelates and protein conjugates containing the same, and methods for their preparation.
  • U.S. Patent Nos. 5,099,069, 5,246,692, 5,286,850, 5,434,287 and 5,124,471 of Gansow also relate to polysubstituted DTPA chelates. These patents are inco ⁇ orated herein in their entirety.
  • compatible metal chelators are ethylenediaminetetiaacetic acid (EDTA), diethylenetriaminepentaacetic acid (DPTA), 1,4,8,11-tetiaazatetiadecane, 1,4,8,11- tetraazatetradecane-1,4,8,11-tetiaacetic acid, l-oxa-4,7,12,15-tetraazaheptadecane- 4,7,12,15-tetiaacetic acid, or the like. Cyclohexyl-DTPA or CHX-DTPA is particularly prefened.
  • Compatible chelators including those yet to be discovered, may easily be discerned by a skilled artisan and are clearly within the scope ofthe present invention.
  • Compatible chelators including the specific bifunctional chelator used to facilitate chelation in co-pending application Serial Nos. 08/475,813, 08/475,815 and 08/478,967, are preferably selected to provide high affinity for trivalent metals, exhibit increased tumor-to-non-tumor ratios and decreased bone uptake as well as greater in vivo retention of radionuclide at target sites, i.e., B-cell lymphoma tumor sites.
  • target sites i.e., B-cell lymphoma tumor sites.
  • other bifunctional chelators that may or may not possess all of these characteristics are known in the art and may also be beneficial in tumor therapy.
  • polypeptides may be conjugated to different radiolabels for diagnostic and therapeutic pu ⁇ oses.
  • radiolabeled therapeutic conjugates for diagnostic "imaging" of tumors before administration of therapeutic molecule.
  • “3h2B8" conjugate comprises a murine monoclonal antibody, 2B8, specific to human CD20 antigen, that is attached to m Ih via a bifunctional chelator, i.e., MX-DTPA (diethylenetriaminepentaacetic acid), which comprises a 1 : 1 mixture of l-isothiocyanatobenzyl-3-methyl-DTPA and 1- methyl-3-isothiocyanatobenzyl-DTPA.
  • MX-DTPA diethylenetriaminepentaacetic acid
  • m 3h is particularly prefened as a diagnostic radionuclide because between about 1 to about 10 mCi canbe safely administered without detectable toxicity; and the imaging data is generally predictive of subsequent 90 Y-labeled antibody distribution.
  • the clinical usefulness of 131 I can be hmited by several factors including: eight-day physical half-life; dehalogenation of iodinated antibody both in the blood and at tumor sites; and emission characteristics (e.g., large gamma component) which can be suboptimal for localized dose deposition in tumor.
  • the opportunity for attaclriing metal chelating groups to proteins has increased the opportunities to utilize other radionuclides such as In and 90 ⁇ 90 ⁇ pj-Qyjdgg several benefits for utilization in radioimmunotherapeutic applications: the 64 hour half-life of 90 Y is long enough to allow accumulation by tumor and, unlike e.g., 131 1, 90 Y is a pure beta emitter of high energy with no accompanying gamma irradiation in its decay, with a range in tissue of 100 to 1,000 cell diameters. Furthermore, the rninimal amount of penetrating radiation allows for outpatient administration of 90 Y-labeled molecules.
  • conjugates with biotin are prepared e.g. by reacting the polypeptides with an activated ester of biotin such as the biotin N- hydroxysuccinimide ester.
  • conjugates with a fluorescent marker may be prepared in the presence of a coupling agent, e.g.
  • cytotoxic drugs particularly those which are used for cancer therapy.
  • a cytotoxin or cytotoxic agent means any agent that is detrimental to the growth and proliferation of cells and may act to reduce, inhibit or destroy a cell or malignancy.
  • Exemplary cytotoxins include, but are not limited to, radionuclides, biotoxins, enzymatically active toxins, cytostatic or cytotoxic therapeutic agents, prodrugs, immunologically active ligands and biological response modifiers such as cytokines. Any cytotoxin that acts to retard or slow the growth of immunoreactive cells or malignant cells is within the scope ofthe present invention.
  • Exemplary cytotoxins include, in general, cytostatic agents, alkylating agents, antimetabolites, anti-proliferative agents, tubulin binding agents, hormones and hormone antagonists, and the like.
  • alkylating substances such as mechlorethamine, triethylenephosphoramide, cyclophosphamide, ifosfamide, chlorambucil, busulfan, melphalan or triaziquone
  • nitrosourea compounds such as carmustine, lomustine, or semustine.
  • cytotoxic agents include, for example, the maytansinoid family of drugs.
  • cytotoxic agents include, for example, the anthracycline family of drugs, the vinca drugs, the mitomycins, the bleomycins, the cytotoxic nucleosides, the pteridine family of drugs, diynenes, and the podophyllotoxins.
  • Particularly useful members of those classes include, for example, adriamycin, carminomycin, daunorubicin (daunomycin), doxorubicin, aminopterin, methotrexate, methopterin, rmthramycin, sitesptonigrin, dichloromethotrexate, mitomycin C, actinomycin-D, porfiromycin, 5-fluorouracil, floxuridine, ftorafur, 6- mercaptopurine, cytarabine, cytosine arabinoside, podophyllotoxin, or podophyllotoxin derivatives such as etoposide or etoposide phosphate, melphalan, vinblastine, vincristine, leurosidine, vindesine, leurosine and the like.
  • cytotoxins that are compatible with the teachings herein include taxol, taxane, cytochalasin B, gramicidin D, ethidium bromide, emetine, tenoposide, colchicin, dihydroxy anthracin dione, mitoxantrone, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof.
  • Hormones and hormone antagonists such as corticosteroids, e.g. prednisone, progestins, e.g. hydroxyprogesterone or medroprogesterone, estrogens, e.g. diethylstilbestrol, antiestiogens, e.g.
  • tamoxifen, androgens, e.g. testosterone, and aromatase inhibitors, e.g. aminogluthetimide are also compatible with the teachings herein.
  • one skilled in the art may make chemical modifications to the desired compound in order to make reactions of that compound more convenient for purposes of preparing conjugates ofthe invention.
  • One example of particularly prefened cytotoxins comprise members or derivatives ofthe enediyne family of anti-tumor antibiotics, including calicheamicin, esperamicins or dynemicins. These toxins are extremely potent and act by cleaving nuclear DNA, leading to cell death.
  • toxins such as calicheamicin, esperamicins and other enediynes are small molecules which are essentially non-immunogenic. These non-peptide toxins are chemically-linked to the dimers or tetramers by techniques which have been previously used to label monoclonal antibodies and other molecules. These linking technologies include site-specific linkage via the N-linked sugar residues present only on the Fc portion ofthe constructs. Such site-directed linking methods have the advantage of reducing the possible effects of linkage on the binding properties ofthe constmcts. As previously alluded to, compatible cytotoxins may comprise a prodrug.
  • prodrug refers to a precursor or derivative form of a pharmaceutically active substance that is less cytotoxic to tumor cells compared to the parent drug and is capable of being enzymatically activated or converted into the more active parent form.
  • Prodrugs compatible with the invention include, but are not limited to, phosphate-containing prodrugs, thiophosphate-containing prodrugs, sulfate containing prodrugs, peptide containing prodrugs, ⁇ -lactam-containing prodrugs, optionally substituted phenoxyacetan ⁇ de-contairiing prodrugs or optionally substituted phenylacetantide-contair ⁇ ig prodrugs, 5-fluorocytosine and other 5-fluorouridine prodrugs that can be converted to the more active cytotoxic free drug.
  • cytotoxic drugs that can be derivatized into a prodrug form for use in the present invention comprise those chemotherapeutic agents described above.
  • polypeptides can also be associated with a biotoxin such as ricin subunit A, abrin, diptheria toxin, botulinum, cyanginosins, saxitoxin, shigatoxin, tetanus, tetiodotoxin, trichothecene, verrucologen or a toxic enzyme.
  • a biotoxin such as ricin subunit A, abrin, diptheria toxin, botulinum, cyanginosins, saxitoxin, shigatoxin, tetanus, tetiodotoxin, trichothecene, verrucologen or a toxic enzyme.
  • a biotoxin such as ricin subunit A, abrin, diptheria toxin, botulinum, cyanginosins, saxitoxin, shigatoxin, tetanus, tet
  • radiosensitizing drugs that maybe effectively directed to tumor or immunoreactive cells.
  • Such drugs enhance the sensitivity to ionizing radiation, thereby increasing the efficacy of radiotherapy.
  • An conjugate intemalized by the tumor cell would deliver the radiosensitizer nearer the nucleus where radiosensitization would be maximal.
  • the unbound radiosensitizer linked polypeptides of the invention would be cleared quickly from the blood, localizing the remaining radiosensitization agent in the target tumor and providing minimal uptake in normal tissues.
  • adjunct radiotherapy would be administered in one of three ways: 1.) external beam radiation directed specifically to the tumor, 2.) radioactivity directly implanted in the tumor or 3.) systemic radioirnmunotherapy with the same targeting molecule.
  • a potentially attractive variation of this approach would be the attachment of a therapeutic radioisotope to the radiosensitized immunoconjugate, thereby providing the convenience of administering to the patient a single drug.
  • a moiety that enhances the stability or efficacy ofthe polypeptide can be conjugated.
  • PEG can be conjugated to the polypeptides ofthe invention to increase their half-life in vivo. Leong, S.R., et al. 2001. Cytokine 16:106; 2002; Adv. in Drug Deliv. Rev. 54:531; or Weir et al. 2002. Biochem. Soc. Transactions 30:512.
  • the route of administration ofthe polypeptide ofthe invention may be oral, parenteral, by inhalation or topical.
  • parenteral as used herein includes intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, rectal or vaginal admimstration.
  • the intravenous, intraarterial, subcutaneous and intramuscular forms of parenteral admiriistration are generally prefened. While all these forms of adrmnistration are clearly contemplated as being within the scope ofthe invention, a form for administration would be a solution for injection, in particular for intravenous or intraarterial injection or drip.
  • a suitable pharmaceutical composition for injection may comprise a buffer (e.g. acetate, phosphate or citrate buffer), a surfactant (e.g. polysorbate), optionally a stabilizer agent (e.g. human albumin), etc.
  • a buffer e.g. acetate, phosphate or citrate buffer
  • a surfactant e.g. polysorbate
  • a stabilizer agent e.g. human albumin
  • the polypeptides can be delivered directly to the site ofthe adverse cellular population thereby increasing the exposure of the diseased tissue to the therapeutic agent.
  • Preparations for parenteral administration includes sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
  • non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • pharmaceutically acceptable carriers include, but are not limited to, 0.01- 0.1M and preferably 0.05M phosphate buffer or 0.8% saline.
  • Other common parenteral vehicles include sodium phosphate solutions, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers, such as those based on Ringer's dextrose, and the like.
  • compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • the composition must be sterile and should be fluid to the extent that easy syrmgabihty exists. It should be stable under the conditions of manufacture and storage and will preferably be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention ofthe action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal and the like.
  • isotonic agents for example, sugars, polyalcohols, such as mannitol, sorbitol, or sodium chloride in the composition.
  • Prolonged abso ⁇ tion ofthe injectable compositions can be brought about by including in the composition an agent which delays abso ⁇ tion, for example, aluminum monostearate and gelatin.
  • sterile injectable solutions can be prepared by inco ⁇ orating an active compound (e.g., a polypeptide by itself or in combination with other active agents) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated herein, as required, followed by filtered sterilization.
  • dispersions are prepared by inco ⁇ orating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the prefened methods of preparation are vacuum drying and freeze-drying, which yields a powder of an active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • the preparations for injections are processed, filled into containers such as ampoules, bags, bottles, syringes or vials, and sealed under aseptic conditions according to methods known in the art. Further, the preparations may be packaged and sold in the form of a kit such as those described in co-pending U.S.S.N.
  • compositions ofthe present invention for the treatment ofthe above described conditions vary depending upon many different factors, including means of administration, target site, physiological state ofthe patient, whether the patient is human or an animal, other medications administered, and whether treatment is prophylactic or therapeutic.
  • the patient is a human but non-human mammals including transgenic mammals can also be tieated.
  • Treatment dosages may be titrated using routine methods known to those of skill in the art to optimize safety and efficacy.
  • the dosage can range, e.g., from about 0.0001 to 100 mg/kg, and more usually 0.01 to 5 mg/kg (e.g., 0.02 mg kg, 0.25 mg/kg, 0.5 mg/kg, 0.75 mg/kg, lmg/kg, 2 mg/kg, etc.), ofthe host body weight.
  • dosages can be 1 mg/kg body weight or 10 mg/kg body weight or within the range of 1- 10 mg/kg, preferably at least 1 mg/kg. Doses intermediate in the above ranges are also intended to be within the scope ofthe invention.
  • Subjects can be administered such doses daily, on alternative days, weekly or according to any other schedule determined by empirical analysis.
  • An exemplary treatment entails administration in multiple dosages over a prolonged period, for example, of at least six months. Additional exemplary treatment regimes entail administration once per every two weeks or once a month or once every 3 to 6 months.
  • Exemplary dosage schedules include 1-10 mg/kg or 15 mg/kg on consecutive days, 30 mg/kg on alternate days or 60 mg/kg weekly.
  • two or more monoclonal antibodies with different binding specificities are administered simultaneously, in which case the dosage of each antibody admimstered falls within the ranges indicated.
  • Polypeptides ofthe invention can be admimstered on multiple occasions. Intervals between single dosages can be weekly, monthly or yearly. Intervals can also be inegular as indicated by measuring blood levels of polypeptide or antigen in the patient. In some methods, dosage is adjusted to achieve a plasma polypeptide concentiation of 1- 1000 ⁇ g/ml and in some methods 25-300 ⁇ g/ml. Alternatively, binding molecules can be administered as a sustained release formulation, in which case less frequent administration is required. Dosage and frequency vary depending on the half-life ofthe molecule in the patient.
  • humanized antibodies show the longest half-life, followed by chimeric antibodies and nonhuman antibodies, hi one embodiment, the binding molecules ofthe invention can be administered in unconjugated form, In another embodiment, the polypeptides ofthe invention can be administered multiple times in conjugated form. In still another embodiment, the binding molecules ofthe invention can be administered in unconjugated form, then in conjugated form, or vise versa.
  • the dosage and frequency of administration can vary depending on whether the treatment is prophylactic or therapeutic, hi prophylactic applications, compositions containing the present polypeptides or a cocktail thereof are administered to a patient not aheady in the disease state to enhance the patient's resistance.
  • Such an amount is defined to be a "prophylactic effective dose.”
  • the precise amounts again depend upon the patient's state of health and general immunity, but generally range from 0.1 to 25 mg per dose, especially 0.5 to 2.5 mg per dose.
  • a relatively low dosage is admimstered at relatively infrequent intervals over a long period of time. Some patients continue to receive treatment for the rest of their lives. hi therapeutic applications, a relatively high dosage (e.g., from about 1 to
  • a subject can be treated with a nucleic acid molecule encoding a polypeptide ofthe invention (e.g., in a vector).
  • Doses for nucleic acids encoding polypeptides range from about 10 ng to 1 g, 100 ng to 100 mg, 1 ⁇ g to 10 mg, or 30-300 ⁇ g DNA per patient.
  • Doses for infectious viral vectors vary from 10-100, or more, virions per dose.
  • Therapeutic agents can be administered by parenteral, topical, intravenous, oral, subcutaneous, intraarterial, intiacranial, intraperitoneal, intianasal or intramuscular means for prophylactic and/or therapeutic treatment.
  • the most typical route of administration of an immunogenic agent is subcutaneous although other routes can be equally effective.
  • the next most common route is intramuscular injection. This 1 type of injection is most typically performed in the arm or leg muscles, hi some methods, agents are injected directly into a particular tissue where deposits have accumulated, for example intiacranial injection. Intramuscular injection or intravenous infusion are prefened for administration of molecules.
  • particular therapeutic molecules are injected directly into the cranium.
  • molecules are administered as a sustained release composition or device, such as a MedipadTM device.
  • Agents ofthe invention can optionally be administered in combination with other agents that are effective in treating the disorder or condition in need of treatment (e.g., prophylactic or therapeutic).
  • Effective single treatment dosages (i.e., therapeutically effective amounts) of 90 Y-labeled polypeptides ofthe invention range from between about 5 and about 75 mCi, more preferably between about 10 and about 40 mCi.
  • Effective single treatment non-manow ablative dosages of 131 I-labeled antibodies range from between about 5 and about 70 mCi, more preferably between about 5 and about 40 mCi.
  • Effective single treatment ablative dosages (i.e., may require autologous bone manow transplantation) of 131 I-labeled antibodies range from between about 30 and about 600 mCi, more preferably between about 50 and less than about 500 mCi.
  • an effective single treatment non-manow ablative dosages of iodine-131 labeled chimeric antibodies range from between about 5 and about 40 mCi, more preferably less than about 30 mCi. Imaging criteria for, e.g., the 111 3h label, are typically less than about 5 mCi.
  • radiolabels are known in the art and have been used for similar proposes.
  • Still other radioisotopes are used for imaging.
  • additional radioisotopes which 1 ⁇ are compatible with the scope ofthe instant invention include, but are not limited to, I, 125 1, 32 P, 57 Co, 64 Cu, 67 Cu, 77 Br, 81 Rb, 81 &, 87 Sr, 113 h ⁇ , 127 Cs, 129 Cs, 132 1, 197 Hg, 203 Pb, 206 Bi, 177 Lu, 186 Re, 212 Pb, 212 Bi, 47 Sc, 105 Rh, 109 Pd, 153 Sm, 188 Re, 199 Au, 225 Ac, At, and 213 Bi.
  • radionuclides are compatible with a selected course of treatment without undue experimentation.
  • additional radionuclides which have already been used in clinical diagnosis include 125 1, 123 1, 99 Tc, 43 K, 52 Fe, 67 Ga, 68 Ga, as well as m In.
  • Antibodies have also been labeled with a variety of radionuclides for potential use in targeted immunotherapy (Peirersz et al. Immunol. Cell Biol. 65: 111-125 (1987)).
  • radionuclides include 188 Re and 186 Re as well as 199 Au and 67 Cu to a lesser extent.
  • U.S. Patent No. 5,460,785 provides additional data regarding such radioisotopes and is inco ⁇ orated herein by reference. Whether or not the polypeptides ofthe invention are used in a conjugated or unconjugated form, it will be appreciated that a major advantage ofthe present invention is the ability to use these polypeptides in myelosuppressed patients, especially those who are undergoing, or have undergone, adjunct therapies such as radiotherapy or chemotherapy. That is, the beneficial delivery profile (i.e.
  • the polypeptides ofthe invention are useful in a conjugated or unconjugated form in patients that have previously undergone adjunct therapies such as external beam radiation or chemotherapy, hi other prefened embodiments, the polypeptides (again in a conjugated or unconjugated form) may be used in a combined therapeutic regimen with chemotherapeutic agents.
  • Such therapeutic regimens may comprise the sequential, simultaneous, concurrent or coextensive administration ofthe disclosed molecules and one or more chemotherapeutic agents.
  • Particularly prefened embodiments of this aspect ofthe invention will comprise the administration of a radiolabeled polypeptide. While the polypeptides may be administered as described immediately above, it must be emphasized that in other embodiments conjugated and unconjugated polypeptides may be administered to otherwise healthy patients as a first line therapeutic agent. In such embodiments the polypeptides may be adieri concludedred to patients having normal or average red manow reserves and/or to patients that have not, and are not, undergoing adjunct therapies such as external beam radiation or chemotherapy.
  • selected embodiments ofthe invention comprise the acinriimstration of polypeptides to myelosuppressed patients or in combination or conjunction with one or more adjunct therapies such as radiotherapy or chemotherapy (i.e. a combined therapeutic regimen).
  • a combined therapeutic regimen such as radiotherapy or chemotherapy
  • the administration of polypeptides in conjunction or combination with an adjunct therapy means the sequential, simultaneous, coextensive, concunent, concomitant or contemporaneous adirdnistration or application of the therapy and the disclosed molecules.
  • the administration or apphcation ofthe various components ofthe combined therapeutic regimen may be timed to enhance the overall effectiveness ofthe treatment.
  • chemotherapeutic agents could be administered in standard, well known courses of treatment followed within a few weeks by radioimmunoconjugates ofthe present invention.
  • cytotoxin associated polypeptides could be adnriinistered intravenously followed by tumor locahzed external beam radiation.
  • the polypeptide maybe admimstered concunently with one or more selected chemotherapeutic agents in a single office visit.
  • a skilled artisan e.g. an experienced oncologist
  • the chemotherapeutic agent may be administered in any order and within any time frame that provides a therapeutic benefit to the patient. That is, the chemotherapeutic agent and polypeptide may be administered in any order or concunently.
  • the polypeptides ofthe present invention will be adrninistered to patients that have previously undergone chemotherapy.
  • the polypeptides and the chemotherapeutic treatment will be administered substantially simultaneously or concunently.
  • the patient may be given the bmding molecule while undergoing a course of chemotherapy.
  • the binding molecule will be administered within 1 year of any chemotherapeutic agent or treatment, hi other prefened embodiments the polypeptide will be adrninistered within 10, 8, 6, 4, or 2 months of any chemotherapeutic agent or tieatment. In still other prefened embodiments the polypeptide will be administered within 4, 3, 2 or 1 week of any chemotherapeutic agent or treatment. In yet other embo ⁇ iiments the polypeptide will be administered within 5, 4, 3, 2 or 1 days ofthe selected chemotherapeutic agent or tieatment. It will further be appreciated that the two agents or treatments may be administered to the patient within a matter of hours or minutes (i.e. substantially simultaneously).
  • a myelosuppressed patient shall be held to mean any patient exhibiting lowered blood counts.
  • blood count parameters conventionally used as clinical indicators of myelosuppresion and one can easily measure the extent to which myelosuppresion is occurring in a patient.
  • Examples of art accepted myelosuppression measurements are the Absolute Neutiophil Count (ANC) or platelet count.
  • ANC Absolute Neutiophil Count
  • Such myelosuppression or partial myeloablation may be a result of various biochemical disorders or diseases or, more likely, as the result of prior chemotherapy or radiotherapy.
  • patients who have undergone traditional chemotherapy typically exhibit reduced red manow reserves.
  • conjugated or unconjugated polypeptides ofthe present invention may be used to effectively treat patients having ANCs lower than about 2000/mm 3 or platelet counts lower than about 150,000/ mm 3 . More preferably the polypeptides ofthe present invention may be used to treat patients having ANCs of less than about 1500/ mm 3 , less than about 1000/mm 3 or even more preferably less than about 500/ mm 3 .
  • the polypeptides ofthe present invention may be used to treat patients having a platelet count of less than about 75,000/mm 3 , less than about 50,000/mm 3 or even less than about 10,000/mm 3 .
  • a platelet count of less than about 75,000/mm 3 , less than about 50,000/mm 3 or even less than about 10,000/mm 3 .
  • myelosuppressed patients have undergone courses of tieatment including chemotherapy, implant radiotherapy or external beam radiotherapy, hi the case ofthe latter, an external radiation source is for local irradiation of a malignancy.
  • radioactive reagents are surgically located within the malignancy, thereby selectively irradiating the site ofthe disease.
  • the disclosed polypeptides may be used to treat disorders in patients exhibiting myelosuppression regardless ofthe cause.
  • the polypeptides ofthe instant invention may be used in conjunction or combination with any chemotherapeutic agent or agents (e.g. to provide a combined therapeutic regimen) that eliminates, reduces, inhibits or controls the growth of neoplastic cells in vivo.
  • any chemotherapeutic agent or agents e.g. to provide a combined therapeutic regimen
  • agents often result in the reduction of red manow reserves. This reduction may be offset, in whole or in part, by the diminished myelotoxicity ofthe compounds ofthe present invention that advantageously allow for the aggressive treatment of neoplasias in such patients.
  • radiolabeled immunoconjugates disclosed herein may be effectively used with radiosensitizers that increase the susceptibility ofthe neoplastic cells to radionuclides.
  • radiosensitizing compounds may be administered after the radiolabeled binding molecule has been largely cleared from the bloodstream but still remains at therapeutically effective levels at the site ofthe tumor or tumors.
  • exemplary chemotherapeutic agents that are compatible with the instant invention include alkylating agents, vinca alkaloids (e.g., vincristine and vinblastine), procarbazine, methotrexate and prednisone.
  • MOPP mechlethamine
  • ABVD e.g., adriamycin, bleomycin, vinblastine and dacarbazine
  • ChlVPP chlorambucil, vinblastine, procarbazine and prednisone
  • CABS lomustine, doxorubicin, bleomycin and stieptozotocm
  • MOPP plus ABVD MOPP plus ABV (doxorubicin, bleomycin and vinblastine) or BCVPP (carmustine, cyclophosphamide, vinblastine, procarbazine and prednisone) combinations
  • BCVPP carmustine, cyclophosphamide, vinblastine, procarbazine and prednisone
  • Additional regimens include use of single alkylating agents such as cyclophosphamide or chlorambucil, or combinations such as CVP (cyclophosphamide, vincristine and prednisone), CHOP (CVP and doxorubicin), C-MOPP (cyclophosphamide, vincristine, prednisone and procarbazine), CAP-BOP (CHOP plus procarbazine and bleomycin), m-BACOD (CHOP plus methotiexate, bleomycin and leucovorin), ProMACE-MOPP ⁇ redhisone, methotrexate, doxorubicin, cyclophosphamide, etoposide and leucovorin plus standard MOPP), ProMACE-CytaBOM (prednisone, doxorubicin, cyclophosphamide, etoposide, cytarabine, bleomycin,
  • CVP cyclophos
  • CHOP has also been combined with bleomycin, methotrexate, procarbazine, nitrogen mustard, cytosine arabinoside and etoposide.
  • Other compatible chemotherapeutic agents include, but are not limited to, 2- chlorodeoxyadenosine (2-CDA), 2'-deoxycoformycin and fludarabine.
  • 2-CDA 2- chlorodeoxyadenosine
  • fludarabine 2- chlorodeoxyadenosine
  • Salvage therapies employ drugs such as cytosine arabinoside, cisplatin, etoposide and ifosfamide given alone or in combination.
  • IMVP-16 ifosfamide, methotiexate and etoposide
  • MIME methyl-gag, ifosfamide, methotrexate and etoposide
  • DHAP dexamethasone, high dose cytarabine and cisplatin
  • ESHAP etoposide, methylpredisolone, HD cytarabine, cisplatin
  • CEPP(B) cyclophosphamide, etoposide, procarbazine, prednisone and bleomycin
  • CAMP lomustine, mitoxantione, cytarabine and prednisone
  • chemotherapeutic agent used in combination with the polypeptides ofthe instant invention may vary by subject or may be admimstered according to what is known in the art. See for example, Bruce A Chabner et al, Antineoplastic Agents, in GOODMAN & GlLMAN's THE PHARMACOLOGICAL BASIS OF THERAPEUTICS 1233-1287 ((Joel G. Hardman et al, eds., 9 th ed. 1996).
  • polypeptides ofthe present invention may be administered in a pharmaceutically effective amount for the in vivo treatment of mammalian disorders.
  • the disclosed binding molecules will be formulated so as to facilitate administration and promote stability ofthe active agent.
  • pharmaceutical compositions in accordance with the present invention comprise a pharmaceutically acceptable, non-toxic, sterile carrier such as physiological saline, non-toxic buffers, preservatives and the like.
  • a pharmaceutically effective amount ofthe polypeptide, immunoreactive fragment or recombinant thereof, conjugated or unconjugated to a therapeutic agent shall be held to mean an amount sufficient to achieve effective binding to an antigen and to achieve a benefit, e.g., to ameliorate symptoms of a disease or disorder or to detect a substance or a cell.
  • the polypeptide will be preferably be capable of interacting with selected immunoreactive antigens on neoplastic or immunoreactive cells and provide for an increase in the death of those cells.
  • the pharmaceutical compositions ofthe present invention may be admimstered in single or multiple doses to provide for a pharmaceutically effective amount ofthe polypeptide.
  • the polypeptides of the invention may be administered to a human or other animal in accordance with the aforementioned methods of tieatment in an amount sufficient to produce a therapeutic or prophylactic effect.
  • the binding molecules ofthe invention can be administered to such human or other animal in a conventional dosage form prepared by combining the binding molecule ofthe invention with a conventional pharmaceutically acceptable carrier or diluent according to known techniques. It will be recognized by one of skill in the art that the form and character ofthe pharmaceutically acceptable carrier or diluent is dictated by the amount of active ingredient with which it is to be combined, the route of administration and other well-known variables. Those skilled in the art will further appreciate that a cocktail comprising one or more species of polypeptides according to the present invention may prove to be particularly effective.
  • the polypeptides ofthe invention can be used for diagnostic or therapeutic purposes.
  • Prefened embodiments ofthe present invention provide compounds, compositions, kits and methods for the diagnosis and/or treatment of disorders, e.g., neoplastic disorders in a mammalian subject in need of such tieatment.
  • the subject is a human.
  • the polypeptides of the instant invention will be useful in a number of different applications.
  • the subject binding molecules should be useful for reducing or eliminating cells bearing an epitope recognized by a binding molecule ofthe invention.
  • the subject binding molecules are effective in reducing the concentiation of or eliminating soluble antigen in the circulation hi one embodiment, tumor size, inhibiting tumor growth and/or prolonging the survival time of tumor-bearing animals.
  • this invention also relates to a method of treating tumors in a human or other animal by administering to such human or animal an effective, non-toxic amount of polypeptide.
  • an effective, non-toxic amount of polypeptide would be able, by routine experimentation, to determine what an effective, non-toxic amount of polypeptide would be for the pvupose of treating malignancies.
  • a therapeutically active amount of a polypeptide may vary according to factors such as the disease stage (e.g., stage I versus stage IV), age, sex, medical complications (e.g., immunosuppressed conditions or diseases) and weight ofthe subject, and the ability of the molecule to elicit a desired response in the subject.
  • the dosage regimen may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily, or the dose may be proportionally reduced as indicated by the exigencies ofthe therapeutic situation.
  • an effective dosage is expected to be in the range of about 0.05 to 100 milligrams per kilogram body weight per day and more preferably from about 0.5 to 10, milligrams per kilogram body weight per day.
  • mammal refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, horses, cats, cows, etc.
  • mammal is human.
  • Treatment refers to both therapeutic tieatment and prophylactic or preventative measures.
  • Those in need of treatment include those already with the disease or disorder as well as those in which the disease or disorder is to be prevented.
  • the mammal may have been diagnosed as having the disease or disorder or may be predisposed or susceptible to the disease.
  • the polypeptides ofthe present invention may be immunoreactive with one or more tumor antigens or antigens associated with immune disorders.
  • the antigen binding site (i.e. the variable region or immunoreactive fragment or recombinant thereof) ofthe disclosed polypeptides binds to a selected tumor associated antigen at the site ofthe malignancy.
  • immune (including autoimmune) disorders the disclosed polypeptides will bind to selected markers on the offending cells.
  • polypeptides useful in the present invention may be obtained or derived from any antibody (including those previously reported in the literature) that reacts with a molecule or marker associated with the selected condition.
  • the parent or precursor antibody, or fragment thereof, used to generate the disclosed polypeptides may be murine, human, chimeric, humanized, non-human primate or primatized.
  • the polypeptides ofthe present invention may comprise single chain antibody constructs (such as that disclosed in U.S. Pat. No. 5,892,019 which is inco ⁇ orated herein by reference) having altered constant domains as described herein. Consequently, any of these types of antibodies modified in accordance with the teachings herein is compatible with the instant invention.
  • tumor associated antigens means any antigen which is generally associated with tumor cells, i.e., occurring at the same or to a greater extent as compared with normal cells. More generally, tumor associated antigens comprise any antigen that provides for the localization of immunoreactive antibodies at a neoplastic cell inespective of its expression on non-malignant cells. Such antigens may be relatively tumor specific and limited in their expression to the surface of malignant cells. Alternatively, such antigens may be found on both malignant and non-malignant cells.
  • CD20 is a pan B antigen that is found on the surface of both malignant and non-malignant B cells that has proved to be an extremely effective target for immunotherapeutic antibodies for the treatment of non-Hodgkin's lymphoma.
  • pan T cell antigens such as CD2, CD3, CD5, CD6 and CD7 also comprise tumor associated antigens within the meaning ofthe present invention.
  • tumor associated antigens comprise but not limited to MAGE-1, MAGE-3, MUC-1, HPV 16, HPV E6 & E7, TAG-72, CEA, L6-Antigen, CD 19, CD22, CD37, CD52, HLA- DR, EGF Receptor and HER2 Receptor.
  • polypeptides ofthe present invention preferably associate with, and bind to, tumor or immune associated antigens as described above.
  • polypeptides ofthe present invention may be derived, generated or fabricated from any one of a number of antibodies that react with tumor associated antigens, hi prefened embodiments the polypeptides are modified or domain deleted antibodies that are derived using common genetic engineering techniques whereby at least a portion of one or more constant region domains are deleted or altered so as to provide the desired biochemical characteristics such as reduced serum half-life. More particularly, one skilled in the art may readily isolate the genetic sequence conesponding to the variable and/or constant regions ofthe subject antibody and delete or alter the appropriate nucleotides to provide polypeptides ofthe invention for use as monomeric subunits in accordance with the instant invention.
  • compatible polypeptides ofthe invention may be expressed and produced on a clinical or commercial scale using well-established protocols.
  • Previously reported antibodies that react with tumor associated antigens may be altered as described herein to provide the polypeptides ofthe present invention.
  • Exemplary antibodies that may be used to provide antigen binding regions for, generate or derive the disclosed polypeptides include, but are not limited to 2B8 and C2B8 (Zevalin ® and P ⁇ tuxan ® , IDEC Pharmaceuticals Co ⁇ ., San Diego), Lym 1 and Lym 2 (Techniclone), LL2 (Immunomedics Co ⁇ ., New Jersey), HER2 (Herceptin ® , Genentech hie, South San Francisco), Bl (Bexxar ® , Coulter Pharm., San Francisco), Campath ® (Millennium Pharmaceuticals, Cambridge) MB1, BH3, B4, B72.3 (Cytogen Co ⁇ .), CC49 (National Cancer Institute) and 5E10 (University of Iowa).
  • the polypeptides ofthe present invention will bind to the same tumor associated antigens as the antibodies enumerated immediately above.
  • the polypeptides will be derived from or bind the same antigens as 2B8, C2B8, CC49 and C5E10 and, even more preferably, will lack all or part of a CH2 domain.
  • a binding molecule ofthe invention binds to the CD23 (U.S. patent 6,011,138). In a prefened embodiment, a binding molecule ofthe invention binds to the same epitope as the 5E8 antibody. In another embodiment, a binding molecule ofthe invention comprises at least one CDR from an anti-CD23 antibody, e.g., the 5E8 antibody. In one embodiment, a binding molecule ofthe invention binds to the CR3PTO-I antigen (WO02/088170A2 or WO03/083041 A2). In a prefened embodiment, a binding molecule ofthe invention binds to the same epitope as the B3F6 antibody.
  • a binding molecule ofthe invention comprises at least one CDR from an anti-CRIPTO-I antibody, e.g., the B3F6 antibody.
  • the polypeptide will bind to the same tumor associated antigen as Rituxan ® .
  • Rituxan ® also known as, rituximab, 1DEC-C2B8 and C2B8 was the first FDA-approved monoclonal antibody for treatment of human B-cell lymphoma (see U.S. Patent Nos. 5,843,439; 5,776,456 and 5,736,137 each of which is inco ⁇ orated herein by reference).
  • Y2B8 (90Y labeled 2B8; Zevalin®; ibritumomab tiuxetan) is the murine parent of C2B8.
  • -Rituxan ® is a chimeric, anti-CD20 monoclonal antibody which is growth inhibitory and reportedly sensitizes certain lymphoma cell lines for apoptosis by chemotherapeutic agents in vitro.
  • the antibody efficiently binds human complement, has strong FcR bmding, and can effectively kill human lymphocytes in vitro via both complement dependent (CDC) and antibody-dependent (ADCC) mechanisms (Reff et al, Blood 83: 435-445 (1994)).
  • dimeric variants may be used in conjugated or unconjugated forms to effectively treat patients presenting with CD20+ malignancies. More generally, it must be reiterated that the polypeptides disclosed herein may be used in either a "naked” or unconjugated state or conjugated to a cytotoxic agent to effectively treat any one of a number of disorders. In other prefened embodiments ofthe present invention, the polypeptide ofthe invention will be derived from, or bind to, the same tumor associated antigen as CC49.
  • CC49 binds human tumor associated antigen TAG-72 which is associated with the surface of certain tumor cells of human origin, specifically the LS174T tumor cell line.
  • LS174T [American Type Culture Collection (herein ATCC) No. CL 188] is a variant ofthe LSI 80 (ATCC No. CL 187) colon adenocarcinoma line.
  • numerous murine monoclonal antibodies have been developed which have binding specificity for TAG-72.
  • One of these monoclonal antibodies, designated B72.3 is a murine IgGl produced by hybridoma B72.3 (ATCC No. HB-8108).
  • B72.3 is a first generation monoclonal antibody developed using a human breast carcinoma extract as the immunogen (see Colcher et al, Proc. Natl. Acad. Sci. (USA), 78:3199-3203 (1981); and U.S. Pat. Nos. 4,522,918 and 4,612,282 each of which is inco ⁇ orated herein by reference).
  • Other monoclonal antibodies directed against TAG-72 are designated "CC" (for colon cancer).
  • CC monoclonal antibodies are a family of second generation murine monoclonal antibodies that were prepared using TAG- 72 purified with B72.3.
  • CC49 ATCC No. HB 9459
  • CC 83 ATCC No. HB 9453
  • CC46 ATCC No. HB 9458
  • CC92 ATTCC No. HB 9454
  • CC30 ATCC No. HB 9457
  • CC11 ATCC No. 9455
  • CC15 ATCC No. HB 9460.
  • 5,512,443 further teaches that the disclosed antibodies may be altered into theh chimeric form by substituting, e.g., human constant regions (Fc) domains for mouse constant regions by recombinant DNA techniques known in the art.
  • Fc human constant regions
  • Schlom et al. have also produced variants of a humanized CC49 antibody as disclosed in PCT/US99/25552 and single chain constructs as disclosed in U.S. Pat. No. 5,892,019 each of which is also inco ⁇ orated herein by reference.
  • C5E10 is an antibody that recognizes a glycoprotein determinant of approximately 115 kDa that appears to be specific to prostate tumor cell lines (e.g. DU145, PC3, or NDl).
  • polypeptides e.g. CH2 domain-deleted antibodies
  • C5E10 antibodies could be produced and used in a conjugated or unconjugated form for the treatment of neoplastic disorders.
  • the modified antibody will be derived or comprise all or part ofthe antigen binding region ofthe C5E10 antibody as secreted from the hybridoma cell line having ATCC accession No. PTA-865.
  • the resulting modified antibody could then be conjugated to a radionuclide as described below and administered to a patient suffering from prostate cancer in accordance with the methods herein.
  • the disclosed invention may be used to prophylactically or therapeutically treat any neoplasm comprising an antigenic marker that allows for the targeting ofthe cancerous cells by the binding molecule.
  • Exemplary cancers that may be treated include, but are not limited to, prostate, gastric carcinomas such as colon, skin, breast, ovarian, lung and pancreatic.
  • the binding molecules of the instant invention may be used to treat Kaposi's sarcoma, CNS neoplasias (capillary hemangioblastomas, meningiomas and cerebral metastases), melanoma, gastrointestinal and renal sarcomas, rhabdomyosarcoma, glioblastoma (preferably glioblastoma multiforme), leiomyosarcoma, retinoblastoma, papillary cystadenocarcinoma ofthe ovary, Wilm's tumor or small cell lung carcinoma.
  • Kaposi's sarcoma CNS neoplasias (capillary hemangioblastomas, meningiomas and cerebral metastases), melanoma, gastrointestinal and renal sarcomas, rhabdomyosarcoma, glioblastoma (preferably glioblastoma multiforme), leiomyosarcoma, retino
  • polypeptides may be derived for tumor associated antigens related to each of the forgoing neoplasias without undue experimentation in view ofthe instant disclosure.
  • exemplary hematologic malignancies that are amenable to tieatment with the disclosed invention include Hodgkfns and non-Hodgkins lymphoma as well as leukemias, including ALL-L3 (Burkitt's type leukemia), chronic lymphocytic leukemia (CLL) and monocytic cell leukemias.
  • the compounds and methods ofthe present invention are particularly effective in treating a variety of B-cell lymphomas, including low grade/ follicular non-Hodgkin's lymphoma (NHL), cell lymphoma (FCC), mantle cell lymphoma (MCL), diffuse large cell lymphoma (DLCL), small lymphocytic (SL) NHL, intermediate grade/ follicular NHL, intermediate grade diffuse NHL, high grade immunoblastic NHL, high grade lymphoblastic NHL, high grade small non-cleaved cell NHL, bulky disease NHL and Waldenstrom's Macroglobulinemia.
  • NHL low grade/ follicular non-Hodgkin's lymphoma
  • FCC cell lymphoma
  • MCL mantle cell lymphoma
  • DLCL diffuse large cell lymphoma
  • SL small lymphocytic NHL
  • intermediate grade/ follicular NHL intermediate grade diffuse NHL
  • high grade immunoblastic NHL high grade lymphoblastic NHL
  • the disclosed invention may advantageously be used to treat additional malignancies bearing compatible tumor associated antigens.
  • the polypeptides ofthe instant invention are particularly effective in the tieatment of autoimmune disorders or abnormal immune responses.
  • the polypeptide ofthe present invention maybe used to control, suppress, modulate or eliminate unwanted immune responses to both external and autoantigens.
  • the antigen is an autoantigen.
  • the antigen is an allergen
  • the antigen is an alloantigen or xenoantigen.
  • Use ofthe disclosed polypeptides to reduce an immune response to alloantigens and xenoantigens is of particular use in transplantation, for example to inhibit rejection by a transplant recipient of a donor graft, e.g. a tissue or organ graft or bone manow transplant. Additionally, suppression or elimination of donor T cells within a bone manow graft is useful for inhibiting graft versus host disease.
  • the polypeptides ofthe present invention may be used to treat immune disorders that include, but are not limited to, allergic bronchopulmonary aspergillosis; Allergic rhinitis Autoimmune hemolytic anemia; Acanthosis nigricans; Allergic contact dermatitis; Addison's disease; Atopic deirmatitis; Alopecia areata; Alopecia universalis; Amyloidosis; Anaphylactoid piupura; Anaphylactoid reaction; Aplastic anemia; Angioedema, hereditary; Angioedema, idiopathic; Ankylosing spondylitis; Arteritis, cranial; Arteritis, giant cell; Arteritis, Takayasu's; Arteritis, temporal; Asthma; Ataxia-telangiectasia; Autoimmune oophoritis; Autoimmune orchitis; Autoimmune polyendocrine failure; Behcet's disease
  • the binding molecules ofthe invention can be used for pretargeting applications.
  • the same advantages will be apparent in pretargeting applications for chemotherapeutic drug delivery.
  • a tumor is pretargeted with a binding construct that has affinity for the tumor-associated antigen on the one hand and for, e.g., a radiolabeled hapten on the other.
  • the radiolabeled hapten is adrninistered later, preferably after the bmding molecule has cleared (see, e.g., Boerman et al. 2003. J. Nuclear Med. 44:400).
  • an antibody which is non-toxic, but has been denvitized to react with a drug or prodrug that is toxic only when bound by the binding molecule.
  • the bmding molecules ofthe invention are well suited to use in pretargeting applications.
  • a clearing agent could be eliminated from the pretargeting methodology by using the instant binding molecules.
  • Example 1 Identification of A and B Isoforms Solutions of antibody molecules comprise two different isoforms.
  • One form, Form A comprises heavy chain molecules that are linked via at least one disulfide linkage.
  • the other form, Form B comprises heavy chain molecules that are not linked via at least one disulfide linkage.
  • Form B does not appear or appears at a very low frequency in with intact gamma 1 MAbs, such as Rituxan ® . However with domain deleted (dd) constructs having a similar hinge, the frequency of Form B is much higher.
  • Form A appears as a 120kDa dimer while Form B appears as a 60kDa monomer ( Figure 1).
  • Hinge domains can be subdivided into three distinct regions: upper, middle, and lower hinge regions (Roux et al. J. Immunol. 1998 161:4083). Polypeptide sequences encompassing these regions for IgGl and IgG3 hinges are shown in Table 1. The IgG3 hinge middle region contains, in addition to the two conserved cysteine residues, a 15 amino acid motif that repeats three times. Amino acid sequences from these regions were used to design synthetic IgGl/IgG3 connecting peptides.
  • novel connecting peptides were designed consisting of a serine amino acid residue substituted for the cysteine at positions 239 or 242 combined with either an added proline at position 243 or an added proline, alanine, proline at positions 243, 244, and 245, respectively (Kabat numbering system).
  • Pro243 Ala244Pro245 and Pro 243 connecting peptides were also made.
  • the amino acid sequence ofthe parent CH2 domain deleted humanized CC49 connecting peptide beginning at the first residue ofthe IgGl hinge (position 226, Kabat numbering system) to the last residue ofthe hinge/GlySer connecting peptide is shown in Table 2. Also shown are the various connecting peptide designs by alignment to CC49 with positions ofthe cysteine residues indicated in Kabat numbering system.
  • IgG3 ELKTPLGDTTHT CPRCP (EPKSCDTPPPCPRCP) 3 APELLGGP (SEQ 3D NO:5 ) (SEQ 3D NO:6) (SEQ 3D NO:4)
  • Example 3 Construction of Connecting Polypeptides and Preferential Synthesis of Isoforms
  • Nucleic acid sequences encoding the hinge region connecting peptides shown in Table 2 were introduced into CH2 domain deleted huCC49 gene sequences using the Splicing by Overlap Extension (SOE) method (Horton, R.M. 1993 Methods in Molecular Biology, Vol 15:PCR Protocols: Cunent Methods and applications. Ed. B.A. White). Conect modifications to the hinge region were confirmed by DNA sequence analysis. Plasmid DNA was used to transform CHO DG44 cells for stable production of antibody protein. CH2 domain deleted huCC49 antibodies containing the eight designed synthetic connecting peptides indicated in Table 2 were constructed and antibody produced in CHO DG44 cells.
  • SOE Overlap Extension
  • Supematants were collected from isolated cell lines and concentration of antibody in the culture supematants determined by immunoassay. Supematants containing antibody ranging from 0 to 30 ng of total antibody protein firom each cell line was analyzed by non-reducing SDS-PAGE electrophoresis followed by Western Blot with anti-human kappa 3HRP conjugated antibody to detect CH2 domain deleted huCC49 Form A and Form B isoforms. Under these conditions, Form A migrates as a single 120 kDa homodimer and Form B as a 60 kDa doublet. Also visible are kappa chain monomer and dimers. Connecting peptides shown in SEQ 3D NOs: 8, 9, 14, and 15 were all found to increase the proportion of Form A produced.
  • a connecting peptide ofthe invention comprises a cysteine at at least one of position 239 or 242.
  • connecting peptides which increase the proportion of Form A produced will lead to a beneficial improvement in process, yield and/or stability.
  • These synthetic hinge region connecting peptides are useful for favoring synthesis of CH2 domain deleted antibody Form A isoform for any antibody isotype, e.g., IgGl, IgG2, IgG3, or IgG4, based on the extremely high degree of homology among the CH3 domains for all four human isotypes.
  • IgGl CH3 domain is 98.13% homologous to IgG2 CH3, 97.20% homologous to IgG3 CH3, and 96.26% homologous to IgG4 CH3.
  • Example 4 Purification of Form A and Fomi B from a Monoclonal Antibody Mixture Containing Both Isoforms 10 mL of ddCC49 supernatant was titrated with IM Tris pH 9.0 to a final pH of 7.5. This material was filtered through a series of Sol- Vac 0.8 ⁇ and 0.4 ⁇ membranes. A 100 mL XK50 Protein G column was pre-equilibrated with lxPBS at a flow rate of 80 ml/min. The titrated, filtered supernatant was loaded onto the column at 80 ml/min.
  • Bound protein was washed with the equilibrium buffer for 2 column volumes and then eluted with 100 mM Glycine at pH 3.0. The fractions containing the ddCC49 peak were collected and immediately titrated with 1 M Tris pH 9.0 to a final pH of7.0.
  • a Toso Biosep Phenyl 5PW-HR column was pre-equilibrated with 20 mM Phosphate pH 7.2; 1 M Ammomum Sulfate. The Protein G eluate was titrated to 1 M Ammonium Sulfate using a 3.5 M Ammomum Sulfate pH 7.2 stock and loaded at a concentration of 2 mg/ml of gel bed.
  • Bound protein was washed with a 20mM Phosphate pH 4 or 7.2 Ammonium Sulfate to adjust the conductivity to 116.4 mS/cm.
  • the material eluted from this condition has an apparent molecular weight about 120 kD (Form A) on a non-reducing SDS-PAGE.
  • the remaining bound antibody was further eluted with a linear gradient of reducing Ammonium Sulfate content in the Phosphate buffer. This method separates Forms A and B in two separate peaks. The latter eluted antibody apparently lacks the disulfide linkage between the heavy chains and its molecular weight is about 60 kDa (Form B).
  • Both ofthe above purified materials can be recaptured by bringing the ammonium sulfate concentiation to IM and reloading it onto the cleaned Phenyl 5PW- HR column.
  • Bound protein is eluted with 20mM Phosphate pH 7.2 and dialyzed into 1 x PBS.
  • Example 5 Comparison of Stability of Form A and Form B The biologic activity of Forms A and B (as measured in preliminary experiments e.g., using direct binding or competition studies) revealed that Forms A and B have similar biologic activity. The stability of Forms A and B was also compared. Purified ddCC49 molecules were concentrated to about 5 mg/ml by Amicon concentrator fitted with
  • YM30 membrane (Millipore).
  • the concentrated materials were equally divided into four portions for each isoforms and each fraction was put into 10K dialysis cassette (Pierce, cat# 66410) for 16 h dialysis in the following buffers: 1) 10 mM Sodium Phosphate, pH3; 2) 10 mM Sodium acetate, pH 5; 3) 10 mM Sodium Phosphate, pH 7; and 4) 10 mM Sodium Borate, pH 9.
  • the protein concentiation of each solution was adjusted to 3 mg/ml.
  • a portion of A and B solutions from each pH were mixed to create a mixture containing 50% each isoform.
  • Non-reducing SDS-PAGE was performed on for samples stored at 2-8°C, 20-25°C and 38-42°C for various time points. Both A and B form are relatively stable at pH 5 when stored at 2-8°C. However, when formulated at pH 7 and 9, both A and B forms showed degradation as indicated by increasing in number of bands that were smaller than the original major bands (120 kDa for form A and 60 kDa for form B). It was noticed that, particularly for pH 7 and 9 samples stored at low and intermediate temperatures, the intensity and number of bands that were less than 55 kDa were higher in B-isoform than A. This indicated that under these conditions the A-isoform is more stable than B-isoform.
  • Table 4A through Table 4C list the turbidity data for ddCC49 stored at three different temperatures.
  • the turbidity measures both the soluble and non-soluble aggregates and it is based on the amount of light scattered by these particles. When present, aggregates will scatter light and result in an increase in A 3 o.
  • Table 4A-C the turbidity of ddCC49 molecules stored at 2-8°C increases as pH increased for both A and B isoforms, with the former being less turbid than the latter. This trend held true for samples stored for less than a month at higher temperatures (20- 25°C and 38-40°C). As storage time reached 3 months, the turbidity increased significantly for samples at high pH and temperature, and the difference between A and B forms diminished.
  • Size exclusion chromatography is a powerful method for revealing the percent of intact molecules and the degraded products (both fragments and soluble aggregates) and is highly reproducible.
  • Table 4A-C the percent of intact monomer of A-isoform, B-isoform and the mixture stored at different temperatures are listed.
  • Form A has a higher percentage of monomer as compared to Form B, and the mixture of Form A and Form B was somewhere in between.
  • both forms were relatively stable at pH 3, 5 and 7 (with pH 5 being the most stable condition) for about three months.
  • pH 9 there was a significant decrease in percentage of monomer for Form B but only a slight decrease for Form A.
  • IDEC-159 (ddCC49) is a CH2 domain deleted monoclonal antibody directed against TAG-72 antigen, which is expressed on the surface of tumors.
  • IDEC- 159 contains two isoforms ofthe antibody, called Form A and Form B.
  • the cunent cell culture process for 3DEC-159 produces an approximate 50:50 ratio of Form A to Form B.
  • the Form A isoform is an antibody with a deleted CH2 region in the Fc portion ofthe heavy chain, hi addition to having a deleted CH2 region, Form B also lacks the disulfide bond linkage across the Fc region and is only held together by hydrophobic interactions and salt bridges.
  • the third and final chromatography step in the IDEC- 159 purification process was developed to separate the two isoforms of 3DEC-159.
  • the separation is achieved by hydrophobic interaction chromatography (HIC), using a Phenyl TSKgel 5PW-HR adsorbent. Since form B is more hydrophobic than form A, it adsorbs ineversibly to the stationary phase using approximately 0.73 M Ammonium Sulfate / 20 mM Sodium Phosphate, pH 4.0 - pH 7.0 as the mobile phase. Form A binds to a lesser extent to the stationary phase under these conditions and is therefore eluted isocratically, i.e. it leaves the column with the flowthrough fraction. Subsequent to the isocratic elution of Form A, omitting Ammomum sulfate from the mobile phase desorbs Form B.
  • the following method was used to separate the two isoforms of IDEC-159:
  • HuCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody design was based on appending a huCC49 single chain Fv (scFv) to the carboxyl terminus ofthe HuCC49 CH2 domain-deleted antibody CH3 domain.
  • scFv single chain Fv
  • a schematic diagram of HuCC49 CH2 domain-deleted sc(Fv)2 tetravalent antibody is shown in Figure 4.
  • An equivalent reference to this design is C-scFv Tetravalent CH2 Domain Deleted antibody.
  • the preparation of single polypeptide chain binding molecules ofthe Fv region, single-chain Fv molecules, is described in U.S. Pat. No. 4,946,778.
  • a CC49 scFv immunoglobulin- like antibody is described in U.S. Pat. No. 5,892,019.
  • the huCC49 scFv is comprised of a VL and a VH region sequence tethered by a short synthetic linker (VL - (Gly 4 Ser) 3 linker - VH orientation) and was synthesized by PCR amplification.
  • the 5' VL PCR primer included a Bam HI restriction endonuclease site followed by sequence encoding a (Gly 4 Ser) linker peptide.
  • the 3' VL PCR primer included sequence partially encoding a (Gly 4 Ser) 3 linker peptide used to connect the two VL and VH regions.
  • the 5' VH PCR primer also included sequence partially encoding a (Gly Ser) 3 linker peptide used to connect the VL and VH regions.
  • the 3' VH PCR primer included a stop codon followed by a Bam HI site. The two V regions were amplified with the two sets of PCR primers from plasmid DNA substrate containing huCC49 CH2 domain-deleted antibody and assembly ofthe scFv was accomplished in a second PCR reaction through the common overlapping sequences encoding the (Gly 4 Ser) 3 linker.
  • the huCC49 scFv gene fragment was gel isolated, digested with Bam HI restriction endonuclease and cloned into a single Bam HI site previously introduced into the huCC49 CH2 domain-deleted antibody Polycistronic expression vector. (See US 2003 0157641 Al.). Briefly, the vector was modified by removing an existing stop codon at the 3' end ofthe gene coding for the CH3 domain and replacing with nucleotides coding for the amino acid sequence Ser-Gly-Gly-Gly immediately followed by a Bam HI restriction endonuclease site (coding for Gly-Ser).
  • the Bam HI digested huCC49 scFv fragment was cloned into the Bam HI site ofthe vector resulting in a fusion product ofthe huCC49 scFv to the carboxyl terminus ofthe huCC49 CH2 domain-deleted antibody CH3 domain through a 16 amino acid Ser(Gly 4 Ser) 3 linker.
  • Conect sequences were confirmed by DNA sequence analysis. Plasmid DNA was used to transform CHO DG44 cells for stable production of antibody protein.
  • the engineered antibody was designated huCC49 domain-deleted sc(Fv)2 tetravalent antibody.
  • Figure 8 A shows the DNA sequence of heavy chain huCC49 domain-deleted sc(Fv)2 tetravalent antibody.
  • Figure 8C shows the DNA sequence of light chain huCC49 domain-deleted sc(Fv)2 tetravalent antibody.
  • Figure 9 A shows the amino acid sequence of heavy chain huCC49 domain-deleted sc(Fv)2 tetravalent antibody.
  • Figure 9C shows the amino sequence of light chain huCC49 domain-deleted sc(Fv)2 tetravalent antibody.
  • Supematants were collected from isolated cell lines and concentration of antibody in the culture supematants determined by immunoassay.
  • Supematants were analyzed by non-reducing SDS-PAGE electrophoresis followed by Western Blot with anti-human kappa- HRP conjugated antibody to detect huCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody Form A and Form B isoforms. Under these conditions, Form A was observed to migrate as a single ⁇ 170 kDa homodimer and Form B as a ⁇ 85 kDa doublet in approximately a 50:50 ratio of A to B isoform. As shown in Figure 18, five individually isolated clones were all found to produce an A and B CH2 domain- deleted sc(Fv)2 tetravalent antibody isoform.
  • One ofthe clones was selected for antibody production and purification using HIC chromatography as described in Example 4.
  • Purified huCC49 CH2 domain-deleted sc(Fv)2 tetravalent antibody Forms A and B were analyzed by non-reducing and reducing SDS-PAGE and the results are shown in Figure 19.
  • Form A huCC49 domain-deleted sc(Fv)2 tetravalent antibody was effectively separated from Fomi B in excess of 95% purity.
  • both purified Forms behaved identically under reducing SDS-PAGE conditions.
  • HuCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody Form A was examined by size exclusion chromatography and found to elute primarily as a single peak (96%) indicating that there was no significant aggregation or decomposition of antibody product ( Figure 20).
  • Example 9 Biodistribution Profile of HuCC49 CH2 Domain-Deleted Tetiavalent Antibody.
  • HuCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody Form A was ⁇ tested in a competitive binding assay for it's ability to bind to bovine submaxillary mucine, a source ofthe TAG-72 antigen, by time-resolved flourometric immunoassay using a Delphia fluorimeter (Wallac Inc., Gaithersburg, MD).
  • Competitive binding curves are shown in Figure 21.
  • HuCC49 CH2 domain-deleted sc(Fv)2 tetravalent antibody Form A and contiol parent CH2 domain-deleted huCC49 (refened to as HuCC49 or 3DEC 159) antibodies were evaluated.
  • Relative binding activity for the tetiavalent antibody was found to be 5-fold more avid than the contiol parent CC49 antibody (GraphPad Prism 4.0 for Windows, GraphPad, Software, San Diego California USA. www, graphpad.com), consistent with an expected increase in the number of antigen binding sites. Biodistribution of 90 Y- radiolabeled huCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody was compared to results previously generated with control parent huCC49 antibody in athymic nude mice bearing LS-174T human tumor xenografts.
  • HuCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody was conjugated with the chelator Chx-DTPA and binding activity assessed. Conjugated huCC49 CH2 domain-deleted sc(Fv)2 tetravalent antibody showed a 5-6 fold higher avidity than the conjugated contiol parent huCC49 demonstrating that the tetravalent antibody could be derivatized without losing significant binding activity.
  • HuCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody was labeled with 90 Y and a single dose of radiolabeled antibody was administered by i.v. tail vein injection to mice presenting pre-established tumors of approximately 250 mm 3 . Samples were harvested and processed for beta counting. Percentage injected dose (%3D) of 90 Y radiolabeled antibody per gram of tumor or normal tissue was determined from 3 to 72 hours and is shown in Table 6.
  • FIG. 35 A figure showing tumor retention for contiol parent huCC49 and huCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody as measured by %3D/gm is shown in Figure 35.
  • Figure 35 also shows the same tumor retention data normalized to peak accumulation of radioactivity.
  • AUC analysis ofthe two normalized retention curves in Figure 35 was calculated using GraphPad Prism 4.0 for Windows, GraphPad, Software, San Diego California USA. www. graphpad.com.
  • Control parent huCC49 had a Total Peak Area of 2037 units and huCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody had a Total Peak Area of 2562 units representing a 25.8% increase in area for the tetravalent protein. Representation of the data in this format suggests that there is improved retention of tetravalent antibody in the tumor compartment compared to the parent divalent molecule.
  • the tetrameric HuCC49 constiruct affords certain advantages for pretargeting, e.g., radioimmunotherapeutic (RIT) pretargeting. This advantage is defined by three observations derived from Table 6.
  • the tetrameric HuCC49 CH2 domain-deleted construct has a blood clearance rate comparable to that ofthe current CH2 domain-deleted HuCC49 constiruct.
  • This fast blood clearance may obviate the need for a "clearing agent" to expedite removal ofthe antibody from the blood prior to administration ofthe radiolabeled ligand that localizes to the tumor-bound antibody. Elimination of the clearing agent significantly reduces the complexity of this modality of tieatment in the clinical setting.
  • tumor retention for the tetrameric constiruct is comparable to the cunent dimeric construct. Therefore, radiation dose delivered will be comparable for the two constructs ((Table 6).
  • the lower kidney and liver uptake compared to the CH2 domain-deleted HuCC49 may enable larger input doses ofthe radiolabeled ligand before reaching organ-limiting toxicity.
  • Example 10 Preparation of a HuCC49 CH2 Domain-Deleted Tetravalent Antibody Comprising a Novel Connecting Peptide and Preferential Synthesis of Isoform A
  • gene sequences coding for partial Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide was synthesized by PCR amplification using a 5' connecting peptide PCR primer encoding a Sal I restriction endonuclease site and a 3' connecting peptide PCR primer encoding an Xho I site. Plasmid DNA containing the gene sequence coding for the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide was used as substrate. The PCR product encodes all of Gl/G3/Pro243Ala244Pro245 and part of [Gly/Ser] connecting peptide.
  • the Gl/G3/Pro243Ala244Pro245 hinge fragment was gel isolated, digested with Sal I and Xho I restriction endonucleases and cloned into the Sal I and Xho I vector sites reconstituting the full length Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide.
  • Conect sequences were confirmed by DNA sequence analysis. Plasmid DNA was used to transform CHO DG44 cells for stable production of antibody protein.
  • Figure 8B shows the DNA sequence of heavy chain huCC49 domain-deleted sc(Fv)2 tetravalent antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide.
  • Figure 8C shows the DNA sequence of light chain huCC49 domain-deleted sc(Fv)2 tetravalent antibody containing the Gl/G3/Pro243 Ala244Pro245 + [Gly/Ser] connecting peptide.
  • Figure 9B shows the amino acid sequence of heavy chain huCC49 domain-deleted sc(Fv)2 tetiavalent antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide.
  • Figure 9C shows the amino sequence of light chain huCC49 domain-deleted sc(Fv)2 tetravalent antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide.
  • Supematants were collected from isolated cell lines and concentiation of antibody in the culture supematants determined by immunoassay.
  • Supematants were analyzed by non-reducing SDS-PAGE electrophoresis followed by Western Blot with anti-IgG- HRP conjugated antibody to detect huCC49 CH2 domain-deleted sc(Fv)2 tetravalent (C-scFv tetravalent CH2 domain-deleted) antibody Form A and Form B isoforms. Under these conditions, Form A is expected to migrate as a single ⁇ 170 kDa homodimer and Form B as a ⁇ 85 kDa doublet in approximately a 50:50 ratio of A to B isoform.
  • HuCC49 CH2 domain- deleted sc(Fv)2 tetiavalent antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] (SEQ 3D NO:9) connecting peptide was purified using only the Protein G column, eluted essentially as a single peak at 96% purity without further HIC purification. Reduced and non-reduced purified protein samples were analyzed by SDS- PAGE electrophoresis. Under non-reducing conditions, Form A is expected to migrate as a single 170 kDa homodimer and Form B as a 85 kDa doublet. The connecting peptide shown in SEQ 3D NO: 9 was found to substantially increase the proportion of Form A produced.
  • HuCC49 CH2 domain-deleted sc(Fv)2 tetiavalent Gl/G3/Pro243Ala244Pro245 antibody was examined by size exclusion chromatography and found to essentially elute as a single peak containing 84% monomer. The fraction containing the residual aggregates was removed by preparative size exclusion chromatography with the resulting preparation containing essentially 95% monomer ( Figure 24)
  • HuCC49 CH2 domain-deleted sc(Fv)2 tetiavalent Gl/G3/Pro243Ala244Pro245 antibody was tested in a competitive binding assay for it's ability to bind to bovine submaxillary mucine, a source ofthe TAG-72 antigen, by time-resolved flourometric immunoassay using a Delphia fluorimeter (Wallac Inc., Gaithersburg, MD).
  • Competitive binding curves are shown in Figure 25.
  • HuCC49 CH2 domain-deleted sc(Fv)2 tetravalent antibody Fomi A and contiol parent CH2 domain-deleted huCC49 (refened to as HuCC49 or IDEC 159) antibodies were evaluated.
  • huCC49 minibody and a huCC49 2 sc(Fv)2 tetiavalent antibody were both constructed.
  • huCC49 2 sc(Fv)2 tetiavalent antibody (N-scFv tetiavalent minibody) design was based on inserting a huCC49 single chain Fv (scFv) between the carboxyl end ofthe first scFv domain and the amino-end ofthe hinge connecting peptide in the huCC49 minibody.
  • the preparation of single polypeptide chain binding molecules ofthe Fv region, single- chain Fv molecules, is described in U.S.
  • a CC49 scFv immunoglobulin-like antibody is described in U.S. Pat. No. 5,892,019.
  • the preparation of a mimbody constiruct is described in U.S. Pat. No. 5,837,821.
  • the huCC49 scFv is comprised of a VL and a VH region sequence tethered by a short synthetic linker (VL ⁇ (Gly 4 Ser) 3 linker ⁇ VH orientation) and was synthesized by PCR amplification and used to constiruct a huCC49 minibody.
  • the mimbody vector was modified by adding a modified (Gly 4 Ser) 5 linker to the carboxyl end ofthe amino-terminal scFv domain ofthe huCC49 minibody by PCR amplification, replacing nucleotides coding for the last two amino acids residues ofthe linker with an Nhe I restriction endonuclease site.
  • a second huCC49 scFv was amplified using PCR from plasmid DNA substrate containing huCC49 scFv gene with the 5' VL PCR primer encoding an Nhe I restriction endonuclease site and the 3' VH PCR primer encoding a Sal I site.
  • the huCC49 scFv fragment was gel isolated, digested with Nhe I and Sal I restriction endonucleases and cloned into Nhe I and Sal I sites between the first scFv and the hinge connecting peptide. This results in a fusion product consisting of a leader peptide to two serial huCC49 scFvs to a hinge connecting peptide to a CH3 domain.
  • Conect sequences were confirmed by DNA sequence analysis. Plasmid DNA was used to transform CHO DG44 cells for stable production of antibody protein.
  • Figure 10A shows the DNA sequence of huCC49 tetravalent (N-scFv tetiavalent) mimbody gene.
  • Figure 11A shows the amino acid sequence of huCC49 tetiavalent (N-scFv tetravalent) minibody. Supematants were collected from isolated cell lines and concentration of antibody in the culture supematants determined by immunoassay.
  • huCC49 minibody Form A is expected to migrate as a single ⁇ 82 kDa homodimer and half molecules or Form B as a ⁇ 41 kDa doublet.
  • HuCC49 2 sc(Fv)2 tetiavalent minibody Form A is expected to migrate as a single ⁇ 138 kDa homodimer and Form B as a ⁇ 69 kDa doublet in approximately a 50:50 ratio of A to B isoform.
  • huCC49 CH2 domain deleted antibody (expected to migrate as a single ⁇ 120 kDa homodimer and Form B as a ⁇ 60 kDa doublet in approximately a 50:50 ratio of A to B isoform) was used as control.
  • representative isolated minibody and 2 sc(Fv)2 tetiavalent mimbody clones were found to secrete both A and B isoforms consistent with the expected molecular masses under both non-reducing and reducing SDS-PAGE conditions.
  • gene sequences coding for partial Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide was synthesized by PCR amplification using a 5' connecting peptide PCR primer encoding a Sal I restriction endonuclease site and a 3' connecting peptide PCR primer encoding an Xho I site. Plasmid DNA containing the gene sequence coding for the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide was used as substrate. The PCR product encodes all of Gl/G3/Pro243Ala244Pro245 and part of [Gly/Ser] connecting peptide.
  • the Gl/G3/Pro243 Ala244Pro245 hinge fragment was gel isolated, digested with Sal I and Xho I restriction endonucleases and cloned into the Sal I and Xho I vector sites reconstituting the full length Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide.
  • Conect sequences were confirmed by DNA sequence analysis. Plasmid DNA was used to tiansform CHO DG44 cells for stable production of antibody protein.
  • Figure 10B shows the DNA sequence of huCC492 sc(Fv)2 tetiavalent antibody (N-scFv tetiavalent minibody) gene containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide.
  • Figure 1 IB shows the amino acid sequence of huCC49 2 sc(Fv)2 tetravalent antibody (N-scFv tetiavalent mimbody) gene containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide.
  • Supematants were collected from isolated cell lines and concentration of antibody in the culture supematants determined by immunoassay.
  • Supematants were analyzed by non-reducing SDS-PAGE electrophoresis followed by Western Blot with anti-IgG- HRP conjugated antibody to anti-IgG- HRP conjugated antibody to detect huCC49 2 sc(Fv)2 tetiavalent minibody (N-scFv tetiavalent minibody) Form A and Form B isoforms.
  • huCC492 sc(Fv)2 tetravalent minibody Form A is expected to migrate as a single ⁇ 138 kDa homodimer and Form B as a ⁇ 69 kDa doublet in approximately a 50:50 ratio of A to B isoform.
  • huCC492 sc(Fv)2 tetiavalent mimbody lacks a CHI domain, protein cannot be purified using Protein G chromatography. Antibody was subsequently purified using a combination of anion exchange, hydrophobic interaction, and size exclusion chromatography methods.
  • HuCC49 2 sc(Fv)2 tetravalent minibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] (SEQ 3D NO:9) connecting peptide was purified essentially as a single peak at 97.6 % purity. Reduced and non-reduced purified protein samples were analyzed by SDS-PAGE electrophoresis.
  • Form A is expected to migrate as a single -138 kDa homodimer and Form B as a -69 kDa doublet.
  • the connecting peptide shown in SEQ ID NO: 9 was found to substantially increase the proportion of Form A produced. Exemplary results are shown in Figure 28.
  • Purified huCC49 2 sc(Fv)2 tetravalent Gl/G3/Pro243Ala244Pro245 minibody was examined by size exclusion chromatography and found to essentially elute as a single peak containing 97.6% monomer (Figure 29).
  • Purified huCC49 2 sc(Fv)2 tetiavalent Gl/G3/Pro243Ala244Pro245 mimbody was tested in a competitive binding assay for it's ability to bind to bovine submaxillary mucine, a source ofthe TAG-72 antigen, by time-resolved flourometric immunoassay using a Delphia fluorimeter (Wallac Inc., Gaithersburg, MD).
  • PRIMATIZED® p5E8Gl is a chimeric macaque/human (PRIMATIZED®) monoclonal antibody containing macaque heavy and light variable regions fused to human gamma 1 and kappa constant regions, respectively.
  • PRIMATIZED® p5E8Gl binds to human CD23, the low affinity receptor for IgE (Fc ⁇ RII) (Mavromatis and Cheson. 2003. J. Clin. Oncol. 21:1874; US Patent Application 20030059424).
  • the PRIMATIZED® ⁇ 5E8 scFv used for constructing the sc(Fv)2 tetiavalent antibody is comprised of a p5E8 VL and a VH region sequence tethered by a short synthetic linker in the VL -» (Gly 4 Ser) 3 linker -> VH orientation and is described in greater detail in Example 12 .
  • Conect sequences were confirmed by DNA sequence analysis. Plasmid DNA was used to tiansform CHO DG44 cells for stable production of antibody protein.
  • Figure 12A shows the DNA sequence of heavy chain CH2 domain-deleted PRIMATIZED® p5E8 sc(Fv)2 tetravalent antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide.
  • Figure 12B shows the DNA sequence of light chain CH2 domain-deleted PRIMATIZED® p5E8 sc(Fv)2 tetiavalent antibody.
  • Figure 13 A shows the amino acid sequence of heavy chain CH2 domain-deleted PRIMATIZED® p5E8 sc(Fv)2 tetiavalent antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide.
  • Figure 13B shows the amino sequence of light chain CH2 domain-deleted PRIMATIZED® p5E8 sc(Fv)2 tetravalent antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide.
  • Supernatant was collected from a stably transfected cell line and concentiation of antibody in the culture supernatant determined by immunoassay.
  • Minibodies are single chain polypeptides consisting of an scFv fused to immunoglobulin hinge region and CH3 domain.
  • the preparation of minibody single polypeptide chain binding molecules is described in U.S. Pat. No. 5,837,821.
  • the cysteine residue at position 230 in the hinge region forms a covalent disulfide bond with the carboxyl-terminal light chain constant domain cysteine residue at position 214, joining heavy and light chain polypeptides (Kabat numbering system).
  • the light chain constant domain is absent, eliminating one ofthe two cysteines that participate in forming the disulfide bond.
  • the single remaining cysteine in the hinge region at position 230 has been proposed to participate in a homotypic interchain disulfide bond possibly contributing to hinge region structure and therefore was left in place.
  • Minibodies which lack a CH2 domain, are secreted from cells and accumulate in culture supernatant as a mixture containing Form A and Form B isoforms and perhaps unassembled half molecules as shown in Figure 32. The ratio of these forms is highly variable and presents a challenge for preparing a reproducibly pure product.
  • the absence ofthe immunoglobulin CH1/CL domains precludes isolation of total minibody using Protein G immunoaffinity matrices.
  • the unassembled half molecules (MW - 40-45 kD) can be separated from the homodimers (MW ⁇ 80-90 kD) using a number of chromatographic strategies
  • the remaining intact A and B isoforms cannot be efficiently separated from one another using techmques such as HIC chromatography (described herein) also due to the absence of CH1/CL domains.
  • HIC chromatography described herein
  • These isoforms also cannot be separated by size exclusion chromatography because the molecular masses ofthe two isoforms are nearly identical, prohibiting separation based on this characteristic.
  • the composition of minibody preparations may actually be complex, consisting of a mixture of A and B isoforms.
  • PPJMATIZED® p5E8 minibodies engineered to contain the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide indicated in Table 2 (SEQ 3D NO: 9) was examined.
  • PPJMATIZED® ⁇ 5E8 scFvs were constructed by PCR amplification. ScFvs were built in both orientations (VL ⁇ (Gly Ser) 3 linker ⁇ VH (VL/VH) and VH - (Gly Ser) 3 linker -» VL (VH/VL)). Oligonucleotides used in the construction are shown the tables below: Table 7.
  • PCR primers used to constiruct CH2 domain-deleted PRIMATIZED® p5E8 VL/VH minibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide.
  • SEQ 3D NO:37 the BspLUl 1 1 restriction endonuclease site is underlined.
  • SEQ 3D NO:40 the Sal I restriction endonuclease site is underlined.
  • N-23-VH-2R (SEQ 3D NO:40) 5 '- AGAGAGGTCGACTGAGGAGACGGTGACCAGGAC-3 '
  • N-23-VL-2R (SEQ 3D NO:44) 5'- AGAGAGGTCGACTTTGATTTCCACCTTGGTCC-3
  • the VL/VH scFv was constructed in two steps.
  • the 5' VL PCR forward primer N-23VL- IF (SEQ 3D NO:37) included a BspLUl 1 1 restriction endonuclease site to permit joining ofthe scFv to the immunoglobulin signal peptide in the expression vector.
  • the 3' VL PCR reverse primer 23-VL-1R (SEQ 3D NO:38) included sequence partially encoding the (Gly 4 Ser) 3 linker peptide used to join the VL and VH regions.
  • the 5' forward VH PCR primer 23-VH-2F (SEQ 3D NO:30) also included sequence partially encoding a (Gly Ser) 3 linker peptide used to connect the VL and VH regions and the 3' VH PCR reverse primer N-23-VH-2R (SEQ 3D NO:40) included a Sal I restriction endonuclease site to join the scFv to the hinge region.
  • the two V regions were amplified with the two sets of PCR primers from plasmid DNA substrate contaimng
  • PRIMATIZED® p5E8Gl antibody and assembly ofthe scFv was accomplished in a second PCR reaction through the common overlapping sequences encoding the (Gly 4 Ser) 3 linker.
  • the PRIMATIZED® ⁇ 5E8 scFv gene fragment was gel isolated, digested with BspLUl 1 1 and Sal I restriction endonucleases and cloned into the BspLUl 1 1 and Sal I double-digested CH2 domain-deleted antibody Polycistronic expression vector contaming the Gl/G3/Pro243 Ala244Pro245 + [Gly/Ser] connecting peptide.
  • the PRIMATIZED® p5E8 VH/VL scFv was constructed in a similar manner using PCR primer pairs N-23VH-1F (SEQ JD NO:41) and 23-VH-1R (SEQ 3D NO:36) and 23-VL-2F (SEQ 3D NO:43) and N-23-VL-2R (SEQ 3D NO:44) shown in Tables 7 and 8. Conect sequences of both completed constructs were confirmed by DNA sequence analysis. Plasmid DNA was used to tiansform CHO DG44 cells for transient production of antibody protein.
  • Figure 14 shows the DNA sequence of CH2 domain- deleted PRIMATIZED® p5E8 VL/VH mimbody containing the
  • FIG. 15 shows the DNA sequence of CH2 domain-deleted PRIMATIZED® p5E8 VH/VL mimbody containing the Gl/G3/Pro243 Ala244Pro245 + [Gly/Ser] connecting peptide in the VH -» VL orientation (VH/VL).
  • Figure 16 shows the amino acid sequence of CH2 domain-deleted PRIMATIZED® p5E8 VL/VH minibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide.
  • Figure 17 shows the amino acid sequence of CH2 domain-deleted PRIMATIZED® p5E8 VH7VL minibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide.
  • Supernatant was collected from the transfected cell lines and concentiation of antibody in the culture supernatant determined by immunoassay.
  • Minibody molecules present in culture supernatant were analyzed for binding to soluble CD23 antigen immobilized on plastic microtiter plates by ELISA.
  • Results shown in Figure 33 demonstrate that both PRIMATIZED® p5E8 VH/VL and VL/VH minibodies containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide are equally capable of binding to the CD23 antigen in a dose-responsive manner.
  • Supematants were analyzed by non-reducing SDS-PAGE electrophoresis followed by Western Blot with anti-human IgG- HRP conjugated antibody to detect Form A and Form B isoforms of CH2 domain-deleted PRIMATIZED® p5E8 minibodies containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide.
  • Form A is expected to migrate as a single -80-90 kDa homodimer and Form B as a -40-45 kDa doublet.
  • the connecting peptide shown in SEQ 3D NO: 9 was found to substantially increase the proportion of Form A for both minibodies produced.
  • Exemplary results are shown in Figure 34. These results show that the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide (SEQ 3D NO:9) resulted in the production of essentially all Form A CH2 domain-deleted PPJMATIZED® ⁇ 5E8 mimbody with no detectable Form B.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Diabetes (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • Pulmonology (AREA)
  • Endocrinology (AREA)
  • Dermatology (AREA)
  • Oncology (AREA)
  • Neurology (AREA)
  • Cardiology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Communicable Diseases (AREA)
  • Reproductive Health (AREA)
  • Obesity (AREA)
  • Urology & Nephrology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Cell Biology (AREA)
  • Vascular Medicine (AREA)
  • Biomedical Technology (AREA)
  • Neurosurgery (AREA)

Abstract

The instant invention describes methods of separating or preferentially synthesizing dimers which are linked via at least one interchain disulfide linkage from dimers which are not linked via at least one interchain disulfide linkage from a mixture comprising the two types of polypeptide dimers. These forms can be separated from each other using hydrophobic interaction chromatography. In addition, the invention pertains to connecting peptides that result in the preferential biosynthesis of dimers that are linked via at least one interchain disulfide linkage or that are not linked via at least one interchain disulfide linkage. The invention also pertains to compositions in which a majority of the dimers are linked via at least one interchain disulfide linkage or are not linked via at least one interchain disulfide linkage. The invention still further pertains to novel binding molecules, e.g., comprising; connecting peptides of the invention.

Description

MODIFIED BINDING MOLECULES COMPRISING CONNECTING PEPTIDES
Related Applications This application claims priority to USSN 60/483877, titled "Purification and
Preferential Synthesis of Polypeptides," filed on June 27, 2003 and to USSN
60/508,810, titled "Purification and Preferential Synthesis of Antigen Binding
Polypeptides," filed October 3, 2003. This application also claims priority to USSN 60/515,351, titled "Modified Antibody Molecules Comprising Connecting Peptides," October 28, 2003 and to USSN 60/516,030, titled "Modified Antibody Molecules Comprising Connecting Peptides," filed October 30, 2003. This application is also related to USSN XX/XXXXXX, titled "Purification and preferential synthesis of Binding Polypeptides" filed on June 28, 2004. The contents of these applications are incorporated in their entirety by this reference.
Background ofthe Invention Antibodies are dimeric molecules; each monomer making up the dimer comprises one light and one heavy chain. Solutions of antibody molecules exist in two forms associated with hinge heterogeneity. Using SDS-PAGE analysis of purified Mab MAb, typically the two forms are observed as two protein bands, a major band (MW approximately 150-160 kDa) and a minor band (MW approximately 75-80 kDa). This latter form is typically observed after SDS-PAGE analysis of purified IgG4 preparations, but can be identified at much lower frequencies in all IgG isotypes, including purified, recombinant MAbs (Angal et al. 1993. Mol. Immunol. 30:105; Norderhaug et al. 1990. Eur. J. Immunol. 21:2370). The larger molecular weight isoform, referred to as Form A, contains covalent interchain disulfide bonds at positions corresponding to 239 and 242, Kabat numbering system (positions 226 and 229, EU numbering system) (Kabat, E, Wu, TT, Perry, HM, Gottesman, KS, Foeller, C: Sequences of Proteins of Immunological Interest. Bethesda, US Department of Health and Human Services, NIH, 1991). The second isoform, Form B, is thought to contain no covalent linkages between the two heavy chains and an intrachain disulfide bond between the two neighboring cysteine residues as evidenced by the 75-80 kDa seen in non-reducing SDS-PAGE electrophoresis. The two heavy chains of Form B are presumably held together by strong non-covalent (e.g., ionic) interactions associated with the CH3 domain region of the molecule. These mixtures of A and B forms are not present in solutions of MAb fragments that contain an intact hinge, but lack a CH3 domain, such as, for example, F(ab)2 fragments. Typically, genetically engineered or enzymatically digested F(ab)2 MAb preparations lack the B-form, since the molecule lacks the necessary domains for maintaining non-covalent interactions (e.g., hydrogen bonding). However, they are present in MAb preparations that do contain a CH3 domain, such as IgG4, CH2 domain deleted MAb fragments (e.g., as described in 02/060955 A2) and minibodies (see, e.g., Hu et al. 1996. Cancer Research 56:3055). l The application of protein engineering techniques to therapeutic antibody design has also produced a number of antibody formats that have been shown to have altered, and in some cases, improved pharmacodynamic, biodistribution, and activity profiles. Some altered antibody molecules have been made in which the number of cysteine residues in the hinge region is reduced to one to facilitate assembly of antibody molecules as it is only necessary to form a single disulfide bond. This also provides a specific target for attaching the hinge region either to another hinge region or to an effector or reporter molecule (U.S. Patent 5,677,425). The number of cysteine residues in the antibody hinge has also been increased (U.S. Patent 5,677,425). Other mutated antibodies have been constructed in which the IgGl hinge region and the CH2 domain have been replaced with the human IgG3 hinge region. (WO 97/11370). These molecules contain 11 sulfhydryl groups for substitution of multiple haptens via thiol groups. CH2 domain deleted antibodies have a molecular mass of approximately 120 kDa and have been shown to penetrate tumors significantly better than full length IgG. Minibodies, which also have deletion ofthe CH2 domain, have similar characteristics. These domain deleted molecules accumulate at tumor sites more efficiently than other MAb fragments, such as F(ab)'2s, but without the unfavorable pharmacodynamic profiles seen with intact IgG antibody. CH2 domain deleted antibodies consist of a VLCL light chain and a VH1 heavy chain domain and a portion ofthe hinge region (e.g., the upper and middle hinge) genetically fused (either directly or through a modified peptide spacer) to a CH3 domain. As an example, the biosynthesis of recombinant CH2 domain deleted ddCC49, a domain deleted antibody that recognizes the tumor associated TAG72 antigen expressed on a variety of human carcinomas, produces the A and B isoforms in approximately 50:50 distribution in cell cultures. Cells engineered to express alternative forms of CH2 domain deleted antibodies, for example, tetravalent CH2 domain deleted antibodies, minibodies, or tetravalent minibodies also express a mixture consisting of A and B isoforms and/or monomeric half-mer molecules. Form A and Form B are extremely difficult to separate even after MAb purification, since they are composed of identical amino acids and, therefore, have identical molecular weight and similar physical and chemical properties. They cannot be separated by standard gel filtration, affinity chromatography, or ion exchange chromatography typically used to purify antibody molecules, including recombinant MAb proteins. Current manufacturing processes discard at least 50% ofthe total antibody produced, having a negative impact on overall yield. Moreover, the presence ofthe two isoforms increases efforts required for downstream processing. Thus, a method of separating forms A and B or of increasing biosynthesis of one or the other form of antibody would be of great benefit.
Summary ofthe Invention The invention is based, at least in part, on the finding that in a composition comprising a mixture of dimeric polypeptide molecules comprising different isoforms (molecules comprising two heavy chain portions in which a fraction ofthe molecules comprise two heavy chain portions that are linked via at least one interchain disulfide linkage (Form A) and a portion ofthe molecules comprise two heavy chain portions that are not linked via at least one interchain disulfide linkage (Form B)) one form or the other can be preferentially obtained, e.g., by separation using hydrophobic interaction chromatography or by inclusion of synthetic connecting peptides which result in the preferential biosynthesis of either Form A or Form B. In one embodiment, the binding molecules ofthe invention are tetravalent. The connecting peptides ofthe invention can be included in any dimeric molecule that tends to form both Form A and Form B, e.g., antibody molecules, domain deleted antibody molecules (e.g., lacking all or part of a CH2 domain), minibodies, diabodies, fusion proteins, etc. In a preferred embodiment, the formation of Form A is enhanced. In another embodiment, the invention pertains to a composition comprising polypeptide dimers comprising at least four binding sites and at least two polypeptide chains, wherein said at least two polypeptide chains comprise at least one heavy chain portion and a synthetic connecting peptide, and wherein greater than about 50% ofthe dimers are linked via at least one interchain disulfide linkage. In another embodiment, greater than about 90% ofthe dimers are linked via at least one interchain disulfide linkage. In another embodiment, at least one ofthe polypeptide chains comprises a CH3 domain linked to a VL, VH or CHI domain via the connecting peptide. In another embodiment, the polypeptide chains lack all or part of a CH2 domain. In another embodiment, the dimers are linked via two or more interchain disulfide linkages. In another embodiment, the heavy chain portion is derived from an antibody of an isotype selected from the group consisting of: IgGl, IgG2, IgG3, and IgG4. In another embodiment, the heavy chain portion comprises an amino acid sequence derived from a hinge region selected from the group consisting of: a γl hinge, a γ 2 hinge, a γ 3 hinge, and a γ 4 hinge. In another embodiment, the molecules are bispecific. In another embodiment, the molecules comprise at least one binding site specific for a soluble ligand. In another embodiment, the molecules comprise at least one binding site specific for a cell surface molecule. In another embodiment, the molecules comprise two binding sites specific for a tumor cell antigen and two binding sites specific for a prodrug. In another embodiment, the binding sites specific for the prodrug are catalytic. In another embodiment, the synthetic connecting peptide comprises a proline residue at position 243, Kabat numbering system. In another embodiment, the synthetic connecting peptide further comprises an alanine residue at position 244 and a proline residue at position 245, Kabat numbering system. In another embodiment, the heavy chain portion comprises a chimeric hinge. In another embodiment, the synthetic connecting peptide comprises at least a portion of an IgGl hinge domain, at least a portion of an IgG3 hinge domain. In another embodiment, the connecting peptide comprises an amino acid sequence selected from the group consisting of: SEQ ID NOs: 8-15 and 48. In a second aspect, the invention provides a method of treating a subject that would benefit from treatment with an antigen binding molecule comprising administering to the subject a composition comprising a mixture of dimeric polypeptide molecules comprising different isoforms, wherein one isoform or the other is preferentially obtained, such that treatment occurs. In one embodiment, the subject is suffering from cancer. In another embodiment, the subject is suffering from lymphoma. In another embodiment, the subject is suffering from an autoimmune disease or disorder. In another embodiment, the subject is suffering from an inflammatory disease or disorder. In a third aspect, the invention provides a nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide molecule comprising different isoforms (molecules comprising two heavy chain portions in which a fraction ofthe molecules comprise two heavy chain portions that are linked via at least one interchain disulfide linkage (Form A) and a portion ofthe molecules comprise two heavy chain portions that are not linked via at least one interchain disulfide linkage (Form B)) such that one form or the other can be preferentially obtained. In one embodiment, the polypeptide dimers comprise four polypeptide chains and wherein two ofthe polypeptide chains comprise at least one heavy chain portion and a synthetic connecting peptide. In another embodiment, the nucleic acid molecule comprises a nucleotide sequence shown in Figure 8B (SEQ ID NO: 17). In another embodiment, the nucleic acid molecule comprises a nucleotide sequence shown in Figure 8C (SEQ ID NO: 18). In another embodiment, the nucleic acid molecule comprises a nucleotide sequence shown in Figure 10B (SEQ ID NO: 23). In another embodiment, the nucleic acid molecule comprises a nucleotide sequence shown in Figure 12A (SEQ ID NO:26). In another embodiment, the nucleic acid molecule comprises a nucleotide sequence shown in Figure 12B (SEQ JD NO:27). In another embodiment, the nucleic acid molecule comprises a nucleotide sequence shown in Figure 14 (SEQ ID NO:30). hi another embodiment, the nucleic acid molecule comprises a nucleotide sequence shown in Figure 15 (SEQ ID NO:31). In another embodiment, the nucleic acid molecule is in a vector. In still another embodiment, the vector is in a host cell. In a fourth aspect, the invention provides binding molecules comprising an amino acid sequence encoding a polypeptide molecule comprising different isoforms (molecules comprising two heavy chain portions in which a fraction ofthe molecules comprise two heavy chain portions that are linked via at least one interchain disulfide linkage (Form A) and a portion ofthe molecules comprise two heavy chain portions that are not linked via at least one interchain disulfide linkage (Form B)) such that one form or the other can be preferentially obtained. hi one embodiment, the binding molecule comprises the amino acid sequence of Figure 9B (SEQ ID NO: 20). In another embodiment, the binding molecule comprises the amino acid sequence of Figure 9C (SEQ ID NO: 21). In another embodiment, the binding molecule comprises the amino acid sequence of Figure 11B (SEQ ID NO: 25). In another embodiment, the binding molecule comprises the amino acid sequence of Figure 13 A (SEQ ID NO: 28). In another embodiment, the binding molecule comprises the amino acid sequence of Figure 13B (SEQ ID NO: 29). In another embodiment, the binding molecule comprises the amino acid sequence of Figure 16 (SEQ ID NO: 32). In another embodiment, the binding molecule comprises the amino acid sequence of Figure 17 (SEQ ID NO: 33). In a fifth aspect, the invention provides a composition comprising a mixture of dimeric polypeptide molecules comprising different isoforms (molecules comprising two heavy chain portions in which a fraction ofthe molecules comprise two heavy chain portions that are linked via at least one interchain disulfide linkage (Form A) and a portion ofthe molecules comprise two heavy chain portions that are not linked via at least one interchain disulfide linkage (Form B)) one form or the other can be preferentially obtained, and wherein said binding sites are individually selected from the group consisting of: an antigen binding site, a ligand binding portion of a receptor, and a receptor binding portion of a ligand. In one embodiment, the polypeptide chains have at least one binding site derived from an antibody selected from the group consisting of: 2B8, Lym 1, Lym 2, LL2, Her2, Bl, MB1, BH3, B4, B72.3, CC49, 5E8, B3F6, and 5E10. In another embodiment, the polypeptide dimers are tetravalent minibody molecules. In another embodiment, the polypeptide dimers are tetravalent domain deleted antibody molecules. In another embodiment, the polypeptide dimers are diabodies. In a sixth aspect, the invention provides a composition comprising minibody molecules comprising two polypeptide chains, wherein the polypeptide chains comprise a heavy chain portion and a synthetic connecting peptide, wherein the polypeptide chains lack all or part of a CH2 domain, and wherein greater than about 50% ofthe molecules are present in a form in which one ofthe polypeptide chains are linked via at least one interchain disulfide linkage. In one embodiment, greater than about 90% ofthe dimers are linked via at least one interchain disulfide linkage. In another embodiment, at least one ofthe polypeptide chains comprises a CH3 domain genetically fused to a VL, VH or CHI domain via the connecting peptide. In another embodiment, the polypeptide chains lack the entire CH2 domain. In another embodiment, the dimers are linked via two or more interchain disulfide linkages. In another embodiment, the heavy chain portion is derived from an antibody of an isotype selected from the group consisting of: IgGl, IgG2, IgG3, and IgG4. In another embodiment, the heavy chain portion comprises an amino acid sequence is derived firom a hinge region selected from the group consisting of: a γl hinge, a γ 2 hinge a γ 3 hinge, and a γ 4 hinge. In another embodiment, the binding sites are individually selected from the group consisting of: an antigen binding site, a ligand binding portion of a receptor, and a receptor binding portion of a ligand. In another embodiment, the molecules are bispecific. In another embodiment, the connecting peptide comprises a proline residue at position 243, Kabat numbering system. In another embodiment, the synthetic connecting peptide comprises a chimeric hinge. In another embodiment, the synthetic connecting peptide comprises at least a portion of an IgGl hinge domain, at least a portion of an IgG3 hinge domain. In a seventh aspect, the invention provides a method of treating a subject that would benefit from treatment with an antigen binding molecule comprising admimstering to the subject a composition comprising minibody molecules comprising two polypeptide chains, wherein the polypeptide chains comprise a heavy chain portion and a synthetic connecting peptide, wherein the polypeptide chains lack all or part of a CH2 domain, and wherein greater than about 50% ofthe molecules are present in a form in which one ofthe polypeptide chains are linked via at least one interchain disulfide linkage, such that treatment occurs. In another aspect, the invention provides a nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide chain comprising a heavy chain portion and a synthetic connecting peptide, wherein the polypeptide chains lack all or part of a CH2 domain, and wherein greater than about 50% ofthe molecules are present in a form in which one ofthe polypeptide chains are linked via at least one interchain disulfide linkage. hi still another aspect, the invention provides a composition comprising polypeptide dimers having at least four binding sites and at least two polypeptide chains, wherein said at least two polypeptide chains comprise at least one heavy chain portion and lacks all or part of a CH2 domain, wherein greater than 50% ofthe polypeptide dimers are linked via at least one interchain disulfide linkage.
Brief Description ofthe Drawings
Figure 1 shows Form A which appears as a 120kDa dimer and Form B which appears as a 60kDa monomer in domain deleted antibodies.
Figure 2 shows a schematic diagram of an exemplary two chain dimeric minibody and an exemplary two chain dimeric tetravalent minibody each comprising a hinge connecting peptide (HCP). Other configurations are also possible, for example, the two chain dimeric tetravalent minibody comprising a connecting peptide (HCP) can also be constructed to be bispecific. In another embodiment, the orientation ofthe VH and VL domains in the scFv may be changed.
Figure 3 shows a schematic diagram of a four chain dimeric diabody comprising a hinge connecting peptide (HCP). The four chain dimeric diabody comprising a hinge connecting peptide (HCP) can also be constructed to be bispecific. The orientation ofthe VH and VL domains may be changed.
Figure 4 shows a schematic diagram of a four chain dimeric tetravalent scFv antibody (C-scFv tetravalent antibody) and a four chain tetravalent scFv CH2 domain deleted antibody (C-scFv tetravalent CH2 domain deleted antibody) each comprising a scFv appended to the carboxyl terminus of CH3 and a hinge connecting peptide. The orientation ofthe VH and VL domains in the scFv may be changed.
Figure 5 shows a schematic diagram of a four chain dimeric CH2 domain deleted tetravalent (N -SCFV CH2 domain deleted tetravalent) antibody comprising a hinge connecting peptide (HCP). The four chain dimeric CH2 domain deleted tetravalent antibody comprising a connecting peptide (HCP) can also be constructed to be bispecific. The orientation ofthe VH and VL domains in the scFv appended to the light chain may be changed. Figure 6 shows a schematic diagram of a four chain dimeric CH2 domain deleted tetiavalent (NH-SCFV CH2 domain deleted tetravalent) antibody comprising a hinge connecting peptide (HCP). The four chain dimeric CH2 domain deleted tetravalent antibody comprising a connecting peptide (HCP) can also be constructed to be bispecific. The orientation ofthe VH and VL domains in the scFv appended to the heavy chain may be changed.
Figure 7 shows a schematic diagram of a two chain dimeric tetravalent minibody (C- scFv tetravalent minibody) comprising a hinge connecting peptide (HCP). The two chain dimeric tetravalent minibody comprising a connecting peptide (HCP) can also be constructed to be bispecific. The orientation ofthe VH and VL domains in both scFvs may be changed.
Figure 8 A (SEQ ID NO: 16) shows the single-stranded DNA sequence of heavy chain CH2 domain-deleted sc(Fv)2 tetravalent (C-scFv tetiavalent CH2 domain deleted) huCC49 gene. Figure 8B (SEQ ID NO: 17) shows the single-stranded DNA sequence of heavy chain tetravalent CH2 domain-deleted sc(Fv)2 tetravalent (C-scFv tetravalent CH2 domain deleted) huCC49 gene containing the synthetic
Gl/G3:/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide. Figure 8C (SEQ ID NO: 18) shows the single-stranded DNA sequence of light chain CH2 domain- deleted sc(Fv)2 tetravalent (C-scFv tetravalent CH2 domain deleted) huCC49.
Figure 9A (SEQ ID NO: 19) shows the amino acid sequence of heavy chainCH2 domain-deleted sc(Fv)2 tetravalent (C-scFv tetravalent CH2 domain deleted) huCC49. Figure 9B (SEQ ID NO:20) shows the amino acid sequence of heavy chain CH2 domain-deleted sc(Fv)2 tetravalent (C-scFv tetravalent CH2 domain deleted) huCC49 containing the synthetic Gl/G3/Pro243 Ala244Pro245 + [Gly/Ser] hinge connecting peptide. Figure 9C (SEQ ID NO:21) shows the amino acid sequence of light chain CH2 domain-deleted sc(Fv)2 tetravalent (C-scFv tetiavalent CH2 domain deleted) huCC49
Figure 10A (SEQ ID NO:22) shows the single-stranded DNA sequence of CH2 domain- deleted huCC49 tetravalent (N- scFv tetravalent) minibody gene. Figure 10B (SEQ ID NO:23) shows the single-stranded DNA sequence of tetiavalent CH2 domain-deleted (N- scFv tetiavalent) huCC49 tetravalent minibody gene containing the synthetic Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
Figure 11 A (SEQ ID NO:24) shows the amino acid sequence of tetravalent CH2 domain-deleted (N- scFv tetravalent) huCC49 minibody. Figure 1 IB (SEQ ID NO:25) shows the amino acid sequence of tetravalent CH2 domain-deleted (N- scFv tetravalent) huCC49 minibody containing the synthetic G1/G3/ Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
Figure 12A (SEQ ID NO:26) shows the single-stranded DNA sequence of heavy chain tetravalent CH2 domain-deleted PRLMATIZED® ρ5E8 sc(Fv)2 (C-scFv tetravalent CH2 domain deleted) antibody gene containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
Figure 12B (SEQ ID NO:27) shows the single-stranded DNA sequence of light chain tetravalent CH2 domain-deleted (C-scFv tetravalent CH2 domain deleted) PRIMATIZED® p5E8 sc(Fv)2 gene.
Figure 13A (SEQ ID NO:28) shows the amino acid sequence of heavy chain tetravalent CH2 domain-deleted (C-scFv tetravalent CH2 domain deleted) PRIMATIZED® p5E8 sc(Fv)2 antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
Figure 13B (SEQ ID NO:29) shows the amino acid sequence of light chain tetravalent
CH2 domain-deleted (C-scFv tetravalent CH2 domain deleted) PRIMATIZED® p5E8 sc(Fv)2 antibody .
Figure 14 (SEQ ID NO: 30) shows the single-stranded DNA sequence of CH2 domain- deleted PRIMATIZED® p5E8 VL/VH minibody gene containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
Figure 15 (SEQ ID NO:31) shows the single-stranded DNA sequence of CH2 domain- deleted PRIMATIZED® p5E8 VH/VL minibody gene containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
Figure 16 (SEQ ID NO: 32) shows the amino acid sequence of CH2 domain-deleted PRIMATIZED® p5E8 VL/VH minibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
Figure 17 (SEQ ID NO:33) shows the amino acid sequence of CH2 domain-deleted PRIMATIZED® p5E8 VH/VL minibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide. Figure 18 shows a Western Blot of supematants from five independent clones producing huCC49 domain-deleted sc(Fv)2 tetravalent (C-scFv tetiavalent CH2 domain deleted) antibody. Each supernatant was electiophoresed under both reducing and non-reducing conditions.
Figure 19 shows a Coomassie Blue stained gel of purified Forms A and B huCC49 domain-deleted sc(Fv)2 tetiavalent (C-scFv tetiavalent CH2 domain deleted) antibodies. Each antibody was electiophoresed under reducing and non-reducing conditions.
Figure 20 shows that purified Form A huCC49 domain-deleted sc(Fv)2 tetiavalent (C- scFv tetravalent CH2 domain deleted) antibody predominantly elutes as a single peak by HPLC size-exclusion chromatography.
Figure 21 shows the results of a competitive binding assay of Form A huCC49 domain- deleted sc(Fv)2 tetravalent (C-scFv tetravalent CH2 domain deleted) antibody to bovine submaxillary mucine, a source ofthe TAG-72 antigen, by time-resolved fluorometic immunoassay using a Delphia fluorimeter (Wallac Inc, Gaithersburg, MD).
Figure 22 shows a Western Blot of supernatant from a representative clone producing huCC49 CH2 domain-deleted sc(Fv)2 tetiavalent (C-scFv tetiavalent CH2 domain deleted) antibody containing the Gl/G3/Pro243 Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
Figure 23 shows a Coomassie Blue stained gel of purified Form A huCC49 CH2 domain-deleted sc(Fv)2 tetiavalent G1/G3/PAP (C-scFv tetravalent CH2 domain deleted) antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
Figure 24 shows that purified Form A huCC49 CH2 domain-deleted sc(Fv)2 tetravalent G1/G3/PAP (C-scFv tetiavalent CH2 domain deleted) antibody containing the
Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide predominantly elutes as a single peak by HPLC size-exclusion chromatography.
Figure 25 shows the results of a competitive binding assay of Form A huCC49 CH2 domain-deleted sc(Fv)2 tetiavalent G1/G3/PAP (C-scFv tetravalent CH2 domain deleted) antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide to bovine submaxillary mucine, a source ofthe TAG-72 antigen, by time-resolved fluorometic immunoassay using a Delphia fluorimeter (Wallac Inc, Gaithersburg, MD).
Figure 26 shows Western Blots of supematants from representative clones producing huCC49 minibody, huCC49 2 sc(Fv)2 tetravalent antibody (N-scFv tetiavalent huCC49 minibody), and huCC49 CH2 domain deleted antibody. A Western Blot was performed on supematants that were electiophoresed under reducing and non-reducing conditions.
Figure 27 shows a Western Blot of supematants from representative clones producing huCC49 2 sc(Fv)2 tetravalent antibody (N-scFv tetiavalent huCC49 mimbody) and huCC49 2 sc(Fv)2 tetiavalent antibody (N-scFv tetiavalent huCC49 minibody) containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
Figure 28 shows a Coomassie Blue stained gel of purified Form A huCC49 domain- deleted sc(Fv)2 tetravalent antibody (N-scFv tetiavalent mimbody) containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
Figure 29 shows purified Form A huCC49 domain-deleted sc(Fv)2 tetiavalent antibody (N-scFv tetravalent minibody) containing the Gl/G3/Pro243 Ala244Pro245 + [Gly/Ser] hinge connecting peptide predominantly elutes as a single peak by HPLC size-exclusion chromatography.
Figure 30 shows the results of a competitive binding assay of huCC49 domain-deleted sc(Fv)2 tetravalent antibody (N-scFv tetiavalent minibody) containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide, huCC49 mimbody, huCC49 CH2 domain-deleted sc(Fv)2 tetravalent antibody (C-scFv tetiavalent antibody) containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide, and contiol parent CH2 domain-deleted huCC49 (referred to as HuCC49 or IDEC 159) to bovine submaxillary mucine, a source ofthe TAG-72 antigen, by time-resolved fluorometic immunoassay using a Delphia fluorimeter (Wallac Inc, Gaithersburg, MD).
Figure 31 shows a Western Blot of supernatant from a cell line producing tetravalent CH2 domain-deleted (C-scFv tetravalent CH2 domain deleted) PRIMATIZED® p5E8 sc(Fv)2 antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide.
Figure 32 shows a Western Blot of supematants from five independent cell lines producing CH2 domain-deleted huCC49 VL/VH minibody. Minibody samples were analyzed under non-reducing, denaturing conditions revealing the presence of Form A and Form B isoforms.
Figure 33 show the results of an ELISA binding assay of PRΓMATLZED® p5E8 VH/VL and VL/VH minibodies containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide binding to the CD23 antigen. p5E8Gl is intact full length PRIMATIZED® IgGl.
Figure 34 shows a Western Blot of supernatant from cell lines producing PRIMATIZED® p5E8 VH/VL and VL/VH minibodies containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide.
Figure 35 A shows tumor retention for control parent huCC49 and huCC49 CH2 domain-deleted sc(Fv)2 tetravalent antibody as measured by %ID/gm. Figure 35 B shows the same tumor retention data normalized to peak antibody accumulation.
Detailed Description ofthe Invention Human immunoglobulins (Igs), including monoclonal antibodies (MAbs), can exist in two forms that are associated with hinge heterogeneity. In native solutions, both of these forms are present as dimeric proteins (each monomer comprising one heavy chain and one light chain). One immunoglobulin molecule comprises a stable four chain construct of approximately 150-160 kDa in which the dimers are held together by an interchain heavy chain disulfide bond (Form A) and one comprises form in which the dimers are not linked via interchain disulfide bonds (Form B). Form B also fomis a stable dimer under native conditions, but can be identified under denaturing, non-reducing conditions, in which the heavy chains dissociate yielding a 75-80 kDa molecule. These forms have been extremely difficult to separate, even after MAb affinity purification. The frequency of appearance ofthe B form in various intact IgG isotypes is due to, but not limited to, structural differences associated with the hinge region isotype ofthe MAb molecule. In fact, a single amino acid substitution in the hinge region ofthe human IgG4 hinge can significantly reduce the appearance ofthe B form (Angal et al. 1993. Molecular hnmunology 30:105) to levels typically observed using a human IgGl hinge. However, applying this same amino acid substitution to MAb fragments in which the CH3 domain was retained did not eliminate Form B from preparations. Typically, all recombinant CH2 domain deleted antibodies produced in cell cultures often result in hinge heterogeneity which is not corrected via similar molecular mutations in the hinge. The instant invention advances the state ofthe art by providing methods of, e.g., separating a first dimeric polypeptide from a second dimeric polypeptide wherein the first and second polypeptides comprise at least two polypeptide chains and at least two ofthe polypeptide chains comprise at least one heavy chain portion. In one embodiment, the polypeptides of the invention lack all or part of a CH2 domain. The monomers are linked via at least one interchain disulfide linkage (referred to herein as "Form A") and the monomers ofthe second polypeptide are not linked via at least one interchain disulfide linkage (referred to herein as "Form B"). These forms can be separated from each other using hydrophobic interaction chromatography. In addition, the invention pertains to polypeptides that comprise connecting peptides. The inclusion of certain connecting peptides results in the preferential biosynthesis of polypeptide dimers comprising polypeptide chains that are linked via at least one interchain disulfide linkage or that are not linked via at least one interchain disulfide linkage. Before further description ofthe invention, for convenience, certain terms are described below:
I. Definitions The polypeptides ofthe invention are binding molecules, i.e., polypeptide molecules or the nucleic acid molecules that encode them, that comprise at least one binding domain which comprises a binding site that specifically binds to a target molecule (such as an antigen or binding partner). For example, in one embodiment, a binding molecule ofthe invention comprises an immunoglobulin antigen binding site or the portion of a receptor molecule responsible for ligand binding or the portion of a ligand molecule that is responsible for receptor binding. The binding molecules ofthe invention are polypeptides or the nucleic acid molecules which encode them. In one embodiment, the binding molecules comprise at least two binding sites, hi one embodiment, the binding molecules comprise two binding sites. In one embodiment, the binding molecules comprise three binding sites. In another embodiment, the binding molecules comprise four binding sites. The polypeptides ofthe invention are multimers. For example, in one embodiment, the polypeptides ofthe invention are dimers. In one embodiment, the dimers ofthe invention are homodimers, comprising two identical monomeric subunits. hi another embodiment, the dimers ofthe invention are heterodimers, comprising two non-identical monomeric subunits. The subunits ofthe dimer may comprise one or more polypeptide chains. For example, in one embodiment, the dimers comprise at least two polypeptide chains. In one embodiment, the dimers comprise two polypeptide chains. In another embodiment, the dimers comprise four polypeptide chains (e.g., as in the case of antibody molecules). The polypeptides ofthe invention comprise at least one amino acid sequence derived from an immunoglobulin domain. A polypeptide or amino acid sequence "derived from" a designated protein refers to the origin ofthe polypeptide. Preferably, the polypeptide or aniino acid sequence which is derived from a particular starting polypeptide or amino acid sequence has an amino acid sequence that is essentially identical to that ofthe starting sequence, or a portion thereof wherein the portion consists of at least 10-20 amino acids, preferably at least 20-30 amino acids, more preferably at least 30-50 amino acids, or which is otherwise identifiable to one of ordinary skill in the art as having its origin in the starting sequence. Preferred binding polypeptides comprise an amino acid sequence derived from a human aniino acid sequence. However, binding polypeptides may comprise one or more amino acids from another mammalian species. For example, a primate heavy chain portion, hinge portion, or binding site may be included in the subj ect binding polypeptides and/or connecting polypeptides. Alternatively, one or more murine amino acids may be present in a binding polypeptide, e.g., in an antigen binding site of a binding molecule. Preferred binding molecules ofthe invention are not immunogenic. It will also be understood by one of ordinary skill in the art that the binding molecules ofthe invention (e.g., the heavy chain or light chain portions or binding portions ofthe subject polypeptides) may be modified such that they vary in amino acid sequence from the naturally occurring immunoglobulin molecule from which they were derived. For example, nucleotide or amino acid substitutions leading to conservative substitutions or changes at "non-essential" amino acid residues may be made. An isolated nucleic acid molecule encoding a non-natural variant of a polypeptide derived from an immunoglobulin (e.g., an immunoglobulin heavy chain portion or light chain portion) can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence ofthe immunoglobulin such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations may be introduced by standard techniques, such as site- directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more non-essential amino acid residues. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a nonessential amino acid residue in an immunoglobulin polypeptide is preferably replaced with another amino acid residue from the same side chain family. In another embodiment, a string of amino acids can be replaced with a structurally similar string that differs in order and/or composition of side chain family members. Alternatively, in another embodiment, mutations may be introduced randomly along all or part ofthe immunoglobulin coding sequence, such as by saturation mutagenesis, and the resultant mutants can be incoφorated into polypeptides ofthe invention and screened for their ability to bind to the desired antigen. As used herein, the term "heavy chain portion" includes aniino acid sequences derived from an immunoglobulin heavy chain. A polypeptide comprising a heavy chain portion comprises at least one of: a CHI domain, a hinge (e.g., upper, middle, and/or lower hinge region) domain, a CH2 domain, a CH3 domain, or a variant or fragment thereof. In one embodiment, a polypeptide ofthe invention comprises a polypeptide chain comprising a CHI domain, at least a portion of a hinge domain, and a CH2 domain. In another embodiment, a polypeptide ofthe invention comprises a polypeptide chain comprising a CHI domain and a CH3 domain, hi another embodiment, a polypeptide ofthe invention comprises a polypeptide chain comprising a CHI domain, at least a portion of a hinge domain, and a CH3 domain. In another embodiment, a polypeptide ofthe invention comprises a polypeptide chain comprising a CH3 domain. In one embodiment, a polypeptide ofthe invention lacks at least a portion of a CH2 domain (e.g., all or part of a CH2 domain). In another embodiment, a polypeptide ofthe invention comprises a complete lg heavy chain. As set forth above, it will be understood by one of ordinary skill in the art that these domains (e.g., the heavy chain portions) may be modified such that they vary in amino acid sequence from the naturally occurring immunoglobulin molecule. hi one embodiment, at least two ofthe polypeptide chains of a binding molecule ofthe invention comprise at least one heavy chain portion derived from an antibody or immunoglobulin molecule, hi one embodiment, at least two heavy chain portions of a polypeptide ofthe invention are present on different polypeptide chains and interact, e.g., via at least one disulfide linkage (Form A) or via non-covalent interactions (Form B) to form a dimeric polypeptide, each monomer ofthe dimer comprising at least one heavy chain portion. In one embodiment, the heavy chain portions of one polypeptide chain of a dimer are identical to those on a second polypeptide chain ofthe dimer. In one embodiment, the monomers (or half-mers) of a dimer ofthe invention are identical to each other. In another embodiment, they are not identical. For example, each monomer may comprise a different target binding site. In one embodiment, a dimer ofthe invention is held together by covalent interactions, e.g., disulfide bonds. In one embodiment, a dimer ofthe invention is held together by one or more disulfide bonds. In another embodiment, a dimer ofthe invention is held together by one or more, preferably two disulfide bonds. In another embodiment, a dimer ofthe invention is held together by one or more, preferably three disulfide bonds. In another embodiment, a dimer ofthe invention is held together by one or more, preferably four disulfide bonds. In another embodiment, a dimer ofthe invention is held together by one or more, preferably five disulfide bonds. In another embodiment a dimer ofthe invention is held together by one or more, preferably six disulfide bonds, hi another embodiment, a dimer ofthe invention is held together by one or more, preferably seven disulfide bonds. In another embodiment, a dimer ofthe invention is held together by one or more, preferably eight disulfide bonds. In another embodiment, a dimer ofthe invention is held together by one or more, preferably nine disulfide bonds. In another embodiment, a dimer ofthe invention is held together by one or more, preferably ten disulfide bonds, hi a further embodiment, a dimer ofthe invention is not held together by disulfide bonds, but is held together, e.g., by non- covalent interactions. The heavy chain portions of a polypeptide may be derived from different immunoglobulin molecules. For example, a heavy chain portion of a polypeptide may comprise a CHI domain derived from an IgGl molecule and a hinge region derived from an IgG3 molecule. In another example, a heavy chain portion can comprise a hinge region derived, in part, from an IgGl molecule and, in part, from an IgG3 molecule. In another example, a heavy chain portion can comprise a chimeric hinge derived, in part, from an IgGl molecule and, in part, from an IgG4 molecule. As used herein, the term "light chain portion" includes amino acid sequences derived from an immunoglobulin light chain. Preferably, the light chain portion comprises at least one of a VL or CL domain. In one embodiment a polypeptide ofthe invention comprises an amino acid sequence or one or more moieties not derived from an lg molecule. Exemplary modifications are described in more detail below. For example, in one embodiment, a polypeptide ofthe invention may comprise a flexible linker sequence. In another embodiment, a polypeptide may be modified to add a functional moiety (e.g., PEG, a drug, or a label). In one embodiment, a binding polypeptide ofthe invention is a fusion protein. Fusion proteins are chimeric molecules which comprise a binding domain comprising at least one target binding site and at least one heavy chain portion, hi one embodiment, a fusion protein further comprises a synthetic connecting peptide. A "chimeric" protein comprises a first amino acid sequence linked to a second amino acid sequence with which it is not naturally linked in nature. The amino acid sequences may normally exist in separate proteins that are brought together in the fusion polypeptide or they may normally exist in the same protein but are placed in a new arrangement in the fusion polypeptide. A chimeric protein may be created, for example, by chemical synthesis, or by creating and translating a polynucleotide in which the peptide regions are encoded in the desired relationship. Exemplary chimeric polypeptides include fusion proteins and the chimeric hinge connecting peptides ofthe invention. The term "heterologous" as applied to a polynucleotide or a polypeptide, means that the polynucleotide or polypeptide is derived from a genotypically distinct entity from that ofthe rest ofthe entity to which it is being compared. For instance, a heterologous polynucleotide or antigen may be derived from a different species origin, different cell type, or the same type of cell of distinct individuals. The term "ligand binding domain" or "ligand binding portion of a receptor" as used herein refers to any native receptor (e.g., cell surface receptor) or any region or derivative thereof retaining at least a qualitative ligand binding ability, and preferably the biological activity of a corresponding native receptor. The term "receptor binding domain" or "receptor binding portion of a ligand" as used herein refers to any native ligand or any region or derivative thereof retaining at least a qualitative receptor binding ability, and preferably the biological activity of a conesponding native ligand. hi one embodiment, a binding molecule ofthe invention is a fusion protein. A fusion protein ofthe invention is a chimeric molecule that comprises a binding domain (which comprises at least one binding site) and a dimerization domain (which comprises at least one heavy chain portion). The heavy chain portion may be from any immunoglobulin, such as IgGl, IgG2, IgG3, or IgG4 subtypes, IgA, IgE, IgD orlgM. In another embodiment ofthe invention, a binding molecule is an "antibody-fusion protein chimera." Such molecules comprise a molecule which combines at least one binding domain of an antibody with at least one fusion protein. Preferably, the interface between the two polypeptides is a CH3 domain of an immunoglobulin molecule. hi one embodiment, the binding molecules ofthe invention are "antibody" or "immunoglobulin" molecules, e.g., naturally occurring antibody or immunoglobulin molecules or genetically engineered antibody molecules that bind antigen in a manner similar to antibody molecules. As used herein, the term "immunoglobulin" includes a polypeptide having a combination of two heavy and two light chains whether or not it possesses any relevant specific immunoreactivity. "Antibodies" refers to such assemblies which have significant known specific immunoreactive activity to an antigen of interest (e.g. a tumor associated antigen). Antibodies and immunoglobulins comprise light and heavy chains, with or without an interchain covalent linkage between them. Basic immunoglobulin structures in vertebrate systems are relatively well understood. As will be discussed in more detail below, the generic term "immunoglobulin" comprises five distinct classes of antibody that can be distinguished biochemically. All five classes of antibodies are clearly within the scope ofthe present invention, the following discussion will generally be directed to the IgG class of immunoglobulin molecules. With regard to IgG, immunoglobulins comprise two identical light polypeptide chains of molecular weight approximately 23,000 Daltons, and two identical heavy chains of molecular weight 53,000-70,000. The four chains are joined by disulfide bonds in a "Y" configuration wherein the light chains bracket the heavy chains starting at the mouth ofthe "Y" and continuing through the variable region. Both the light and heavy chains are divided into regions of structural and functional homology. The terms "constant" and "variable" are used functionally. In this regard, it will be appreciated that the variable domains of both the light (VL) and heavy (VH) chain portions determine antigen recognition and specificity. Conversely, the constant domains ofthe light chain (CL) and the heavy chain (CHI, CH2 or CH3) confer important biological properties such as secretion, tiansplacental mobility, Fc receptor binding, complement binding, and the like. By convention the numbering of the constant region domains increases as they become more distal from the antigen binding site or amino-terminus ofthe antibody. The N-terminus is a variable region and at the C-terminus is a constant region; the CH3 and CL domains actually comprise the carboxy-terminus ofthe heavy and light chain, respectively. Light chains are classified as either kappa or lambda (K, λ). Each heavy chain class may be bound with either a kappa or lambda light chain, hi general, the light and heavy chains are covalently bonded to each other, and the "tail" portions ofthe two heavy chains are bonded to each other by covalent disulfide linkages or non-covalent linkages when the immunoglobulins are generated either by hybridomas, B cells or genetically engineered host cells. In the heavy chain, the amino acid sequences run from an N-terminus at the forked ends ofthe Y configuration to the C-terminus at the bottom of each chain. Those skilled in the art will appreciate that heavy chains are classified as gamma, mu, alpha, delta, or epsilon, (γ, μ, α, δ, ε) with some subclasses among them (e.g., γl- γ 4). It is the nature of this chain that determines the "class" ofthe antibody as IgG, IgM, IgA IgG, or IgE, respectively. The immunoglobulin subclasses (isotypes) e.g., IgG IgG2, IgG3, IgG , IgAi, etc. are well characterized and are known to confer functional specialization. Modified versions of each of these classes and isotypes are readily discernable to the skilled artisan in view ofthe instant disclosure and, accordingly, are within the scope ofthe instant invention. As indicated above, the variable region allows the antibody to selectively recognize and specifically bind epitopes on antigens. That is, the V domain and VH domain of an antibody combine to form the variable region that defines a three dimensional antigen binding site. This quaternary antibody structure forms the antigen binding site present at the end of each arm ofthe Y. More specifically, the antigen binding site is defined by three complementary determining regions (CDRs) on each of the VH and VL chains. As used herein, the term "binding site" or "binding domain" comprises a region of a polypeptide which is responsible for selectively binding to a target molecule of interest (e.g. an antigen, ligand, receptor, substrate or inhibitor). Exemplary binding domains include an antibody variable domain, a receptor binding domain of a ligand, a ligand binding domain of a receptor or an enzymatic domain. hi one embodiment, the binding molecules have at least one binding site specific for a molecule targeted for reduction or elimination, e.g., a cell surface antigen or a soluble antigen. In preferred embodiments, the binding domain is an antigen binding site. An antigen binding site is formed by variable regions that vary from one polypeptide to another. The polypeptides ofthe invention comprise at least two antigen binding sites. As used herein, the term "antigen binding site" includes a site that specifically binds (immunoreacts with) an antigen (e.g., a cell surface or soluble antigen). The antigen binding site includes an immunoglobulin heavy chain and light chain variable region and the binding site formed by these variable regions determines the specificity ofthe antibody. In one embodiment, an antigen binding molecule ofthe invention comprises at least one heavy or light chain CDR of an antibody molecule (e.g., the sequence of which is known in the art or described herein). In another embodiment, an antigen binding molecule ofthe invention comprises at least two CDRs from one or more antibody molecules. In another embodiment, an antigen binding molecule ofthe invention comprises at least three CDRs from one or more antibody molecules. In another embodiment, an antigen binding molecule ofthe invention comprises at least four CDRs from one or more antibody molecules. In another embodiment, an antigen binding molecule ofthe invention comprises at least five CDRs from one or more antibody molecules. In another embodiment, an antigen binding molecule ofthe invention comprises at least six CDRs from one or more antibody molecules. Exemplary antibody molecules comprising at least one CDR that can be included in the subject antigen binding molecules are known in the art and exemplary molecules are described herein. The polypeptides comprising two heavy chain portions disclosed herein may be linked to form two associated Ys so there will be four binding sites forming a "tetravalent" molecule (see e.g., WO02/096948A2)). In another embodiment, tetravalent minibodies or domain deleted antibodies can be made. The term "specificity" includes the number of potential binding sites which specifically bind (e.g., immunoreact with) a given target. A polypeptide may be monospecific and contain one or more binding sites which specifically bind a target or a polypeptide may be multispecific and contain two or more binding sites which specifically bind the same or different targets. hi one embodiment, a binding molecule ofthe invention is a bispecific molecule (e.g., antibody, mimbody, domain deleted antibody, or fusion protein having binding specificity for more than one molecule, e.g., more than one antigen or more than one epitope on the same antigen. In one embodiment, the bispecific molecules have at least one target binding site specific for a molecule targeted for reduction or elimination and a targeting molecule on a cell. In another embodiment, the bispecific molecules have at least one target binding site specific for a molecule targeted for reduction or elimination and at least one target binding site specific for a drug. In yet another embodiment, the bispecific molecules have at least one target binding site specific for a molecule targeted for reduction or elimination and at least one target binding site specific for a prodrug. In a preferred embodiment, the bispecific molecules are tetravalent antibodies that have two target binding sites specific for one target and two target binding sites specific for the second target. A tetravalent bispecific molecule may be bivalent for each specificity. Further description of bispecific molecules is provided below. As used herein the term "valency" refers to the number of potential target binding sites in a polypeptide. Each target binding site specifically binds one target molecule or specific site on a target molecule. When a polypeptide comprises more than one target binding site, each target binding site may specifically bind the same or different molecules (e.g., may bind to different ligands or different antigens, or different epitopes on the same antigen). hi naturally occurring antibodies, the six CDRs present on each monomeric antibody are short, non-contiguous sequences of aniino acids that are specifically positioned to form the antigen binding site as the antibody assumes its three dimensional configuration in an aqueous environment. The remainder ofthe heavy and light variable domains show less inter-molecular variability in amino acid sequence and are termed the framework regions. The framework regions largely adopt a β-sheet conformation and the CDRs form loops which connect, and in some cases form part of, the β-sheet stiucture. Thus, these framework regions act to form a scaffold that provides for positioning the six CDRs in correct orientation by inter-chain, non-covalent interactions. The antigen binding site formed by the positioned CDRs defines a surface complementary to the epitope on the immunoreactive antigen. This complementary surface promotes the non-covalent binding ofthe antibody to the immunoreactive antigen epitope. The position of CDRs can be readily identified by one of ordinary skill in the art. As previously indicated, the subunit structures and three dimensional configuration ofthe constant regions of he various immunoglobulin classes are well known. As used herein, the term "VH domain" includes the amino terminal variable domain of an immunoglobulin heavy chain and the term "CHI domain" includes the first (most amino terminal) constant region domain of an immunoglobulin heavy chain. The CHI domain is adjacent to the VH domain and is amino terminal to the hinge region of an immunoglobulin heavy chain molecule. As used herein the term "CH2 domain" includes the portion of a heavy chain molecule that extends, e.g., from about residue 244 to residue 360 of an antibody using conventional numbering schemes (residues 244 to 360, Kabat numbering system; and residues 231-340, EU numbering system,; and Kabat EA et al. Sequences of Proteins of Immunological Interest. Bethesda, US Department of Health and Human Services, NJJL 1991). The CH2 domain is unique in that it is not closely paired with another domain. Rather, two N-linked branched carbohydrate chains are interposed between the two CH2 domains of an intact native IgG molecule. It is also well documented that the CH3 domain extends from the CH2 domain to the C-terminal ofthe IgG molecule and comprises approximately 108 residues. As used herein, the term "hinge region" includes the portion of a heavy chain molecule that joins the CHI domain to the CH2 domain. This hinge region comprises approximately 25 residues and is flexible, thus allowing the two N-terminal antigen binding regions to move independently. Hinge regions can be subdivided into three distinct domains: upper, middle, and lower hinge domains (Roux et al. J. Immunol. 1998 161:4083). In one embodiment, a binding molecule ofthe invention comprises a connecting peptide. The connecting peptides ofthe invention are synthetic. As used herein the term "synthetic" with respect to polypeptides includes polypeptides which comprise an amino acid sequence that is not naturally occurring. For example, non- naturally occurring polypeptides which are modified forms of naturally occurring polypeptides (e.g., comprising a mutation such as an addition, substitution or deletion) or which comprise a first amino acid sequence (which may or may not be naturally occurring) that is linked in a linear sequence of amino acids to a second amino acid sequence (which may or may not be naturally occurring) to which it is not naturally linked in nature. Connecting peptides ofthe invention connect two domains (e.g., a binding domain and a dimerization domain) of a binding molecule ofthe invention. For example, connecting peptides connect a heavy chain portion to a binding domain comprising a binding site. In one embodiment, a connecting peptide connects two heavy chain constant region domains, such as CHI and CH2 domains; CHI and CH3 domains; hinge and CHI domains; hinge and CH3 domains; VH and hinge domains, or a CH3 domain and a non-immunoglobulin polypeptide) in a linear amino acid sequence of a polypeptide chain. Preferably, such connecting peptides provide flexibility to the polypeptide molecule and facilitate dimerization via disulfide bonding, i one embodiment, the connecting peptides ofthe invention are used to replace one or more heavy chain domains (e.g., at least a portion of a constant region domain (e.g., at least a portion of a CH2 domain) and/or at least a portion ofthe hinge region (e.g., at least a portion ofthe lower hinge region domain) in a domain deleted construct). For example, in one embodiment, a VH domain is fused to a CH3 domain via a connecting peptide (the C-terminus ofthe connecting peptide is attached to the N-terminus ofthe CH3 domain and the N-terminus ofthe connecting peptide is attached to the C-terminus of the VH domain), h another embodiment, a VL domain is fused to a CH3 domain via a connecting peptide (the C-terminus ofthe connecting peptide is attached to the N- terminus ofthe CH3 domain and the N-terminus ofthe connecting peptide is attached to the C-terminus ofthe VL domain, h another embodiment, a CHI domain is fused to a CH3 domain via a connecting peptide (the C-terminus ofthe connecting peptide is attached to the N-terminus ofthe CH3 domain and the N-terminus ofthe connecting peptide is attached to the C-terminus ofthe CHI domain). In one embodiment, a synthetic connecting peptide comprises a portion of a constant region domain. For example, in one embodiment, a connecting peptide that replaces a CH2 domain can comprise a portion ofthe CH2 domain. In one embodiment, a connecting peptide comprises or consists of a gly- ser linker. As used herein, the term "gly-ser linker" refers to a peptide that consists of glycine and serine residues An exemplary gly/ser linker comprises the amino acid sequence GGGSSGGGSG (SEQ ID NO.T). In one embodiment, a connecting peptide of the invention comprises at least a portion of an upper hinge region (e.g., derived from an IgGl, IgG3, or IgG4 molecule), at least a portion of a middle hinge region(e.g., derived from an IgGl, IgG3, or IgG4 molecule) and a series of gly/ser amino acid residues (e.g., a gly/ser linker such as GGGSSGGGSG (SEQ ID NO:l)). In one embodiment, the connecting peptide comprises a substitution of one or more amino acids as compared to naturally occurring IgGl or IgG3 hinge regions. In another embodiment, a connecting peptide comprises an amino acid sequence such as described in WO 02/060955. Connecting peptides are described in more detail below. As used herein the term "disulfide bond" includes the covalent bond formed between two sulfur atoms. The amino acid cysteine comprises a thiol group that can form a disulfide bond or bridge with a second thiol group. In most naturally occurring IgG molecules, the CHI and CL regions are linked by a disulfide bond and the two heavy chains are linked by two disulfide bonds at positions corresponding to 239 and 242 using the Kabat numbering system (position 226 or 229, EU numbering system). It is known in the art that the constant region mediates several effector functions. For example, binding ofthe Cl component of complement to antibodies activates the complement system. Activation of complement is important in the opsonisation and lysis of cell pathogens. The activation of complement also stimulates the inflammatory response and may also be involved in autoimmune hypersensitivity. Further, antibodies bind to cells via the Fc region, with a Fc receptor site on the antibody Fc region binding to a Fc receptor (FcR) on a cell. There are a number of Fc receptors which are specific for different classes of antibody, including IgG (gamma receptors), IgE (epsilon receptors), IgA (alpha receptors) and IgM (mu receptors). Binding of antibody to Fc receptors on cell surfaces triggers a number of important and diverse biological responses including engulfment and destruction of antibody-coated particles, clearance of immune complexes, lysis of antibody-coated target cells by killer cells (called antibody-dependent cell-mediated cytotoxicity, or ADCC), release of inflammatory mediators, placental transfer and control of immunoglobulin production. In one embodiment, the Fc portion may be mutated to decrease effector function using techniques known in the art. For example, the deletion or inactivation (through point mutations or other means) of a constant region domain may reduce Fc receptor binding ofthe circulating modified antibody thereby increasing tumor localization. In other cases it may be that constant region modifications consistent with the instant invention moderate compliment binding and thus reduce the serum half life and nonspecific association of a conjugated cytotoxin. Yet other modifications ofthe constant region may be used to modify disulfide linkages or oligosaccharide moieties that allow for enhanced localization due to increased antigen specificity or antibody flexibility. More generally, those skilled in the art will realize that antibodies modified as described herein may exert a number of subtle effects that may or may not be readily appreciated. However the resulting physiological profile, bioavailability and other biochemical effects ofthe modifications, such as tumor localization, biodistribution and serum half-life, may easily be measured and quantified using well know immunological techniques without undue experimentation. In one embodiment, modified forms of antibodies can be made from a whole precursor or parent antibody using techniques known in the art. Exemplary techniques are discussed in more detail below. In particularly preferred embodiments both the variable and constant regions of polypeptides ofthe invention are human, i one embodiment, fully human antibodies can be made using techniques that are known in the art. For example, fully human antibodies against a specific antigen can be prepared by administering the antigen to a transgenic animal which has been modified to produce such antibodies in response to antigenic challenge, but whose endogenous loci have been disabled. Exemplary techniques that can be used to make antibodies are described in US patents: 6,150,584; 6,458,592; 6,420,140. Other techniques are known in the art. A polypeptide comprising a heavy chain portion may or may not comprise other amino acid sequences or moieties not derived from an immunoglobulin molecule. Such modifications are described in more detail below. For example, in one embodiment, a polypeptide ofthe invention may comprise a flexible linker sequence. In another embodiment, a polypeptide may be modified to add a functional moiety such as PEG. The polypeptides ofthe instant invention comprise at least two binding sites that provide for the association ofthe polypeptide with the selected target molecule, hi one embodiment, a binding molecule ofthe invention comprises an antibody molecule, e.g., an intact antibody molecule, or a fragment of an antibody molecule. In another embodiment, binding molecule ofthe invention is a modified or synthetic antibody molecule. In one embodiment, a binding molecule ofthe invention comprises all or a portion of (e.g., at least one antigen binding site from, at least one CDR from, or at least one heavy chain portion from) a monoclonal antibody, a humanized antibody, a chimeric antibody, or a recombinantly produced antibody. In embodiments where the binding molecule is an antibody or modified antibody, the antigen binding site and the heavy chain portions need not be derived from the same immunoglobulin molecule. In this regard, the variable region may or be derived from any type of animal that can be induced to mount a humoral response and generate immunoglobulins against the desired antigen. As such, the variable region of the polypeptides may be, for example, of mammalian origin e.g., may be human, murine, non-human primate (such as cynomolgus monkeys, macaques, etc.), lupine, camelid (e.g., from camels, llamas and related species), hi another embodiment, the variable region may be condricthoid in origin (e.g., from sharks). Polypeptides ofthe invention can be made using techniques that are known in the art. In one embodiment, the polypeptides ofthe invention are antibody molecules that have been "recombinantly produced," i.e., are produced using recombinant DNA technology. Exemplary techniques for making antibody molecules are discussed in more detail below. In one embodiment, the polypeptides ofthe invention are modified antibodies. As used herein, the term "modified antibody" includes synthetic forms of antibodies which are altered such that they are not naturally occurring, e.g., antibodies that comprise at least two heavy chain portions but not two complete heavy chains (such as, domain deleted antibodies or minibodies); multispecific forms of antibodies (e.g., bispecific, trispecific, etc.) altered to bind to two or more different antigens or to different epitopes on a single antigen); heavy chain molecules joined to scFv molecules and the like. ScFv molecules are known in the art and are described, e.g., in US patent 5,892,019. i addition, the term "modified antibody" includes multivalent forms of antibodies (e.g., trivalent, tetravalent, etc., antibodies that bind to three or more copies of the same antigen). In another embodiment, a binding molecule ofthe invention is a fusion protein comprising at least one heavy chain portion lacking a CH2 domain and comprising a binding domain of a polypeptide comprising the binding portion of one member of a ligand and its receptor. hi one embodiment, the term, "modified antibody" according to the present mvention includes immunoglobulins, antibodies, or immunoreactive fragments or recombinants thereof, in which at least a fraction of one or more ofthe constant region domains has been deleted or otherwise altered so as to provide desired biochemical characteristics such as the ability to non-covalently dimerize, increased ability to localize at the site of a tumor, or reduced serum half-life when compared with a whole, unaltered antibody of approximately the same immunogenicity. In a preferred embodiment, the polypeptides ofthe present invention are domain deleted antibodies which comprise a polypeptide chain similar to an immunoglobulin heavy chain, but which lack at least a portion of one or more heavy chain domains. More preferably, one entire domain ofthe constant region ofthe modified antibody will be deleted and even more preferably all or part ofthe CH2 domain will be deleted. In preferred embodiments, a polypeptide ofthe invention will not elicit a deleterious immune response in a human. Modifications to the constant region compatible with the instant invention comprise additions, deletions or substitutions of one or more amino acids in one or more domains. That is, the polypeptides ofthe invention disclosed herein may comprise alterations or modifications to one or more of the three heavy chain constant domains (CHI, CH2 or CH3) and/or to the light chain constant region domain (CL). In one embodiment, the invention pertains to a modified antibody molecule comprising at least one CC49 binding site (specific for Tag72). For example, Figure 8A (SEQ ID NO:16) shows the single-stranded DNA sequence of sc(Fv)2 heavy chain tetiavalent CH2 domain-deleted huCC49 gene. Figure 8B (SEQ JD NO: 17) shows the single-stranded DNA sequence of sc(Fv)2 heavy chain tetravalent CH2 domain-deleted huCC49 gene containing the synthetic Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide. Figure 8C (SEQ JD NO: 18) shows the single- stranded DNA sequence of sc(Fv)2 light chain CH2 domain-deleted huCC49. Figure 9 A (SEQ ID NO: 19) shows the amino acid sequence of heavy chain sc(Fv)2 tetravalent CH2 domain-deleted huCC49. Figure 9B (SEQ ID NO:20) shows the amino acid sequence of heavy chain tetravalent CH domain-deleted sc(Fv)2 huCC49 containing the synthetic Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide. Figure 9C (SEQ ID NO:21) shows the amino acid sequence of light chain CH2 domain-deleted sc(Fv)2 huCC49. Figure 10A (SEQ JD NO:22) shows the single-stranded DNA sequence of tetiavalent CH2 domain-deleted 2sc(Fv)2 huCC49 minibody gene. Figure 10B (SEQ ID NO:23) shows the single-stranded DNA sequence of tetravalent CH2 domain-deleted sc(Fv)2 huCC49 mimbody gene containing the synthetic Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide. Figure 11 A (SEQ JD NO:24) shows the amino acid sequence of tetravalent CH2 domain-deleted sc(Fv)2 huCC49 mimbody. Figure 1 IB (SEQ ID NO:25) shows the amino acid sequence of tetravalent CH2 domain-deleted sc(Fv)2 huCC49 minibody containing the synthetic Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide. In another embodiment, the invention pertains to a modified antibody molecule comprising at least one p5E8 binding site (specific for CD23). Figure 12A (SEQ JD NO:26) shows the single-stranded DNA sequence of heavy chain tetravalent CH2 domain-deleted PRIMATIZED® p5E8 sc(Fv)2 antibody gene containing the Gl/G3 Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide. Figure 12B (SEQ JD NO:27) shows the single-stranded DNA sequence of light chain tetravalent CH2 domain-deleted PRIMATIZED® ρ5E8 sc(Fv)2 gene. Figure 13A (SEQ ID NO:28) shows the amino acid sequence of heavy chain tetravalent CH2 domain-deleted
PRIMATIZED® p5E8 sc(Fv)2 antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide. Figure 13B (SEQ ID NO:29) shows the amino acid sequence of light chain tetiavalent CH2 domain-deleted PRIMATIZED® p5E8 sc(Fv)2 antibody. Figure 14 (SEQ JD NO:30) shows the single-stranded DNA sequence of CH2 domain-deleted PRIMATIZED® p5E8 VL VH minibody gene contaimng the
Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide. Figure 15 (SEQ ED NO:31) shows the single-stranded DNA sequence of CH2 domain-deleted PRIMATIZED® p5E8 VH/VL minibody gene containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide. Figure 16 (SEQ 3D NO:32) shows the amino acid sequence of CH2 domain-deleted Pl^JMATLZED® ρ5E8 VL/VH minibody containing the Gl/G3 Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide. Figure 17 (SEQ ID NO:33) shows the amino acid sequence of CH2 domain-deleted PRIMATIZED® p5E8 VH/VL minibody containing the Gl/G3 Pro243Ala244Pro245 + [Gly/Ser] hinge connecting peptide. In one embodiment, the polypeptides ofthe invention may be modified to reduce their immunogenicity using art-recognized techniques. For example, antibodies or polypeptides ofthe invention can be humanized, deimmunized, or chimeric antibodies can be made. These types of antibodies are derived from a non-human antibody, typically a murine antibody, that retains or substantially retains the antigen-binding properties ofthe parent antibody, but which is less immunogenic in humans. This may be achieved by various methods, including (a) grafting the entire non-human variable domains onto human constant regions to generate chimeric antibodies; (b) grafting at least a part of one or more of the non-human complementarity determining regions (CDRs) into a human framework and constant regions with or without retention of critical framework residues; or (c) transplanting the entire non-human variable domains, but "cloaking" them with a human-like section by replacement of surface residues. Such methods are disclosed in Morrison et al, Proc. Natl. Acad. Sci. 81: 6851-5 (1984); Morrison et al, Adv. Immunol. 44: 65-92 (1988); Verhoeyen et al, Science 239: 1534- 1536 (1988); Padlan, Molec. Immun. 28: 489-498 (1991); Padlan, Molec. Immun. 31: 169-217 (1994), and U.S. Pat. Nos. 5,585,089, 5,693,761 and 5,693,762 all of which are hereby incorporated by reference in their entirety. De-immunization can also be used to decrease the irnmunogerricity of an antibody. As used herein, the term "de-immunization'' includes alteration of an antibody to modify T cell epitopes (see, e.g., WO9852976A1, WO0034317A2). For example, VH and VL sequences from the starting antibody are analyzed and a human T cell epitope "map" from each V region showing the location of epitopes in relation to complementarity-determining regions (CDRs) and other key residues within the sequence Individual T cell epitopes from the T cell epitope map are analyzed in order to identify alternative amino acid substitutions with a low risk of altering activity ofthe final antibody. A range of alternative VH and VL sequences are designed comprising combinations of amino acid substitutions and these sequences are subsequently incorporated into a range of polypeptides ofthe invention that are tested for function. Typically, between 12 and 24 variant antibodies are generated and tested. Complete heavy and light chain genes comprising modified V and human C regions are then cloned into expression vectors and the subsequent plasmids introduced into cell lines for the production of whole antibody. The antibodies are then compared in appropriate biochemical and biological assays, and the optimal variant is identified, hi one embodiment, the binding molecule comprises a chimeric antibody. In the context ofthe present application the term "chimeric antibodies" will be held to mean any antibody wherein the immunoreactive region or site is obtained or derived from a first species and the constant region (which may be intact, partial or modified in accordance with the instant invention) is obtained from a second species. In preferred embodiments the target binding region or site will be from a non-human source (e.g. mouse) and the constant region is human. Preferably, the variable domains in both the heavy and light chains are altered by at least partial replacement of one or more CDRs and, if necessary, by partial framework region replacement and sequence changing. Although the CDRs may be derived from an antibody ofthe same class or even subclass as the antibody from which the framework regions are derived, it is envisaged that the CDRs will be derived from an antibody of different class and preferably from an antibody from a different species. It may not be necessary to replace all ofthe CDRs with the complete CDRs from the donor variable region to transfer the antigen binding capacity of one variable domain to another. Rather, it may only be necessary to transfer those residues that are necessary to maintain the activity ofthe target binding site. Given the explanations set forth in U. S. Pat. Nos. 5,585,089, 5,693,761 and 5,693,762, it will be well within the competence of those skilled in the art, either by carrying out routine experimentation or by trial and error testing to obtain a functional antibody with reduced immunogenicity. As used herein the temi "properly folded polypeptide" includes polypeptides (e.g., antigen binding molecules such as antibodies) in which all ofthe functional domains comprising the polypeptide are distinctly active. As used herein, the term "improperly folded polypeptide" includes polypeptides in which at least one ofthe functional domains ofthe polypeptide is not active. In one embodiment, a properly folded polypeptide comprises polypeptide chains linked by at least one disulfide bond and, conversely, an improperly folded polypeptide comprises polypeptide chains not linked by at least one disulfide bond. As used herein, the term "malignancy" refers to a non-benign tumor or a cancer. As used herein, the term "cancer" includes a malignancy characterized by deregulated or uncontrolled cell growth. Exemplary cancers include: carcinomas, sarcomas, leukemias, and lymphomas. The term "cancer" includes primary malignant tumors (e.g., those whose cells have not migrated to sites in the subject's body other than the site ofthe original tumor) and secondary malignant tumors (e.g., those arising from metastasis, the migration of tumor cells to secondary sites that are different from the site ofthe original tumor). In one embodiment, a binding molecule ofthe invention binds to a tumor cell. Exemplary antibodies which comprise antigen binding sites that bind to antigens expressed on tumor cells are known in the art and one or more CDRs from such antibodies can be included in a binding molecule ofthe invention. Exemplary antibodies include: 2B8, Lym 1 , Lym 2, LL2, Her2, B 1 , MB 1 , BH3, B4, B72.3, 5E8, B3F6 and 5E10. In a preferred embodiment, a polypeptide ofthe invention is a C2B8 antibody which binds to CD20. In another preferred embodiment, a polypeptide ofthe invention is a CC49 antibody which recognizes TAG72. In one embodiment, a binding molecule ofthe invention binds to a molecule which is useful in treating an autoimmune or inflammatory disease or disorder. As used herein, the term "autoimmune disease or disorder" refers to disorders or conditions in a subject wherein the immune system attacks the body's own cells, causing tissue destruction. Autoimmune diseases include general autoimmune diseases, i.e., in which the autoimmune reaction takes place simultaneously in a number of tissues, or organ specific autoimmune diseases, i.e. , in which the autoimmune reaction targets a single organ. Examples of autoimmune diseases that can be diagnosed, , prevented or treated by the methods and compositions of the present invention include, but are not limited to, Crohn's disease; Inflammatory bowel disease (JJ3D); systemic lupus erythematosus; ulcerative colitis; rheumatoid arthritis; goodpasture's syndrome; Grave's disease; Hashimoto's thyroiditis; pemphigus vulgaris; myasthenia gravis; scleroderma; autoimmune hemolytic anemia; autoimmune thrombocytopenic purpura; polymyositis and dermatomyositis; pernicious anemia; Sjδgren's syndrome; ankylosing spondylitis; vasculitis; type I diabetes mellitus; neurological disorders, multiple sclerosis, and secondary diseases caused as a result of autoimmune diseases. As used herein the term "inflammatory disease or disorder" includes diseases or disorders which are caused, at least in part, or exacerbated by inflammation, e.g., increased blood flow, edema, activation of immune cells (e.g., proliferation, cytokine production, or enhanced phagocytosis). Exemplary disorders include those in which inflammation or inflammatory factors (e.g., matrix metalloproteinases (MMPs), nitric oxide (NO), TNF, interleukins, plasma proteins, cellular defense systems, cytokines, lipid metabolites, proteases, toxic radicals, mitochondria, apoptosis, adhesion molecules, etc.) are involved or are present in an area in aberrant amounts, e.g., in amounts which may be advantageous to alter, e.g., to benefit the subject. The inflammatory process is the response of living tissue to damage. The cause of inflammation may be due to physical damage, chemical substances, micro-organisms, tissue necrosis, cancer or other agents. Acute inflammation is short-lasting, lasting only a few days. If it is longer lasting however, then it may be referred to as chronic inflammation. Inflammatory disorders include acute inflammatory disorders, chronic inflammatory disorders, and recurrent inflammatory disorders. Acute inflammatory disorders are generally of relatively short duration, and last for from about a few minutes to about one to two days, although they may last several weeks. The main characteristics of acute inflammatory disorders include increased blood flow, exudation of fluid and plasma proteins (edema) and emigration of leukocytes, such as neutiophils. Chronic inflammatory disorders, generally, are of longer duration, e.g., weeks to months to years or even longer, and are associated histologically with the presence of lymphocytes and macrophages and with proliferation of blood vessels and connective tissue. Recurrent inflammatory disorders include disorders which recur after a period of time or which have periodic episodes. Examples of recurrent inflammatory disorders include asthma and multiple sclerosis. Some disorders may fall within one or more categories. Inflammatory disorders are generally characterized by heat, redness, swelling, pain and loss of function. Examples of causes of inflammatory disorders include, but are not limited to, microbial infections (e.g., bacterial, viral and fungal infections), physical agents (e.g., burns, radiation, and trauma), chemical agents (e.g., toxins and caustic substances), tissue necrosis and various types of immunologic reactions. Examples of inflammatory disorders include, but are not limited to, osteoarthritis, rheumatoid arthritis, acute and chronic infections (bacterial, viral and fungal); acute and chronic bronchitis, sinusitis, and other respiratory infections, including the common cold; acute and chronic gastroenteritis and colitis; acute and chronic cystitis and urethritis; acute respiratory distress syndrome; cystic fibrosis; acute and chronic dermatitis; acute and chronic conjunctivitis; acute and chronic serositis (pericarditis, peritonitis, synovitis, pleuritis and tendinitis); uremic pericarditis; acute and chronic cholecystis; acute and chronic vaginitis; acute and chronic uveitis; drug reactions; and burns (thermal, chemical, and electrical). As used herein the term "medium that separates polypeptides based on hydrophobic interaction" includes a medium comprising hydrophobic ligands (e.g., alkyl or aryl groups) covalently attached to a matrix. Such a medium can be used to separate polypeptides based on interaction between a solvent and accessible non-polar groups on the surface ofthe polypeptides and the hydrophobic ligands ofthe medium. An exemplary medium is Phenyl 5PW-HR available from Tosoh Bioscience. As used herein, the term "conductivity" includes electrical conductivity of a solution as measured in microSiemens/cm (formerly micromhos/cm). The greater the ion content of a solution, the greater the conductivity ofthe solution. Conductivity can be readily measured using techniques that are well known in the art (e.g., by measuring the current passing between two electrodes). The separation methods ofthe invention can be used with solutions having a pH ranging from acid to neutral, e.g., from about pH 3.5 to approximately neutral. As used herein, the term "approximately neutral pH" includes pH values of approximately 7. For example, in one embodiment, a separation method ofthe invention can be performed using a solution (e.g., a buffer) having a pH of about 3, about 4, about 5, about 6, about 7, or about 8. Preferably, the pH ofthe solution is about 6 or about 7. In one embodiment, the pH ofthe solution is about 4.0, about 4.1, about 4.2, about 4.3, about 4.4, about 4.5, about 4.6, about 4.7, about 4.8, about 4.9, about 5.0, about 5.1, about 5.2, about 5.3, about 5.4, about 5.5, about 5.6, about 5.7, about 5.8, about 5.9, about 6.0, about 6.1, about 6.2, about 6.3, about 6.4, about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, about 7.0, about 7.1, about 7.2, about 7.3, about 7.4, about 7.5, about 7.6, about 7.7, about 7.8, about 7.9, or about 8.0. As used herein the term "affinity matrix" includes a matrix, such as agarose, controlled pore glass, or poly (styrenedivinyl) benzene to which an affinity ligand is attached. The affinity ligand binds to the desired polypeptide and the contaminating polypeptides are not bound to the affinity ligand. The desired polypeptide can be eluted from the affinity matrix using known protocols. As used herein the term "engineered" includes manipulation of nucleic acid or polypeptide molecules by synthetic means (e.g. by recombinant techniques, in vitro peptide synthesis, by enzymatic or chemical coupling of peptides or some combination of these techniques). Preferably, the binding molecules ofthe invention are engineered, e.g., to express a connecting peptide ofthe invention. As used herein, the terms "linked," "fused" or "fusion" are used interchangeably. These terms refer to the joining together of two more elements or components, by whatever means including chemical conjugation or recombinant means. An "in-frame fusion" refers to the joining of two or more open reading frames (ORFs) to form a continuous longer ORF, in a manner that maintains the correct reading frame of the original ORFs. Thus, the resulting recombinant fusion protein is a single protein containing two ore more segments that correspond to polypeptides encoded by the original ORFs (which segments are not normally so joined in nature.) Although the reading frame is thus made continuous throughout the fused segments, the segments may be physically or spatially separated by, for example, in-frame linker sequence. In the context of polypeptides, a "linear sequence" or a "sequence" is an order of amino acids in a polypeptide in an amino to carboxyl terminal direction in which residues that neighbor each other in the sequence are contiguous in the primary structure ofthe polypeptide. As used herein, the phrase "subject that would benefit from administration of a binding molecule" includes subjects, such as mammalian subjects, that would benefit from administration of a binding molecule used, e.g., for detection of an antigen recognized by a binding molecule (e.g., for a diagnostic procedure) and/or from treatment with a binding molecule to reduce or eliminate the target recognized by the binding molecule. For example, in one embodiment, the subject may benefit from reduction or elimination of a soluble or particulate molecule from the circulation or serum (e.g., a toxin or pathogen) or from reduction or elimination of a population of cells expressing the target (e.g., tumor cells). As described in more detail herein, the binding molecule can be used in unconjugated form or can be conjugated, e.g., to a drug, prodrug, or an isotope.
II. Synthetic Connecting Peptides At least one polypeptide chain of a dimer ofthe invention can comprise a synthetic connecting peptide ofthe invention. In one embodiment, at least two chains of a dimer ofthe invention comprise a connecting peptide. In a prefened embodiment, two chains of a dimer of the invention comprise a connecting peptide. In one embodiment, connecting peptides can be used to join two heavy chain portions in frame in a single polypeptide chain. For example, in one embodiment, a connecting peptide ofthe invention can be used to fuse a CH3 domain (or synthetic CH3 domain) to a hinge region (or synthetic hinge region). In another embodiment, a connecting peptide ofthe invention can be used to fuse a CH3 domain (or synthetic CH3 domain) to a CHI domain (or synthetic CHI domain). In still another embodiment, a connecting peptide can act as a peptide spacer between the hinge region (or synthetic hinge region) and a CH2 domain (or a synthetic CH2 domain). In another embodiment, a CH3 domain can be fused to an extracellular protein domain (e.g., a VL domain (or synthetic domain), a VH domain (or synthetic domain), a CHI domain (or synthetic domain), a hinge domain (or synthetic hinge), or to the ligand binding portion of a receptor or the receptor binding portion of a ligand). For example, in one embodiment, a VH or VL domain is fused to a CH3 domain via a connecting peptide (the C-terminus ofthe connecting peptide is attached to the N- terminus ofthe CH3 domain and the N-terminus ofthe connecting peptide is attached to the C-terminus ofthe VH or VL domain), hi another embodiment, a CHI domain is fused to a CH3 domain via a connecting peptide (the C-terminus ofthe connecting peptide is attached to the N-terminus ofthe CH3 domain and the N-terminus ofthe connecting peptide is attached to the C-terminus ofthe CHI domain), hi another embodiment, a connecting peptide ofthe invention can be used to fuse a CH3 domain (or synthetic CH3 domain) to a hinge region (or synthetic hinge region) or portion thereof. In still another embodiment, a connecting peptide can act as a peptide spacer between the hinge region (or synthetic hinge region) and a CH2 domain (or a synthetic CH2 domain). In one embodiment, a connecting peptide can comprise or consist of a gly/ser spacer. For example, a domain deleted CC49 construct having a short amino acid spacer GGSSGGGGSG (SEQ. ID No. 1) substituted for the CH2 domain and the lower hinge region (CC49.ΔCH2 [gly/ser]) can be used, hi another embodiment, a connecting peptide comprises the amino acid sequence IGKTISKKAK (SEQ ID NO:36). In another embodiment, connecting peptide can comprise at least a portion of an immunoglobulin hinge region. For example, chimeric hinge domains can be constructed which combine hinge elements derived from different antibody isotypes. In one embodiment, a connecting peptide comprises at least a portion of an IgGl hinge region. In another embodiment, a connecting peptide can comprise at least a portion of an IgG3 hinge region. In another embodiment, a connecting peptide can comprise at least a portion of an IgGl hinge region and at least a portion of an IgG3 hinge region. In one embodiment, a connecting peptide can comprise an IgGl upper and middle hinge and a single IgG3 middle hinge repeat motif. Because the numbering of individual amino acids in such connecting peptides comprising an amino acid sequence derived from an immunoglobulin hinge region may vary depending upon the length ofthe connecting peptide, the numbering of amino acid positions in these molecules is given using Kabat numbering see, e.g., Table 2). Table 1 shows naturally occurring hinge sequence for IgGl, IgG3, and IgG4 molecules. Table 2 shows Kabat numbering for portions of these hinge molecules and also shows Kabat numbering for connecting peptide amino acid residues presented in that table. In one embodiment, a connecting peptide ofthe invention comprises a non-naturally occurring immunoglobulin hinge region domain, e.g., a hinge region domain that is not naturally found in the polypeptide comprising the hinge region domain and/or a hinge region domain that has been altered so that it differs in amino acid sequence from a naturally occurring immunoglobulin hinge region domain. In one embodiment, mutations can be made to binge region domains to make a connecting peptide ofthe invention, hi one embodiment, a connecting peptide ofthe invention comprises a hinge domain which does not comprise a naturally occurring number of cysteines, i.e., the connecting peptide comprises either fewer cysteines or a greater number of cysteines than a naturally occurring hinge molecule. In a prefened embodiment, incorporation of a connecting peptide (e.g., comprising a non-naturally occurring number of cysteines) into a polypeptide results in a composition in which greater than 50%, 60%, 70%, 80% or 90% ofthe dimeric molecules present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage. hi one embodiment ofthe invention, a connecting peptide comprises hinge region domain comprising a proline residue at an amino acid position corresponding to amino acid position 243 in the Kabat numbering system (position 230, EU numbering system). In one embodiment, a connecting peptide comprises an alanine residue at an amino acid position conesponding to position 244, Kabat numbering system (position 246, EU numbering system). In another embodiment, a connecting peptide ofthe invention comprises a proline residue at an amino acid position conesponding to position 245 (Kabat numbering system; position 247, EU numbering system)). In one embodiment, a connecting peptide comprises a cysteine residue at an amino acid position conesponding to position 239, Kabat numbering system (position 226, EU numbering system), hi one embodiment, a connecting peptide comprises a serine residue at an amino acid position corresponding to position 239, Kabat numbering system (position 226, EU numbering system). In one embodiment, a connecting peptide comprises a cysteine residue at an amino acid position conesponding to position 242, Kabat numbering system (position 229, EU numbering system). In one embodiment, a connecting peptide comprises a serine residue at an amino acid position corresponding to position 242, Kabat numbering system (position 229, EU numbering system). In one embodiment, the connecting peptide can be chosen to result in the preferential synthesis of a particular isoform of polypeptide, e.g., in which the two heavy chain portions are linked via disulfide bonds or are not linked via disulfide bonds. For example, as described in the instant examples, the Gl/G3/Pro243 + [gly/ser] linker (SEQ ID NO: 8), Gl/G3/Pro243Ala244Pro245 + [gly/ser] linker (SEQ ID NO: 9), Pro243 + [gly/ser] linker (SEQ ID NO: 15), and Pro243 Ala244Pro245 + [gly/ser] linker (SEQ JD NO: 14), connecting peptides resulted in the production of only Form A CH2 domain- deleted antibody with no detectable Form B. In contrast, CH2 domain-deleted Cys242Ser:Pro243 (SEQ JD NO: 12), and CH2 domain-deleted Cys242Ser:Pro243Ala244Pro245 (SEQ JD NO: 13), both resulted in a preference for the Form B isoform. These synthetic hinge region connecting peptides would thus be useful for favoring synthesis of Form A or B isoform. This is true for any isotype of antibody, (e.g., IgGl, IgG2, IgG3, or IgG4) based on the high degree of homology among the CH3 domains for all four human isotypes. (Including identical and conserved amino acid residues, IgGl CH3 domain is 98.13% homologous to IgG2 CH3, 97.20% homologous to IgG3 CH3, and 96.26% homologous to IgG4 CH3). The parentheticals referring to connecting peptides and various binding molecules ofthe invention represent equivalent terminology unless otherwise indicated. In one embodiment, a connecting peptide ofthe invention comprises a hinge region domain followed by a flexible gly/ser linker. Exemplary connecting peptides are shown in Table 2 and in SEQ 3D NOs: 8-15, 48, and 49. It will be understood that variant forms of these exemplary connecting peptides can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence encoding a connecting peptide such that one or more amino acid substitutions, additions or deletions are introduced into the connecting peptide. For example, mutations may be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more non-essential amino acid residues such that the ability ofthe connecting peptide to preferentially enhance synthesis of Form A or Form B is not altered. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a nonessential amino acid residue in an immunoglobulin polypeptide is preferably replaced with another amino acid residue from the same side chain family, hi another embodiment, a string of amino acids can be replaced with a stiucturally similar string that differs in order and/or composition of side chain family members. Connecting peptides ofthe invention can be of varying lengths. In one embodiment, a connecting peptide ofthe invention is from about 15 to about 50 amino acids in length, hi another embodiment, a connecting peptide ofthe invention is firom about 20 to about 45 amino acids in length. In another embodiment, a connecting peptide ofthe invention is from about 25 to about 40 amino acids in length. 3h another embodiment, a connecting peptide ofthe invention is from about 30 to about 35 amino acids in length. In another embodiment, a connecting peptide ofthe invention is from about 24 to about 27amino acids in length. In another embodiment, a connecting peptide ofthe invention is from about 40 to about 42 amino acids in length. Connecting peptides can be introduced into polypeptide sequences using techniques known in the art. For example, in one embodiment, the Splicing by Overlap Extension (SOE) method (Horton, R.M. 1993 Methods in Molecular Biology, Vol 15:PCR Protocols: Cunent Methods and applications. Ed. B.A. White) can be used. Modifications can be confirmed by DNA sequence analysis. Plasmid DNA can be used to transform host cells for stable production ofthe polypeptides produced. In one embodiment, incorporation of one ofthe subject connecting peptides into a polypeptide yields a composition comprising polypeptide molecules having at least two binding sites and at least two polypeptide chains, wherein at least two ofthe polypeptide chains comprise a synthetic connecting peptide and wherein greater than 50% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage. In another embodiment, greater than 60% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage. In another embodiment, greater than 70% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage. In another embodiment, greater than 80% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage. In another embodiment, greater than 90% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage. In one embodiment, incorporation of one ofthe subject connecting peptides into an IgG4 molecule yields a composition in which greater than 95% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage.
III. Binding molecules
The polypeptides ofthe invention comprise at least two binding sites which bind to a target molecule of interest. Exemplary binding sites include, e.g., sites which bind to an antigen (antigen binding sites), sites which bind to a receptor (receptor binding sites), or sites which bind to a ligand (ligand binding sites). In one embodiment, the binding molecules comprise at least two binding sites. In one embodiment, the binding molecules comprise two binding sites. In one embodiment, the binding molecules comprise three binding sites. In another embodiment, the binding molecules comprise four binding sites. hi one embodiment, the binding molecules have at least one target binding site specific for a molecule which mediates a biological effect (e.g., which modulates cellular activation (e.g., by binding to a cell surface receptor and resulting in transmission or inhibition of an activating or inhibitory signal), which results in death of the cell (e.g., by complement fixation or exposure to a payload present on the binding molecule), or which modulates a disease or disorder in a subject (e.g., by promoting lysis of a fibrin clot or promoting clot formation, or by modulating the amount of a substance which is bioavailable (e.g., by enhancing or reducing the amount of a ligand such as TNFα in the subject)). ' In one embodiment, the binding molecules have at least one target binding site specific for an molecule targeted for reduction or elimination, e.g., a cell surface antigen or a soluble antigen. In one embodiment, binding ofthe binding molecule to the target results in reduction or elimination ofthe target, e.g., from a tissue or from the circulation. In another embodiment, the binding molecules have at least one binding site specific for a molecule that can be used to detect the presence of a target molecule (e.g., to detect a contaminant or diagnose a condition or disorder). In yet another embodiment, a binding molecule ofthe invention comprises at least one binding site that targets the binding molecule to a specific site in a subject (e.g., to a tumor cell or blood clot). Exemplary binding sites that can be included in the binding domain of a binding molecule ofthe invention include: the receptor binding portion of a ligand, the ligand binding portion of a receptor, the substrate binding portion of an enzyme, the enzyme binding portion of a substrate, or one or more antigen binding portions of an antibody. hi one embodiment, at least one target binding site of a binding molecule
(e.g., an antibody molecule, a bispecific antibody, or a modified antibody) is catalytic (Shokat and Schultz. 1990. Annu. Rev. Immunol. 8:335). In one embodiment, a heavy chain variable portion and a light chain variable portion of a binding molecule are present in the same polypeptide, e.g., as in a single chain antibody or a mimbody (see e.g., US patent 5,837,821 or WO 94/09817A1). In another embodiment, the heavy chain portion and the light chain portion of a polypeptide are present in different polypeptide chains, e.g., as in antibody molecules. The target binding polypeptides ofthe invention are multimeric molecules. In one embodiment, the target binding polypeptides are dimers. 3h one embodiment, the dimers ofthe invention are homodimers, comprising two identical monomeric subunits. In another embodiment, the dimers ofthe invention are heterodimers, comprising two non-identical monomeric subunits. The dimers comprise at least two polypeptide chains. In one embodiment, the binding molecules comprise two polypeptide chains. In another embodiment, the binding molecules comprise three polypeptide chains. In another embodiment, the binding molecules comprise four polypeptide chains. In a prefened embodiment, a binding molecule ofthe invention comprises at least one CDR of an antibody, e.g., an antibody known in the art to bind to a target of interest. In another embodiment, a binding molecule ofthe invention comprises at least two CDRs. In another embodiment, a binding molecule ofthe invention comprises at least three CDRs. In another embodiment, a binding molecule of the invention comprises at least four CDRs. In another embodiment, a binding molecule ofthe invention comprises at least five CDRs. hi another embodiment, a binding molecule ofthe invention comprises at least six CDRs. In a prefened embodiment, a binding molecule ofthe invention comprises at least one VH domain of an antibody, e.g., an antibody known in the art to bind to a target of interest. In a preferred embodiment, a binding molecule ofthe invention comprises at least one VL domain. In another prefened embodiment, a binding molecule of the invention comprises at least one VH domain and one VL domain of an antibody. In one embodiment, an antigen binding site consists of a VH domain, e.g., derived from camelids, which is stable in the absence of a VL chain (Hamers- Casterman et al. 1993. Nature 363. -446; Desmyter et al. 1996. Nat. Struct. Biol. 3:803; Desmyter, A., 1996. Nat. Struct. Biol. 3:803; Decanniere, K., et al. 1999. Structure 7:361; Davies et al. 1996. Protein Eng. 9:531; Kortt et al. 1995. J. Protein Chem. 14:167).
A. Fusion Proteins
The invention also pertains to binding molecules which comprise one or more immunoglobulin domains. The fusion proteins ofthe invention comprise a binding domain (which comprises at least one binding site) and a dimerization domain (which comprises at least one heavy chain portion). The subject fusion proteins may be bispecific (with one binding site for a first target and a second binding site for a second target) or may be multivalent (with two binding sites for the same target). Exemplary fusion proteins reported in the literature include fusions ofthe T cell receptor (Gascoigne et al., Proc. Natl. Acad. Sci. USA 84:2936-2940 (1987)); CD4 (Capon et al., Nature 337:525-531 (1989); Traunecker et al., Nature 339:68-70 (1989); Zettmeissl et al., DNA Cell Biol. USA 9:347-353 (1990); and Bym et al., Nature 344:667-670 (1990)); L-selectin (homing receptor) (Watson et al., J. Cell. Biol. 110:2221-2229 (1990); and Watson et al., Nature 349:164-167 (1991)); CD44 (Aruffo et al., Cell 61:1303-1313 (1990)); CD28 and B7 (Linsley et al., J. Exp. Med. 173:721-730 (1991)); CTLA-4 (Lisley et al., J. Exp. Med. 174:561-569 (1991)); CD22 (Stamenkovic et al., Cell 66:1133-1144 (1991)); TNF receptor (Ashkenazi et al., Proc. Natl. Acad. Sci. USA 88:10535-10539 (1991); Lesslauer et al., Eur. J. Immunol. 27:2883-2886 (1991); and Peppel et al., J. Exp. Med. 174:1483-1489 (1991)); and IgE receptor a (Ridgway and Gorman, J. Cell. Biol. Vol. 115, Abstract No. 1448 (1991)). In one embodiment a fusion protein combines the binding domain(s) of the ligand or receptor (e.g. the extracellular domain (ECD) of a receptor) with at least one heavy chain domain and a synthetic connecting peptide. hi one embodiment, when preparing the fusion proteins ofthe present invention, nucleic acid encoding the binding domain ofthe ligand or receptor will be fused C-terminally to nucleic acid encoding the N-terminus of an immunoglobulin constant domain sequence. N-terminal fusions are also possible. In one embodiment, a fusion protein includes a CH2 and a CH3 domain. Fusions may also be made to the C-terminus ofthe Fc portion of a constant domain, or immediately N-terminal to the CHI ofthe heavy chain or the conesponding region of the light chain. In one embodiment, the sequence ofthe ligand or receptor domain is fused to the N-terminus ofthe Fc domain of an immunoglobulin molecule. It is also possible to fuse the entire heavy chain constant region to the sequence ofthe ligand or receptor domain. In one embodiment, a sequence beginning in the hinge region just upstream ofthe papain cleavage site which defines IgG Fc chemically (i.e. residue 216, taking the first residue of heavy chain constant region to be 114), or analogous sites of other immunoglobulins is used in the fusion. The precise site at which the fusion is made is not critical; particular sites are well known and may be selected in order to optimize the biological activity, secretion, or binding characteristics ofthe molecule. Methods for making fusion proteins are known in the art. For bispecific fusion proteins, the fusion proteins are assembled as multimers, and particularly as heterodimers or heterotetramers. Generally, these assembled immunoglobulins will have known unit structures. A basic four chain structural unit is the form in which IgG, IgD, and IgE exist. A four chain unit is repeated in the higher molecular weight immunoglobulins; IgM generally exists as a pentamer of four basic units held together by disulfide bonds. IgA globulin, and occasionally IgG globulin, may also exist in multimeric form in serum. In the case of multimer, each of the four units may be the same or different. Additonal exemplary ligands and their receptors that may be included in the subject fusion proteins include the following:
Cytokines and Cytokine Receptors Cytokines have pleiotropic effects on the proliferation, differentiation, and functional activation of lymphocytes. Various cytokines, or receptor binding portions thereof, can be utilized in the fusion proteins ofthe invention. Exemplary cytokines include the interleukins (e.g. IL-1, IL-2, 3L-3, IL-4, IL-5, IL-6, 3L-7, IL-8, IL- 10, IL-11, LL-12, IL-13, and IL-18), the colony stimulating factors (CSFs) (e.g. granulocyte CSF (G-CSF), granulocyte-macrophage CSF (GM-CSF), and monocyte macrophage CSF (M-CSF)), tumor necrosis factor (TNF) alpha and beta, and interferons such as interferon-α, β, or γ(US Patent Nos. 4,925,793 and 4,929,554). Cytokine receptors typically consist of a ligand-specific alpha chain and a common beta chain. Exemplary cytokine receptors include those for GM-CSF, IL-3 (US Patent No. 5,639,605), IL-4 (US Patent No. 5,599,905), IL-5 (US Patent No. 5,453,491), 3TNγ(EP0240975), and the TNF family of receptors (e.g., TNFα (e.g. TNFR-1 (EP 417, 563), TNFR-2 (EP 417,014) lymphotoxin beta receptor).
Adhesion Proteins Adhesion molecules are membrane-bound proteins that allow cells to interact with one another. Various adhesion proteins, including leukocyte homing receptors and cellular adhesion molecules, of receptor binding portions thereof, can be incoφorated in a fusion protein ofthe invention. Leucocyte homing receptors are expressed on leucocyte cell surfaces during inflammation and include the β-1 integrins (e.g. VLA-1, 2, 3, 4, 5, and 6) which mediate binding to extracellular matrix components, and the j32-integrins (e.g. LFA-1, LPAM-1, CR3, and CR4) which bind cellular adhesion molecules (CAMs) on vascular endothelium. Exemplary CAMs include ICAM-1, ICAM-2, VCAM-1, and MAdCAM-1. Other CAMs include those of the selectin family including E-selectin, L-selectin, and P-selectin.
Chemokines Chemokines, chemotactic proteins which stimulate the migration of leucocytes towards a site of infection, can also be incoφorated into a fusion protein of the invention. Exemplary chemokines include Macrophage inflammatory proteins (MIP-l-o- and MIP-l-j8), neutiophil chemotactic factor, and PvANTES (regulated on activation normally T-cell expressed and secreted).
Growth Factors and Growth Factor Receptors Growth factors or their receptors (or receptor binding or ligand binding portions thereof) may be incoφorated in the fusion proteins ofthe invention. Exemplary growth factors include Vascular Endothelial Growth Factor (VEGF) and its isoforms (U.S. Pat. No. 5,194,596 ; Fibroblastic Growth Factors (FGF), including aFGF and bFGF; atrial natriuretic factor (ANF); hepatic growth factors (HGFs; US Patent Nos. 5,227,158 and 6,099,841), neurotiophic factors such as bone-derived neurotrophic factor (BDNF), neurotroρhin-3, -4, -5, or -6 (NT-3, NT-4, NT-5, or NT-6), or a nerve growth factor such as NGF-β platelet-derived growth factor (PDGF) (U.S. Pat. Nos. 4.889,919. 4.845,075. 5,910,574, and 5,877,016); transforming growth factors (TGF) such as TGF- alpha and TGF-beta (WO 90/14359), osteoinductive factors including bone moφhogenetic protein (BMP); insulin-like growth factors-I and -II (IGF-I and IGF-II; US Patent Nos. 6,403,764 and 6,506,874); Erythropoietin (EPO); stem-cell factor (SCF), thrombopoietin (c-Mpl ligand), and the Wnt polypeptides (US Patent No. 6,159,462). Exemplary growth factor receptors which may be used as targeting receptor domains of the invention include EGF receptors; VEGF receptors (e.g. Fltl or Flkl/KDR), PDGF receptors (WO 90/14425); HGF receptors (US Patent Nos. 5,648,273, and 5,686,292), and neurotrophic receptors including the low affinity receptor (LNGFR), also termed as p75NTR or p75, which binds NGF, BDNF, and NT-3, and high affinity receptors that are members ofthe trk family ofthe receptor tyrosine kinases (e.g. trkA, trkB (EP 455,460), trkC (EP 522,530)).
Hormones Exemplary growth hormones for use as targeting agents in the fusion proteins ofthe invention include renin, human growth hormone (HGH; US Patent No. 5,834,598), N-methionyl human growth hormone; bovine growth hormone; growth hormone releasing factor; parathyroid hormone (PTH); thyroid stimulating hormone (TSH); thyroxine; proinsulin and insulin (US Patent Nos. 5,157,021 and 6,576,608); follicle stimulating hormone (FSH), calcitonin, luteinizing hormone (LH), leptin, glucagons; bombesin; somatropin; mullerian-inhibiting substance; relaxin and prorelaxin; gonadotiopin-associated peptide; prolactin; placental lactogen; OB protein; or mullerian-inhibiting substance.
Clotting Factors Exemplary blood coagulation factors for use as targeting agents in the fusion proteins ofthe invention include the clotting factors (e.g. , factors V, VII, VIII, X, IX, XI, XII and Xfll, von Willebrand factor); tissue factor (U.S. Pat. Nos. 5,346,991, 5,349,991, 5,726,147, and 6,596,84); thrombin and prothrombin; fibrin and fibrinogen; plasmin and plasminogen; plasminogen activators, such as urokinase or human urine or tissue-type plasminogen activator (t-PA).
Other exemplary fusion proteins are taught, e.g., in WO0069913A1 and WO0040615 A2. Another exemplary molecule that may be included in a fusion protein ofthe invention is IGSF9. Fusion proteins can be prepared using methods that are well known in the art (see for example US Patent Nos. 5,116,964 and 5,225,538). Ordinarily, the ligand or receptor domain is fused C-terminally to the N-terminus ofthe constant region ofthe heavy chain (or heavy chain portion) and in place ofthe variable region. Any tiansmembrane regions or lipid or phospholipids anchor recognition sequences of ligand binding receptor are preferably inactivated or deleted prior to fusion. DNA encoding the ligand or receptor domain is cleaved by a restriction enzyme at or proximal to the 5' and 3 'ends ofthe DNA encoding the desired ORF segment. The resultant DNA fragment is then readily inserted into DNA encoding a heavy chain constant region. The precise site at which the fusion is made may be selected empirically to optimize the secretion or binding characteristics ofthe soluble fusion protein. DNA encoding the fusion protein is then transfected into a host cell for expression.
B. Antibodies or portions thereof In one embodiment, a binding molecule, e.g., antigen bmding molecule, of the invention is an antibody molecule. Using art recognized protocols, for example, antibodies are preferably raised in mammals by multiple subcutaneous or intraperitoneal inj ections ofthe relevant antigen (e.g., purified tumor associated antigens or cells or cellular extracts comprising such antigens) and an adjuvant. This immunization typically elicits an immune response that comprises production of antigen-reactive antibodies from activated splenocytes or lymphocytes. While the resulting antibodies may be harvested from the serum ofthe animal to provide polyclonal preparations, it is often desirable to isolate individual lymphocytes from the spleen, lymph nodes or peripheral blood to provide homogenous preparations of monoclonal antibodies (MAbs). Preferably, the lymphocytes are obtained from the spleen. In this well known process (Kohler et al., Nature, 256:495 (1975)) the relatively short-lived, or mortal, lymphocytes from a mammal which has been injected with antigen are fused with an immortal tumor cell line (e.g. a myeloma cell line), thus, producing hybrid cells or "hybridomas" which are both immortal and capable of producing the genetically coded antibody ofthe B cell. The resulting hybrids are segregated into single genetic strains by selection, dilution, and regrowth with each individual strain comprising specific genes for the formation of a single antibody. They produce antibodies which are homogeneous against a desired antigen and, in reference to their pure genetic parentage, are termed "monoclonal." Hybridoma cells thus prepared are seeded and grown in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival ofthe unfused, parental myeloma cells. Those skilled in the art will appreciate that reagents, cell lines and media for the formation, selection and growth of hybridomas are commercially available from a number of sources and standardized protocols are well established. Generally, culture medium in which the hybridoma cells are growing is assayed for production of monoclonal antibodies against the desired antigen. Preferably, the binding specificity ofthe monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or by an in vitro assay, such as a radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA). After hybridoma cells are identified that produce antibodies ofthe desired specificity, affinity and/or activity, the clones may be subcloned by limiting dilution procedures and grown by standard methods (Goding, Monoclonal Antibodies: Principles and Practice, pp 59-103 (Academic Press, 1986)). It will further be appreciated that the monoclonal antibodies secreted by the subclones may be separated from culture medium, ascites fluid or serum by conventional purification procedures such as, for example, protein- A, hydroxylapatite chromatography, gel electrophoresis, dialysis or affinity chromatography. In another embodiment, DNA encoding a desired monoclonal antibodies maybe readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). The isolated and subcloned hybridoma cells serve as a prefened source of such DNA. Once isolated, the DNA may be placed into expression vectors, which are then transfected into prokaryotic or eukaryotic host cells such as E. coli cells, simian COS cells, Chinese Hamster Ovary (CHO) cells or myeloma cells that do not otherwise produce immunoglobulins. More particularly, the isolated DNA (which may be modified as described herein) maybe used to clone constant and variable region sequences for the manufacture antibodies as described in Newman et al, U.S. Pat. No.. 5,658,570, filed January 25, 1995, which is incoφorated by reference herein. Essentially, this entails extraction of RNA from the selected cells, conversion to cDNA, and amplification by PCR using lg specific primers. Suitable primers for this puφose are also described in U.S. Pat. No. 5,658,570. As will be discussed in more detail below, transformed cells expressing the desired antibody may be grown up in relatively large quantities to provide clinical and commercial supplies ofthe immunoglobulin. Those skilled in the art will also appreciate that DNA encoding antibodies or antibody fragments may also be derived from antibody phage libraries, e.g., using pd phage or Fd phagemid technology. Exemplary methods are set forth, for example, in EP 368 684 Bl; U.S. patent. 5,969,108, Hoogenboom, H.R. and Chames. 2000. Immunol.
Today 21:371; Nagy et al. 2002. Nat. Med. 8:801; Huie et al. 2001. Proc. Natl. Acad. Sci. USA 98:2682; Lui et al. 2002. J. Mol. Biol. 315:1063, each of which is incoφorated herein by reference. Several publications (e.g., Marks et al. Bio/Technology 10:779-783 (1992)) have described the production of high affinity human antibodies by chain shuffling, as well as combinatorial infection and in vivo recombination as a stiategy for constructing large phage libraries. In another embodiment, Ribosomal display can be used to replace bacteriophage as the display platform (see, e.g., Hanes et al. 2000. Nat. Biotechnol. 18:1287; Wilson et al. 2001. Proc. Natl. Acad. Sci. USA 98:3750; or Irving et al. 2001 J. Immunol. Methods 248:31. In yet another embodiment, cell surface libraries can be screened for antibodies (Boder et al. 2000. Proc. Natl. Acad. Sci. USA 97:10701; Daugherty et al. 2000 J. Immunol. Methods 243 :211. Such procedures provide alternatives to traditional hybridoma techniques for the isolation and subsequent cloning of monoclonal antibodies. Yet other embodiments ofthe present invention comprise the generation of human or substantially human antibodies in transgenic animals (e.g., mice) that are incapable of endogenous immunoglobulin production (see e.g., U.S. Pat. Nos. 6,075,181, 5,939,598, 5,591,669 and 5,589,369 each of which is incoφorated herein by reference). For example, it has been described that the homozygous deletion of the antibody heavy-chain joining region in chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production. Transfer of a human immunoglobulin gene array to such germ line mutant mice will result in the production of human antibodies upon antigen challenge. Another prefened means of generating human antibodies using SCID mice is disclosed in U.S. Pat. No. 5,811,524 which is incoφorated herein by reference. It will be appreciated that the genetic material associated with these human antibodies may also be isolated and manipulated as described herein. Yet another highly efficient means for generating recombinant antibodies is disclosed by Newman, Biotechnology, 10: 1455-1460 (1992). Specifically, this technique results in the generation of primatized antibodies that contain monkey variable domains and human constant sequences. This reference is incoφorated by reference in its entirety herein. Moreover, this technique is also described in commonly assigned U.S. Pat. Nos. 5,658,570, 5,693,780 and 5,756,096 each of which is incoφorated herein by reference. In another embodiment, lymphocytes can be selected by micromanipulation and the variable genes isolated. For example, peripheral blood mononuclear cells can be isolated from an immunized mammal and cultured for about 7 days in vitro. The cultures can be screened for specific IgGs that meet the screening criteria. Cells from positive wells can be isolated. Individual Ig-producing B cells can be isolated by FACS or by identifying them in a complement-mediated hemolytic plaque assay. Ig-producing B cells can be micromanipulated into a tube and the Vh and VI genes can be amplified using, e.g., RT-PCR. The VH and VL genes can be cloned into an antibody expression vector and transfected into cells (e.g., eukaryotic or prokaryotic cells) for expression. Moreover, genetic sequences useful for producing the polypeptides ofthe present invention may be obtained from a number of different sources. For example, as discussed extensively above, a variety of human antibody genes are available in the form of publicly accessible deposits. Many sequences of antibodies and antibody-encoding genes have been published and suitable antibody genes can be chemically synthesized from these sequences using art recognized techniques. Oligonucleotide synthesis techniques compatible with this aspect ofthe invention are well known to the skilled artisan and may be carried out using any of several commercially available automated synthesizers. In addition, DNA sequences encoding several types of heavy and light chains set forth herein can be obtained through the services of commercial DNA synthesis vendors. The genetic material obtained using any ofthe foregoing methods may then be altered or modified to provide obtain polypeptides ofthe present invention. Alternatively, antibody-producing cell lines may be selected and cultured using teclrrniques well known to the skilled artisan. Such techniques are described in a variety of laboratory manuals and primary publications, hi this respect, techniques suitable for use in the invention as described below are described in Current Protocols in Immunology, Coligan et al., Eds., Green Pubhshing Associates and Wiley-Interscience, John Wiley and Sons, New York (1991) which is herein incoφorated by reference in its entirety, including supplements. It will further be appreciated that the scope of this invention further encompasses all alleles, variants and mutations of antigen binding DNA sequences. As is well known, RNA may be isolated from the original hybridoma cells or from other transformed cells by standard techniques, such as guanidinium isothiocyanate extraction and precipitation followed by centrifugation or chromatography. Where desirable, mRNA may be isolated from total RNA by standard techniques such as chromatography on oligo dT cellulose. Suitable techniques are familiar in the art. Variable and constant region domains can be obtained from any source and be incoφorated into a modified antibody ofthe invention. To clone antibodies, mRNA can be isolated from hybridoma, spleen, or lymph cells, reverse transcribed into DNA, and antibody genes amplified by PCR. PCR may be imtiated by consensus constant region primers or by more specific primers based on the published heavy and light chain DNA and amino acid sequences. As discussed above, PCR also may be used to isolate DNA clones encoding the antibody light and heavy chains. In this case the libraries may be screened by consensus primers or larger homologous probes, such as mouse constant region probes. Numerous primer sets suitable for amplification of antibody genes are known in the art (e.g., 5' primers based on the N-terminal sequence of purified antibodies (Benhar and Pastan. 1994. Protein Engineering 7:1509); rapid amplification of cDNA ends (Ruberti, F. et al. 1994. J. hnmunol. Methods 173:33); antibody leader sequences (Larrick et al. 1989 Biochem. Biophys. Res. Commun. 160:1250); or based on known variable region framework amino acid sequences from the Kabat (Kabat et al. 1991. Sequences of Proteins of Immunological Interest. Bethesda, MD:JS Dep. Health Hum. Serv. 5th ed.) or the V-base databases (e.g., Orlandi et al. 1989. Proc. Natl. Acad. Sci. USA 86:3833; Sblattero et al. 1998. lmmunotechnology 3:271; or Krebber et al. 1997. J. Immunol. Methods 201:35). Constant region domains can be selected having a particular effector function (or lacking a particular effector function) or with a particular modification to reduce immunogenicity. Variable and constant domains can be cloned, e.g., using the polymerase chain reaction and primers which are selected to amplify the domain of interest. PCR amplification methods are described in detail in U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800,159; 4,965,188; and in, e.g., "PCR Protocols: A Guide to Methods and Applications" 3hnis et al. eds., Academic Press, San Diego, CA (1990); Ho et al. 1989. Gene 77:51; Horton et al. 1993. Methods Enzymol. 217:270). Alternatively, V domains can be obtained from libraries of V gene sequences from an animal of choice. Libraries expressing random combinations of domains, e.g., VH and VL domains, can be screened with a desired antigen to identify elements which have desired binding characteristics. Methods of such screening are well known in the art. For example, antibody gene repertoires can be cloned into a λ bacteriophage expression vector (Huse, WD et al. 1989. Science 2476:1275). In addition, cells (Boder and Wittrup. 1997. Nat. Biotechnol. 15:553; Daugtherty, P. et al. 2000. J. hnmunol. Methods. 243:211; Francisco et al. 1994. Proc. Natl. Acad. Sci. USA 90:10444; Georgiou et al. 1997. Nature Biotechnology 15:29) or viruses (e.g., Hoogenboom, HR. 1998 lmmunotechnology 4:1 Winter et al. 1994. Annu. Rev. Immunol. 12:433; Griffiths, AD. 1998. Cun. Opin. Biotechnol. 9:102) expressing antibodies on their surface can be screened. Ribosomal display can also be used to screen antibody libraries (Hanes J., et al. 1998. Proc. Natl. Acad. Sci. USA 95:14130; Hanes, J. and Pluckthun. 1999. Curr. Top. Microbiol. Immunol. 243:107; He, M. and Taussig. 1997. Nucleic Acids Research 25:5132). Prefened libraries for screening are human V gene libraries. VL and VH domains from a non-human source may also be used. In one embodiment, such non- human V domains can be altered to reduce their immunogenicity using art recognized techniques. Libraries can be naϊve, from immunized subjects, or semi-synthetic (Hoogenboom, H.R. and Winter. 1992. J. Mol. Biol. 227:381; Griffiths, AD, et al. EMBO J. 13:3245; de I ruif, J. et al. 1995. J. Mol. Biol. 248:97; Barbas, C.F., et al. 1992. Proc. Natl. Acad. Sci. USA 89:4457). In addition, the sequences of many antibody V and C domains are known and such domains can be synthesized using methods well known in the art. In one embodiment, mutations can be made to immunoglobulin domains to create a library of nucleic acid molecules having greater heterogeneity (Thompson, J., et al. 1996. J. Mol. Biol. 256:77; Lamminmaki, U. et al. 1999. J. Mol. Biol. 291:589; Caldwell, R.C. and Joyce GF. 1992. PCR Methods Appl. 2:28; Caldwell RC and Joyce GF. 1994. PCR Methods Appl. 3:S136. Standard screening procedures can be used to select high affinity variants, hi another embodiment, changes to VH and VL sequences can be made to increase antibody avidity, e.g., using information obtained from crystal structures using techniques known in the art.
C. Modified Antibodies Exemplary constructs include, e.g., minibodies, diabodies, diabodies fused to CH3 molecules, tetiavalent antibodies, intradiabodies (e.g., Jendreyko et al.
2003. J. Biol. Chem. 278:47813), bispecific antibodies, fusion proteins (e.g., antibody cytokine fusion proteins, proteins fused to at least a portion of an Fc receptor), bispecific antibodies. Other immunoglobulins (lg) and certain variants thereof are described, for example in U.S. Pat. No. 4,745,055; EP 256,654; Faulkner et al., Nature 298:286 (1982); EP 120,694; EP 125,023; Morrison, J. Immun. 123:793 (1979); Kohler et al., Proc. Natl. Acad. Sci. USA 77:2197 (1980); Raso et al., Cancer Res. 41:2073 (1981); Morrison et al., Ann. Rev. Immunol. 2:239 (1984); Morrison, Science 229:1202 (1985); Morrison et al., Proc. Natl. Acad. Sci. USA 81:6851 (1984); EP 255,694; EP 266,663; and WO 88/03559. Reassorted immunoglobulin chains also are known. See, for example, U.S. Pat. No. 4,444,878; WO 88/03565; and EP 68,763 and references cited therein. In one embodiment, a polypeptide ofthe invention comprises an immunoglobulin heavy chain having deletion or substitution of at least one amino acid. For example, the mutation of one or more single amino acid in selected areas ofthe CH2 domain may be enough to substantially reduce Fc binding and thereby increase tumor localization. Similarly, it may be desirable to simply delete that part of one or more constant region domains that control the effector function (e.g. complement bmding) to be modulated. Such partial deletions ofthe constant regions may improve selected characteristics ofthe antibody (serum half-life) while leaving other desirable functions associated with the subject constant region domain intact. Accordingly, in one embodiment, a bmding molecule ofthe invention lacks all or part of a CH2 domain. Moreover, as alluded to above, the constant regions ofthe disclosed antibodies maybe modified through the mutation or substitution of one or more amino acids that enhances the profile ofthe resulting construct, hi this respect it may be possible to disrupt the activity provided by a conserved binding site (e.g. Fc binding) while substantially maintaining the configuration and immunogenic profile ofthe modified antibody. Yet other prefened embodiments may comprise the addition of one or more amino acids to the constant region to enhance desirable characteristics such as effector function or provide for more cytotoxin or carbohydrate attachment. In such embodiments it may be desirable to insert or replicate specific sequences derived from selected constant region domains. In another embodiment, mutations to naturally occurring hinge regions can be made. Such modifications to the constant region in accordance with the instant invention may easily be made using well known biochemical or molecular engineering techniques well within the skill ofthe art. hi one embodiment, polypeptides ofthe invention comprise modified constant regions wherein one or more domains are partially or entirely deleted ("domain deleted antibodies"). In especially prefened embodiments compatible modified antibodies will comprise domain deleted constructs or variants wherein the entire CH2 domain has been removed. A variety of modified antibody constructs are described in more detail below. i. Minibodies In one embodiment, the modified antibodies ofthe invention are minibodies. Minibodies are dimeric molecules made up of two polypeptide chains each comprising an ScFv molecule (a single polypeptide comprising one or more antigen binding sites, e.g., a VL domain linked by a flexible linker to a VH domain fused to a CH3 domain via a connecting peptide. An exemplary minibody construct is shown in Figure 2. hi Figure 2 a CH3 domain is fused at its N-terminus to a connecting peptide which is fused at its N-terminus to a VH domain which is fused via its N-terminus to a flexible linker which is fused at its N-terminus to a VL domain. ScFv molecules can be constructed in a VH-linker-VL orientation or VL- linker-VH orientation. The flexible hinge that links the VL and VH domains that make up the antigen binding site preferably comprises from about 10 to about 50 amino acid residues. An exemplary connecting peptide for this pvurpose is (Gly4Ser)3 (SEQ 3D NO:35) (Huston et al. . 1988. Proc. Natl. Acad. Sci. USA 85:5879). Other connecting peptides are known in the art. Methods of making single chain antibodies are well known in the art, e.g., Ho et al. 1989. Gene 77:51; Bird et al. 1988 Science 242:423; Pantoliano et al. 1991. Biochemistry 30:10117; Milenic et al. 1991. Cancer Research 51:6363; Takkinen et al. 1991. Protein Engineering 4:837. Minibodies can be made by constructing an ScFv component and connecting peptide-CH3 component using methods described in the art (see, e.g., US patent 5,837,821 or WO 94/09817A1). These components can be isolated from separate plasmids as restriction fragments and then ligated and recloned into an appropriate vector. Appropriate assembly can be verified by restriction digestion and DNA sequence analysis. In one embodiment, a minibody ofthe invention comprises a connecting peptide. In one embodiment, the connecting peptide comprises a gly/ser linker, e.g., GGGSSGGGSGG (SEQ ID NO: 1). In another embodiment, a tetravalent minibody can be constructed. Tetiavalent minibodies can be constructed in the same manner as minibodies, except that two ScFv molecules are linked using a flexible linker, e.g., having an amino acid sequence (G4S) G3AS (SEQ 3D NO: 36). An exemplary tetravalent minibody is illustrated in Figure 2. ii. Domain Deleted Antibodies In another embodiment, the modified antibodies ofthe invention are CH2 domain deleted antibodies. Domain deleted constructs can be derived from a vector (e.g., from -DEC Pharmaceuticals, San Diego) encoding an IgGi human constant domain (see, e.g., WO 02/060955A2 and WO02/096948A2). Essentially, the vector was engineered to delete the CH2 domain and provide a modified vector expressing a domain deleted IgGi constant region. Genes encoding the murine variable region ofthe C2B8 antibody, 5E8 antibody, B3F6 antibody, or the variable region ofthe humanized CC49 antibody were then inserted in the modified vector and cloned. When expressed in transformed cells, these vectors provided C2B8.ΔCH2, 5E8.ΔCH2, B3F6.ΔCH2 or huCC49.ΔCH2 or respectively. These constructs exhibit a number of properties that make them particularly attractive candidates for monomeric subunits. Besides the deletion of whole constant region domains, it will be appreciated that the antibodies ofthe present invention can be engineered to partially delete or substitute of a few amino acids or even a single amino acid. For example, the mutation of a single amino acid in selected areas ofthe CH2 domain may be enough to substantially reduce Fc binding and thereby increase tumor localization. Similarly, it may be deshable to simply delete that part of one or more constant region domains that control the effector function (e.g. complement C1Q binding). Such partial deletions ofthe constant regions may improve selected characteristics of the antibody (serum half-life) while leaving other desirable functions associated with the subject constant region domain intact. Creation of a CH2 domain deleted version can be accomplished by way of overlapping PCR mutagenesis. The gamma 1 constant domain begins with a plasmid encoded Nhe I site with is in translational reading frame with the immunoglobulin sequence. A 5' PCR primer was constructed encoding the Nhe I site as well as sequence immediately downstream. A 3 ' PCR primer mate was constructed such that it anneals with the 3 ' end to the immunoglobulin hinge region and encodes in frame the first several amino acids ofthe gamma 1 CH3 domain. A second PCR primer pair consisted ofthe reverse complement ofthe 3' PCR primer from the first pair (above) as the 5' primer and a 3' primer that anneals at a loci spanning the BsrG I restriction site within the CH3 domain. Following each PCR amplification, the resultant products were utilized as template with the Nhe I and BsrG 15' and 3', respectively primers. The amplified product was then cloned back into N5KG1 to create the plasmid N5KG1ΔCH2. This construction places the intact CH3 domain immediately downstream and in frame with the intact hinge region. A similar procedure can be used to create a domain deleted constiruct in which the CH3 domain is immediately downstream of a connecting peptide. For example, a domain deleted version ofthe C2B8 antibody was created in this manner as described in U.S. Pat. Nos. 5,648,267 and 5,736,137 each of which is incoφorated herein by reference. In one embodiment, tetravalent domain-deleted antibodies can be produced by combining a DNA sequence encoding a domain deleted antibody with a ScFv molecule. For example, in one embodiment, these sequences are combined such that the ScFv molecule is linked at its N-terminus to the CH3 domain ofthe domain deleted antibody via a flexible linker (e.g., a gly/ser linker such as (Gly4Ser)3 (SEQ 3D NO: 35). In another embodiment a tetravalent antibody can be made by fusing an ScFv molecule to a connecting peptide, which is fused to a CHI domain to construct an ScFv - Fab tetravalent molecule. (Coloma and Morrison. 1997. Nature Biotechnology. 15:159; WO 95/09917).
iii. Diabodies Diabodies are similar to scFv molecules, but usually have a short (less than 10 and preferably 1-5) amino acid residue linker connecting both V-domains, such that the VL and VH domains on the same polypeptide chain can not interact. Instead, the VL and VH domain of one polypeptide chain interact with the VH and VL domain (respectively) on a second polypeptide chain (WO 02/02781). hi one embodiment, a binding molecule ofthe invention is a diabody fused to at least one heavy chain portion. In a prefened embodiment, a binding molecule ofthe invention is a diabody fused to a CH3 domain.
In one embodiment a modified antibody ofthe invention a binding molecule comprisies a tetravalent or bispecific tetravalent CH2 domain-deleted antibody with a scFv appended to the N-terminus ofthe light chain. In another embodiment of the invention, a binding molecule comprises a a tetiavalent or bispecific tetravalent CH2 domain-deleted antibody with a scFv appended to the N-terminus ofthe heavy chain. In one embodiment, the attachment ofthe scFv to the N-terminus results in reduced aggregation ofthe molecules as compared to molecules in which the scFv is attached at the carboxy-terminus. hi one embodiment, less than about 30% aggregates are present in a composition of binding molecules produced by cells expressing a N-terminal fusion constiruct. i one embodiment, less than about 20% aggregates are present in a composition of binding molecules produced by cells expressing a N-terminal fusion construct. In one embodiment, less than about 10% aggregates are present in a composition of binding molecules produced by cells expressing a N-terminal fusion constiruct. In one embodiment, less than about 5% aggregates are present in a composition of binding molecules produced by cells expressing a N-terminal fusion construct.
Other forms of modified antibodies are also within the scope ofthe instant invention (e.g., WO 02/02781 Al; 5,959,083; 6,476,198 Bl; US 2002/0103345 Al; WO 00/06605; Bym et al. 1990. Nature. 344:667-70; Chamow and Ashkenazi. 1996. Trends Biotechnol. 14:52).
D. Catalytic antibodies In one embodiment, at least one binding specificity of a modified antibody molecule ofthe invention is catalytic. Catalytic binding specificities can be made using art recognized techniques (see, e.g., U.S. Pat. No. 6,590,080, U.S. Pat. No. 5,658,753). Catalytic binding specificities can work by a number of basic mechanisms similar to those identified for enzymes to stabilize the transition state, thereby reducing the free energy of activation. For example, general acid and base residues can be optimally positioned for participation in catalysis within catalytic active sites; covalent enzyme-substiate intermediates can be formed; catalytic antibodies can also be in proper orientation for reaction and increase the effective concentration of reactants by at least seven orders of magnitude (Fersht, A. R., et al., Am. Chem. Soc. 90 (1968):5833) and thereby greatly reduce the entropy of a chemical reaction. Finally, catalytic antibodies can convert the energy obtained upon substrate binding to distort the reaction towards a structure resembling the transition state. In one embodiment, acid or base residues can be brought into the binding site by using a complementary charged molecule as an immunogen. This technique proved successful for elicitation of antibodies with a hapten containing a positively- charged ammonium ion (Shokat, et al, Chem. Int. Ed. Engl. 27 (1988):269-271). In another approach, antibodies can be elicited to stable compounds that resemble the size, shape, and charge ofthe tiansition state of a desired reaction (i.e., transition state analogs). See U.S. Pat. No. 4,792,446 and U.S. Pat. No. 4,963,355 which describe the use of tiansition state analogues to iinmunize animals and the production of catalytic antibodies. Both of these patents are hereby incoφorated by reference. In one embodiment, such molecules can be admimstered as part of an immunoconjugate, e.g., with an immunogenic carrier molecule, such as KLH. Exemplary catalytic binding specificities can have, e.g., esterase activity
(involving a charged transition state whose electrostatic and shape characteristics can be mimicked by a phosphonate structure; Jacobs, et al., J. Am. Chem. Soc. 109 (1987):2174-2176; Durfor, et al., J. Am. Chem. Soc. 110 (1988):8713-8714; Tramontano, et al., J. Am. Chem. Soc. 110 (1988):2282; Pollack, et al., J. Am. Chem. Soc. Ill (1989):5961-5962); peptidase or amidase activity (Janda, et al., Science 241 (1988):1188-1191; Iverson, et al., Science 243 (1989):1184-1188; Paul, et al., Science 244 (1989):1158-1162); Claisen reanangement (Jackson, et al., J. Am. Chem. Soc. 110 (1988):4841-4842; Hilvert, et al., Proc. Natl. Acad. Sci. USA 85 (1988):4953-4955; Hilvert, et al., J. Am. Chem. Soc. 110 (1988):5593-5594); redox reactions (Shokat, et al., Angew. Chem. Int. Ed. Engl. 27 (1989):269-271); photochemical cleavage of a thymine dimer (Cochran, et al., J. Am. Chem. Soc. 110 (1988):7888-7890); stereospecific transesterification reanangements (Napper, et al., Science 237 (1987):1041-1043); or a bimolecular amide synthesis (Benkovic, et al., Proc. Natl. Acad. Sci. USA 85 (1988):5355-5358; Janda, et al., Science 241 (1988):1188-1191). In another approach, conventional binding specificities can be mutated to render them catalytic. Methods of screening for catalytic antibody activity are well known in the art (e.g., Reymond, J.L. 2002. Journal of Immunological Methods 269:125; Mouratou et al. 2002. J. of Immunological Methods. 269:147. hi yet another embodiment, catalytic B cells can be selected, e.g., as described in US patent 6,590,080 using a molecule can be constructed which facilitates selection of catalytic B cells. In another embodiment, catalytic binding specificities can be developed as part of a two step process. Catalytic antibodies can be selected only if displaying the following binding features: binding both the substrate and a reactive group in such a way that the two groups are in a reactive position towards each other. Second, the selected antibodies can be chemically engineered by covalently binding a reactive group into the binding pocket ofthe antibody. J Immunol Methods. 2002. 269:81-98. hi one embodiment, a catalytic binding specificity is specific for a prodrug. Such a binding specificity can be used to catalyze the conversion of a prodrug into a drug which is effective in vivo. Preferably, the reaction catalyzed is one that cannot be accomplished by natural enzymes in vivo. Examples of prodrug activation by antibodies are known in the art (see, e.g., Miyashita et al. 1993. Proc. Natl. Acad. Sci. USA 90:5337). In one embodiment, a modified antibody molecule ofthe invention comprises at least one binding specificity for a target cell and at least one binding specificity for a prodrug. For example, in a prefened embodiment, an modified antibody molecule ofthe invention comprises at least one binding specificity for a tumor cell and at least one binding specificity for a prodrug which can be converted to cytotoxic drug. In one example, a modified antibody ofthe invention comprises a binding specificity for a carbamate prodrug 4-[N,N,-bis(2-chloroethyl)]aminophenyl-N- [(lS-(l,3-dicarboxy)propyl]carbamate and generates the conesponding cytotoxic nitrogen mustard (Wentworth et al. 1996. Proc Natl. Acad. Sci. USA. 93:799). hi one embodiment, the modified antibody is admimstered prior to admimstration ofthe prodrug to allow accumulation at the site ofthe target cell. Exemplary prodrugs are known in the art. Prodrugs can also be synthesized by incoφorating a portion designed to be released by catalytic action, e.g., by sequential retro-aldol/retro-Michael reactions catalyzed by an antibody with aldolase activity.
(Shabat et al. 2001. Proc. Natl. Acad. Sci. USA 98:7428). Such drug masking portions can be made, e.g., by modification of hydroxyl or thiol groups of drugs.
E. Multispecific Binding Molecules hi one embodiment, a binding molecule ofthe invention is multispecific, i.e., has at least one binding site that binds to a first molecule or epitope of a molecule and at least one second binding site that binds to a second molecule of epitope of a molecule. In one embodiment, a binding molecule ofthe invention is bispecific.
Bispecific molecules can bind to two different target sites, e.g., on the same target molecule or on different target molecules. For example, in the case of antibodies, bispecific molecules can bind to two different epitopes, e.g., on the same antigen or on two different antigens. Bispecific molecules can be used, e.g., in diagnostic and therapeutic applications. For example, they can be used to immobilize enzymes for use in immunoassays. They can also be used in diagnosis and treatment of cancer, e.g., by binding both to a tumor associated molecule and a detectable marker (e.g., a chelator which tightly binds a radionuclide. Bispecific molecules can also be used for human therapy, e.g., by directing cytotoxicity to a specific target (for example by binding to a pathogen or tumor cell and to a cytotoxic trigger molecule, such as the T cell receptor or the Fcγ receptor. Bispecific antibodies can also be used, e.g., as fibrinolytic agents or vaccine adjuvants. Examples of bispecific binding molecules include those with at least two arms directed against tumor cell antigens; bispecific binding molecules with at least one arm directed against a tumor cell antigen and the at least one arm directed against a cytotoxic trigger molecule (such as anti-Fc.gamma.RI/anti-CD 15, anti- pl85.sup.HER2/Fc.gamma.Rπi (CD16), anti-CD3/anti-malignant B-cell (1D10), anti- CD3/anti-pl85.sup.HER2, anti-CD3/anti-p97, anti-CD3/anti-renal cell carcinoma, anti- CD3/anti-OVCAR-3, anti-CD3/L-Dl (anti-colon carcinoma), anti-CD3/anti-melanocyte stimulating hormone analog, anti-EGF receptor/anti-CD3, anti-CD3/anti-CAMAl, anti- CD3/anti-CD19, anti-CD3/MoV18, anti-neural cell adhesion molecule (NCAMVanti- CD3, anti-folate binding protein (FBP)/anti-CD3, anti-pan carcinoma associated antigen (AMOC-3 l)/anti-CD3); bispecific binding molecules with at least one which binds specifically to a tumor antigen and at least one which binds to a toxin (such as anti- saporin/anti-Id-1, anti-CD22/anti-saporm, anti-CD7/anti-saporin, anti-CD38/anti- saporin, anti-CEA/anti-ricin A chain, anti-interferon-.alpha.(IFN-.alpha.)/anti-hybridoma idiotype, anti-CEA/anti-vinca alkaloid); bispecific binding molecules for converting enzyme activated prodrugs (such as anti-CD30/anti-alkaline phosphatase (which catalyzes conversion of mitomycin phosphate prodrug to mitomycin alcohol)); bispecific binding molecules which can be used as fibrinolytic agents (such as anti-fibrin/anti- tissue plasminogen activator (tPA), anti-fibrin/anti-urokinase-type plasminogen activator (uPA)); bispecific binding molecules for targeting immune complexes to cell surface receptors (such as anti-low density lipoprotein (LDL)/anti-Fc receptor (e.g.
Fc.gamma.PJ, Fc.gamma.RJJ or Fc.gamma.J_Un)); bispecific binding molecules for use in therapy of infectious diseases (such as anti-CD3/anti-heφes simplex vims (HSV), anti-T-cell receptor:CD3 complex/anti-influenza, anti-Fc.gamma.R/anti-HIV; bispecific binding molecules for tumor detection in vitro or in vivo such as anti-CEA/anti- EOTUBE, anti-CEA/anti-DPTA, anti-pl 85HER2/anti- -hapten); bispecific binding molecules as vaccine adjuvants (see Fanger et al., supra); and bispecific binding molecules as diagnostic tools (such as anti-rabbit IgG/anti-ferritin, anti-horse radish peroxidase (HRP)/anti-hormone, anti-somatostatin/anti-substance P, anti-HRP/anti- FITC, anti-CEA/anti-.beta.-galactosidase (see Nolan et al., supra)). Examples of trispecific antibodies include anti-CD3/anti-CD4/anti-CD37, anti-CD3/anti-CD5/anti- CD37 and anti-CD3/anti-CD8/anti-CD37. hi a prefened embodiment, a bispecific molecule ofthe invention binds to CPJPTO-I. Bispecific molecules may be monovalent for each specificity or be multivalent for each specificity. For example, an antibody molecule or fusion protein may comprise one binding site that reacts with a first target molecule and one binding site that reacts with a second target molecule or it may comprise two binding sites that react with a first target molecule and two binding sites that react with a second target molecule. Methods of producing bispecific molecules are well known in the art. For example, recombinant technology can be used to produce bispecific molecules, e.g., diabodies, single-chain diabodies, tandem scFvs, etc. Exemplary techniques for producing bispecific molecules are known in the art (e.g., Kontermann et al. Methods in Molecular Biology Vol. 248: Antibody Engineering: Methods and Protocols. Pp 227- 242 US 2003/0207346 Al and the references cited therein; ). In one embodiment, a multimeric bispecific molecules are prepared using methods such as those described e.g., in US 2003/0207346 Al or US patent 5,821,333, or US2004/0058400. As used herein the phrase "multispecific fusion protein" designates fusion proteins (as hereinabove defined) having at least two binding specificities (i.e. combining two or more binding domains of a ligand or receptor). Multispecific fusion proteins can be assembled as heterodimers, heterotrimers or heterotetiamers, essentially as disclosed in WO 89/02922 (published Apr. 6, 1989), in EP 314, 317 (published May 3, 1989), and in U.S. Pat. No. 5,116,964 issued May 2, 1992. Prefened multispecific fusion proteins are bispecific. Examples of bispecific fusion proteins include CD4- IgG/TNFreceptor-IgG and CD4-IgG/L-selectin-IgG. The last mentioned molecule combines the lymph node binding function ofthe lymphocyte homing receptor (LHR, L- selectin), and the HIV binding function of CD4, and finds potential application in the prevention or treatment of HIV infection, related conditions, or as a diagnostic. Target binding sites for the multispecific binding molecules ofthe invention can readily be selected by one of ordinary skill in the art. While not limiting in any way, exemplary binding sites include one or more epitopes of a tumor antigen. Other exemplary target molecules include one or more epitopes of, e.g., heparin sulfate, growth factors or their receptors (e.g., epidermal growth factor receptor, insulin-like growth factor receptor, hepatocyte growth factor (HGF/SF) receptor, MORE
(See, e.g., Cao et al. Proc. Natl. Acad. Sci 2001. 98:7443; Lu et al. 2004. J. Biol. Chem. 279:2856). In another embodiment, the invention pertains to bispecific molecules, e.g., antibodies, which incoφorate at least one binding site that binds to a known target and at least one binding site which recognizes an unknown target (for example, in one embodiment, the bispecific molecule incoφorates binding sites selected from a semi- synthetic antibody phage display library). In one embodiment ofthe invention, one of ordinary skill in the art could start with a single chain antibody of known specificity and build a Fab library using techniques known in the art or, alternatively, the skilled artisan could start with an Fab fragment of known specificity and build a single chain library using techniques known in the art. It is known in the art that libraries from nonimmunized sources and prepared by synthetic recombination of V-gene sequences (preferably recombination of VH with, DH and JH, and VL with JL sequences) can be used to isolate antibodies to any antigen. For example, patent application WO92/01047 teaches that antibody fragments can be displayed on the surface of bacteriophage and that they will bind antigen. Antibody fragments (e.g., Fab, Fv, ScFv and VH) can be directly selected using this characteristic. Other methods known in the art include those taught, e.g., in U.S. patent 5,698,426; 6,291,159; 5,658,727; 5,667,988; and 5,969,108. In another embodiment, scFv which recognize a known target can be dimerized with scFv isolated from a semi-synthetic human phage antibody display library, (see, e.g., Kruif and Logtenberg 1996. J. Biol. Chem. 271:7630). In one embodiment, the subject bispecific molecule is expressed in any expression system used to express antibody molecules, for example mammalian cells, yeast such as Picchia, E. coli, Bacculovirus, etc. In one embodiment, the subject bispecific molecule is expressed in the NEOSPLA vector system (see, e.g., U.S. patent 6,159,730). This vector contains the cytomegalovirus promoter/enhancer, the mouse beta globin major promoter, the SV40 origin of replication, the bovine growth hormone polyadenylation sequence, neomycin phosphotiansferase exon 1 and exon 2, the dihydrofolate reductase gene and leader sequence. In one embodiment, the subject bispecific molecules comprise a synthetic connecting peptide. These bispecific molecules have one or more binding sites for a known target and express a library at one or more binding sites. Such bispecific molecules can be used, e.g., to identify molecules in close proximity to or associated with the known target. For example, the skilled artisan could use the subject bispecific molecules in an assay to select for those that induce a particular response, e.g., apoptosis or cellular activation, using screening methods well known in the art. The bispecific molecule identified as producing the response screened for can then be identified and its specificity determined. Using such methods it is possible to identify molecules in close association with particular targets of interest, e.g., T cell markers or other signaling molecules (such as CRIPTO-I, death domain molecules, or molecules involved in apoptosis). The proximity ofthe known target and the molecule newly identified as a "nearest neighbor" can be confirmed using immunoprecipitation or other techniques known to those of skill in the art. Using these methods it is possible to identify molecules as targets for modulating a particular cellular response.
In one embodiment, a polypeptide molecule ofthe invention comprises an amino acid sequence encoded by a nucleic acid molecule comprising a nucleic acid sequence shown in Figure 8A (SEQ ID NO:16), Figure 8B (SEQ 3D NO:17), Figure 8C (SEQ ID NO: 18), Figure 10A (SEQ 3D NO:22), Figure 10B (SEQ 3D NO:23). In another embodiment, a nucleic acid molecule ofthe invention comprises a nucleotide sequence shown in Figure 8A (SEQ 3D NO: 16), Figure 8B (SEQ ID NO: 17), Figure 8C (SEQ ID NO: 18), Figure 10A (SEQ 3D NO:22), Figure 10B (SEQ 3D NO:23). In another embodiment, a polypeptide ofthe invention comprises an amino acid sequence shown in Figure 9A (SEQ 3D NO: 19), Figure 9B (SEQ 3D NO:20), Figure 9C (SEQ ID NO:21), Figure 11 A (SEQ 3D NO:24), or Figure 1 IB (SEQ 3D NO:25). In another embodiment, a polypeptide ofthe invention is encoded by a nucleic acid molecule comprising the nucleotide sequence shown in Figure 12A (SEQ 3D NO:26), Figure 12B (SEQ 3D NO:27), Figure 14 (SEQ 3D NO:30), or Figure 15 (SEQ ID NO:31). hi another embodiment, a nucleic acid molecule of the invention comprises a nucleotide sequence shown in Figure 12A (SEQ 3D NO:26), Figure 12B (SEQ ID NO:27), Figure 14 (SEQ ID NO:30), or Figure 15 (SEQ ID NO:31). In one embodiment, a polypeptide molecule ofthe invention comprises an amino acid sequence shown in Figure 13A (SEQ 3D NO:28), Figure 13B (SEQ ID NO:29), Figure 16 (SEQ 3D NO:32), or Figure 17 (SEQ 3D NO:33). The other nucleic acid and amino acid sequences disclosed herein in the sequence listing and Figures are also embraced by the invention.
B. Expression of Polypeptides
Following manipulation ofthe isolated genetic material to provide polypeptides ofthe invention as set forth above, the genes are typically inserted in an expression vector for introduction into host cells that may be used to produce the desired quantity of modified antibody that, in turn, provides the claimed polypeptides. The term "vector" or "expression vector" is used herein for the pturposes of the specification and claims, to mean vectors used in accordance with the present invention as a vehicle for introducing into and expressing a desired gene in a cell. As known to those skilled in the art, such vectors may easily be selected from the group consisting of plasmids, phages, viruses and retroviruses. In general, vectors compatible with the instant invention will comprise a selection marker, appropriate restriction sites to facihtate cloning ofthe desired gene and the ability to enter and/or replicate in eukaryotic or prokaryotic cells. For the puφoses of this invention, numerous expression vector systems may be employed. For example, one class of vector utilizes DNA elements which are derived from animal viruses such as bovine papilloma virus, polyoma virus, adenovirus, vaccinia virus, baculovirus, retroviruses (RSV, MMTV or MOMLV) or SV40 vims. Others involve the use of polycistronic systems with internal ribosome binding sites. Exemplary vectors include those taught in U.S. patent no. 6,159,730 or 6,413,777 or US 2003 0157641 Al). Additionally, cells which have integrated the DNA into their chromosomes may be selected by introducing one or more markers which allow selection of transfected host cells. The marker may provide for prototrophy to an auxotiophic host, biocide resistance (e.g., antibiotics) or resistance to heavy metals such as copper. The selectable marker gene can either be directly linked to the DNA sequences to be expressed, or introduced into the same cell by cotransformation. In one embodiment, an inducible expression system can be employed. Additional elements may also be needed for optimal synthesis of nrRNA. These elements may include signal sequences, splice signals, as well as transcriptional promoters, enhancers, and termination signals. In one embodiment, a secretion signal, e.g., any one of several well characterized bacterial leader peptides (e.g., pelB, phoA, or ompA), can be fused in- frame to the N terminus of a polypeptide ofthe invention to obtain optimal secretion of the polypeptide. (Lei et al. 1988 Nature 331:543; Better et al. Science 1988. 240:1041; Mullinax et al., 1990. Proc. Natl. Acad. Sci. USA 87:8095). In one embodiment, a vector can be used which comprises a nucleic acid sequence encoding a peptide linker, hi another embodiment, it might be desirable to first assemble the desired coding sequences (e.g., secretion signal, VL, linker peptide, VH, etc.) into a single sequence, for example, by PCR amplification using overlapping primers, followed by ligation into a plasmid or other vector. hi particularly prefened embodiments the cloned variable region genes are inserted into an expression vector along with the heavy and light chain constant region genes (preferably human) modified as discussed above. Preferably, this is effected using a proprietary expression vector of -DEC, hie, refened to as NEOSPLA see U.S. patent 6,159,730. This vector contains the cytomegalovirus promoter/enhancer, the mouse beta globin major promoter, the SV40 origin of replication, the bovine growth hormone polyadenylation sequence, neomycin phosphotiansferase exon 1 and exon 2, the dihydrofolate reductase gene and leader sequence. As seen in the examples below, this vector has been found to result in very high level expression of antibodies upon incoφoration of variable and constant region genes, transfection in CHO cells, followed by selection in G418 containing medium and methotrexate amplification. Vector systems are also taught in U.S. Pat. Nos. 5,736,137 and 5,658,570, each of which is incoφorated by reference in its entirety herein. This system provides for high expression levels, e.g., > 30 pg/cell/day. Other exemplary vector systems are disclosed e.g., in U.S. patent 6,413,777. hi other prefened embodiments the polypeptides ofthe invention ofthe instant invention may be expressed using polycistronic constructs such as those disclosed in United States provisional application No. 60/331,481 filed November 16, 2001 and incoφorated herein in its entirety. In these novel expression systems, multiple gene products of interest such as heavy and light chains of antibodies may be produced from a single polycistronic constiruct. These systems advantageously use an internal ribosome entry site (IRES) to provide relatively high levels of polypeptides ofthe invention in eukaryotic host cells. Compatible IRES sequences are disclosed in U.S. Pat. No. 6,193,980 which is also incoφorated herein. Those skilled in the art will appreciate that such expression systems may be used to effectively produce the full range of polypeptides disclosed in the instant application. More generally, once the vector or DNA sequence encoding a monomeric subunit ofthe polypeptide (e.g. a modified antibody) has been prepared, the expression vector may be introduced into an appropriate host cell. That is, the host cells may be transformed. Introduction ofthe plasmid into the host cell can be accomplished by various techniques well known to those of skill in the art. These include, but are not limited to, transfection (including electrophoresis and electroporation), protoplast fusion, calcium phosphate precipitation, cell fusion with enveloped DNA, microinjection, and infection with intact vims. See, Ridgway, A. A. G. "Mammalian Expression Vectors" Chapter 24.2, pp. 470-472 Vectors, Rodriguez and Denhardt, Eds. (Butterworths, Boston, Mass. 1988). Most preferably, plasmid introduction into the host is via electroporation. The transformed cells are grown under conditions appropriate to the production ofthe light chains and heavy chains, and assayed for heavy and/or light chain protein synthesis. Exemplary assay techniques include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), or flourescence-activated cell sorter analysis (FACS), immunohistochemistry and the like. As used herein, the term "transformation" shall be used in a broad sense to refer to any introduction of DNA into a recipient host cell that changes the genotype and consequently results in a change in the recipient cell. Along those same lines, "host cells" refers to cells that have been transformed with vectors constructed using recombinant DNA techniques and encoding at least one heterologous gene, hi descriptions of processes for isolation of antibodies from recombinant hosts, the terms "cell" and "cell culture" are used interchangeably to denote the source of antibody unless it is clearly specified otherwise, hi other words, recovery of polypeptide from the "cells" may mean either from spun down whole cells, or from the cell culture containing both the medium and the suspended cells. The host cell line used for protein expression is most preferably of mammalian origin; those skilled in the art are credited with ability to preferentially determine particular host cell lines which are best suited for the desired gene product to be expressed therein. Exemplary host cell lines include, but are not limited to, DG44 and DUXBl 1 (Chinese Hamster Ovary lines, DHFR minus), HELA (human cervical carcinoma), CVI (monkey kidney line), COS (a derivative of CVI with SV40 T antigen), R1610 (Chinese hamster fibroblast) BALBC/3T3 (mouse fibroblast), HAK (hamster kidney line), SP2/O (mouse myeloma), P3.times.63-Ag3.653 (mouse myeloma), BFA- lclBPT (bovine endothelial cells), RAJI (human lymphocyte) and 293 (human kidney). CHO cells are particularly prefened. Host cell lines are typically available from commercial services, the American Tissue Culture Collection or from published literature. In another embodiment, a host cell is a prokaryotic cell, e.g., a strain which allows the formation of disulfide bonds (Derrnan, AI, et al. 1993. Science. 262:1744; Bessette, PH. Et al. 1999. Proc. Natl. Acad. Sci. USA 96:13703). In vitro production allows scale-up to give large amounts ofthe desired polypeptides. Techniques for mammalian cell cultivation under tissue culture conditions are known in the art and include homogeneous suspension culture, e.g. in an airlift reactor or in a continuous stiner reactor, or immobilized or entrapped cell culture, e.g. in hollow fibers, microcapsules, on agarose microbeads or ceramic cartridges. If necessary and/or desired, the solutions of polypeptides can be purified by the customary chromatography methods, for example gel filtration, ion-exchange chromatography, chromatography over DEAE-cellulose or (immuno-)affinity chromatography, e.g., after preferential biosynthesis of a modified hinge region polypeptide or prior to or subsequent to the HIC chromatography step described herein. Genes encoding the polypeptide ofthe invention can also be expressed non-mammalian cells such as bacteria or yeast or plant cells. In this regard it will be appreciated that various unicellular non-mammalian microorganisms such as bacteria can also be transformed; i.e. those capable of being grown in cultures or fermentation. Bacteria, which are susceptible to transformation, include members ofthe enterobacteriaceae, such as strains of Escherichia coli or Salmonella; Bacillaceae, such as Bacillus subtilis; Pneumococcus; Streptococcus, and Haemophilus influenzae. It will further be appreciated that, when expressed in bacteria, the polypeptides typically become part of inclusion bodies. The polypeptides must be isolated, purified and then assembled into functional molecules. Where tetravalent forms of antibodies are desired, the subunits will then self-assemble into tetravalent antibodies (WO02/096948A2). In addition to prokaryates, eukaryotic microbes may also be used. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used among eukaryotic microorganisms although a number of other strains are commonly available. For expression in Saccharomyces, the plasmid YRp7, for example, (Stinchcomb et al., Nature, 282:39 (1979); Kingsman et al., Gene, 7:141 (1979); Tschemper et al., Gene, 10:157 (1980)) is commonly used. This plasmid already contains the TRP1 gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No.44076 or PEP4-1 (Jones, Genetics, 85:12 (1977)). The presence ofthe tipl lesion as a characteristic ofthe yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.
IV. Separation of Polypeptides Comprising at Least One Interchain Disulfide Linkage From Those Lacking Interchain Disulfide Linkages In one aspect, the invention pertains to separation of molecules having two heavy chain portions from a mixture, where a fraction ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage and a fraction ofthe molecules comprise heavy chain portions that are not linked via at least one disulfide linkage by hydrophobic interaction chromatography. Hydrophobic interaction chromatography was first developed following the observation that proteins could be retained on affinity gels which comprised hydrocarbon spacer arms but lacked the affinity ligand. Elution from HIC supports can be effected by alterations in solvent, pH, ionic strength, or by the addition of chaotropic agents or organic modifiers, such as ethylene or propylene glycol. A description ofthe general principles of hydrophobic interaction chromatography can be found e.g., in U. S. Patent 3,917,527 and in U. S. Patent 4,000,098. HIC in the context of high performance liquid chromatography (HPLC) has been used to separate antibody fragments lacking heavy chain portions (e.g., F(ab')2) from intact antibody molecules in a single step protocol. (Morimoto, K. et al., L Biochem. Biophvs. Meth. 24: 107 (1992)). The separation method ofthe invention can be performed on an unpurified population of polypeptides (e.g., culture supematants or preparations or preparations of polypeptides isolated from prokaryotic inclusion bodies). Alternatively, the instant separation methods can be used on polypeptide mixtures obtained after one or more initial purification steps, e.g., after a preparation comprising forms A and B has been eluted from an affinity matrix. hi one embodiment, the binding molecules subjected to HIC chromatography comprise a connecting peptide ofthe invention. In a prefened embodiment, HIC can be applied to mixtures that have been partially purified by other protein purification procedures. The term "partially purified" as used herein includes a protein preparation in which the protein of interest is present in at least 5 % by weight, more preferably at least 10% and most preferably at least 45%. Initial or subsequent purification steps can be used to remove, e.g., immunoglobulin aggregates, misfolded species, host cell protein, residue material from preceding chromatographic steps (such as Protein A when employed). In one embodiment, HIC can be performed on polypeptides comprising a connecting peptide of the invention. Accordingly, the application of HIC can also be appreciated in the context of an overall purification protocol. Exemplary purification steps that can be used prior to or subsequent to HIC include: affinity chromatography (for example, PROSEP-A® (BioProcessing Ltd., U.K.) which consists of Protein A covalently coupled to controlled pore glass or Protein A SEPHAROSE® Fast Flow (Pharmacia) or TOYOPEARL 650M Protein A (TosoHaas)). Protein A is prefened for human γl, γ 2, or γ 4 heavy chains and protein G for mouse isotypes. Bakerbond ABXtm resin can be used if the molecule comprises a CH3 domain. In addition or alternatively, ion exchange chromatography may be employed. In this regard various anionic or cationic substituents. may be attached to matrices in order to form anionic or cationic supports for chromatography. Anionic exchange substituents include diethylaminoethyl(DEAE), quaternary aminoethyl(QAE) and quaternary amine(Q) groups. Cationic exchange substituents. include carboxymethyl (CM), sulfoethyl(SE), sulfopropyl(SP), phosphate(P) and sulfonate(S). Cellulose ion exchange resins such as DE23, DE32, DE52, CM-23, CM-32 and CM-52 are available from Whatman Ltd. Maidstone, Kent, U.K. SEPHADEX®-based and -locross-linked ion exchangers are also known. For example, DEAE-, QAE-, CM-, and SP- SEPHADEX® and DEAE-, Q-, CM-and S- SEPHAROSE® and SEPHAROSE® Fast Flow are all available from Pharmacia AB. Further, both DEAE and CM derivitized ethylene glycol-methacrylate copolymer such as TOYOPEARL DEAE-650S or M and TOYOPEARL CM-650S or M are available firom Toso Haas Co., Philadelphia, Pa. Because elution from ion exchange supports usually involves addition of salt and because HIC is enhanced under increased salt concentrations, the introduction of a HIC step following an ionic exchange chromatographic step or other salt mediated purification step is prefened. Additional purification protocols may be added including but not necessarily limited to: further ionic exchange chromatography, size exclusion chromatography, viral inactivation, concentration and freeze drying, hydroxylapatite chromatography, gel electrophoresis, dialysis, ethanol precipitation, reverse phase HPLC, chromatography on silica, chromatography on heparin SEQHAROSE™, chromatofocusing, or ammom'um sulfate precipitation. Prior to purification using the subject methods, the composition comprising the mixture of polypeptides to be separated will preferably be placed in a buffer of acidic or approximately neutial pH. This can be done, for example, by adding concentrated buffer, resuspending the sample in the buffer, exchanging the buffer ( e.g., using dialysis or ultrafiltiation). Alternatively, the pH ofthe sample buffer can simply be adjusted to be within the desired range. Hydrophobic interactions are strongest at high ionic strength, therefore, this form of separation is conveniently performed following salt precipitations or ion exchange procedures. Adsoφtion ofthe proteins to a HIC column is favored by high salt concentrations, but the actual concentrations can vary over a wide range depending on the nature ofthe protein and the particular HIC ligand chosen. Various ions can be ananged in a so-called soluphobic series depending on whether they promote hydrophobic interactions (salting-out effects) or disrupt the structure of water
(chaotropic effect) and lead to the weakening ofthe hydrophobic interaction. Cations are ranked in terms of increasing salting out effect as Ba++<; Ca++<; Mg^ <; Li+ <; Cs+ <; Na+ <; K+ <; Rb+ <; NH4 +, while anions may be ranked in terms of increasing chaotropic effect as PO- <; S04 " <; CH3COOO" <; CF <; B <; NO3 " <; C104 " <; T <; SCN" In general, Na, K or NH4 sulfates effectively promote ligand-protein interaction in HIC. Salts may be formulated that influence the strength ofthe interaction as given by the following relationship: (NH )2SO4 >; Na SO >; NaCl >;NH C1 >; NaBr >; NaSCN. In general, salt concentrations of between about 0.75 and about 2M ammonium sulfate or between about 1 and 4M NaCl are useful. A number of chromatographic supports may be employed in the preparation of HIC columns, the most extensively used are agarose, silica and organic polymer or co-polymer resins. The hydrophobic interaction material is generally a base matrix (e.g., a hydrophilic carbohydrate (such as cross-linked agarose) or synthetic copolymer material) to which hydrophobic ligands (e.g., alkyl or aryl groups) are . coupled. The prefened HIC material comprises an agarose resin substituted with phenyl groups. Exemplary HIC material includes: phenyl SEPHAROSE™, FAST FLOW with low or high substitution (Pharmacia LKB Biotechnology, AB, Sweden); phenyl SEPHAROSE™ High Performance column; phenyl or butyl-SEPHAROSE® CL-4B, butyl- SEPHAROSE® FF, octyl-SEPHAROSE® FF and phenyl-SEPHAROSE® FF (Pharmacia LKB Biotechnology AB, Sweden); FractogelTM EMD Propyl or
FRACTOGEL™ EMC Phenyl columns (E. Merck, Germany); MACROPREP™ Methyl or MACRO-PREP™ t-Butyl Supports (Bio-Rad, California); WP Hl-Propyl (C3) ™ column (J.T. Baker, New Jersey). Exemplary HIC materials are also available from Tosoh Coφoration, Tokyo, Japan under the product names TOYOPEARL ether 650, phenyl 650, butyl 650 (Fractogel), ether-5PW-HR, or phenyl-5PW-HR; Miles-Yeda, Rehovot, Israel under the product name alkyl-agarose, wherein the alkyl group contains from 2-10 carbon atoms, and J.T. Baker, Phillipsburg, NJ. under the product name Bakerbond WP-HI-propyl. It is also possible to prepare the desired HIC column using conventional chemistry. (Sa: for example, Er-el. Z. gl all , Biochem. Biophys. Res. Comm. 49:383 (1972) orUlbrichN. rd gL Coll. Czech. Chem. Cornmum. 9:1466 (1964)). The choice of a particular gel can be determined by the skilled artisan, hi general the strength ofthe interaction ofthe protein and the HIC ligand increases with the chain length ofthe alkyl ligands but ligands having from about 4 to about 8 carbon atoms are suitable for most separations. A phenyl group has about the same hydrophobicity as a pentyl group, although the selectivity can be different owing to the possibility of pi-pi orbital interaction with aromatic groups on the protein. Selectively may also be affected by the chemistry ofthe supporting resin. Ligand density is an important parameter in that it influences not only the strength ofthe interaction but the capacity ofthe column as well. The ligand density of the commercially available phenyl or octyl phenyl gels is on the order of 40 pmoles/ml gel bed. Gel capacity is a function ofthe particular protein in question as well as pH, temperature and salt type and concentration but generally can be expected to fall in the range of 3-20 mg ml of gel. In general, a decrease in temperature decreases the interaction with HIC material. However, any benefit that would accrue by increasing the temperature must also be weighed against -adverse effects such an increase may have on the stability ofthe protein. In one embodiment, the polypeptides ofthe invention can be eluted isocratically. isocratic elution, all compounds begin migration through the column at onset. However, each migrates at a different rate, resulting in faster or slower elution rate. For example, as described in the instant examples, form A can be eluted with the flow through of the column. In another embodiment, one or more polypeptides ofthe invention can be bound to the column and eluted, e.g., using stepwise elution or gradient elution. Elution, whether stepwise or in the form of a gradient, can be accomplished in a variety of ways: (a) by changing the salt concentration, (b) by changing the polarity ofthe solvent or (c) by adding detergents. By decreasing salt concentration adsorbed proteins are eluted in order of increasing hydrophobicity. Changes in polarity may be affected by additions of solvents such as ethylene or propylene glycol or (iso)propanol, thereby decreasing the strength ofthe hydrophobic interactions. Detergents function as displacers of proteins and have been used primarily in connection with the purification of membrane proteins In performing the separation, the polypeptide mixture can be contacted with the HIC material e.g., using a batch purification technique or using a column. Prior to HIC purification it may be desirable to remove any chaotropic agents or very hydrophobic substances, e.g., by passing the mixture through a precolumn. For example, for batch purification, HIC material is prepared in or equilibrated to the desired starting buffer. A slurry ofthe HIC material is obtained. The polypeptide solution is contacted with the slurry to adsorb at least one ofthe polypeptides to be separated to the HIC material. The solution containing the polypeptides that do not bind to the HIC material is separated from the slurry, e.g., by allowing the slurry to settle and removing the supernatant. The slurry can be subjected to one or more washing steps. If desired, the slurry can be contacted with a solution of lower conductivity to desorb polypeptides that have bound to the HIC material. In order to elute bound polypeptides, the salt concentiation can be decreased. m one embodiment, the HIC material can be packed in a column. A mixture comprising the polypeptides to be separated can be applied to the column allowing at least one ofthe polypeptides to be separated to adsorb to the column. The polypeptides that do not adsorb to the column pass through and can be collected. In order to elute bound polypeptides, the salt concentiation can be decreased, e.g., in a step- wise fashion or using a salt gradient. Since form B is more hydrophobic than form A, it adsorbs ineversibly to the stationary phase using approximately 0.7 M (e.g., 0.73M)Ammonium Sulfate / 20 mM Sodium Phosphate, pH 4.0 to pH 8.0 as the mobile phase. Form A binds to a lesser extent to the stationary phase under these conditions and is therefore eluted isocratically, i.e. it leaves the column with the flowthrough fraction. Subsequent to the isocratic elution of form A, omitting Ammonium sulfate from the mobile phase desorbs form B. In an exemplary purification scheme, the HIC material is equilibrated in a buffer comprising a salt concentration yielding a conductivity of from between about 160 to about 110, preferably from between about 140 to about 115, even more preferably from between about 130 or about 120 to about 117 mS/cm. For example, an exemplary starting solution comprises a salt concentration of approximately IM to 0.7M, e.g., IM to 0.7M ammonium sulfate. In a prefened embodiment, the solution comprising the mixture of polypeptides to be separated is also brought to the same, or approximately the same conductivity (e.g., using a concentrated stock solution of salt). Under these conditions, Form A is eluted from the column at a conductivity of about 120mS/cm. In order to elute Form B, a stepwise or linear gradient of reducing ammonium sulfate content can be applied to the column. Form B elutes at a conductivity of approximately 115 to approximately lOOmS/cm. 3h one embodiment, the subject purification method yields a composition comprising polypeptide molecules having at least two target binding sites and two heavy chain portions, wherein the heavy chain portions lack CH2 domains and wherein greater than about 50% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage. In another embodiment, greater than about 60% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage. In another embodiment, greater than about 70% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage. In another embodiment, greater than about 80% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage. In another embodiment, greater than about 90% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage. hi one embodiment, the subject purification method yields a composition comprising recombinant polypeptide molecules having at least two target binding sites and two heavy chain portions, wherein greater than about 99% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage. In one embodiment, the subject purification method yields a composition comprising polypeptide molecules having at least two target binding sites and two heavy chain portions, wherein greater than about 95% ofthe molecules are present in a form in which the two heavy chain portions are linked via at least one interchain disulfide linkage, and wherein the heavy chain portions ofthe polypeptides are derived from an antibody of the IgG4 isotype. In one embodiment, the subject purification method yields a composition comprising polypeptide molecules having two light chain portions and two heavy chain portions, wherein the heavy chain portions lack CH2 domains and wherein greater than about 80% ofthe molecules are present in a form in which the two heavy chain portions are not linked via at least one interchain disulfide linkage. In another aspect, the instant invention also provides methods for momtoring the results of purification and/or preferential biosynthesis comprising measuring the relative amounts of Form A and Form B in a composition. Form A and Form B can be measured, e.g., as described herein using non-reducing SDS polyacrylamide gel electrophoresis or mass spectrometry. V. Labeling or Conjugation of Polypeptides The polypeptide molecules ofthe present invention may be used in non- conjugated form or may conjugated to at least one of a variety of molecules, e.g., to facilitate antigen detection or for imaging or therapy ofthe patient. The polypeptides of the invention can be labeled or conjugated either before or after purification, when purification is performed. In particular, the polypeptides ofthe present invention may be conjugated to cytotoxins (such as radioisotopes, cytotoxic drugs, or toxins) therapeutic agents, cytostatic agents, biological toxins, prodrugs, peptides, proteins, enzymes, vimses, lipids, biological response modifiers, pharmaceutical agents, irnmunologically active ligands (e.g., lymphokines or antibodies wherein the resulting molecule binds to both the neoplastic cell and an effector cell such as a T cell), or PEG. In another embodiment, a polypeptide ofthe invention can be conjugated to a molecule that decreases vascularization of tumors. In other embodiments, the disclosed compositions may comprise polypeptides ofthe invention coupled to drugs or prodrugs. Still other embodiments ofthe present invention comprise the use of polypeptides ofthe invention conjugated to specific biotoxins or their cytotoxic fragments such as ricin, gelonin, pseudomonas exotoxin or diphtheria toxin. The selection of which conjugated or unconjugated polypeptide to use will depend on the type and stage of cancer, use of adjunct treatment (e.g., chemotherapy or external radiation) and patient condition. It will be appreciated that one skilled in the art could readily make such a selection in view ofthe teachings herein. It will be appreciated that, in previous studies, anti-tumor antibodies labeled with isotopes have been used successfully to destroy cells in solid tumors as well as lymphomas/leukemias in animal models, and in some cases in humans. Exemplary radioisotopes include: 90Y, 1251, 1311, 123I, mIn, 105Rh, 153Sm, 67Cu, 67Ga, 166Ho, 177Lu, 186Re and 188Re. The radionuclides act by producing ionizing radiation which causes multiple strand breaks in nuclear DNA, leading to cell death. The isotopes used to produce therapeutic conjugates typically produce high energy - or β-particles which have a short path length. Such radionuclides kill cells to which they are in close proximity, for example neoplastic cells to which the conjugate has attached or has entered. They have little or no effect on non-localized cells. Radionuclides are essentially non-immunogenic. With respect to the use of radiolabeled conjugates in conjunction with the present invention, polypeptides ofthe invention may be directly labeled (such as through iodination) or may be labeled indirectly through the use of a chelating agent. As used herein, the phrases "indirect labeling" and "indirect labeling approach" both mean that a chelating agent is covalently attached to a molecule and at least one radionuclide is associated with the chelating agent. Such chelating agents are typically refened to as bifunctional chelating agents as they bind both the polypeptide and the radioisotope. Particularly prefened chelating agents comprise l-isothiocycmatobenzyl-3- methyldiothelene triaminepentaacetic acid ("MX-DTPA") and cyclohexyl diethylenetriamine pentaacetic acid ("CHX-DTPA") derivatives. Other chelating agents comprise P-DOTA and EDTA derivatives. Particularly prefened radionuclides for indirect labeling include mIn and 90Y. As used herein, the phrases "direct labeling" and "direct labeling approach" both mean that a radionuclide is covalently attached directly to a polypeptide (typically via an aniino acid residue). More specifically, these linking technologies include random labeling and site-directed labeling. In the latter case, the labeling is directed at specific sites on the polypeptide, such as the N-linked sugar residues present only on the Fc portion ofthe conjugates. Further, various direct labeling techniques and protocols are compatible with the instant invention. For example, Technetium-99m labeled polypeptides may be prepared by ligand exchange processes, by reducing pertechnate (TcO4 ") with stannous ion solution, chelating the reduced technetium onto a Sephadex column and applying the polypeptides to this column, or by batch labeling techniques, e.g. by incubating pertechnate, a reducing agent such as SnCl , a buffer solution such as a sodium-potassium phthalate-solution, and the molecules. In any event, prefened radionuclides for directly labeling polypeptides are well known in the art and a particularly prefened radionuclide for direct labeling is 131I covalently attached via tyrosine residues. Polypeptides according to the invention may be derived, for example, with radioactive sodium or potassium iodide and a chemical oxidizing agent, such as sodium hypochlorite, chloramine T or the like, or an enzymatic oxidizing agent, such as lactoperoxidase, glucose oxidase and glucose. However, for the puφoses ofthe present invention, the indirect labeling approach is particularly prefened.
Patents relating to chelators and chelator conjugates are known in the art. For instance, U.S. Patent No. 4,831,175 of Gansow is directed to polysubstituted diethylenetriaminepentaacetic acid chelates and protein conjugates containing the same, and methods for their preparation. U.S. Patent Nos. 5,099,069, 5,246,692, 5,286,850, 5,434,287 and 5,124,471 of Gansow also relate to polysubstituted DTPA chelates. These patents are incoφorated herein in their entirety. Other examples of compatible metal chelators are ethylenediaminetetiaacetic acid (EDTA), diethylenetriaminepentaacetic acid (DPTA), 1,4,8,11-tetiaazatetiadecane, 1,4,8,11- tetraazatetradecane-1,4,8,11-tetiaacetic acid, l-oxa-4,7,12,15-tetraazaheptadecane- 4,7,12,15-tetiaacetic acid, or the like. Cyclohexyl-DTPA or CHX-DTPA is particularly prefened. Still other compatible chelators, including those yet to be discovered, may easily be discerned by a skilled artisan and are clearly within the scope ofthe present invention. Compatible chelators, including the specific bifunctional chelator used to facilitate chelation in co-pending application Serial Nos. 08/475,813, 08/475,815 and 08/478,967, are preferably selected to provide high affinity for trivalent metals, exhibit increased tumor-to-non-tumor ratios and decreased bone uptake as well as greater in vivo retention of radionuclide at target sites, i.e., B-cell lymphoma tumor sites. However, other bifunctional chelators that may or may not possess all of these characteristics are known in the art and may also be beneficial in tumor therapy. It will also be appreciated that, in accordance with the teacMngs herein, polypeptides may be conjugated to different radiolabels for diagnostic and therapeutic puφoses. To this end the aforementioned co-pending applications, herein incoφorated by reference in their entirety, disclose radiolabeled therapeutic conjugates for diagnostic "imaging" of tumors before administration of therapeutic molecule. "3h2B8" conjugate comprises a murine monoclonal antibody, 2B8, specific to human CD20 antigen, that is attached to mIh via a bifunctional chelator, i.e., MX-DTPA (diethylenetriaminepentaacetic acid), which comprises a 1 : 1 mixture of l-isothiocyanatobenzyl-3-methyl-DTPA and 1- methyl-3-isothiocyanatobenzyl-DTPA. m3h is particularly prefened as a diagnostic radionuclide because between about 1 to about 10 mCi canbe safely administered without detectable toxicity; and the imaging data is generally predictive of subsequent 90Y-labeled antibody distribution. Most imaging studies utilize 5 mCi π ^-labeled antibody, because this dose is both safe and has increased imaging efficiency compared with lower doses, with optimal imaging occurring at three to six days after antibody administration. See, for example, Munay, J. Nuc. Med. 26: 3328 (1985) and Catrraguillo et al, J. Nuc. Med. 26: 67 (1985). As indicated above, a variety of radionuclides are applicable to the present invention and those skilled in the can readily determine which radionuclide is most appropriate under various circumstances. For example, 131I is a well known radionuclide used for targeted immunotherapy. However, the clinical usefulness of 131I can be hmited by several factors including: eight-day physical half-life; dehalogenation of iodinated antibody both in the blood and at tumor sites; and emission characteristics (e.g., large gamma component) which can be suboptimal for localized dose deposition in tumor. With the advent of superior chelating agents, the opportunity for attaclriing metal chelating groups to proteins has increased the opportunities to utilize other radionuclides such as In and 90γ 90γ pj-Qyjdgg several benefits for utilization in radioimmunotherapeutic applications: the 64 hour half-life of 90Y is long enough to allow accumulation by tumor and, unlike e.g., 1311, 90Y is a pure beta emitter of high energy with no accompanying gamma irradiation in its decay, with a range in tissue of 100 to 1,000 cell diameters. Furthermore, the rninimal amount of penetrating radiation allows for outpatient administration of 90Y-labeled molecules. Additionally, intemahzation of labeled polypeptides is not required for cell killing, and the local emission of ionizing radiation should be lethal for adjacent tumor cells lacking the target antigen. Those skilled in the art will appreciate that these non-radioactive conjugates may also be assembled using a variety of techniques depending on the selected agent to be conjugated. For example, conjugates with biotin are prepared e.g. by reacting the polypeptides with an activated ester of biotin such as the biotin N- hydroxysuccinimide ester. Similarly, conjugates with a fluorescent marker may be prepared in the presence of a coupling agent, e.g. those listed above, or by reaction with an isothiocyanate, preferably fluorescein-isothiocyanate. Conjugates ofthe polypeptides ofthe invention with cytostatic/cytotoxic substances and metal chelates are prepared in an analogous manner. Prefened agents for use in the present invention are cytotoxic drugs, particularly those which are used for cancer therapy. As used herein, "a cytotoxin or cytotoxic agent" means any agent that is detrimental to the growth and proliferation of cells and may act to reduce, inhibit or destroy a cell or malignancy. Exemplary cytotoxins include, but are not limited to, radionuclides, biotoxins, enzymatically active toxins, cytostatic or cytotoxic therapeutic agents, prodrugs, immunologically active ligands and biological response modifiers such as cytokines. Any cytotoxin that acts to retard or slow the growth of immunoreactive cells or malignant cells is within the scope ofthe present invention. Exemplary cytotoxins include, in general, cytostatic agents, alkylating agents, antimetabolites, anti-proliferative agents, tubulin binding agents, hormones and hormone antagonists, and the like. Exemplary cytostatics that are compatible with the present invention include alkylating substances, such as mechlorethamine, triethylenephosphoramide, cyclophosphamide, ifosfamide, chlorambucil, busulfan, melphalan or triaziquone, also nitrosourea compounds, such as carmustine, lomustine, or semustine. Other prefened classes of cytotoxic agents include, for example, the maytansinoid family of drugs. Other prefened classes of cytotoxic agents include, for example, the anthracycline family of drugs, the vinca drugs, the mitomycins, the bleomycins, the cytotoxic nucleosides, the pteridine family of drugs, diynenes, and the podophyllotoxins. Particularly useful members of those classes include, for example, adriamycin, carminomycin, daunorubicin (daunomycin), doxorubicin, aminopterin, methotrexate, methopterin, rmthramycin, stieptonigrin, dichloromethotrexate, mitomycin C, actinomycin-D, porfiromycin, 5-fluorouracil, floxuridine, ftorafur, 6- mercaptopurine, cytarabine, cytosine arabinoside, podophyllotoxin, or podophyllotoxin derivatives such as etoposide or etoposide phosphate, melphalan, vinblastine, vincristine, leurosidine, vindesine, leurosine and the like. Still other cytotoxins that are compatible with the teachings herein include taxol, taxane, cytochalasin B, gramicidin D, ethidium bromide, emetine, tenoposide, colchicin, dihydroxy anthracin dione, mitoxantrone, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof. Hormones and hormone antagonists, such as corticosteroids, e.g. prednisone, progestins, e.g. hydroxyprogesterone or medroprogesterone, estrogens, e.g. diethylstilbestrol, antiestiogens, e.g. tamoxifen, androgens, e.g. testosterone, and aromatase inhibitors, e.g. aminogluthetimide are also compatible with the teachings herein. As noted previously, one skilled in the art may make chemical modifications to the desired compound in order to make reactions of that compound more convenient for purposes of preparing conjugates ofthe invention. One example of particularly prefened cytotoxins comprise members or derivatives ofthe enediyne family of anti-tumor antibiotics, including calicheamicin, esperamicins or dynemicins. These toxins are extremely potent and act by cleaving nuclear DNA, leading to cell death. Unlike protein toxins which can be cleaved in vivo to give many inactive but immunogenic polypeptide fragments, toxins such as calicheamicin, esperamicins and other enediynes are small molecules which are essentially non-immunogenic. These non-peptide toxins are chemically-linked to the dimers or tetramers by techniques which have been previously used to label monoclonal antibodies and other molecules. These linking technologies include site-specific linkage via the N-linked sugar residues present only on the Fc portion ofthe constructs. Such site-directed linking methods have the advantage of reducing the possible effects of linkage on the binding properties ofthe constmcts. As previously alluded to, compatible cytotoxins may comprise a prodrug. As used herein, the term "prodrug" refers to a precursor or derivative form of a pharmaceutically active substance that is less cytotoxic to tumor cells compared to the parent drug and is capable of being enzymatically activated or converted into the more active parent form. Prodrugs compatible with the invention include, but are not limited to, phosphate-containing prodrugs, thiophosphate-containing prodrugs, sulfate containing prodrugs, peptide containing prodrugs, β-lactam-containing prodrugs, optionally substituted phenoxyacetanήde-contairiing prodrugs or optionally substituted phenylacetantide-contairώig prodrugs, 5-fluorocytosine and other 5-fluorouridine prodrugs that can be converted to the more active cytotoxic free drug. Further examples of cytotoxic drugs that can be derivatized into a prodrug form for use in the present invention comprise those chemotherapeutic agents described above. Among other cytotoxins, it will be appreciated that polypeptides can also be associated with a biotoxin such as ricin subunit A, abrin, diptheria toxin, botulinum, cyanginosins, saxitoxin, shigatoxin, tetanus, tetiodotoxin, trichothecene, verrucologen or a toxic enzyme. Preferably, such constructs will be made using genetic engineering techniques that allow for direct expression ofthe binding molecule-toxin constiruct. Other biological response modifiers that may be associated with the polypeptides ofthe invention ofthe present invention comprise cytokines such as lymphokines and interferons. In view ofthe instant disclosure it is submitted that one skilled in the art could readily form such constructs using conventional techniques. Another class of compatible cytotoxins that may be used in conjunction with the disclosed polypeptides are radiosensitizing drugs that maybe effectively directed to tumor or immunoreactive cells. Such drugs enhance the sensitivity to ionizing radiation, thereby increasing the efficacy of radiotherapy. An conjugate intemalized by the tumor cell would deliver the radiosensitizer nearer the nucleus where radiosensitization would be maximal. The unbound radiosensitizer linked polypeptides of the invention would be cleared quickly from the blood, localizing the remaining radiosensitization agent in the target tumor and providing minimal uptake in normal tissues. After rapid clearance from the blood, adjunct radiotherapy would be administered in one of three ways: 1.) external beam radiation directed specifically to the tumor, 2.) radioactivity directly implanted in the tumor or 3.) systemic radioirnmunotherapy with the same targeting molecule. A potentially attractive variation of this approach would be the attachment of a therapeutic radioisotope to the radiosensitized immunoconjugate, thereby providing the convenience of administering to the patient a single drug. hi one embodiment, a moiety that enhances the stability or efficacy ofthe polypeptide can be conjugated. For example, in one embodiment, PEG can be conjugated to the polypeptides ofthe invention to increase their half-life in vivo. Leong, S.R., et al. 2001. Cytokine 16:106; 2002; Adv. in Drug Deliv. Rev. 54:531; or Weir et al. 2002. Biochem. Soc. Transactions 30:512.
VI. Administration of Polypeptides
Methods of preparing and administering polypeptides ofthe invention to a subject are well known to or are readily determined by those skilled in the art. The route of administration ofthe polypeptide ofthe invention may be oral, parenteral, by inhalation or topical. The term parenteral as used herein includes intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, rectal or vaginal admimstration. The intravenous, intraarterial, subcutaneous and intramuscular forms of parenteral admiriistration are generally prefened. While all these forms of adrmnistration are clearly contemplated as being within the scope ofthe invention, a form for administration would be a solution for injection, in particular for intravenous or intraarterial injection or drip. Usually, a suitable pharmaceutical composition for injection may comprise a buffer (e.g. acetate, phosphate or citrate buffer), a surfactant (e.g. polysorbate), optionally a stabilizer agent (e.g. human albumin), etc. However, in other methods compatible with the teachings herein, the polypeptides can be delivered directly to the site ofthe adverse cellular population thereby increasing the exposure of the diseased tissue to the therapeutic agent. Preparations for parenteral administration includes sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. In the subject invention, pharmaceutically acceptable carriers include, but are not limited to, 0.01- 0.1M and preferably 0.05M phosphate buffer or 0.8% saline. Other common parenteral vehicles include sodium phosphate solutions, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers, such as those based on Ringer's dextrose, and the like. Preservatives and other additives may also be present such as for example, antimicrobials, antioxidants, chelating agents, and inert gases and the like. More particularly, pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In such cases, the composition must be sterile and should be fluid to the extent that easy syrmgabihty exists. It should be stable under the conditions of manufacture and storage and will preferably be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention ofthe action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols, such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absoφtion ofthe injectable compositions can be brought about by including in the composition an agent which delays absoφtion, for example, aluminum monostearate and gelatin. In any case, sterile injectable solutions can be prepared by incoφorating an active compound (e.g., a polypeptide by itself or in combination with other active agents) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated herein, as required, followed by filtered sterilization. Generally, dispersions are prepared by incoφorating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the prefened methods of preparation are vacuum drying and freeze-drying, which yields a powder of an active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. The preparations for injections are processed, filled into containers such as ampoules, bags, bottles, syringes or vials, and sealed under aseptic conditions according to methods known in the art. Further, the preparations may be packaged and sold in the form of a kit such as those described in co-pending U.S.S.N. 09/259,337 and U.S.S.N. 09/259,338 each of which is incoφorated herein by reference. Such articles of manufacture will preferably have labels or package inserts indicating that the associated compositions are useful for treating a subject suffering from, or predisposed to autoimmune or neoplastic disorders. Effective doses ofthe compositions ofthe present invention, for the treatment ofthe above described conditions vary depending upon many different factors, including means of administration, target site, physiological state ofthe patient, whether the patient is human or an animal, other medications administered, and whether treatment is prophylactic or therapeutic. Usually, the patient is a human but non-human mammals including transgenic mammals can also be tieated. Treatment dosages may be titrated using routine methods known to those of skill in the art to optimize safety and efficacy. For passive immunization with an antibody, the dosage can range, e.g., from about 0.0001 to 100 mg/kg, and more usually 0.01 to 5 mg/kg (e.g., 0.02 mg kg, 0.25 mg/kg, 0.5 mg/kg, 0.75 mg/kg, lmg/kg, 2 mg/kg, etc.), ofthe host body weight. For example dosages can be 1 mg/kg body weight or 10 mg/kg body weight or within the range of 1- 10 mg/kg, preferably at least 1 mg/kg. Doses intermediate in the above ranges are also intended to be within the scope ofthe invention. Subjects can be administered such doses daily, on alternative days, weekly or according to any other schedule determined by empirical analysis. An exemplary treatment entails administration in multiple dosages over a prolonged period, for example, of at least six months. Additional exemplary treatment regimes entail administration once per every two weeks or once a month or once every 3 to 6 months. Exemplary dosage schedules include 1-10 mg/kg or 15 mg/kg on consecutive days, 30 mg/kg on alternate days or 60 mg/kg weekly. In some methods, two or more monoclonal antibodies with different binding specificities are administered simultaneously, in which case the dosage of each antibody admimstered falls within the ranges indicated.
Polypeptides ofthe invention can be admimstered on multiple occasions. Intervals between single dosages can be weekly, monthly or yearly. Intervals can also be inegular as indicated by measuring blood levels of polypeptide or antigen in the patient. In some methods, dosage is adjusted to achieve a plasma polypeptide concentiation of 1- 1000 μg/ml and in some methods 25-300 μg/ml. Alternatively, binding molecules can be administered as a sustained release formulation, in which case less frequent administration is required. Dosage and frequency vary depending on the half-life ofthe molecule in the patient. In general, humanized antibodies show the longest half-life, followed by chimeric antibodies and nonhuman antibodies, hi one embodiment, the binding molecules ofthe invention can be administered in unconjugated form, In another embodiment, the polypeptides ofthe invention can be administered multiple times in conjugated form. In still another embodiment, the binding molecules ofthe invention can be administered in unconjugated form, then in conjugated form, or vise versa. The dosage and frequency of administration can vary depending on whether the treatment is prophylactic or therapeutic, hi prophylactic applications, compositions containing the present polypeptides or a cocktail thereof are administered to a patient not aheady in the disease state to enhance the patient's resistance. Such an amount is defined to be a "prophylactic effective dose." In this use, the precise amounts again depend upon the patient's state of health and general immunity, but generally range from 0.1 to 25 mg per dose, especially 0.5 to 2.5 mg per dose. A relatively low dosage is admimstered at relatively infrequent intervals over a long period of time. Some patients continue to receive treatment for the rest of their lives. hi therapeutic applications, a relatively high dosage (e.g., from about 1 to
400 mg/kg of antibody per dose, with dosages of from 5 to 25 mg being more commonly used for radioimmunoconjugates and higher doses for cytotoxin-drug conjugated molecules) at relatively short intervals is sometimes required until progression ofthe disease is reduced or terminated, and preferably until the patient shows partial or complete amelioration of symptoms of disease. Thereafter, the patent can be administered a prophylactic regime. In one embodiment, a subject can be treated with a nucleic acid molecule encoding a polypeptide ofthe invention (e.g., in a vector). Doses for nucleic acids encoding polypeptides range from about 10 ng to 1 g, 100 ng to 100 mg, 1 μg to 10 mg, or 30-300 μg DNA per patient. Doses for infectious viral vectors vary from 10-100, or more, virions per dose. Therapeutic agents can be administered by parenteral, topical, intravenous, oral, subcutaneous, intraarterial, intiacranial, intraperitoneal, intianasal or intramuscular means for prophylactic and/or therapeutic treatment. The most typical route of administration of an immunogenic agent is subcutaneous although other routes can be equally effective. The next most common route is intramuscular injection. This1 type of injection is most typically performed in the arm or leg muscles, hi some methods, agents are injected directly into a particular tissue where deposits have accumulated, for example intiacranial injection. Intramuscular injection or intravenous infusion are prefened for administration of molecules. In some methods, particular therapeutic molecules are injected directly into the cranium. In some methods, molecules are administered as a sustained release composition or device, such as a Medipad™ device. Agents ofthe invention can optionally be administered in combination with other agents that are effective in treating the disorder or condition in need of treatment (e.g., prophylactic or therapeutic). Effective single treatment dosages (i.e., therapeutically effective amounts) of 90Y-labeled polypeptides ofthe invention range from between about 5 and about 75 mCi, more preferably between about 10 and about 40 mCi. Effective single treatment non-manow ablative dosages of 131I-labeled antibodies range from between about 5 and about 70 mCi, more preferably between about 5 and about 40 mCi. Effective single treatment ablative dosages (i.e., may require autologous bone manow transplantation) of 131I-labeled antibodies range from between about 30 and about 600 mCi, more preferably between about 50 and less than about 500 mCi. In conjunction with a chimeric antibody, owing to the longer circulating half life vis-a-vis murine antibodies, an effective single treatment non-manow ablative dosages of iodine-131 labeled chimeric antibodies range from between about 5 and about 40 mCi, more preferably less than about 30 mCi. Imaging criteria for, e.g., the 1113h label, are typically less than about 5 mCi. Wliile a great deal of clinical experience has been gained with I and 90Y, other radiolabels are known in the art and have been used for similar proposes. Still other radioisotopes are used for imaging. For example, additional radioisotopes which 1 ^ are compatible with the scope ofthe instant invention include, but are not limited to, I, 1251, 32P, 57Co, 64Cu, 67Cu, 77Br, 81Rb, 81&, 87Sr, 113hι, 127Cs, 129Cs, 1321, 197Hg, 203Pb, 206Bi, 177Lu, 186Re, 212Pb, 212Bi, 47Sc, 105Rh, 109Pd, 153Sm, 188Re, 199Au, 225Ac, At, and 213Bi. hi this respect alpha, gamma and beta emitters are all compatible with in the instant invention. Further, in view ofthe instant disclosure it is submitted that one skilled in the art could readily determine which radionuclides are compatible with a selected course of treatment without undue experimentation. To this end, additional radionuclides which have already been used in clinical diagnosis include 1251, 1231, 99Tc, 43K, 52Fe, 67Ga, 68Ga, as well as mIn. Antibodies have also been labeled with a variety of radionuclides for potential use in targeted immunotherapy (Peirersz et al. Immunol. Cell Biol. 65: 111-125 (1987)). These radionuclides include 188Re and 186Re as well as 199Au and 67Cu to a lesser extent. U.S. Patent No. 5,460,785 provides additional data regarding such radioisotopes and is incoφorated herein by reference. Whether or not the polypeptides ofthe invention are used in a conjugated or unconjugated form, it will be appreciated that a major advantage ofthe present invention is the ability to use these polypeptides in myelosuppressed patients, especially those who are undergoing, or have undergone, adjunct therapies such as radiotherapy or chemotherapy. That is, the beneficial delivery profile (i.e. relatively short serum dwell time, high binding affinity and enhanced localization) ofthe polypeptides makes them particularly useful for treating patients that have reduced red manow reserves and are sensitive to myelotoxicity. hi this regard, the unique delivery profile ofthe polypeptides make them very effective for the administration of radiolabeled conjugates to myelosuppressed cancer patients. As such, the polypeptides ofthe invention are useful in a conjugated or unconjugated form in patients that have previously undergone adjunct therapies such as external beam radiation or chemotherapy, hi other prefened embodiments, the polypeptides (again in a conjugated or unconjugated form) may be used in a combined therapeutic regimen with chemotherapeutic agents. Those skilled in the art will appreciate that such therapeutic regimens may comprise the sequential, simultaneous, concurrent or coextensive administration ofthe disclosed molecules and one or more chemotherapeutic agents. Particularly prefened embodiments of this aspect ofthe invention will comprise the administration of a radiolabeled polypeptide. While the polypeptides may be administered as described immediately above, it must be emphasized that in other embodiments conjugated and unconjugated polypeptides may be administered to otherwise healthy patients as a first line therapeutic agent. In such embodiments the polypeptides may be adiriinistered to patients having normal or average red manow reserves and/or to patients that have not, and are not, undergoing adjunct therapies such as external beam radiation or chemotherapy. However, as discussed above, selected embodiments ofthe invention comprise the acinriimstration of polypeptides to myelosuppressed patients or in combination or conjunction with one or more adjunct therapies such as radiotherapy or chemotherapy (i.e. a combined therapeutic regimen). As used herein, the administration of polypeptides in conjunction or combination with an adjunct therapy means the sequential, simultaneous, coextensive, concunent, concomitant or contemporaneous adirdnistration or application of the therapy and the disclosed molecules. Those skilled in the art will appreciate that the administration or apphcation ofthe various components ofthe combined therapeutic regimen may be timed to enhance the overall effectiveness ofthe treatment. For example, chemotherapeutic agents could be administered in standard, well known courses of treatment followed within a few weeks by radioimmunoconjugates ofthe present invention. Conversely, cytotoxin associated polypeptides could be adnriinistered intravenously followed by tumor locahzed external beam radiation. In yet other embodiments, the polypeptide maybe admimstered concunently with one or more selected chemotherapeutic agents in a single office visit. A skilled artisan (e.g. an experienced oncologist) would be readily be able to discern effective combined therapeutic regimens without undue experimentation based on the selected adjunct therapy and the teachings ofthe instant specification. hi this regard it will be appreciated that the combination ofthe polypeptide
(with or without cytotoxin) and the chemotherapeutic agent may be administered in any order and within any time frame that provides a therapeutic benefit to the patient. That is, the chemotherapeutic agent and polypeptide may be administered in any order or concunently. hi selected embodiments the polypeptides ofthe present invention will be adrninistered to patients that have previously undergone chemotherapy. In yet other embodiments, the polypeptides and the chemotherapeutic treatment will be administered substantially simultaneously or concunently. For example, the patient may be given the bmding molecule while undergoing a course of chemotherapy. In prefened embodiments the binding molecule will be administered within 1 year of any chemotherapeutic agent or treatment, hi other prefened embodiments the polypeptide will be adrninistered within 10, 8, 6, 4, or 2 months of any chemotherapeutic agent or tieatment. In still other prefened embodiments the polypeptide will be administered within 4, 3, 2 or 1 week of any chemotherapeutic agent or treatment. In yet other embo<iiments the polypeptide will be administered within 5, 4, 3, 2 or 1 days ofthe selected chemotherapeutic agent or tieatment. It will further be appreciated that the two agents or treatments may be administered to the patient within a matter of hours or minutes (i.e. substantially simultaneously). Moreover, in accordance with the present invention a myelosuppressed patient shall be held to mean any patient exhibiting lowered blood counts. Those skilled in the art will appreciate that there are several blood count parameters conventionally used as clinical indicators of myelosuppresion and one can easily measure the extent to which myelosuppresion is occurring in a patient. Examples of art accepted myelosuppression measurements are the Absolute Neutiophil Count (ANC) or platelet count. Such myelosuppression or partial myeloablation may be a result of various biochemical disorders or diseases or, more likely, as the result of prior chemotherapy or radiotherapy. In this respect, those skilled in the art will appreciate that patients who have undergone traditional chemotherapy typically exhibit reduced red manow reserves. As discussed above, such subjects often cannot be treated using optimal levels of cytotoxin (i.e. radionuclides) due to unacceptable side effects such as anemia or immunosuppression that result in increased mortality or morbidity. More specifically conjugated or unconjugated polypeptides ofthe present invention may be used to effectively treat patients having ANCs lower than about 2000/mm3 or platelet counts lower than about 150,000/ mm3. More preferably the polypeptides ofthe present invention may be used to treat patients having ANCs of less than about 1500/ mm3, less than about 1000/mm3 or even more preferably less than about 500/ mm3. Similarly, the polypeptides ofthe present invention may be used to treat patients having a platelet count of less than about 75,000/mm3, less than about 50,000/mm3 or even less than about 10,000/mm3. hi a more general sense, those skilled in the art will easily be able to determine when a patient is myelosuppressed using government implemented guidelines and procedures. As indicated above, many myelosuppressed patients have undergone courses of tieatment including chemotherapy, implant radiotherapy or external beam radiotherapy, hi the case ofthe latter, an external radiation source is for local irradiation of a malignancy. For radiotherapy implantation methods, radioactive reagents are surgically located within the malignancy, thereby selectively irradiating the site ofthe disease. In any event, the disclosed polypeptides may be used to treat disorders in patients exhibiting myelosuppression regardless ofthe cause. In this regard it will further be appreciated that the polypeptides ofthe instant invention may be used in conjunction or combination with any chemotherapeutic agent or agents (e.g. to provide a combined therapeutic regimen) that eliminates, reduces, inhibits or controls the growth of neoplastic cells in vivo. As discussed, such agents often result in the reduction of red manow reserves. This reduction may be offset, in whole or in part, by the diminished myelotoxicity ofthe compounds ofthe present invention that advantageously allow for the aggressive treatment of neoplasias in such patients. In other prefened embodiments the radiolabeled immunoconjugates disclosed herein may be effectively used with radiosensitizers that increase the susceptibility ofthe neoplastic cells to radionuclides. For example, radiosensitizing compounds may be administered after the radiolabeled binding molecule has been largely cleared from the bloodstream but still remains at therapeutically effective levels at the site ofthe tumor or tumors. With respect to these aspects ofthe invention, exemplary chemotherapeutic agents that are compatible with the instant invention include alkylating agents, vinca alkaloids (e.g., vincristine and vinblastine), procarbazine, methotrexate and prednisone. The four-drug combination MOPP (mechlethamine
(nitrogen mustard), vincristine (Oncovin), procarbazine and prednisone) is very effective in treating various types of lymphoma and comprises a prefened embodiment ofthe present invention. In MOPP-resistant patients, ABVD (e.g., adriamycin, bleomycin, vinblastine and dacarbazine), ChlVPP (chlorambucil, vinblastine, procarbazine and prednisone), CABS (lomustine, doxorubicin, bleomycin and stieptozotocm), MOPP plus ABVD, MOPP plus ABV (doxorubicin, bleomycin and vinblastine) or BCVPP (carmustine, cyclophosphamide, vinblastine, procarbazine and prednisone) combinations can be used. Arnold S. Freedman and Lee M. Nadler, Malignant Lymphomas, in HARRISON'S PRINCIPLES OF INTERNAL MEDICINE 1774-1788 (Kurt J. Isselbacher et al, eds., 13th ed. 1994) and V. T. DeVita et al, (1997) and the references cited therein for standard dosing and scheduling. These therapies can be used unchanged, or altered as needed for a particular patient, in combination with one or more polypeptides ofthe invention as described herein. Additional regimens that are useful in the context ofthe present invention include use of single alkylating agents such as cyclophosphamide or chlorambucil, or combinations such as CVP (cyclophosphamide, vincristine and prednisone), CHOP (CVP and doxorubicin), C-MOPP (cyclophosphamide, vincristine, prednisone and procarbazine), CAP-BOP (CHOP plus procarbazine and bleomycin), m-BACOD (CHOP plus methotiexate, bleomycin and leucovorin), ProMACE-MOPP φredhisone, methotrexate, doxorubicin, cyclophosphamide, etoposide and leucovorin plus standard MOPP), ProMACE-CytaBOM (prednisone, doxorubicin, cyclophosphamide, etoposide, cytarabine, bleomycin, vincristine, methotrexate and leucovorin) and MACOP-B (methotrexate, doxorubicin, cyclophosphamide, vincristine, fixed dose prednisone, bleomycin and leucovorin). Those skilled in the art will readily be able to determine standard dosages and scheduling for each of these regimens. CHOP has also been combined with bleomycin, methotrexate, procarbazine, nitrogen mustard, cytosine arabinoside and etoposide. Other compatible chemotherapeutic agents include, but are not limited to, 2- chlorodeoxyadenosine (2-CDA), 2'-deoxycoformycin and fludarabine. For patients with intermediate- and high-grade NHL, who fail to achieve remission or relapse, salvage therapy is used. Salvage therapies employ drugs such as cytosine arabinoside, cisplatin, etoposide and ifosfamide given alone or in combination. In relapsed or aggressive forms of certain neoplastic disorders the following protocols are often used: IMVP-16 (ifosfamide, methotiexate and etoposide), MIME (methyl-gag, ifosfamide, methotrexate and etoposide), DHAP (dexamethasone, high dose cytarabine and cisplatin), ESHAP (etoposide, methylpredisolone, HD cytarabine, cisplatin), CEPP(B) (cyclophosphamide, etoposide, procarbazine, prednisone and bleomycin) and CAMP (lomustine, mitoxantione, cytarabine and prednisone) each with well known dosing rates and schedules. The amount of chemotherapeutic agent to be used in combination with the polypeptides ofthe instant invention may vary by subject or may be admimstered according to what is known in the art. See for example, Bruce A Chabner et al, Antineoplastic Agents, in GOODMAN & GlLMAN's THE PHARMACOLOGICAL BASIS OF THERAPEUTICS 1233-1287 ((Joel G. Hardman et al, eds., 9th ed. 1996).
As previously discussed, the polypeptides ofthe present invention, immunoreactive fragments or recombinants thereof may be administered in a pharmaceutically effective amount for the in vivo treatment of mammalian disorders. In this regard, it will be appreciated that the disclosed binding molecules will be formulated so as to facilitate administration and promote stability ofthe active agent. Preferably, pharmaceutical compositions in accordance with the present invention comprise a pharmaceutically acceptable, non-toxic, sterile carrier such as physiological saline, non-toxic buffers, preservatives and the like. For the piuposes ofthe instant application, a pharmaceutically effective amount ofthe polypeptide, immunoreactive fragment or recombinant thereof, conjugated or unconjugated to a therapeutic agent, shall be held to mean an amount sufficient to achieve effective binding to an antigen and to achieve a benefit, e.g., to ameliorate symptoms of a disease or disorder or to detect a substance or a cell. In the case of tumor cells, the polypeptide will be preferably be capable of interacting with selected immunoreactive antigens on neoplastic or immunoreactive cells and provide for an increase in the death of those cells. Of course, the pharmaceutical compositions ofthe present invention may be admimstered in single or multiple doses to provide for a pharmaceutically effective amount ofthe polypeptide. In keeping with the scope of the present disclosure, the polypeptides of the invention may be administered to a human or other animal in accordance with the aforementioned methods of tieatment in an amount sufficient to produce a therapeutic or prophylactic effect. The binding molecules ofthe invention can be administered to such human or other animal in a conventional dosage form prepared by combining the binding molecule ofthe invention with a conventional pharmaceutically acceptable carrier or diluent according to known techniques. It will be recognized by one of skill in the art that the form and character ofthe pharmaceutically acceptable carrier or diluent is dictated by the amount of active ingredient with which it is to be combined, the route of administration and other well-known variables. Those skilled in the art will further appreciate that a cocktail comprising one or more species of polypeptides according to the present invention may prove to be particularly effective.
VII. Methods of Use The polypeptides ofthe invention can be used for diagnostic or therapeutic purposes. Prefened embodiments ofthe present invention provide compounds, compositions, kits and methods for the diagnosis and/or treatment of disorders, e.g., neoplastic disorders in a mammalian subject in need of such tieatment. Preferably, the subject is a human. The polypeptides of the instant invention will be useful in a number of different applications. For example, in one embodiment, the subject binding molecules should be useful for reducing or eliminating cells bearing an epitope recognized by a binding molecule ofthe invention. In another embodiment, the subject binding molecules are effective in reducing the concentiation of or eliminating soluble antigen in the circulation hi one embodiment, tumor size, inhibiting tumor growth and/or prolonging the survival time of tumor-bearing animals. Accordingly, this invention also relates to a method of treating tumors in a human or other animal by administering to such human or animal an effective, non-toxic amount of polypeptide. One skilled in the art would be able, by routine experimentation, to determine what an effective, non-toxic amount of polypeptide would be for the pvupose of treating malignancies. For example, a therapeutically active amount of a polypeptide may vary according to factors such as the disease stage (e.g., stage I versus stage IV), age, sex, medical complications (e.g., immunosuppressed conditions or diseases) and weight ofthe subject, and the ability of the molecule to elicit a desired response in the subject. The dosage regimen may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily, or the dose may be proportionally reduced as indicated by the exigencies ofthe therapeutic situation. Generally, however, an effective dosage is expected to be in the range of about 0.05 to 100 milligrams per kilogram body weight per day and more preferably from about 0.5 to 10, milligrams per kilogram body weight per day. For puφoses of clarification "mammal" refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, horses, cats, cows, etc. Preferably, the mammal is human. "Treatment" refers to both therapeutic tieatment and prophylactic or preventative measures. Those in need of treatment include those already with the disease or disorder as well as those in which the disease or disorder is to be prevented. Hence, the mammal may have been diagnosed as having the disease or disorder or may be predisposed or susceptible to the disease. As discussed above, the polypeptides ofthe present invention may be immunoreactive with one or more tumor antigens or antigens associated with immune disorders. For example, for neoplastic disorders, the antigen binding site (i.e. the variable region or immunoreactive fragment or recombinant thereof) ofthe disclosed polypeptides binds to a selected tumor associated antigen at the site ofthe malignancy. Similarly, in immune (including autoimmune) disorders the disclosed polypeptides will bind to selected markers on the offending cells. Given the number of reported antigens associated with neoplasias and immune disorders, and the number of related antibodies, those skilled in the art will appreciate that the presently disclosed polypeptides may therefore be derived from any one of a number of whole antibodies. More generally, polypeptides useful in the present invention may be obtained or derived from any antibody (including those previously reported in the literature) that reacts with a molecule or marker associated with the selected condition. Further, the parent or precursor antibody, or fragment thereof, used to generate the disclosed polypeptides may be murine, human, chimeric, humanized, non-human primate or primatized. In other prefened embodiments the polypeptides ofthe present invention may comprise single chain antibody constructs (such as that disclosed in U.S. Pat. No. 5,892,019 which is incoφorated herein by reference) having altered constant domains as described herein. Consequently, any of these types of antibodies modified in accordance with the teachings herein is compatible with the instant invention. As used herein, "tumor associated antigens" means any antigen which is generally associated with tumor cells, i.e., occurring at the same or to a greater extent as compared with normal cells. More generally, tumor associated antigens comprise any antigen that provides for the localization of immunoreactive antibodies at a neoplastic cell inespective of its expression on non-malignant cells. Such antigens may be relatively tumor specific and limited in their expression to the surface of malignant cells. Alternatively, such antigens may be found on both malignant and non-malignant cells. For example, CD20 is a pan B antigen that is found on the surface of both malignant and non-malignant B cells that has proved to be an extremely effective target for immunotherapeutic antibodies for the treatment of non-Hodgkin's lymphoma. In this respect, pan T cell antigens such as CD2, CD3, CD5, CD6 and CD7 also comprise tumor associated antigens within the meaning ofthe present invention. Still other exemplary tumor associated antigens comprise but not limited to MAGE-1, MAGE-3, MUC-1, HPV 16, HPV E6 & E7, TAG-72, CEA, L6-Antigen, CD 19, CD22, CD37, CD52, HLA- DR, EGF Receptor and HER2 Receptor. In many cases immunoreative antibodies for each of these antigens have been reported in the literature. Those skilled in the art will appreciate that each of these antibodies may serve as a precursor for polypeptides ofthe invention in accordance with the present invention. The polypeptides ofthe present invention preferably associate with, and bind to, tumor or immune associated antigens as described above. Accordingly, as will be discussed in some detail below the polypeptides ofthe present invention may be derived, generated or fabricated from any one of a number of antibodies that react with tumor associated antigens, hi prefened embodiments the polypeptides are modified or domain deleted antibodies that are derived using common genetic engineering techniques whereby at least a portion of one or more constant region domains are deleted or altered so as to provide the desired biochemical characteristics such as reduced serum half-life. More particularly, one skilled in the art may readily isolate the genetic sequence conesponding to the variable and/or constant regions ofthe subject antibody and delete or alter the appropriate nucleotides to provide polypeptides ofthe invention for use as monomeric subunits in accordance with the instant invention. It will further be appreciated that compatible polypeptides ofthe invention may be expressed and produced on a clinical or commercial scale using well-established protocols. Previously reported antibodies that react with tumor associated antigens may be altered as described herein to provide the polypeptides ofthe present invention. Exemplary antibodies that may be used to provide antigen binding regions for, generate or derive the disclosed polypeptides include, but are not limited to 2B8 and C2B8 (Zevalin® and Pάtuxan®, IDEC Pharmaceuticals Coφ., San Diego), Lym 1 and Lym 2 (Techniclone), LL2 (Immunomedics Coφ., New Jersey), HER2 (Herceptin®, Genentech hie, South San Francisco), Bl (Bexxar®, Coulter Pharm., San Francisco), Campath® (Millennium Pharmaceuticals, Cambridge) MB1, BH3, B4, B72.3 (Cytogen Coφ.), CC49 (National Cancer Institute) and 5E10 (University of Iowa). Other antibody binding sites that can be incoφorated into the subject binding molecules include: Orthoclone OKT3 (CD3), ReoPro (Gpllb/glla), Zenapax (C25), Remicade (TNF-a), Simulect (CD25), Synagis (RSV), Mylotarg (CD33), and Campath (CD52). hi prefened embodiments, the polypeptides ofthe present invention will bind to the same tumor associated antigens as the antibodies enumerated immediately above. In particularly prefened embodiments, the polypeptides will be derived from or bind the same antigens as 2B8, C2B8, CC49 and C5E10 and, even more preferably, will lack all or part of a CH2 domain. hi one embodiment, a binding molecule ofthe invention binds to the CD23 (U.S. patent 6,011,138). In a prefened embodiment, a binding molecule ofthe invention binds to the same epitope as the 5E8 antibody. In another embodiment, a binding molecule ofthe invention comprises at least one CDR from an anti-CD23 antibody, e.g., the 5E8 antibody. In one embodiment, a binding molecule ofthe invention binds to the CR3PTO-I antigen (WO02/088170A2 or WO03/083041 A2). In a prefened embodiment, a binding molecule ofthe invention binds to the same epitope as the B3F6 antibody. In another embodiment, a binding molecule ofthe invention comprises at least one CDR from an anti-CRIPTO-I antibody, e.g., the B3F6 antibody. hi a first prefened embodiment, the polypeptide will bind to the same tumor associated antigen as Rituxan®. Rituxan® (also known as, rituximab, 1DEC-C2B8 and C2B8) was the first FDA-approved monoclonal antibody for treatment of human B-cell lymphoma (see U.S. Patent Nos. 5,843,439; 5,776,456 and 5,736,137 each of which is incoφorated herein by reference). Y2B8 (90Y labeled 2B8; Zevalin®; ibritumomab tiuxetan) is the murine parent of C2B8. -Rituxan® is a chimeric, anti-CD20 monoclonal antibody which is growth inhibitory and reportedly sensitizes certain lymphoma cell lines for apoptosis by chemotherapeutic agents in vitro. The antibody efficiently binds human complement, has strong FcR bmding, and can effectively kill human lymphocytes in vitro via both complement dependent (CDC) and antibody-dependent (ADCC) mechanisms (Reff et al, Blood 83: 435-445 (1994)). Those skilled in the art will appreciate that dimeric variants (homodimers or heterodimers) of C2B8 or 2B8, modified according to the instant disclosure, may be used in conjugated or unconjugated forms to effectively treat patients presenting with CD20+ malignancies. More generally, it must be reiterated that the polypeptides disclosed herein may be used in either a "naked" or unconjugated state or conjugated to a cytotoxic agent to effectively treat any one of a number of disorders. In other prefened embodiments ofthe present invention, the polypeptide ofthe invention will be derived from, or bind to, the same tumor associated antigen as CC49. As previously alluded to, CC49 binds human tumor associated antigen TAG-72 which is associated with the surface of certain tumor cells of human origin, specifically the LS174T tumor cell line. LS174T [American Type Culture Collection (herein ATCC) No. CL 188] is a variant ofthe LSI 80 (ATCC No. CL 187) colon adenocarcinoma line. It will further be appreciated that numerous murine monoclonal antibodies have been developed which have binding specificity for TAG-72. One of these monoclonal antibodies, designated B72.3, is a murine IgGl produced by hybridoma B72.3 (ATCC No. HB-8108). B72.3 is a first generation monoclonal antibody developed using a human breast carcinoma extract as the immunogen (see Colcher et al, Proc. Natl. Acad. Sci. (USA), 78:3199-3203 (1981); and U.S. Pat. Nos. 4,522,918 and 4,612,282 each of which is incoφorated herein by reference). Other monoclonal antibodies directed against TAG-72 are designated "CC" (for colon cancer). As described by Schlom et al. (U.S. Pat. No. 5,512,443 which is incoφorated herein by reference) CC monoclonal antibodies are a family of second generation murine monoclonal antibodies that were prepared using TAG- 72 purified with B72.3. Because of theh relatively good binding affinities to TAG-72, the following CC antibodies have been deposited at the ATCC, with restricted access having been requested: CC49 (ATCC No. HB 9459); CC 83 (ATCC No. HB 9453); CC46 (ATCC No. HB 9458); CC92 (ATTCC No. HB 9454); CC30 (ATCC No. HB 9457); CC11 (ATCC No. 9455); and CC15 (ATCC No. HB 9460). U.S.P.N. 5,512,443 further teaches that the disclosed antibodies may be altered into theh chimeric form by substituting, e.g., human constant regions (Fc) domains for mouse constant regions by recombinant DNA techniques known in the art. Besides disclosing murine and chimeric anti-TAG-72 antibodies, Schlom et al. have also produced variants of a humanized CC49 antibody as disclosed in PCT/US99/25552 and single chain constructs as disclosed in U.S. Pat. No. 5,892,019 each of which is also incoφorated herein by reference. Those skilled in the art will appreciate that each ofthe foregoing antibodies, constructs or recombfnants, and variations thereof, may be modified and used to provide polypeptides in accordance with the present invention. 3h addition to the anti-TAG-72 antibodies discussed above, various groups have also reported the construction and partial characterization of domain-deleted CC49 andB72.3 antibodies (e.g., Calvo et al. Cancer Biotherapy, 8(1):95-109 (1993), Slavin- CHorini et al. Int. J. Cancer 53:97-103 (1993) and Slavin-CMorini et al. Cancer. Res. 55:5957-5967 (1995 Still other prefened embodiments ofthe present invention comprise modified antibodies that are derived from or bind to the same tumor associated antigen as C5E10. As set forth in co-pending application 09/104,717, C5E10 is an antibody that recognizes a glycoprotein determinant of approximately 115 kDa that appears to be specific to prostate tumor cell lines (e.g. DU145, PC3, or NDl). Thus, in conjunction with the present invention, polypeptides (e.g. CH2 domain-deleted antibodies) that specifically bind to the same tumor associated antigen recognized by C5E10 antibodies could be produced and used in a conjugated or unconjugated form for the treatment of neoplastic disorders. In particularly prefened embodiments, the modified antibody will be derived or comprise all or part ofthe antigen binding region ofthe C5E10 antibody as secreted from the hybridoma cell line having ATCC accession No. PTA-865. The resulting modified antibody could then be conjugated to a radionuclide as described below and administered to a patient suffering from prostate cancer in accordance with the methods herein. hi general, the disclosed invention may be used to prophylactically or therapeutically treat any neoplasm comprising an antigenic marker that allows for the targeting ofthe cancerous cells by the binding molecule. Exemplary cancers that may be treated include, but are not limited to, prostate, gastric carcinomas such as colon, skin, breast, ovarian, lung and pancreatic. More particularly, the binding molecules of the instant invention may be used to treat Kaposi's sarcoma, CNS neoplasias (capillary hemangioblastomas, meningiomas and cerebral metastases), melanoma, gastrointestinal and renal sarcomas, rhabdomyosarcoma, glioblastoma (preferably glioblastoma multiforme), leiomyosarcoma, retinoblastoma, papillary cystadenocarcinoma ofthe ovary, Wilm's tumor or small cell lung carcinoma. It will be appreciated that appropriate polypeptides may be derived for tumor associated antigens related to each of the forgoing neoplasias without undue experimentation in view ofthe instant disclosure. Exemplary hematologic malignancies that are amenable to tieatment with the disclosed invention include Hodgkfns and non-Hodgkins lymphoma as well as leukemias, including ALL-L3 (Burkitt's type leukemia), chronic lymphocytic leukemia (CLL) and monocytic cell leukemias. It will be appreciated that the compounds and methods ofthe present invention are particularly effective in treating a variety of B-cell lymphomas, including low grade/ follicular non-Hodgkin's lymphoma (NHL), cell lymphoma (FCC), mantle cell lymphoma (MCL), diffuse large cell lymphoma (DLCL), small lymphocytic (SL) NHL, intermediate grade/ follicular NHL, intermediate grade diffuse NHL, high grade immunoblastic NHL, high grade lymphoblastic NHL, high grade small non-cleaved cell NHL, bulky disease NHL and Waldenstrom's Macroglobulinemia. It should be clear to those of skill in the art that these lymphomas will often have different names due to changing systems of classification, and that patients having lymphomas classified under different names may also benefit from the combined therapeutic regimens ofthe present invention, hi addition to the aforementioned neoplastic disorders, it will be appreciated that the disclosed invention may advantageously be used to treat additional malignancies bearing compatible tumor associated antigens. Besides neoplastic disorders, the polypeptides ofthe instant invention are particularly effective in the tieatment of autoimmune disorders or abnormal immune responses. In this regard, it will be appreciated that the polypeptide ofthe present invention maybe used to control, suppress, modulate or eliminate unwanted immune responses to both external and autoantigens. For example, in one embodiment, the antigen is an autoantigen. In another embodiment, the antigen is an allergen, hi yet other embodiments, the antigen is an alloantigen or xenoantigen. Use ofthe disclosed polypeptides to reduce an immune response to alloantigens and xenoantigens is of particular use in transplantation, for example to inhibit rejection by a transplant recipient of a donor graft, e.g. a tissue or organ graft or bone manow transplant. Additionally, suppression or elimination of donor T cells within a bone manow graft is useful for inhibiting graft versus host disease. hi yet other embodiments the polypeptides ofthe present invention may be used to treat immune disorders that include, but are not limited to, allergic bronchopulmonary aspergillosis; Allergic rhinitis Autoimmune hemolytic anemia; Acanthosis nigricans; Allergic contact dermatitis; Addison's disease; Atopic deirmatitis; Alopecia areata; Alopecia universalis; Amyloidosis; Anaphylactoid piupura; Anaphylactoid reaction; Aplastic anemia; Angioedema, hereditary; Angioedema, idiopathic; Ankylosing spondylitis; Arteritis, cranial; Arteritis, giant cell; Arteritis, Takayasu's; Arteritis, temporal; Asthma; Ataxia-telangiectasia; Autoimmune oophoritis; Autoimmune orchitis; Autoimmune polyendocrine failure; Behcet's disease; Berger's disease; Buerger's disease; bronchitis; Bullous pemphigus; Candidiasis, chronic mucocutaneous; Caplan's syndrome; Post-myocardial infarction syndrome; Post- pericardiotomy syndrome; Carditis; Celiac sprue; Chagas's disease; Chediak-Higashi syndrome; Churg-Stiauss disease; Cogan's syndrome; Cold agglutinin disease; CREST syndrome; Crohn's disease; Cryoglobulinemia; Cryptogenic fibrosfng alveolitis; Dermatitis heφetifomis; Dermatomyositis; Diabetes mellitus; Diamond-Blackfan syndrome; DiGeorge syndrome; Discoid lupus erythematosus; Eosinophihc fasciitis; Episcleritis; Drythema elevatum diutinum; Erythema marginatum; Erythema multiforme; Erythema nodosum; Familial Meditenanean fever; Felty's syndrome; Fibrosis pulmonary; Glomeralonephritis, anaphylactoid; Glomerulonephritis, autoimmune; Glomemlonephritis, post-streptococcal; Glomemlonephritis, post-transplantation; Glomeralopathy, membranous; Goodpasture's syndrome; Granulocytopenia, immune-mediated; Granuloma annulare; Granulomatosis, allergic; Granulomatous myositis; Grave's disease; Hashimoto's thyroiditis; Hemolytic disease ofthe newborn; Hemochromatosis, idiopathic; Henoch- Schoenlern puφura; Hepatitis, chronic active and chronic progressive; Histiocytosis X; Hypereosinophihc syndrome; Idiopathic thrombocytopenic purpura; Job's syndrome; Juvenile dermatomyositis; Juvenile rheumatoid arthritis (Juvenile chronic arthritis); Kawasaki's disease; Keratitis; Keratoconjunctivitis sicca; Landry-Guillarn-Bane-Strohl syndrome; Leprosy, lepromatous; Loeffler's syndrome; lupus; Lyell's syndrome; Lyme disease; Lymphomatoid granulomatosis; Mastocytosis, systemic; Mixed connective tissue disease; Mononeuritis multiplex; Muckle- Wells syndrome; Mucocutaneous lymph node syndrome; Mucocutaneous lymph node syndrome; Multicentric reticulohistiocytosis; Multiple sclerosis; Myasthenia gravis; Mycosis fungoides; Necrotizing vasculitis, systemic; Nephrotic syndrome; Overlap syndrome; Pannicuhtis; Paroxysmal cold hemoglobinuria; Paroxysmal nocturnal hemoglobinuria; Pemphigoid; Pemphigus; Pemphigus erythema- tosus; Pemphigus foliaceus; Pemphigus vulgaris; Pigeon breeder's disease; Pneumonitis, hypersensitivity; Polyarteritis nodosa; Polymyalgia rheumatic; Polymyositis; Polyneuritis, idiopathic; Portuguese famihal polyneuropathies; Pre-eclampsia/eclampsia; Primary biliary cinhosis; Progressive systemic sclerosis (Scleroderma); Psoriasis; Psoriatic arthritis; Pulmonary alveolar proteinosis; Pulmonary fibrosis, Raynaud's phenomenon/syndrome; Reidel's thyroiditis; Reiter's syndrome, Relapsing polychrondritis; Rheumatic fever; Rheumatoid arthritis; Sarcoidosis; Scleritis; Sclerosfng cholangitis; Serum sickness; Sezary syndrome; Sjogren's syndrome; Stevens- Johnson syndrome; Still's disease; Subacute sclerosing panencephalitis; Sympathetic ophthalmia; Systemic lupus erythematosus; Transplant rejection; Ulcerative colitis; Undifferentiated connective tissue disease;
Urticaria, chronic; Urticaria, cold; Uveitis; Vitiligo; Weber-Christian disease; Wegener's granulomatosis and Wiskott- Aldrich syndrome. hi another embodiment, the binding molecules ofthe invention can be used for pretargeting applications. For example, the same advantages will be apparent in pretargeting applications for chemotherapeutic drug delivery. For example, in pretargeting a tumor is pretargeted with a binding construct that has affinity for the tumor-associated antigen on the one hand and for, e.g., a radiolabeled hapten on the other. The radiolabeled hapten is adrninistered later, preferably after the bmding molecule has cleared (see, e.g., Boerman et al. 2003. J. Nuclear Med. 44:400). hi another example, an antibody which is non-toxic, but has been denvitized to react with a drug or prodrug that is toxic only when bound by the binding molecule. Given the biodistribution data in the instant examples, the bmding molecules ofthe invention are well suited to use in pretargeting applications. In one embodiment, a clearing agent could be eliminated from the pretargeting methodology by using the instant binding molecules.
This invention is further illustrated by the following examples which should not be construed as limiting. The contents of all references, patents and published patent applications cited throughout this application are incoφorated herein by reference.
Examples
Example 1 : Identification of A and B Isoforms Solutions of antibody molecules comprise two different isoforms. One form, Form A comprises heavy chain molecules that are linked via at least one disulfide linkage. The other form, Form B, comprises heavy chain molecules that are not linked via at least one disulfide linkage. Form B does not appear or appears at a very low frequency in with intact gamma 1 MAbs, such as Rituxan®. However with domain deleted (dd) constructs having a similar hinge, the frequency of Form B is much higher.
These forms can be distinguished using denaturing, non-reducing SDS page. In domain deleted antibody preparations, Form A appears as a 120kDa dimer while Form B appears as a 60kDa monomer (Figure 1).
Example 2: Identification of Hinge Region Heterogeneity in CH2 Domain Deleted MAb Fragments
Hinge domains can be subdivided into three distinct regions: upper, middle, and lower hinge regions (Roux et al. J. Immunol. 1998 161:4083). Polypeptide sequences encompassing these regions for IgGl and IgG3 hinges are shown in Table 1. The IgG3 hinge middle region contains, in addition to the two conserved cysteine residues, a 15 amino acid motif that repeats three times. Amino acid sequences from these regions were used to design synthetic IgGl/IgG3 connecting peptides. These consisted of IgGl upper hinge residues conesponding to positions 226 through 238, an IgGl middle hinge conesponding to positions 239 through 241, and a single IgG3 middle hinge repeat motif conesponding to positions 241EE through 242 combined with either an added proline at position 243 or an added proline, alanine, proline at positions 243, 244, and 245, respectively (Kabat numbering system), followed by a flexible Gly/Ser spacer (Table 2). In addition, novel connecting peptides were designed consisting of a serine amino acid residue substituted for the cysteine at positions 239 or 242 combined with either an added proline at position 243 or an added proline, alanine, proline at positions 243, 244, and 245, respectively (Kabat numbering system). Pro243 Ala244Pro245 and Pro 243 connecting peptides were also made. The amino acid sequence ofthe parent CH2 domain deleted humanized CC49 connecting peptide beginning at the first residue ofthe IgGl hinge (position 226, Kabat numbering system) to the last residue ofthe hinge/GlySer connecting peptide is shown in Table 2. Also shown are the various connecting peptide designs by alignment to CC49 with positions ofthe cysteine residues indicated in Kabat numbering system.
Table 1: IgGl, IgG3 and IgG4 Hinge Regions
IgG Upper Hinge Middle Hinge Lower Hinge
IgGl EPKSCDKTHT CPPCP APELLGGP (SEQ 3D NO:2 ) (SEQ 3D NO:3) (SEQ 3D NO:4 )
IgG3 ELKTPLGDTTHT CPRCP (EPKSCDTPPPCPRCP)3 APELLGGP (SEQ 3D NO:5 ) (SEQ 3D NO:6) (SEQ 3D NO:4)
IgG4 ESKYGPP CPSCP APEFLGGP (SEQ 3D NO:45 ) (SEQ 3D NO:46) (SEQ 3D NO:47)
Table 2: Hinge Region Connecting Peptide Sequences
Figure imgf000093_0001
Example 3. Construction of Connecting Polypeptides and Preferential Synthesis of Isoforms Nucleic acid sequences encoding the hinge region connecting peptides shown in Table 2 were introduced into CH2 domain deleted huCC49 gene sequences using the Splicing by Overlap Extension (SOE) method (Horton, R.M. 1993 Methods in Molecular Biology, Vol 15:PCR Protocols: Cunent Methods and applications. Ed. B.A. White). Conect modifications to the hinge region were confirmed by DNA sequence analysis. Plasmid DNA was used to transform CHO DG44 cells for stable production of antibody protein. CH2 domain deleted huCC49 antibodies containing the eight designed synthetic connecting peptides indicated in Table 2 were constructed and antibody produced in CHO DG44 cells. Supematants were collected from isolated cell lines and concentration of antibody in the culture supematants determined by immunoassay. Supematants containing antibody ranging from 0 to 30 ng of total antibody protein firom each cell line was analyzed by non-reducing SDS-PAGE electrophoresis followed by Western Blot with anti-human kappa 3HRP conjugated antibody to detect CH2 domain deleted huCC49 Form A and Form B isoforms. Under these conditions, Form A migrates as a single 120 kDa homodimer and Form B as a 60 kDa doublet. Also visible are kappa chain monomer and dimers. Connecting peptides shown in SEQ 3D NOs: 8, 9, 14, and 15 were all found to increase the proportion of Form A produced.
Table 3. The percentage of Form A antibody after affinity chromatography (Protein G) and after HIC purification
Figure imgf000095_0001
These data show that novel, engineered synthetic hinge region connecting peptides can be used to preferentially favor the formation ofthe A or B isoform. These studies also reveal the importance ofthe cysteine residues at position 242 (Kabat numbering system) in synthesizing the CH2 domain-deleted antibody Form A isofbrm. Substituting the cysteine at either position 239 or 242 with serine (e.g., using connecting peptides shown in SEQ 3D NOs: 10, 11, 12, or 13) shifts CH2 domain-deleted antibody biosynthesis to the Form B isoform. Accordingly, in one embodiment, a connecting peptide ofthe invention comprises a cysteine at at least one of position 239 or 242. The use of connecting peptides which increase the proportion of Form A produced will lead to a beneficial improvement in process, yield and/or stability. These synthetic hinge region connecting peptides are useful for favoring synthesis of CH2 domain deleted antibody Form A isoform for any antibody isotype, e.g., IgGl, IgG2, IgG3, or IgG4, based on the extremely high degree of homology among the CH3 domains for all four human isotypes. Including identical and conserved amino acid residues, IgGl CH3 domain is 98.13% homologous to IgG2 CH3, 97.20% homologous to IgG3 CH3, and 96.26% homologous to IgG4 CH3. Example 4: Purification of Form A and Fomi B from a Monoclonal Antibody Mixture Containing Both Isoforms 10 mL of ddCC49 supernatant was titrated with IM Tris pH 9.0 to a final pH of 7.5. This material was filtered through a series of Sol- Vac 0.8 μ and 0.4 μ membranes. A 100 mL XK50 Protein G column was pre-equilibrated with lxPBS at a flow rate of 80 ml/min. The titrated, filtered supernatant was loaded onto the column at 80 ml/min. Bound protein was washed with the equilibrium buffer for 2 column volumes and then eluted with 100 mM Glycine at pH 3.0. The fractions containing the ddCC49 peak were collected and immediately titrated with 1 M Tris pH 9.0 to a final pH of7.0. A Toso Biosep Phenyl 5PW-HR column was pre-equilibrated with 20 mM Phosphate pH 7.2; 1 M Ammomum Sulfate. The Protein G eluate was titrated to 1 M Ammonium Sulfate using a 3.5 M Ammomum Sulfate pH 7.2 stock and loaded at a concentration of 2 mg/ml of gel bed. Bound protein was washed with a 20mM Phosphate pH 4 or 7.2 Ammonium Sulfate to adjust the conductivity to 116.4 mS/cm. The material eluted from this condition has an apparent molecular weight about 120 kD (Form A) on a non-reducing SDS-PAGE. The remaining bound antibody was further eluted with a linear gradient of reducing Ammonium Sulfate content in the Phosphate buffer. This method separates Forms A and B in two separate peaks. The latter eluted antibody apparently lacks the disulfide linkage between the heavy chains and its molecular weight is about 60 kDa (Form B). Both ofthe above purified materials can be recaptured by bringing the ammonium sulfate concentiation to IM and reloading it onto the cleaned Phenyl 5PW- HR column. Bound protein is eluted with 20mM Phosphate pH 7.2 and dialyzed into 1 x PBS.
Example 5. Comparison of Stability of Form A and Form B The biologic activity of Forms A and B (as measured in preliminary experiments e.g., using direct binding or competition studies) revealed that Forms A and B have similar biologic activity. The stability of Forms A and B was also compared. Purified ddCC49 molecules were concentrated to about 5 mg/ml by Amicon concentrator fitted with
YM30 membrane (Millipore). The concentrated materials were equally divided into four portions for each isoforms and each fraction was put into 10K dialysis cassette (Pierce, cat# 66410) for 16 h dialysis in the following buffers: 1) 10 mM Sodium Phosphate, pH3; 2) 10 mM Sodium acetate, pH 5; 3) 10 mM Sodium Phosphate, pH 7; and 4) 10 mM Sodium Borate, pH 9. After dialysis, the protein concentiation of each solution was adjusted to 3 mg/ml. In addition to the pure A and B isoform solution, a portion of A and B solutions from each pH were mixed to create a mixture containing 50% each isoform. Total of 12 formulations were created (four pH levels times 3 antibody solutions). The solutions were filtered and filled in 3 ml Type-1 glass serum vials (West Pharmaceuticals) with gray butyl stopper. Three temperatures, 2-8°C, 20-25°C, and 38-42°C were chosen to store the protein solutions for stability testing. Prior to storage, 500 μl samples were drawn from each formulation for physical and chemical analyses, these zero-time point data were refened to as control. Once in storage, samples were drawn at the following schedule, 2 weeks, 1 month, 2 months and 3 months and submitted for testing immediately. To evaluate the physical and chemical stability ofthe two isoforms, the following methods were used: turbidity measured at OD32o, non-reducing SDS-PAGE, and size-exclusion chromatography. Non-reducing SDS-PAGE was performed on for samples stored at 2-8°C, 20-25°C and 38-42°C for various time points. Both A and B form are relatively stable at pH 5 when stored at 2-8°C. However, when formulated at pH 7 and 9, both A and B forms showed degradation as indicated by increasing in number of bands that were smaller than the original major bands (120 kDa for form A and 60 kDa for form B). It was noticed that, particularly for pH 7 and 9 samples stored at low and intermediate temperatures, the intensity and number of bands that were less than 55 kDa were higher in B-isoform than A. This indicated that under these conditions the A-isoform is more stable than B-isoform. However, this seems not to be the case for A-isoform in pH 5 and stored at 20-25°C. This sample seemed to have more fragments than B-isoform. This appears to have been an artifact due to microbial contamination (discussed in more detail below). At high storage temperature, both forms at pH 9 were significantly degraded and there was almost no difference in gel patterns among the samples. Under this condition, trace amount of smear bands showed up at top ofthe gel which indicated the formation of aggregates. Because aggregates could be dissolved by SDS, the aggregation was investigated using the methods described in the following sections.
Table 4A through Table 4C list the turbidity data for ddCC49 stored at three different temperatures. The turbidity measures both the soluble and non-soluble aggregates and it is based on the amount of light scattered by these particles. When present, aggregates will scatter light and result in an increase in A3 o. As showed in Table 4A-C, the turbidity of ddCC49 molecules stored at 2-8°C increases as pH increased for both A and B isoforms, with the former being less turbid than the latter. This trend held true for samples stored for less than a month at higher temperatures (20- 25°C and 38-40°C). As storage time reached 3 months, the turbidity increased significantly for samples at high pH and temperature, and the difference between A and B forms diminished. These results parallel those of SDS-PAGE and indicate that both isoforms are relatively stable (in terms of not forming aggregates) at pH 3 and 5, and that A-isoform is less susceptible to aggregation than the B isoform.
Figure imgf000098_0001
Figure imgf000099_0001
Size exclusion chromatography (SEC) is a powerful method for revealing the percent of intact molecules and the degraded products (both fragments and soluble aggregates) and is highly reproducible. In Table 4A-C the percent of intact monomer of A-isoform, B-isoform and the mixture stored at different temperatures are listed. For samples stored at 2-8°C, it is clear that Form A has a higher percentage of monomer as compared to Form B, and the mixture of Form A and Form B was somewhere in between. At this storage temperature, both forms were relatively stable at pH 3, 5 and 7 (with pH 5 being the most stable condition) for about three months. However, at pH 9 there was a significant decrease in percentage of monomer for Form B but only a slight decrease for Form A. At elevated temperatures, all samples showed a significant decrease in percent of monomer as storage time increased; the A-isoform outperformed the B- isoform. However there was an exception, the sample of A-isoform in pH 5 stored at room temperature exhibited much more degradation than the B-isoform or the mixture under similar storage conditions. A close examination of this particular A-isoform vial, the data from SDS-PAGE, and SEC ofthe sample suggested that microbial contamination might have caused this unexpected result. First, both the SEC and SDS- PAGE results indicated that the degradation for this sample was primarily accounted for by a increase in fragmentation, presumably resulting from microbial digestion, otherwise some degree of increase in aggregation would have been expected. Second, the fact that the mixture sample, which contained 50% each of A and B-isoform, showed a better stability profile than B-isoform indicating that a more stable A-isoform must have contributed to the higher percent of monomer. Finally, A-isoform in pH 5 stored at 2- 8°C and 38-42°C both showed higher percent of monomer than B-isoform under similar conditions. Therefore, intermediate storage temperature should have yielded similar results. Due to the limited amount of sample, an assay for microbial contamination could not be performed. It was also noted that for both isoforms of 3DEC-159 stored in high pH (9) and at 40°C, the percent of monomer reduced to about 30%. Under these severe conditions, the stability differences between the two isofomis disappeared. This SEC result minors ofthe results found using SDS-PAGE. Both results indicate that, although some chemical and physical characteristics differ between the two isoforms, the mechanism and by-products of degradation for both isoforms are similar, if not identical. hi summary, the SEC results indicate that both A and B-isoforms have optimal pH at about 5, and that A-isoform is more stable than B-isoform in terms of retaining higher percent of intact monomer at similar storage conditions.
Figure imgf000100_0001
Example 7. Preparative Purification of Forms A and B IDEC-159 (ddCC49) is a CH2 domain deleted monoclonal antibody directed against TAG-72 antigen, which is expressed on the surface of tumors. IDEC- 159 contains two isoforms ofthe antibody, called Form A and Form B. The cunent cell culture process for 3DEC-159 produces an approximate 50:50 ratio of Form A to Form B. The Form A isoform is an antibody with a deleted CH2 region in the Fc portion ofthe heavy chain, hi addition to having a deleted CH2 region, Form B also lacks the disulfide bond linkage across the Fc region and is only held together by hydrophobic interactions and salt bridges. The third and final chromatography step in the IDEC- 159 purification process was developed to separate the two isoforms of 3DEC-159. The separation is achieved by hydrophobic interaction chromatography (HIC), using a Phenyl TSKgel 5PW-HR adsorbent. Since form B is more hydrophobic than form A, it adsorbs ineversibly to the stationary phase using approximately 0.73 M Ammonium Sulfate / 20 mM Sodium Phosphate, pH 4.0 - pH 7.0 as the mobile phase. Form A binds to a lesser extent to the stationary phase under these conditions and is therefore eluted isocratically, i.e. it leaves the column with the flowthrough fraction. Subsequent to the isocratic elution of Form A, omitting Ammomum sulfate from the mobile phase desorbs Form B. The following method was used to separate the two isoforms of IDEC-159:
• The column was sanitized using 3 CVs of 0.5 N NaOH, at 150 cm/hr.
•The column was equilibrated using ≥5 CVs of 0.73 M Ammomum Sulfate / 20 mM
Sodium Phosphate, pH 4.0, at <150 cm/hr.
•The column was loaded with room temperature TMAE Flowthrough that has been adjusted to include 0.43 volumes of 2.5 M Ammomum Sulfate / 20 mM Sodium Phosphate, pH 4.0 liquid stock solution, at 5 mg per ml of resin. •The antibody was loaded onto the column at pH 4.0, at ≤IOO cm/hr. •Collection ofthe antibody started when the outlet OD. at 280 nm reaches 10 mAU. •The column was washed using 15 CVs of 0.73 M Ammonium Sulfate / 20 mM Sodium Phosphate, pH 4.0, at <100 cm/hr.
•Continue antibody collection throughout the 15 CV wash, then the outlet was diverted back to waste.
•The column was stripped using >5CVs of 20 mM Sodium Phosphate, pH 4.0, at <100 cm/hr. 6. The column was cleaned with 3 CVs 0.5 N NaOH, at <150 cm/hr.
•The column was equilibrated with >3 CVs of 0.73 M Ammonium Sulfate / 20 mM Sodium Phosphate, pH 4.0, at <150 cm/hr. •The column was stored in Ξ≥3 CVs of 20% Ethanol, at >150 cm/hr. The separation ofthe two forms at a preparative scale (5L column volume, total IDEC-159 load approximately 20 g) is shown in Figures 13 (A and B). The first two peaks comprise the isocratic elution of Form A, the second peak shows the eluted Form B, while the third peak contains impurities, which are removed from the stationary phase during cleaning. The capability of this method to separate Forms A and B at preparative scale was also demonstrated by SDS PAGE.
Example 8. Preparation of a CH2 Domain-Deleted Tetiavalent Antibody
HuCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody design was based on appending a huCC49 single chain Fv (scFv) to the carboxyl terminus ofthe HuCC49 CH2 domain-deleted antibody CH3 domain. A schematic diagram of HuCC49 CH2 domain-deleted sc(Fv)2 tetravalent antibody is shown in Figure 4. An equivalent reference to this design is C-scFv Tetravalent CH2 Domain Deleted antibody. The preparation of single polypeptide chain binding molecules ofthe Fv region, single-chain Fv molecules, is described in U.S. Pat. No. 4,946,778. A CC49 scFv immunoglobulin- like antibody is described in U.S. Pat. No. 5,892,019. The huCC49 scFv is comprised of a VL and a VH region sequence tethered by a short synthetic linker (VL - (Gly4Ser)3 linker - VH orientation) and was synthesized by PCR amplification. The 5' VL PCR primer included a Bam HI restriction endonuclease site followed by sequence encoding a (Gly4Ser) linker peptide. The 3' VL PCR primer included sequence partially encoding a (Gly4Ser)3 linker peptide used to connect the two VL and VH regions. The 5' VH PCR primer also included sequence partially encoding a (Gly Ser)3 linker peptide used to connect the VL and VH regions. Finally, the 3' VH PCR primer included a stop codon followed by a Bam HI site. The two V regions were amplified with the two sets of PCR primers from plasmid DNA substrate containing huCC49 CH2 domain-deleted antibody and assembly ofthe scFv was accomplished in a second PCR reaction through the common overlapping sequences encoding the (Gly4Ser)3 linker. The huCC49 scFv gene fragment was gel isolated, digested with Bam HI restriction endonuclease and cloned into a single Bam HI site previously introduced into the huCC49 CH2 domain-deleted antibody Polycistronic expression vector. (See US 2003 0157641 Al.). Briefly, the vector was modified by removing an existing stop codon at the 3' end ofthe gene coding for the CH3 domain and replacing with nucleotides coding for the amino acid sequence Ser-Gly-Gly-Gly immediately followed by a Bam HI restriction endonuclease site (coding for Gly-Ser). The Bam HI digested huCC49 scFv fragment was cloned into the Bam HI site ofthe vector resulting in a fusion product ofthe huCC49 scFv to the carboxyl terminus ofthe huCC49 CH2 domain-deleted antibody CH3 domain through a 16 amino acid Ser(Gly4Ser)3 linker. Conect sequences were confirmed by DNA sequence analysis. Plasmid DNA was used to transform CHO DG44 cells for stable production of antibody protein. The engineered antibody was designated huCC49 domain-deleted sc(Fv)2 tetravalent antibody. Figure 8 A shows the DNA sequence of heavy chain huCC49 domain-deleted sc(Fv)2 tetravalent antibody. Figure 8C shows the DNA sequence of light chain huCC49 domain-deleted sc(Fv)2 tetravalent antibody. Figure 9 A shows the amino acid sequence of heavy chain huCC49 domain-deleted sc(Fv)2 tetravalent antibody. Figure 9C shows the amino sequence of light chain huCC49 domain-deleted sc(Fv)2 tetravalent antibody. Supematants were collected from isolated cell lines and concentration of antibody in the culture supematants determined by immunoassay. Supematants were analyzed by non-reducing SDS-PAGE electrophoresis followed by Western Blot with anti-human kappa- HRP conjugated antibody to detect huCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody Form A and Form B isoforms. Under these conditions, Form A was observed to migrate as a single ~170 kDa homodimer and Form B as a ~85 kDa doublet in approximately a 50:50 ratio of A to B isoform. As shown in Figure 18, five individually isolated clones were all found to produce an A and B CH2 domain- deleted sc(Fv)2 tetravalent antibody isoform. One ofthe clones was selected for antibody production and purification using HIC chromatography as described in Example 4. Purified huCC49 CH2 domain-deleted sc(Fv)2 tetravalent antibody Forms A and B were analyzed by non-reducing and reducing SDS-PAGE and the results are shown in Figure 19. Form A huCC49 domain-deleted sc(Fv)2 tetravalent antibody was effectively separated from Fomi B in excess of 95% purity. As expected, both purified Forms behaved identically under reducing SDS-PAGE conditions. HuCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody Form A was examined by size exclusion chromatography and found to elute primarily as a single peak (96%) indicating that there was no significant aggregation or decomposition of antibody product (Figure 20). Example 9. Biodistribution Profile of HuCC49 CH2 Domain-Deleted Tetiavalent Antibody. HuCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody Form A was ^tested in a competitive binding assay for it's ability to bind to bovine submaxillary mucine, a source ofthe TAG-72 antigen, by time-resolved flourometric immunoassay using a Delphia fluorimeter (Wallac Inc., Gaithersburg, MD). Competitive binding curves are shown in Figure 21. HuCC49 CH2 domain-deleted sc(Fv)2 tetravalent antibody Form A and contiol parent CH2 domain-deleted huCC49 (refened to as HuCC49 or 3DEC 159) antibodies were evaluated. Relative binding activity for the tetiavalent antibody was found to be 5-fold more avid than the contiol parent CC49 antibody (GraphPad Prism 4.0 for Windows, GraphPad, Software, San Diego California USA. www, graphpad.com), consistent with an expected increase in the number of antigen binding sites. Biodistribution of 90Y- radiolabeled huCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody was compared to results previously generated with control parent huCC49 antibody in athymic nude mice bearing LS-174T human tumor xenografts. HuCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody was conjugated with the chelator Chx-DTPA and binding activity assessed. Conjugated huCC49 CH2 domain-deleted sc(Fv)2 tetravalent antibody showed a 5-6 fold higher avidity than the conjugated contiol parent huCC49 demonstrating that the tetravalent antibody could be derivatized without losing significant binding activity. HuCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody was labeled with 90Y and a single dose of radiolabeled antibody was administered by i.v. tail vein injection to mice presenting pre-established tumors of approximately 250 mm3. Samples were harvested and processed for beta counting. Percentage injected dose (%3D) of 90Y radiolabeled antibody per gram of tumor or normal tissue was determined from 3 to 72 hours and is shown in Table 6.
Table 6.
Figure imgf000104_0001
Data represent mean values +/- standard enors. ** technical problem with sample HuCC49 CH2 domain-deleted sc(Fv)2 tetiavalent (C-scFv tetravalent CH2 domain deleted) antibody showed lower accumulation in the kidney than contiol huCC49 antibody, likely due to the increased molecular mass ofthe antibody. Tumor accumulation of huCC49 CH2 domain-deleted sc(Fv)2 tetravalent antibody was similar to that achieved with the contiol parent huCC49 (Table 6). However, as mentioned, these two biodistribution studies were not conducted simultaneously and are subject to experimental variation. A figure showing tumor retention for contiol parent huCC49 and huCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody as measured by %3D/gm is shown in Figure 35. Figure 35 also shows the same tumor retention data normalized to peak accumulation of radioactivity. AUC analysis ofthe two normalized retention curves in Figure 35 was calculated using GraphPad Prism 4.0 for Windows, GraphPad, Software, San Diego California USA. www. graphpad.com. Control parent huCC49 had a Total Peak Area of 2037 units and huCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody had a Total Peak Area of 2562 units representing a 25.8% increase in area for the tetravalent protein. Representation of the data in this format suggests that there is improved retention of tetravalent antibody in the tumor compartment compared to the parent divalent molecule. The tetrameric HuCC49 constiruct affords certain advantages for pretargeting, e.g., radioimmunotherapeutic (RIT) pretargeting. This advantage is defined by three observations derived from Table 6. First, the tetrameric HuCC49 CH2 domain-deleted construct has a blood clearance rate comparable to that ofthe current CH2 domain-deleted HuCC49 constiruct. This fast blood clearance may obviate the need for a "clearing agent" to expedite removal ofthe antibody from the blood prior to administration ofthe radiolabeled ligand that localizes to the tumor-bound antibody. Elimination of the clearing agent significantly reduces the complexity of this modality of tieatment in the clinical setting. Second, tumor retention for the tetrameric constiruct is comparable to the cunent dimeric construct. Therefore, radiation dose delivered will be comparable for the two constructs ((Table 6). Third, the lower kidney and liver uptake compared to the CH2 domain-deleted HuCC49 may enable larger input doses ofthe radiolabeled ligand before reaching organ-limiting toxicity.
Example 10. Preparation of a HuCC49 CH2 Domain-Deleted Tetravalent Antibody Comprising a Novel Connecting Peptide and Preferential Synthesis of Isoform A A huCC49 CH2 domain-deleted sc(Fv)2 tetravalent antibody similar to the design shown in the bottom half of Figure 4 but containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] synthetic connecting peptide indicated in Table 2 was constructed. Briefly, gene sequences coding for partial Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide was synthesized by PCR amplification using a 5' connecting peptide PCR primer encoding a Sal I restriction endonuclease site and a 3' connecting peptide PCR primer encoding an Xho I site. Plasmid DNA containing the gene sequence coding for the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide was used as substrate. The PCR product encodes all of Gl/G3/Pro243Ala244Pro245 and part of [Gly/Ser] connecting peptide. The Gl/G3/Pro243Ala244Pro245 hinge fragment was gel isolated, digested with Sal I and Xho I restriction endonucleases and cloned into the Sal I and Xho I vector sites reconstituting the full length Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide. Conect sequences were confirmed by DNA sequence analysis. Plasmid DNA was used to transform CHO DG44 cells for stable production of antibody protein. Figure 8B shows the DNA sequence of heavy chain huCC49 domain-deleted sc(Fv)2 tetravalent antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide. Figure 8C shows the DNA sequence of light chain huCC49 domain-deleted sc(Fv)2 tetravalent antibody containing the Gl/G3/Pro243 Ala244Pro245 + [Gly/Ser] connecting peptide. Figure 9B shows the amino acid sequence of heavy chain huCC49 domain-deleted sc(Fv)2 tetiavalent antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide. Figure 9C shows the amino sequence of light chain huCC49 domain-deleted sc(Fv)2 tetravalent antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide. Supematants were collected from isolated cell lines and concentiation of antibody in the culture supematants determined by immunoassay. Supematants were analyzed by non-reducing SDS-PAGE electrophoresis followed by Western Blot with anti-IgG- HRP conjugated antibody to detect huCC49 CH2 domain-deleted sc(Fv)2 tetravalent (C-scFv tetravalent CH2 domain-deleted) antibody Form A and Form B isoforms. Under these conditions, Form A is expected to migrate as a single ~170 kDa homodimer and Form B as a ~85 kDa doublet in approximately a 50:50 ratio of A to B isoform. As shown in Figure 22, a representative CH2 domain-deleted sc(Fv)2 tetiavalent antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide was found to produce all Form A tetiavalent antibody isoform. A cell line containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] (SEQ 3D NO: 9) connecting peptide introduced into the huCC49 CH2 domain-deleted sc(Fv)2 tetravalent antibody sequence was used for antibody production. Antibody was produced and purified using methods described in Example 4 above. HuCC49 CH2 domain- deleted sc(Fv)2 tetiavalent antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] (SEQ 3D NO:9) connecting peptide was purified using only the Protein G column, eluted essentially as a single peak at 96% purity without further HIC purification. Reduced and non-reduced purified protein samples were analyzed by SDS- PAGE electrophoresis. Under non-reducing conditions, Form A is expected to migrate as a single 170 kDa homodimer and Form B as a 85 kDa doublet. The connecting peptide shown in SEQ 3D NO: 9 was found to substantially increase the proportion of Form A produced. Exemplary results are shown in Figure 23. This result shows that the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge (SEQ 3D NO:9) resulted in the production of essentially all Form A huCC49 CH2 domain-deleted sc(Fv)2 tetiavalent (C-scFv tetravalent CH2 domain deleted) antibody with little or no detectable Form B, demonstrating that the utility of this hinge for producing the Form A isoform is generally applicable to complex antibodies such as multivalent antibodies. It is clear that this invention is also applicable to bispecific tetravalent antibody formats as well. HuCC49 CH2 domain-deleted sc(Fv)2 tetiavalent Gl/G3/Pro243Ala244Pro245 antibody was examined by size exclusion chromatography and found to essentially elute as a single peak containing 84% monomer. The fraction containing the residual aggregates was removed by preparative size exclusion chromatography with the resulting preparation containing essentially 95% monomer (Figure 24)
HuCC49 CH2 domain-deleted sc(Fv)2 tetiavalent Gl/G3/Pro243Ala244Pro245 antibody was tested in a competitive binding assay for it's ability to bind to bovine submaxillary mucine, a source ofthe TAG-72 antigen, by time-resolved flourometric immunoassay using a Delphia fluorimeter (Wallac Inc., Gaithersburg, MD). Competitive binding curves are shown in Figure 25. HuCC49 CH2 domain-deleted sc(Fv)2 tetravalent antibody Fomi A and contiol parent CH2 domain-deleted huCC49 (refened to as HuCC49 or IDEC 159) antibodies were evaluated. Relative binding activity for the tetravalent antibody was found to be 8-fold more avid than the control parent HuCC49 antibody (GraphPad Prism 4.0 for Windows, GraphPad, Software, San Diego California USA. www, graphpad.com), consistent with an expected increase in the number of antigen binding sites. These results show that the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide (SEQ 3D NO:9) resulted in the production of essentially all Form A huCC49 CH2 domain-deleted sc(Fv)2 tetiavalent antibody with no detectable Form B. The purified antibody demonstiated an increase in avidity towards antigen.
Example 11. Preparation of a CH2 Domain-Deleted Tetravalent Antibody
A huCC49 minibody and a huCC49 2 sc(Fv)2 tetiavalent antibody (N- scFv tetravalent mimbody) as shown in Figure 2 were both constructed. Briefly, huCC49 2 sc(Fv)2 tetiavalent antibody (N-scFv tetiavalent minibody) design was based on inserting a huCC49 single chain Fv (scFv) between the carboxyl end ofthe first scFv domain and the amino-end ofthe hinge connecting peptide in the huCC49 minibody. The preparation of single polypeptide chain binding molecules ofthe Fv region, single- chain Fv molecules, is described in U.S. Pat. No. 4,946,778. A CC49 scFv immunoglobulin-like antibody is described in U.S. Pat. No. 5,892,019. The preparation of a mimbody constiruct is described in U.S. Pat. No. 5,837,821. The huCC49 scFv is comprised of a VL and a VH region sequence tethered by a short synthetic linker (VL → (Gly4Ser)3 linker → VH orientation) and was synthesized by PCR amplification and used to constiruct a huCC49 minibody. Second, the mimbody vector was modified by adding a modified (Gly4Ser)5 linker to the carboxyl end ofthe amino-terminal scFv domain ofthe huCC49 minibody by PCR amplification, replacing nucleotides coding for the last two amino acids residues ofthe linker with an Nhe I restriction endonuclease site. This results in a (Gly4Ser)4 -Gly3-Ala-Ser linker followed by a Sal I restriction endonuclease site separated by several nucleotides. A second huCC49 scFv was amplified using PCR from plasmid DNA substrate containing huCC49 scFv gene with the 5' VL PCR primer encoding an Nhe I restriction endonuclease site and the 3' VH PCR primer encoding a Sal I site. The huCC49 scFv fragment was gel isolated, digested with Nhe I and Sal I restriction endonucleases and cloned into Nhe I and Sal I sites between the first scFv and the hinge connecting peptide. This results in a fusion product consisting of a leader peptide to two serial huCC49 scFvs to a hinge connecting peptide to a CH3 domain. Conect sequences were confirmed by DNA sequence analysis. Plasmid DNA was used to transform CHO DG44 cells for stable production of antibody protein. Figure 10A shows the DNA sequence of huCC49 tetravalent (N-scFv tetiavalent) mimbody gene. Figure 11A shows the amino acid sequence of huCC49 tetiavalent (N-scFv tetravalent) minibody. Supematants were collected from isolated cell lines and concentration of antibody in the culture supematants determined by immunoassay. Supematants were analyzed by non-reducing SDS-PAGE electrophoresis followed by Western Blot with anti-IgG- HRP conjugated antibody to detect heavy chain constant sequences in the Form A and Form B isofomis. Under these conditions, huCC49 minibody Form A is expected to migrate as a single ~82 kDa homodimer and half molecules or Form B as a ~41 kDa doublet. HuCC49 2 sc(Fv)2 tetiavalent minibody Form A is expected to migrate as a single ~138 kDa homodimer and Form B as a ~69 kDa doublet in approximately a 50:50 ratio of A to B isoform. By comparison, huCC49 CH2 domain deleted antibody (expected to migrate as a single ~120 kDa homodimer and Form B as a ~60 kDa doublet in approximately a 50:50 ratio of A to B isoform) was used as control. As shown in Figure 26, representative isolated minibody and 2 sc(Fv)2 tetiavalent mimbody clones were found to secrete both A and B isoforms consistent with the expected molecular masses under both non-reducing and reducing SDS-PAGE conditions. Example 12. Preparation of a HuCC49 CH2 Domain-Deleted Tetiavalent Antibody Comprising a Novel Connecting Peptide and Preferential Synthesis of Isoform A A huCC49 2 sc(Fv)2 tetiavalent antibody (N-scFv tetravalent mimbody) similar to the design shown in the bottom of Figure 2 but containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide indicated in Table 2 was constructed. Briefly, gene sequences coding for partial Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide was synthesized by PCR amplification using a 5' connecting peptide PCR primer encoding a Sal I restriction endonuclease site and a 3' connecting peptide PCR primer encoding an Xho I site. Plasmid DNA containing the gene sequence coding for the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide was used as substrate. The PCR product encodes all of Gl/G3/Pro243Ala244Pro245 and part of [Gly/Ser] connecting peptide. The Gl/G3/Pro243 Ala244Pro245 hinge fragment was gel isolated, digested with Sal I and Xho I restriction endonucleases and cloned into the Sal I and Xho I vector sites reconstituting the full length Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide. Conect sequences were confirmed by DNA sequence analysis. Plasmid DNA was used to tiansform CHO DG44 cells for stable production of antibody protein. Figure 10B shows the DNA sequence of huCC492 sc(Fv)2 tetiavalent antibody (N-scFv tetiavalent minibody) gene containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide. Figure 1 IB shows the amino acid sequence of huCC49 2 sc(Fv)2 tetravalent antibody (N-scFv tetiavalent mimbody) gene containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide. Supematants were collected from isolated cell lines and concentration of antibody in the culture supematants determined by immunoassay. Supematants were analyzed by non-reducing SDS-PAGE electrophoresis followed by Western Blot with anti-IgG- HRP conjugated antibody to anti-IgG- HRP conjugated antibody to detect huCC49 2 sc(Fv)2 tetiavalent minibody (N-scFv tetiavalent minibody) Form A and Form B isoforms. Under these conditions, huCC492 sc(Fv)2 tetravalent minibody Form A is expected to migrate as a single ~138 kDa homodimer and Form B as a ~69 kDa doublet in approximately a 50:50 ratio of A to B isoform. As shown in Figure 27, a representative huCC49 2 sc(Fv)2 tetravalent mimbody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide was found to produce essentially all Form A tetravalent minibody isoform. A cell line containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] (SEQ 3D NO: 9) connecting peptide introduced into the huCC49 2 sc(Fv)2 tetiavalent minibody sequence was used for antibody production. Because huCC492 sc(Fv)2 tetiavalent mimbody lacks a CHI domain, protein cannot be purified using Protein G chromatography. Antibody was subsequently purified using a combination of anion exchange, hydrophobic interaction, and size exclusion chromatography methods. HuCC49 2 sc(Fv)2 tetravalent minibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] (SEQ 3D NO:9) connecting peptide was purified essentially as a single peak at 97.6 % purity. Reduced and non-reduced purified protein samples were analyzed by SDS-PAGE electrophoresis. Under non-reducing conditions, Form A is expected to migrate as a single -138 kDa homodimer and Form B as a -69 kDa doublet. The connecting peptide shown in SEQ ID NO: 9 was found to substantially increase the proportion of Form A produced. Exemplary results are shown in Figure 28. This result shows that the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] hinge (SEQ 3D NO:9) resulted in the production of essentially all Form A huCC49 2 sc(Fv)2 tetiavalent minibody (N- scFv tetiavalent minibody) with little or no detectable Form B, demonstrating that the utility of this hinge for producing the Form A isoform is generally applicable to complex antibodies such as multivalent antibodies. It is clear that this invention is also applicable to bispecific tetravalent antibody formats as well. Purified huCC49 2 sc(Fv)2 tetravalent Gl/G3/Pro243Ala244Pro245 minibody was examined by size exclusion chromatography and found to essentially elute as a single peak containing 97.6% monomer (Figure 29). Purified huCC49 2 sc(Fv)2 tetiavalent Gl/G3/Pro243Ala244Pro245 mimbody was tested in a competitive binding assay for it's ability to bind to bovine submaxillary mucine, a source ofthe TAG-72 antigen, by time-resolved flourometric immunoassay using a Delphia fluorimeter (Wallac Inc., Gaithersburg, MD). Competitive binding curves are shown in Figure 30. HuCC49 2 sc(Fv)2 tetiavalent Gl/G3/Pro243Ala244Pro245 mimbody, huCC49 minibody, huCC49 CH2 domain- deleted sc(Fv)2 tetravalent Gl/G3/Pro243 Ala244Pro245 antibody, and control parent CH2 domain-deleted huCC49 (refened to as HuCC49 or IDEC 159) antibodies were evaluated. Relative binding activities for both tetravalent antibodies were found to be more avid than the control parent huCC49 antibody or minibody (GraphPad Prism 4.0 for Windows, GraphPad, Software, San Diego California USA. www. graphpad.com . consistent with an expected increase in the number of antigen binding sites.
Example 13. Preparation of a PRIMATIZED® ρ5E8 CH2 Domain-Deleted Tetravalent Antibody Comprising a Novel Connecting Peptide and Preferential Synthesis of Isoform A PRIMATIZED® p5E8Gl is a chimeric macaque/human (PRIMATIZED®) monoclonal antibody containing macaque heavy and light variable regions fused to human gamma 1 and kappa constant regions, respectively. PRIMATIZED® p5E8Gl binds to human CD23, the low affinity receptor for IgE (FcεRII) (Mavromatis and Cheson. 2003. J. Clin. Oncol. 21:1874; US Patent Application 20030059424). CH2 domain-deleted PRIMATIZED® p5E8 sc(Fv)2 tetiavalent antibody contaimng the Gl/G3/Pro243 Ala244Pro245 + [Gly/Ser] synthetic connecting peptide indicated in Table 2 (SEQ 3D NO: 9) was constracted using a similar strategy as that described in Example 10. The PRIMATIZED® ρ5E8 scFv used for constructing the sc(Fv)2 tetiavalent antibody is comprised of a p5E8 VL and a VH region sequence tethered by a short synthetic linker in the VL -» (Gly4Ser)3 linker -> VH orientation and is described in greater detail in Example 12 . Conect sequences were confirmed by DNA sequence analysis. Plasmid DNA was used to tiansform CHO DG44 cells for stable production of antibody protein. Figure 12A shows the DNA sequence of heavy chain CH2 domain-deleted PRIMATIZED® p5E8 sc(Fv)2 tetravalent antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide. Figure 12B shows the DNA sequence of light chain CH2 domain-deleted PRIMATIZED® p5E8 sc(Fv)2 tetiavalent antibody. Figure 13 A shows the amino acid sequence of heavy chain CH2 domain-deleted PRIMATIZED® p5E8 sc(Fv)2 tetiavalent antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide. Figure 13B shows the amino sequence of light chain CH2 domain-deleted PRIMATIZED® p5E8 sc(Fv)2 tetravalent antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide. Supernatant was collected from a stably transfected cell line and concentiation of antibody in the culture supernatant determined by immunoassay. Supernatant was analyzed by non-reducing SDS-PAGE electrophoresis followed by Western Blot with anti-human IgG- HRP conjugated antibody to detect Form A and Form B isoforms of CH2 domain-deleted PRIMATIZED® p5E8 sc(Fv)2 tetiavalent antibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide. Under these conditions, Form A is expected to migrate as a single -170 kDa homodimer and Form B as a -85 kDa doublet. The connecting peptide shown in SEQ 3D NO: 9 was found to substantially increase the proportion of Form A tetravalent antibody produced. Exemplary results are shown in Figure 31. These results show that the
Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide (SEQ ID NO:9) resulted in the production of essentially all Form A CH2 domain-deleted PRIMATIZED® ρ5E8 sc(Fv)2 tetiavalent antibody with no detectable Form B, demonstrating that the utility of this hinge for producing the Form A isoform CH2 domain-deleted sc(Fv)2 tetiavalent antibodies is generally applicable to antibodies of varying specificities. Example 14. Preparation of PRIMATIZED® p5E8 Minibodies Comprising a Novel Connecting Peptide and Preferential Synthesis of Isoform A
Minibodies are single chain polypeptides consisting of an scFv fused to immunoglobulin hinge region and CH3 domain. The preparation of minibody single polypeptide chain binding molecules is described in U.S. Pat. No. 5,837,821. Normally, in intact IgG molecules the cysteine residue at position 230 in the hinge region forms a covalent disulfide bond with the carboxyl-terminal light chain constant domain cysteine residue at position 214, joining heavy and light chain polypeptides (Kabat numbering system). In the mimbody design the light chain constant domain is absent, eliminating one ofthe two cysteines that participate in forming the disulfide bond. The single remaining cysteine in the hinge region at position 230, however, has been proposed to participate in a homotypic interchain disulfide bond possibly contributing to hinge region structure and therefore was left in place. Minibodies, which lack a CH2 domain, are secreted from cells and accumulate in culture supernatant as a mixture containing Form A and Form B isoforms and perhaps unassembled half molecules as shown in Figure 32. The ratio of these forms is highly variable and presents a challenge for preparing a reproducibly pure product. The absence ofthe immunoglobulin CH1/CL domains precludes isolation of total minibody using Protein G immunoaffinity matrices. While the unassembled half molecules (MW - 40-45 kD) can be separated from the homodimers (MW ~ 80-90 kD) using a number of chromatographic strategies, the remaining intact A and B isoforms cannot be efficiently separated from one another using techmques such as HIC chromatography (described herein) also due to the absence of CH1/CL domains. These isoforms also cannot be separated by size exclusion chromatography because the molecular masses ofthe two isoforms are nearly identical, prohibiting separation based on this characteristic. Thus the composition of minibody preparations may actually be complex, consisting of a mixture of A and B isoforms. The production of CH2 domain- deleted PPJMATIZED® p5E8 minibodies engineered to contain the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide indicated in Table 2 (SEQ 3D NO: 9) was examined. PPJMATIZED® ρ5E8 scFvs were constructed by PCR amplification. ScFvs were built in both orientations (VL → (Gly Ser)3 linker → VH (VL/VH) and VH - (Gly Ser)3 linker -» VL (VH/VL)). Oligonucleotides used in the construction are shown the tables below: Table 7. PCR primers used to constiruct CH2 domain-deleted PRIMATIZED® p5E8 VL/VH minibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide. In SEQ 3D NO:37 the BspLUl 1 1 restriction endonuclease site is underlined. In SEQ 3D NO:40 the Sal I restriction endonuclease site is underlined.
N-23VL-1F (SEQ 3D NO:37)
5 '- AGAGAGACATGTGGCGACATCCAGATGACCCAGTC-3 '
23-VL-1R (SEQ 3D NO:38)
5'- GGAGCCACCCCCACCGGACCCGCCACCGCCTTTGATTTCCACCTTGGTCC-
3'
23-VH-2F (SEQ 3D NO:39) 5'-
GGGTCCGGTGGGGGTGGCTCCGGGGGCGGTGGCTCCGAGGTGCAGCTGGT GGAGTC-3'
N-23-VH-2R (SEQ 3D NO:40) 5 '- AGAGAGGTCGACTGAGGAGACGGTGACCAGGAC-3 '
Table 8. PCR primers used to construct CH2 domain-deleted PRIMATIZED® ρ5E8 VH/VL minibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide. In SEQ 3D NO:41 the BspLUl 1 1 restriction endonuclease site is underlined. In SEQ 3D NO:44 the Sal I restriction endonuclease site is underlined.
N-23VH-1F (SEQ 3D NO:41)
5 '- AGAGAGACATGTGGCGAGGTGCAGCTGGTGGAGTC-3 '
23-VH-1R (SEQ 3D NO:42) 5 '-GGAGCCACCCCCACCGGACCCGCCACCGCCTGAGGAGACGGTGACCAGG AC-3'
23-VL-2F (SEQ 3D NO:43) 5'- GGGTCCGGTGGGGGTGGCTCCGGGGGCGGTGGCTCCGACATCCAGATGAC CCAGTC-3'
N-23-VL-2R (SEQ 3D NO:44) 5'- AGAGAGGTCGACTTTGATTTCCACCTTGGTCC-3
The VL/VH scFv was constructed in two steps. The 5' VL PCR forward primer N-23VL- IF (SEQ 3D NO:37) included a BspLUl 1 1 restriction endonuclease site to permit joining ofthe scFv to the immunoglobulin signal peptide in the expression vector. The 3' VL PCR reverse primer 23-VL-1R (SEQ 3D NO:38) included sequence partially encoding the (Gly4Ser)3 linker peptide used to join the VL and VH regions. The 5' forward VH PCR primer 23-VH-2F (SEQ 3D NO:30) also included sequence partially encoding a (Gly Ser)3 linker peptide used to connect the VL and VH regions and the 3' VH PCR reverse primer N-23-VH-2R (SEQ 3D NO:40) included a Sal I restriction endonuclease site to join the scFv to the hinge region. The two V regions were amplified with the two sets of PCR primers from plasmid DNA substrate contaimng
PRIMATIZED® p5E8Gl antibody and assembly ofthe scFv was accomplished in a second PCR reaction through the common overlapping sequences encoding the (Gly4Ser)3 linker. The PRIMATIZED® ρ5E8 scFv gene fragment was gel isolated, digested with BspLUl 1 1 and Sal I restriction endonucleases and cloned into the BspLUl 1 1 and Sal I double-digested CH2 domain-deleted antibody Polycistronic expression vector contaming the Gl/G3/Pro243 Ala244Pro245 + [Gly/Ser] connecting peptide. The PRIMATIZED® p5E8 VH/VL scFv was constructed in a similar manner using PCR primer pairs N-23VH-1F (SEQ JD NO:41) and 23-VH-1R (SEQ 3D NO:36) and 23-VL-2F (SEQ 3D NO:43) and N-23-VL-2R (SEQ 3D NO:44) shown in Tables 7 and 8. Conect sequences of both completed constructs were confirmed by DNA sequence analysis. Plasmid DNA was used to tiansform CHO DG44 cells for transient production of antibody protein. Figure 14 shows the DNA sequence of CH2 domain- deleted PRIMATIZED® p5E8 VL/VH mimbody containing the
Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide in the VL → VH orientation (VL/VH). Figure 15 shows the DNA sequence of CH2 domain-deleted PRIMATIZED® p5E8 VH/VL mimbody containing the Gl/G3/Pro243 Ala244Pro245 + [Gly/Ser] connecting peptide in the VH -» VL orientation (VH/VL). Figure 16 shows the amino acid sequence of CH2 domain-deleted PRIMATIZED® p5E8 VL/VH minibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide. Figure 17 shows the amino acid sequence of CH2 domain-deleted PRIMATIZED® p5E8 VH7VL minibody containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide. Supernatant was collected from the transfected cell lines and concentiation of antibody in the culture supernatant determined by immunoassay. Minibody molecules present in culture supernatant were analyzed for binding to soluble CD23 antigen immobilized on plastic microtiter plates by ELISA. Results shown in Figure 33 demonstrate that both PRIMATIZED® p5E8 VH/VL and VL/VH minibodies containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide are equally capable of binding to the CD23 antigen in a dose-responsive manner. Supematants were analyzed by non-reducing SDS-PAGE electrophoresis followed by Western Blot with anti-human IgG- HRP conjugated antibody to detect Form A and Form B isoforms of CH2 domain-deleted PRIMATIZED® p5E8 minibodies containing the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide. Under these conditions, Form A is expected to migrate as a single -80-90 kDa homodimer and Form B as a -40-45 kDa doublet. The connecting peptide shown in SEQ 3D NO: 9 was found to substantially increase the proportion of Form A for both minibodies produced. Exemplary results are shown in Figure 34. These results show that the Gl/G3/Pro243Ala244Pro245 + [Gly/Ser] connecting peptide (SEQ 3D NO:9) resulted in the production of essentially all Form A CH2 domain-deleted PPJMATIZED® ρ5E8 mimbody with no detectable Form B.
Equivalents Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments ofthe invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

What is claimed is:
1. A composition comprising polypeptide dimers comprising at least four binding sites and at least two polypeptide chains, wherein said at least two polypeptide chains comprise at least one heavy chain portion and a synthetic connecting peptide, and wherein greater than about 50% ofthe dimers comprise polypeptide chains that are linked via at least one interchain disulfide linkage.
2. The composition of claim 1 wherein greater than about 90% ofthe dimers are linked via at least one interchain disulfide linkage.
3. The composition of claim 1 wherein at least one ofthe polypeptide chains comprises a CH3 domain linked to a VL, VH or CHI domain via the connecting peptide.
4. The composition of claim 1, wherein the polypeptide chains lack all or part of a CH2 domain.
5. The composition of claim 1, wherein the dimers are linked via two or more interchain disulfide linkages.
6. The composition of claim 1 , wherein the heavy chain portion is derived from an antibody of an isotype selected from the group consisting of: IgGl, IgG2, IgG3, and IgG4.
7. The composition of claim 6, wherein the heavy chain portion comprises an amino acid sequence derived from a hinge region selected from the group consisting of: a γl hinge, a γ 2 hinge a γ 3 hinge, and a γ 4 hinge.
8. The composition of claim 1, wherein the molecules are bispecific.
9. The composition of claim 1, wherein the molecules comprise at least one binding site specific for a soluble ligand.
10. The composition of claim 1, wherein the molecules comprise at least one binding site specific for a cell surface molecule.
11. The composition of claim 1 , wherein the molecules comprise two binding sites specific for a tumor cell antigen and two binding sites specific for a prodrug.
12. The composition of claim 11 , wherein the binding sites specific for the prodrug are catalytic.
13. The composition of claim 1 , wherein the synthetic connecting peptide comprises a proline residue at position 243, Kabat numbering system.
14. The composition of claim 13, wherein the synthetic connecting peptide further comprises an alanine residue at position 244 and a proline residue at position 245 , Kabat numbering system.
15. The composition of claim 1 , wherein the heavy chain portion comprises a chimeric hinge.
16. The composition of claim 1 , wherein the synthetic connecting peptide comprises at least a portion of an IgGl hinge domain, at least a portion of an IgG3 hinge domain.
17. The composition of claim 1, wherein the connecting peptide comprises an amino acid sequence selected from the group consisting of: SEQ 3D NOs: 8-15 and 48.
18. A method of treating a subj ect that would benefit from tieatment with an antigen binding molecule comprising administering a composition of claim 1 to the subject such that tieatment occurs.
19. The method of claim 18, wherein the subject is suffering from cancer.
20. The method of claim 18, wherein the subject is suffering from lymphoma.
21. The method of claim 18, wherein the subj ect is suffering from an autoimmune disease or disorder.
22. The method of claim 18, wherein the subject is suffering from an inflammatory disease or disorder.
23. A nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide chain of claim 1.
24. The composition of claim 1 , wherein the polypeptide dimers comprise four polypeptide chains and wherein two ofthe polypeptide chains comprise at least one heavy chain portion and a synthetic connecting peptide.
25. A nucleic acid molecule comprising a nucleotide sequence shown in
Figure 8B (SEQ 3D NO: 17)
26. A nucleic acid molecule comprising a nucleotide sequence shown in Figure 8C (SEQ 3D NO: 18)
27. A nucleic acid molecule comprising a nucleotide sequence shown in Figure 10B (SEQ ID NO: 23)
28. A nucleic acid molecule comprising a nucleotide sequence shown in Figure 12A (SEQ 3D NO:26).
29. A nucleic acid molecule comprising a nucleotide sequence shown in Figure 12B (SEQ ID NO:27).
30. A nucleic acid molecule comprising a nucleotide sequence shown in
Figure 14 (SEQ 3D NO:30).
31. A nucleic acid molecule comprising a nucleotide sequence shown in Figure 15 (SEQ 3D NO:31).
32. The nucleic acid molecule of any one of claims 24-30 which is in a vector.
33. A host cell comprising the vector of claim 32.
34. A binding molecule comprising the amino acid sequence of Figure 9B (SEQ 3D NO: 20).
35. A binding molecule comprising the amino acid sequence of Figure 9C (SEQ 3D NO: 21).
36. A binding molecule comprising the amino acid sequence of Figure 1 IB (SEQ ID NO: 25).
37. A binding molecule comprising the amino acid sequence of Figure 13 A
(SEQ 3D NO: 28).
38. A binding molecule comprising the amino acid sequence of Figure 13B
(SEQ ID NO: 29).
39. An binding molecule comprising the aniino acid sequence of Figure 16 (SEQ 3D NO: 32).
40. A binding molecule comprising the amino acid sequence of Figure 17 (SEQ ID NO: 33).
41. The composition of claim 1 , wherein said binding sites are individually selected from the group consisting of: an antigen binding site, a ligand binding portion of a receptor, and a receptor binding portion of a ligand.
42. The method of claim 41, wherein the polypeptide chains have at least one binding site derived from an antibody selected from the group consisting of: 2B8, Lym 1, Lym 2, LL2, Her2, Bl, MB1, BH3, B4, B72.3, CC49, 5E8, B3F6, and 5E10.
43. The composition of claim 1 , wherein the polypeptide dimers are tetravalent minibody molecules.
44. The composition of claim 1 , wherein the polypeptide dimers are tetravalent domain deleted antibody molecules.
45. The composition of claim 1, wherein the polypeptide dimers are diabodies.
46. A composition comprising minibody molecules comprising two polypeptide chains, wherein the polypeptide chains comprise a heavy chain portion and a synthetic connecting peptide, wherein the polypeptide chains lack all or part of a CH2 domain, and wherein greater than about 50% ofthe molecules are present in a form in which one ofthe polypeptide chains are linked via at least one interchain disulfide linkage.
47. The composition of claim 46, wherein greater than about 90% ofthe dimers are linked via at least one interchain disulfide linkage.
48. The composition of claim 46 wherein at least one ofthe polypeptide chains comprises a CH3 domain genetically fused to a VL, VH or CHI domain via the connecting peptide.
49. The composition of claim 46, wherein the polypeptide chains lack the entire CH2 domain.
50. The composition of claim 46, wherein the dimers are linked via two or more interchain disulfide linkages.
51. The composition of claim 46, wherein a heavy chain portion is derived firom an antibody of an isotype selected from the group consisting of: IgGl, IgG2, IgG3, and IgG4.
52. The composition of claim 46, wherein the heavy chain portion comprises an amino acid sequence is derived from a hinge region selected from the group consisting of: a γl hinge, a γ 2 hinge a γ 3 hinge, and a γ 4 hinge.
53. The composition of claim 46, wherein said binding sites are individually selected from the group consisting of: an antigen binding site, a ligand binding portion of a receptor, and a receptor binding portion of a ligand.
54. The composition of claim 46, wherein the molecules are bispecific.
55. The composition of claim 46, wherein the connecting peptide comprises a proline residue at position 243, Kabat numbering system.
56. The composition of claim 46, wherein the synthetic connecting peptide comprises a chimeric hinge.
57. The composition of claim 46, wherein the synthetic connecting peptide comprises at least a portion of an IgGl hinge domain, at least a portion of an IgG3 hinge domain.
58. A method of treating a subject that would benefit firom treatment with an antigen binding molecule comprising administering a composition of claim 45 to the subject such that treatment occurs.
59. A nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide chain of claim 46.
60. A composition comprising polypeptide dimers having at least four binding sites and at least two polypeptide chains, wherein said at least two polypeptide chains comprise at least one heavy chain portion and lack all or part of a CH2 domain, wherein greater than 50% ofthe polypeptide dimers comprise polypeptide chains that , are linked via at least one interchain disulfide linkage.
120 0/41
PCT/US2004/020945 2003-06-27 2004-06-28 Modified binding molecules comprising connecting peptides WO2005000899A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
AU2004252171A AU2004252171B2 (en) 2003-06-27 2004-06-28 Modified binding molecules comprising connecting peptides
CA002530388A CA2530388A1 (en) 2003-06-27 2004-06-28 Modified binding molecules comprising connecting peptides
EP04777279A EP1641827A2 (en) 2003-06-27 2004-06-28 Use of hydrophobic-interaction-chromatography or hinge-region modifications for the production of homogeneous antibody-solutions
NZ544924A NZ544924A (en) 2003-06-27 2004-06-28 Modified binding molecules comprising connecting peptides
CN200480024454.7A CN1842538B (en) 2003-06-27 2004-06-28 Modified binding molecules comprising connecting peptides
JP2006517785A JP5068072B2 (en) 2003-06-27 2004-06-28 Modified binding molecule comprising a linking peptide

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US48387703P 2003-06-27 2003-06-27
US60/483,877 2003-06-27
US50881003P 2003-10-03 2003-10-03
US60/508,810 2003-10-03
US51535103P 2003-10-28 2003-10-28
US60/515,351 2003-10-28
US51603003P 2003-10-30 2003-10-30
US60/516,030 2003-10-30

Publications (2)

Publication Number Publication Date
WO2005000899A2 true WO2005000899A2 (en) 2005-01-06
WO2005000899A3 WO2005000899A3 (en) 2005-08-11

Family

ID=33556653

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2004/020944 WO2005000898A2 (en) 2003-06-27 2004-06-28 Use of hydrophobic-interaction-chromatography or hinge-region modifications for the production of homogeneous antibody-solutions
PCT/US2004/020945 WO2005000899A2 (en) 2003-06-27 2004-06-28 Modified binding molecules comprising connecting peptides

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/US2004/020944 WO2005000898A2 (en) 2003-06-27 2004-06-28 Use of hydrophobic-interaction-chromatography or hinge-region modifications for the production of homogeneous antibody-solutions

Country Status (7)

Country Link
US (3) US20050163782A1 (en)
EP (2) EP1641827A2 (en)
JP (4) JP5091476B2 (en)
AU (3) AU2004252171B2 (en)
CA (2) CA2529945A1 (en)
NZ (2) NZ544923A (en)
WO (2) WO2005000898A2 (en)

Cited By (55)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006074399A2 (en) * 2005-01-05 2006-07-13 Biogen Idec Ma Inc. Multispecific binding molecules comprising connecting peptides
WO2007048037A2 (en) * 2005-10-21 2007-04-26 Amgen Inc. METHODS FOR GENERATING MONOVALENT IgG
WO2007146968A2 (en) * 2006-06-12 2007-12-21 Trubion Pharmaceuticals, Inc. Single-chain multivalent binding proteins with effector function
EP1874816A2 (en) * 2005-04-26 2008-01-09 MedImmune, Inc. Modulation of antibody effector function by hinge domain engineering
WO2008119353A1 (en) * 2007-03-29 2008-10-09 Genmab A/S Bispecific antibodies and methods for production thereof
WO2009043051A2 (en) * 2007-09-27 2009-04-02 Biogen Idec Ma Inc. Cd23 binding molecules and methods of use thereof
WO2009036209A3 (en) * 2007-09-14 2009-05-07 Amgen Inc Homogeneous antibody populations
WO2009032949A3 (en) * 2007-09-04 2009-12-30 The Regents Of The University Of California High affinity anti-prostate stem cell antigen (psca) antibodies for cancer targeting and detection
US7662925B2 (en) 2002-03-01 2010-02-16 Xencor, Inc. Optimized Fc variants and methods for their generation
US7700097B2 (en) 2003-06-27 2010-04-20 Biogen Idec Ma Inc. Purification and preferential synthesis of binding molecules
WO2010079149A1 (en) * 2009-01-09 2010-07-15 Ipk Gatersleben Fusion antibody
US7973136B2 (en) 2005-10-06 2011-07-05 Xencor, Inc. Optimized anti-CD30 antibodies
US8021661B2 (en) 2005-01-05 2011-09-20 Biogen Idec Ma Inc. Cripto binding molecules
US8039592B2 (en) 2002-09-27 2011-10-18 Xencor, Inc. Optimized Fc variants and methods for their generation
WO2011117648A3 (en) * 2010-03-25 2011-11-17 Ucb Pharma S.A. Disulfide stabilised antibodies and fragments thereof
US8084582B2 (en) 2003-03-03 2011-12-27 Xencor, Inc. Optimized anti-CD20 monoclonal antibodies having Fc variants
US8101720B2 (en) 2004-10-21 2012-01-24 Xencor, Inc. Immunoglobulin insertions, deletions and substitutions
US8124731B2 (en) 2002-03-01 2012-02-28 Xencor, Inc. Optimized Fc variants and methods for their generation
US8188231B2 (en) 2002-09-27 2012-05-29 Xencor, Inc. Optimized FC variants
US8309690B2 (en) 2005-07-01 2012-11-13 Medimmune, Llc Integrated approach for generating multidomain protein therapeutics
US8318907B2 (en) 2004-11-12 2012-11-27 Xencor, Inc. Fc variants with altered binding to FcRn
US8388955B2 (en) 2003-03-03 2013-03-05 Xencor, Inc. Fc variants
US8394374B2 (en) 2006-09-18 2013-03-12 Xencor, Inc. Optimized antibodies that target HM1.24
US8409568B2 (en) 2005-10-14 2013-04-02 Medimmune, Llc Mutant antibody Fc domains and fusion proteins thereof
US8524867B2 (en) 2006-08-14 2013-09-03 Xencor, Inc. Optimized antibodies that target CD19
US8546543B2 (en) 2004-11-12 2013-10-01 Xencor, Inc. Fc variants that extend antibody half-life
US8629246B2 (en) 2007-09-26 2014-01-14 Ucb Pharma S.A. Dual specificity antibody fusions
US8802820B2 (en) 2004-11-12 2014-08-12 Xencor, Inc. Fc variants with altered binding to FcRn
US8853366B2 (en) 2001-01-17 2014-10-07 Emergent Product Development Seattle, Llc Binding domain-immunoglobulin fusion proteins
GB2519786A (en) * 2013-10-30 2015-05-06 Sergej Michailovic Kiprijanov Multivalent antigen-binding protein molecules
US9040041B2 (en) 2005-10-03 2015-05-26 Xencor, Inc. Modified FC molecules
US9051373B2 (en) 2003-05-02 2015-06-09 Xencor, Inc. Optimized Fc variants
US9101609B2 (en) 2008-04-11 2015-08-11 Emergent Product Development Seattle, Llc CD37 immunotherapeutic and combination with bifunctional chemotherapeutic thereof
US9150663B2 (en) 2010-04-20 2015-10-06 Genmab A/S Heterodimeric antibody Fc-containing proteins and methods for production thereof
US9200079B2 (en) 2004-11-12 2015-12-01 Xencor, Inc. Fc variants with altered binding to FcRn
US9657106B2 (en) 2003-03-03 2017-05-23 Xencor, Inc. Optimized Fc variants
US9714282B2 (en) 2003-09-26 2017-07-25 Xencor, Inc. Optimized Fc variants and methods for their generation
US9714291B2 (en) 2012-10-05 2017-07-25 Kyowa Hakko Kirin Co., Ltd Heterodimer protein composition
EP2496603B1 (en) * 2009-11-05 2018-07-18 F. Hoffmann-La Roche AG Glycosylated repeat-motif-molecule conjugates
US10071158B2 (en) 2005-04-26 2018-09-11 Lindis Biotech Gmbh Combination of the application of antibodies for immunostimulation together with glucocorticoids
US10143748B2 (en) 2005-07-25 2018-12-04 Aptevo Research And Development Llc B-cell reduction using CD37-specific and CD20-specific binding molecules
WO2019074973A3 (en) * 2017-10-10 2019-06-13 Sanofi Anti-cd38 antibodies and combinations with anti-cd3 and anti-cd28 antibodies
US10344050B2 (en) 2011-10-27 2019-07-09 Genmab A/S Production of heterodimeric proteins
US10407513B2 (en) 2008-09-26 2019-09-10 Ucb Biopharma Sprl Biological products
WO2020028721A1 (en) * 2018-08-01 2020-02-06 City Of Hope Tag72 targeted chimeric antigen receptor modified t cells for treatment of tag72-positive tumors
US10865253B2 (en) 2014-12-19 2020-12-15 Genmab A/S Rodent bispecific heterodimeric proteins
US10882922B2 (en) 2016-04-13 2021-01-05 Sanofi Trispecific and/or trivalent binding proteins
US11129905B2 (en) 2015-10-25 2021-09-28 Sanofi Bivalent, bispecific binding proteins for prevention or treatment of HIV infection
US11352426B2 (en) 2015-09-21 2022-06-07 Aptevo Research And Development Llc CD3 binding polypeptides
US11401348B2 (en) 2009-09-02 2022-08-02 Xencor, Inc. Heterodimeric Fc variants
US11530268B2 (en) 2018-10-09 2022-12-20 Sanofi Trispecific anti-CD38, anti-CD28, and anti-CD3 binding proteins and methods of use for treating viral infection
US11613576B2 (en) 2019-04-09 2023-03-28 Sanofi Trispecific binding proteins, methods, and uses thereof
US11820830B2 (en) 2004-07-20 2023-11-21 Xencor, Inc. Optimized Fc variants
US11932685B2 (en) 2007-10-31 2024-03-19 Xencor, Inc. Fc variants with altered binding to FcRn
US11932704B2 (en) 2016-04-13 2024-03-19 Sanofi Trispecific and/or trivalent binding proteins

Families Citing this family (181)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6136311A (en) 1996-05-06 2000-10-24 Cornell Research Foundation, Inc. Treatment and diagnosis of cancer
JP5374359B2 (en) 2006-03-17 2013-12-25 バイオジェン・アイデック・エムエイ・インコーポレイテッド Stabilized polypeptide compounds
EP1996716B1 (en) 2006-03-20 2011-05-11 The Regents of the University of California Engineered anti-prostate stem cell antigen (psca) antibodies for cancer targeting
US20100278821A1 (en) 2006-03-21 2010-11-04 The Regents Of The University Of California N-cadherin: target for cancer diagnosis and therapy
AU2014200661B2 (en) * 2006-06-12 2016-06-30 Aptevo Research And Development Llc Single-chain multivalent binding proteins with effector function
US8759297B2 (en) 2006-08-18 2014-06-24 Armagen Technologies, Inc. Genetically encoded multifunctional compositions bidirectionally transported between peripheral blood and the cns
AU2008282496B2 (en) 2007-07-27 2013-04-04 Armagen Technologies, Inc. Methods and compositions for increasing alpha-iduronidase activity in the CNS
EP3714906A1 (en) * 2007-10-03 2020-09-30 Cornell University Treatment of proliferative disorders using radiolabelled antibodies to psma
US20090162359A1 (en) 2007-12-21 2009-06-25 Christian Klein Bivalent, bispecific antibodies
US9266967B2 (en) 2007-12-21 2016-02-23 Hoffmann-La Roche, Inc. Bivalent, bispecific antibodies
US20100069616A1 (en) * 2008-08-06 2010-03-18 The Regents Of The University Of California Engineered antibody-nanoparticle conjugates
US8268314B2 (en) 2008-10-08 2012-09-18 Hoffmann-La Roche Inc. Bispecific anti-VEGF/anti-ANG-2 antibodies
MX2011007833A (en) * 2009-01-23 2011-10-06 Biogen Idec Inc Stabilized fc polypeptides with reduced effector function and methods of use.
WO2010096394A2 (en) 2009-02-17 2010-08-26 Redwood Biosciences, Inc. Aldehyde-tagged protein-based drug carriers and methods of use
EP2398504B1 (en) * 2009-02-17 2018-11-28 Cornell Research Foundation, Inc. Methods and kits for diagnosis of cancer and prediction of therapeutic value
WO2010112194A1 (en) 2009-04-02 2010-10-07 F. Hoffmann-La Roche Ag Antigen-binding polypeptides and multispecific antibodies comprising them
JP5501439B2 (en) * 2009-04-02 2014-05-21 ロシュ グリクアート アクチェンゲゼルシャフト Multispecific antibody comprising a full-length antibody and a single chain Fab fragment
BRPI1014449A2 (en) 2009-04-07 2017-06-27 Roche Glycart Ag bispecific antibodies anti-erbb-2 / anti-c-met.
MX2011010166A (en) 2009-04-07 2011-10-11 Roche Glycart Ag Bispecific anti-erbb-3/anti-c-met antibodies.
JP5616428B2 (en) 2009-04-07 2014-10-29 ロシュ グリクアート アクチェンゲゼルシャフト Trivalent bispecific antibody
US9676845B2 (en) 2009-06-16 2017-06-13 Hoffmann-La Roche, Inc. Bispecific antigen binding proteins
WO2011034605A2 (en) 2009-09-16 2011-03-24 Genentech, Inc. Coiled coil and/or tether containing protein complexes and uses thereof
HUE044865T2 (en) 2009-10-09 2019-11-28 Armagen Inc Methods and compositions for increasing iduronate 2-sulfatase activity in the cns
JP5911805B2 (en) 2009-11-20 2016-04-27 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア Epithelial membrane protein-2 (EMP2) and proliferative vitreoretinopathy (PVR)
MX354143B (en) 2009-12-02 2018-02-14 Imaginab Inc J591 minibodies and cys-diabodies for targeting human prostate specific membrane antigen (psma) and methods for their use.
WO2011091078A2 (en) 2010-01-19 2011-07-28 Xencor, Inc. Antibody fc variants with enhanced complement activity
TW201138821A (en) 2010-03-26 2011-11-16 Roche Glycart Ag Bispecific antibodies
AR080794A1 (en) 2010-03-26 2012-05-09 Hoffmann La Roche BIVING SPECIFIC ANTIBODIES ANTI-VEGF / ANTI-ANG-2
EP2588631A4 (en) 2010-07-01 2013-11-20 Univ California Protein kinase ck2 gene mutations, amplifications and polymorphisms in human cancers and methods of use
WO2012025530A1 (en) 2010-08-24 2012-03-01 F. Hoffmann-La Roche Ag Bispecific antibodies comprising a disulfide stabilized - fv fragment
WO2012064792A2 (en) 2010-11-09 2012-05-18 Altimab Therapeutics, Inc. Protein complexes for antigen binding and methods of use
JP5766296B2 (en) 2010-12-23 2015-08-19 エフ.ホフマン−ラ ロシュ アーゲーF. Hoffmann−La Roche Aktiengesellschaft Polypeptide-polynucleotide complexes and their use in targeted delivery of effector components
JP6162606B2 (en) 2011-01-14 2017-07-12 レッドウッド バイオサイエンス, インコーポレイテッド Aldehyde-tagged immunoglobulin polypeptides and methods of use thereof
MX342034B (en) 2011-02-28 2016-09-12 Hoffmann La Roche Monovalent antigen binding proteins.
RU2607038C2 (en) 2011-02-28 2017-01-10 Ф. Хоффманн-Ля Рош Аг Antigen-binding proteins
AU2012253652B2 (en) * 2011-05-09 2017-07-06 Minerva Biotechnologies Corporation Genetically engineered growth factor variants
MX2014009565A (en) 2012-02-10 2014-11-10 Genentech Inc Single-chain antibodies and other heteromultimers.
WO2013150043A1 (en) 2012-04-05 2013-10-10 F. Hoffmann-La Roche Ag Bispecific antibodies against human tweak and human il17 and uses thereof
ES2924722T3 (en) * 2012-05-18 2022-10-10 Aptevo Res & Development Llc Immunofusion binding of bispecific scFv (BIf) to CD123 and CD3
WO2014001325A1 (en) 2012-06-27 2014-01-03 F. Hoffmann-La Roche Ag Method for making antibody fc-region conjugates comprising at least one binding entity that specifically binds to a target and uses thereof
ES2597228T3 (en) 2012-06-27 2017-01-17 F. Hoffmann-La Roche Ag Procedure for the selection and production of objectification entities, such as targets, highly selective and multi-specific, customized, which contain at least two different binding entities, and use of these
CA2871386A1 (en) 2012-06-27 2014-01-03 F. Hoffmann-La Roche Ag Method for the selection and production of tailor-made, selective and multi-specific therapeutic molecules comprising at least two different targeting entities and uses thereof
HUE029435T2 (en) 2012-07-04 2017-02-28 Hoffmann La Roche Anti-theophylline antibodies and methods of use
WO2014006124A1 (en) 2012-07-04 2014-01-09 F. Hoffmann-La Roche Ag Covalently linked antigen-antibody conjugates
KR20150030755A (en) 2012-07-04 2015-03-20 에프. 호프만-라 로슈 아게 Anti-biotin antibodies and methods of use
TWI635098B (en) 2013-02-01 2018-09-11 再生元醫藥公司 Antibodies comprising chimeric constant domains
NZ751877A (en) * 2013-04-16 2020-04-24 Genentech Inc Pertuzumab variants and evaluation thereof
TWI596107B (en) 2013-06-25 2017-08-21 卡地拉保健有限公司 Novel purification process for monoclonal antibodies
CN104341504B (en) 2013-08-06 2017-10-24 百奥泰生物科技(广州)有限公司 Bispecific antibody
BR112016006929A2 (en) 2013-10-11 2017-09-19 Hoffmann La Roche ANTIBODY, NUCLEIC ACID, EXPRESSION VECTOR, HOST CELL, METHODS OF PREPARING ANTIBODY, TREATMENT OF PATIENTS AND GENERATION OF AN ANTIBODY, PHARMACEUTICAL COMPOSITION AND USE OF THE ANTIBODY
JPWO2015079977A1 (en) * 2013-11-26 2017-03-16 シャープ株式会社 Antibody separation method, antibody evaluation method, pharmaceutical evaluation method, and antibody two-dimensional electrophoresis kit
MX2016007208A (en) 2013-12-20 2016-07-21 Hoffmann La Roche HUMANIZED ANTI-Tau(pS422) ANTIBODIES AND METHODS OF USE.
BR112016013849A2 (en) 2014-01-03 2017-10-10 Hoffmann La Roche bispecific antihapten / blood-brain barrier receptor conjugates, their uses, and pharmaceutical formulation
CA2930046A1 (en) 2014-01-03 2015-07-09 F. Hoffmann-La Roche Ag Covalently linked polypeptide toxin-antibody conjugates
JP6602304B2 (en) 2014-01-03 2019-11-06 エフ.ホフマン−ラ ロシュ アーゲー Covalently linked helicer-anti-helicer antibody conjugates and uses thereof
JOP20200094A1 (en) 2014-01-24 2017-06-16 Dana Farber Cancer Inst Inc Antibody molecules to pd-1 and uses thereof
JOP20200096A1 (en) 2014-01-31 2017-06-16 Children’S Medical Center Corp Antibody molecules to tim-3 and uses thereof
CN106103484B (en) 2014-03-14 2021-08-20 诺华股份有限公司 Antibody molecules against LAG-3 and uses thereof
ES2939760T3 (en) 2014-03-15 2023-04-26 Novartis Ag Cancer treatment using a chimeric receptor for antigens
TWI754319B (en) 2014-03-19 2022-02-01 美商再生元醫藥公司 Methods and antibody compositions for tumor treatment
AR100978A1 (en) 2014-06-26 2016-11-16 Hoffmann La Roche ANTI-Tau HUMANIZED ANTIBODY BRAIN LAUNCHERS (pS422) AND USES OF THE SAME
ES2785551T3 (en) 2014-06-30 2020-10-07 Glykos Finland Oy Saccharide derivative of a toxic payload and its conjugates with antibodies
JP2017520575A (en) 2014-07-01 2017-07-27 ファイザー・インク Bispecific heterodimeric diabody and uses thereof
WO2016014553A1 (en) 2014-07-21 2016-01-28 Novartis Ag Sortase synthesized chimeric antigen receptors
JP6831777B2 (en) 2014-07-21 2021-02-17 ノバルティス アーゲー Treatment of cancer using the CD33 chimeric antigen receptor
JP2017528433A (en) 2014-07-21 2017-09-28 ノバルティス アーゲー Low immunoenhancing dose of mTOR inhibitor and CAR combination
RU2751660C2 (en) 2014-07-21 2021-07-15 Новартис Аг Treatment of malignant neoplasm using humanized chimeric antigen receptor against bcma
EP4205749A1 (en) 2014-07-31 2023-07-05 Novartis AG Subset-optimized chimeric antigen receptor-containing cells
US10851149B2 (en) 2014-08-14 2020-12-01 The Trustees Of The University Of Pennsylvania Treatment of cancer using GFR α-4 chimeric antigen receptor
CN107108744B (en) 2014-08-19 2020-09-25 诺华股份有限公司 anti-CD 123 Chimeric Antigen Receptor (CAR) for cancer therapy
CA2961636A1 (en) 2014-09-17 2016-03-24 Boris ENGELS Targeting cytotoxic cells with chimeric receptors for adoptive immunotherapy
UY36351A (en) 2014-10-14 2016-06-01 Novartis Ag ANTIBODY MOLECULES THAT JOIN PD-L1 AND USES OF THE SAME
KR102614189B1 (en) 2014-11-17 2023-12-18 리제너론 파아마슈티컬스, 인크. Methods for tumor treatment using cd3xcd20 bispecific antibody
PL3227332T3 (en) 2014-12-03 2020-06-15 F. Hoffmann-La Roche Ag Multispecific antibodies
US20180334490A1 (en) 2014-12-03 2018-11-22 Qilong H. Wu Methods for b cell preconditioning in car therapy
US10538589B2 (en) * 2015-01-14 2020-01-21 Armagen Inc. Methods and compositions for increasing N-acetylglucosaminidase (NAGLU) activity in the CNS using a fusion antibody comprising an anti-human insulin receptor antibody and NAGLU
KR20170110601A (en) 2015-02-05 2017-10-11 몰레큘러 템플레이츠, 인코퍼레이션. Multivalent CD20 binding molecules comprising a &lt; RTI ID = 0.0 &gt; cigarotoxin A &lt; / RTI &gt;
EP3277725B1 (en) 2015-03-30 2020-11-25 Regeneron Pharmaceuticals, Inc. Heavy chain constant regions with reduced binding to fc gamma receptors
IL303972A (en) 2015-04-08 2023-08-01 Novartis Ag Cd20 therapies, cd22 therapies, and combination therapies with a cd19 chimeric antigen receptor (car) - expressing cell
WO2016172583A1 (en) 2015-04-23 2016-10-27 Novartis Ag Treatment of cancer using chimeric antigen receptor and protein kinase a blocker
EP3744732A1 (en) 2015-06-24 2020-12-02 F. Hoffmann-La Roche AG Humanized anti-tau(ps422) antibodies and methods of use
US20180179274A1 (en) 2015-06-26 2018-06-28 Institute For Research In Biomedicine Proteins comprising a mutated lair-1 fragment and uses thereof
EP3964528A1 (en) 2015-07-29 2022-03-09 Novartis AG Combination therapies comprising antibody molecules to lag-3
US20180207273A1 (en) 2015-07-29 2018-07-26 Novartis Ag Combination therapies comprising antibody molecules to tim-3
EP4378957A2 (en) 2015-07-29 2024-06-05 Novartis AG Combination therapies comprising antibody molecules to pd-1
KR20180050321A (en) 2015-08-07 2018-05-14 이미지냅 인코포레이티드 An antigen binding construct for targeting a molecule
BR112018006991A2 (en) * 2015-10-06 2018-10-16 Hope City psca-targeted chimeric antigen receptors
WO2017059878A1 (en) 2015-10-07 2017-04-13 Humabs Biomed Sa Antibodies that potently neutralize hepatitis b virus and uses thereof
KR20180094977A (en) 2015-12-17 2018-08-24 노파르티스 아게 Combinations of c-Met inhibitors and antibody molecules for PD-1 and uses thereof
JP2019503349A (en) 2015-12-17 2019-02-07 ノバルティス アーゲー Antibody molecules against PD-1 and uses thereof
MA55746A (en) 2016-01-21 2022-03-02 Novartis Ag MULTISPECIFIC MOLECULES TARGETING CLL-1
SG11201807489PA (en) 2016-03-04 2018-09-27 Novartis Ag Cells expressing multiple chimeric antigen receptor (car) molecules and uses therefore
EP3432924A1 (en) 2016-03-23 2019-01-30 Novartis AG Cell secreted minibodies and uses thereof
KR20180134385A (en) 2016-04-15 2018-12-18 노파르티스 아게 Compositions and methods for selective protein expression
WO2017189432A1 (en) 2016-04-26 2017-11-02 R.P. Scherer Technologies, Llc Antibody conjugates and methods of making and using the same
WO2017210617A2 (en) 2016-06-02 2017-12-07 Porter, David, L. Therapeutic regimens for chimeric antigen receptor (car)- expressing cells
WO2018010789A1 (en) 2016-07-13 2018-01-18 Humabs Biomed Sa Novel antibodies specifically binding to zika virus epitopes and uses thereof
AU2017295886C1 (en) 2016-07-15 2024-05-16 Novartis Ag Treatment and prevention of cytokine release syndrome using a chimeric antigen receptor in combination with a kinase inhibitor
SG11201900677SA (en) 2016-07-28 2019-02-27 Novartis Ag Combination therapies of chimeric antigen receptors adn pd-1 inhibitors
JP2019527696A (en) 2016-08-01 2019-10-03 ノバルティス アーゲー Treatment of cancer using chimeric antigen receptors in combination with inhibitors of pro-M2 macrophage molecules
MX2019000935A (en) 2016-08-16 2019-07-04 Regeneron Pharma Methods for quantitating individual antibodies from a mixture.
CA3037688A1 (en) 2016-09-21 2018-03-29 Aptevo Research And Development Llc Cd123 binding proteins and related compositions and methods
TW202340473A (en) 2016-10-07 2023-10-16 瑞士商諾華公司 Treatment of cancer using chimeric antigen receptors
CN109923411B (en) 2016-10-25 2022-05-31 里珍纳龙药品有限公司 Method and system for chromatographic data analysis
US20200024312A1 (en) 2017-01-25 2020-01-23 Molecular Templates, Inc. Cell-targeting molecules comprising de-immunized, shiga toxin a subunit effectors and cd8+ t-cell epitopes
WO2018140725A1 (en) 2017-01-26 2018-08-02 Novartis Ag Cd28 compositions and methods for chimeric antigen receptor therapy
WO2018147960A1 (en) 2017-02-08 2018-08-16 Imaginab, Inc. Extension sequences for diabodies
EP3589647A1 (en) 2017-02-28 2020-01-08 Novartis AG Shp inhibitor compositions and uses for chimeric antigen receptor therapy
SG11201909265QA (en) 2017-04-19 2019-11-28 Inst Res Biomedicine Plasmodium sporozoite npdp peptides as vaccine and target novel malaria vaccines and antibodies binding to
EP3615068A1 (en) 2017-04-28 2020-03-04 Novartis AG Bcma-targeting agent, and combination therapy with a gamma secretase inhibitor
WO2018201056A1 (en) 2017-04-28 2018-11-01 Novartis Ag Cells expressing a bcma-targeting chimeric antigen receptor, and combination therapy with a gamma secretase inhibitor
WO2018237157A1 (en) 2017-06-22 2018-12-27 Novartis Ag Antibody molecules to cd73 and uses thereof
CN111050791A (en) 2017-06-27 2020-04-21 诺华股份有限公司 Dosing regimens for anti-TIM-3 antibodies and uses thereof
TWI820031B (en) 2017-07-11 2023-11-01 美商坎伯斯治療有限責任公司 Agonist antibodies that bind human cd137 and uses thereof
US20200172617A1 (en) 2017-07-20 2020-06-04 Novartis Ag Dosage regimens of anti-lag-3 antibodies and uses thereof
WO2019024979A1 (en) 2017-07-31 2019-02-07 Institute For Research In Biomedicine Antibodies with functional domains in the elbow region
WO2019042555A1 (en) 2017-08-31 2019-03-07 Humabs Biomed Sa Multispecific antibodies specifically binding to zika virus epitopes and uses thereof
AU2018353420A1 (en) 2017-10-20 2020-04-16 F. Hoffmann-La Roche Ag Method for generating multispecific antibodies from monospecific antibodies
JP7438942B2 (en) 2017-10-30 2024-02-27 エフ. ホフマン-ラ ロシュ アーゲー Methods for in vivo generation of multispecific antibodies from monospecific antibodies
WO2019089798A1 (en) 2017-10-31 2019-05-09 Novartis Ag Anti-car compositions and methods
US11718679B2 (en) 2017-10-31 2023-08-08 Compass Therapeutics Llc CD137 antibodies and PD-1 antagonists and uses thereof
CN111655288A (en) 2017-11-16 2020-09-11 诺华股份有限公司 Combination therapy
US11851497B2 (en) 2017-11-20 2023-12-26 Compass Therapeutics Llc CD137 antibodies and tumor antigen-targeting antibodies and uses thereof
EP3746116A1 (en) 2018-01-31 2020-12-09 Novartis AG Combination therapy using a chimeric antigen receptor
US20210147547A1 (en) 2018-04-13 2021-05-20 Novartis Ag Dosage Regimens For Anti-Pd-L1 Antibodies And Uses Thereof
EP3784351A1 (en) 2018-04-27 2021-03-03 Novartis AG Car t cell therapies with enhanced efficacy
WO2019226658A1 (en) 2018-05-21 2019-11-28 Compass Therapeutics Llc Multispecific antigen-binding compositions and methods of use
CA3099308A1 (en) 2018-05-21 2019-11-28 Compass Therapeutics Llc Compositions and methods for enhancing the killing of target cells by nk cells
EP3801769A1 (en) 2018-05-25 2021-04-14 Novartis AG Combination therapy with chimeric antigen receptor (car) therapies
US20210214459A1 (en) 2018-05-31 2021-07-15 Novartis Ag Antibody molecules to cd73 and uses thereof
CA3100724A1 (en) 2018-06-13 2019-12-19 Novartis Ag B-cell maturation antigen protein (bcma) chimeric antigen receptors and uses thereof
WO2019246293A2 (en) 2018-06-19 2019-12-26 Atarga, Llc Antibody molecules to complement component 5 and uses thereof
TW202005694A (en) 2018-07-02 2020-02-01 美商里珍納龍藥品有限公司 Systems and methods for preparing a polypeptide from a mixture
AR116109A1 (en) 2018-07-10 2021-03-31 Novartis Ag DERIVATIVES OF 3- (5-AMINO-1-OXOISOINDOLIN-2-IL) PIPERIDINE-2,6-DIONA AND USES OF THE SAME
WO2020021465A1 (en) 2018-07-25 2020-01-30 Advanced Accelerator Applications (Italy) S.R.L. Method of treatment of neuroendocrine tumors
MX2021002190A (en) 2018-08-31 2021-05-14 Regeneron Pharma Dosing strategy that mitigates cytokine release syndrome for cd3/c20 bispecific antibodies.
WO2020078568A1 (en) 2018-10-19 2020-04-23 Humabs Biomed Sa Antibodies and methods for treatment of lyssavirus infection
SG11202104864QA (en) 2018-11-13 2021-06-29 Compass Therapeutics Llc Multispecific binding constructs against checkpoint molecules and uses thereof
CN118108836A (en) 2018-12-19 2024-05-31 胡默波斯生物医学公司 Antibody for neutralizing hepatitis B virus and use thereof
EP3897648B1 (en) 2018-12-20 2023-08-23 Novartis AG Extended low dose regimens for mdm2 inhibitors
EA202191736A1 (en) 2018-12-20 2021-10-01 Вир Байотекнолоджи, Инк. HBV COMBINATION THERAPY
CA3123511A1 (en) 2018-12-20 2020-06-25 Novartis Ag Dosing regimen and pharmaceutical combination comprising 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives
KR20210129672A (en) 2019-02-15 2021-10-28 노파르티스 아게 Substituted 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof
MX2021009744A (en) * 2019-02-15 2021-11-12 Univ Southern California Lym-1 and lym-2 antibody compositions and improved car constructs.
US10871640B2 (en) 2019-02-15 2020-12-22 Perkinelmer Cellular Technologies Germany Gmbh Methods and systems for automated imaging of three-dimensional objects
US20220144807A1 (en) 2019-02-15 2022-05-12 Novartis Ag 3-(1-oxo-5-(piperidin-4-yl)isoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof
US20220088075A1 (en) 2019-02-22 2022-03-24 The Trustees Of The University Of Pennsylvania Combination therapies of egfrviii chimeric antigen receptors and pd-1 inhibitors
SG11202110732XA (en) 2019-03-29 2021-10-28 Atarga Llc Anti fgf23 antibody
WO2020221451A1 (en) 2019-04-30 2020-11-05 Humabs Biomed Sa Antibodies binding to plasmodium circumsporozoite protein and uses thereof
EP3757127A1 (en) 2019-06-28 2020-12-30 Institute for Research in Biomedicine Deimmunized antibodies binding to alpha-4 integrin and uses thereof
EP4021578A1 (en) 2019-08-29 2022-07-06 VIR Biotechnology, Inc. Antibody compositions and methods for treating hepatitis b virus infection
CN114786679A (en) 2019-10-21 2022-07-22 诺华股份有限公司 Combination therapy with Vernetork and TIM-3 inhibitors
AU2020370832A1 (en) 2019-10-21 2022-05-19 Novartis Ag TIM-3 inhibitors and uses thereof
US20210155671A1 (en) 2019-11-24 2021-05-27 Molecular Templates, Inc. Uses of cd20-binding molecules and additional therapeutic agents
MX2022006391A (en) 2019-11-26 2022-06-24 Novartis Ag Chimeric antigen receptors binding bcma and cd19 and uses thereof.
CN115175937A (en) 2019-12-20 2022-10-11 诺华股份有限公司 Combination of anti-TIM-3 antibody MBG453 and anti-TGF-beta antibody NIS793 with or without decitabine or anti-PD-1 antibody, gabapentin, for the treatment of myelofibrosis and myelodysplastic syndrome
KR20220128389A (en) 2020-01-17 2022-09-20 노파르티스 아게 A combination comprising a TIM-3 inhibitor and a hypomethylating agent for use in treating myelodysplastic syndrome or chronic myelomonocytic leukemia
WO2021146636A1 (en) 2020-01-17 2021-07-22 Becton, Dickinson And Company Methods and compositions for single cell secretomics
AU2021225949A1 (en) 2020-02-27 2022-09-15 Novartis Ag Methods of making chimeric antigen receptor-expressing cells
GB202007842D0 (en) 2020-05-26 2020-07-08 Quell Therapeutics Ltd Polypeptide useful in adoptive cell therapy
WO2021260528A1 (en) 2020-06-23 2021-12-30 Novartis Ag Dosing regimen comprising 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives
AU2021296848A1 (en) 2020-06-24 2023-02-09 Humabs Biomed Sa Engineered hepatitis B virus neutralizing antibodies and uses thereof
JP2023534214A (en) 2020-07-16 2023-08-08 ノバルティス アーゲー Anti-betacellulin antibodies, fragments thereof, and multispecific binding molecules
WO2022026592A2 (en) 2020-07-28 2022-02-03 Celltas Bio, Inc. Antibody molecules to coronavirus and uses thereof
JP2023536164A (en) 2020-08-03 2023-08-23 ノバルティス アーゲー Heteroaryl-substituted 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof
GB202013477D0 (en) 2020-08-27 2020-10-14 Quell Therapeutics Ltd Nucleic acid constructs for expressing polypeptides in cells
EP4204021A1 (en) 2020-08-31 2023-07-05 Advanced Accelerator Applications International S.A. Method of treating psma-expressing cancers
US20230338587A1 (en) 2020-08-31 2023-10-26 Advanced Accelerator Applications International Sa Method of treating psma-expressing cancers
CN116472288A (en) 2020-11-06 2023-07-21 诺华股份有限公司 Antibody Fc variants
WO2022104061A1 (en) 2020-11-13 2022-05-19 Novartis Ag Combination therapies with chimeric antigen receptor (car)-expressing cells
US20240034772A1 (en) 2020-12-08 2024-02-01 Humabs Biomed Sa Antibodies binding to f-protein of metapneumovirus and uses thereof
TW202245838A (en) 2021-01-26 2022-12-01 美商維爾生物科技股份有限公司 Compositions and methods for treating hepatitis b virus infection
JP2024505049A (en) 2021-01-29 2024-02-02 ノバルティス アーゲー Administration modes for anti-CD73 and anti-ENTPD2 antibodies and their uses
TW202304979A (en) 2021-04-07 2023-02-01 瑞士商諾華公司 USES OF ANTI-TGFβ ANTIBODIES AND OTHER THERAPEUTIC AGENTS FOR THE TREATMENT OF PROLIFERATIVE DISEASES
AR125874A1 (en) 2021-05-18 2023-08-23 Novartis Ag COMBINATION THERAPIES
WO2023036774A1 (en) 2021-09-07 2023-03-16 Institute For Research In Biomedicine Antibodies binding to tetanus toxin and uses thereof
WO2023044483A2 (en) 2021-09-20 2023-03-23 Voyager Therapeutics, Inc. Compositions and methods for the treatment of her2 positive cancer
WO2023092004A1 (en) 2021-11-17 2023-05-25 Voyager Therapeutics, Inc. Compositions and methods for the treatment of tau-related disorders
WO2023150778A1 (en) 2022-02-07 2023-08-10 Visterra, Inc. Anti-idiotype antibody molecules and uses thereof
WO2023220695A2 (en) 2022-05-13 2023-11-16 Voyager Therapeutics, Inc. Compositions and methods for the treatment of her2 positive cancer
WO2024030976A2 (en) 2022-08-03 2024-02-08 Voyager Therapeutics, Inc. Compositions and methods for crossing the blood brain barrier

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995009917A1 (en) 1993-10-07 1995-04-13 The Regents Of The University Of California Genetically engineered bispecific tetravalent antibodies
WO1998052976A1 (en) 1997-05-21 1998-11-26 Biovation Limited Method for the production of non-immunogenic proteins
US6011138A (en) 1997-02-20 2000-01-04 Idec Pharmaceuticals Corporation Gamma-1 anti-human CD23 monoclonal antibodies
WO2000034317A2 (en) 1998-12-08 2000-06-15 Biovation Limited Method for reducing immunogenicity of proteins
WO2002002781A1 (en) 2000-06-30 2002-01-10 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Heterodimeric fusion proteins
WO2002088170A2 (en) 2001-04-26 2002-11-07 Biogen, Inc. Cripto blocking antibodies and uses thereof
US6590080B1 (en) 1997-09-19 2003-07-08 Frank Koentgen Catalytic antibodies and a method of producing same
WO2003083041A2 (en) 2002-03-22 2003-10-09 Biogen, Inc. Cripto-specific antibodies

Family Cites Families (109)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4485045A (en) * 1981-07-06 1984-11-27 Research Corporation Synthetic phosphatidyl cholines useful in forming liposomes
US4816567A (en) * 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4544545A (en) * 1983-06-20 1985-10-01 Trustees University Of Massachusetts Liposomes containing modified cholesterol for organ targeting
IL75318A (en) 1984-05-31 1994-08-26 Genentech Inc Recombinant human lymphotoxin and methods for its recombinant production
US5206344A (en) 1985-06-26 1993-04-27 Cetus Oncology Corporation Interleukin-2 muteins and polymer conjugation thereof
US5618920A (en) * 1985-11-01 1997-04-08 Xoma Corporation Modular assembly of antibody genes, antibodies prepared thereby and use
GB8529014D0 (en) * 1985-11-25 1986-01-02 Biogen Nv Enhanced secretion of heterologous proteins
DE3883899T3 (en) * 1987-03-18 1999-04-22 Sb2 Inc CHANGED ANTIBODIES.
EP0284898A3 (en) 1987-04-02 1990-06-27 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Hinge peptides, process for their preparation and their use in manufacturing synthetic immunogenes
US5892019A (en) 1987-07-15 1999-04-06 The United States Of America, As Represented By The Department Of Health And Human Services Production of a single-gene-encoded immunoglobulin
US5677425A (en) * 1987-09-04 1997-10-14 Celltech Therapeutics Limited Recombinant antibody
GB8720833D0 (en) 1987-09-04 1987-10-14 Celltech Ltd Recombinant dna product
WO1989007142A1 (en) 1988-02-05 1989-08-10 Morrison Sherie L Domain-modified constant region antibodies
EP0359096B1 (en) * 1988-09-15 1997-11-05 The Trustees Of Columbia University In The City Of New York Antibodies having modified carbohydrate content and methods of preparation and use
US6051225A (en) * 1988-10-19 2000-04-18 The Dow Chemical Company Family of high affinity, modified antibodies for cancer treatment
US5530101A (en) * 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5714149A (en) 1989-02-10 1998-02-03 Celltech Therapeutics Limited Crosslinked antibodies and processes for their preparation
US5225538A (en) * 1989-02-23 1993-07-06 Genentech, Inc. Lymphocyte homing receptor/immunoglobulin fusion proteins
US5166322A (en) 1989-04-21 1992-11-24 Genetics Institute Cysteine added variants of interleukin-3 and chemical modifications thereof
GB8916400D0 (en) * 1989-07-18 1989-09-06 Dynal As Modified igg3
US5208020A (en) * 1989-10-25 1993-05-04 Immunogen Inc. Cytotoxic agents comprising maytansinoids and their therapeutic use
US5859205A (en) * 1989-12-21 1999-01-12 Celltech Limited Humanised antibodies
GB8928874D0 (en) 1989-12-21 1990-02-28 Celltech Ltd Humanised antibodies
US6552170B1 (en) * 1990-04-06 2003-04-22 Amgen Inc. PEGylation reagents and compounds formed therewith
US6495137B1 (en) 1990-04-19 2002-12-17 The Dow Chemical Company Humanized anti-tag-72 monoclonal antibodies using human subgroup 4 kappa light chains
US5976531A (en) * 1990-04-19 1999-11-02 The Dow Chemical Company Composite antibodies of human subgroup IV light chain capable of binding to tag-72
GB9009106D0 (en) 1990-04-23 1990-06-20 3I Res Expl Ltd Processes and intermediates for synthetic antibody derivatives
US5766897A (en) * 1990-06-21 1998-06-16 Incyte Pharmaceuticals, Inc. Cysteine-pegylated proteins
EP0536299B1 (en) * 1990-06-27 2001-06-06 Biogen, Inc. Surface complexed lymphotoxin
US7030080B2 (en) * 1990-06-27 2006-04-18 Biogen, Inc. Lymphotoxin-β, lymphotoxin-β complexes, pharmaceutical preparations and therapeutic uses thereof
US5670149A (en) * 1990-06-27 1997-09-23 Biogen, Inc. Lymphotoxin-β, Lymphotoxin-β complexes, pharmaceutical preparations and therapeutic uses thereof
DE4111283A1 (en) * 1991-04-08 1992-10-15 Basf Ag RADIATION SENSITIVE MIXTURE, CONTAINING SAEURELABILE GROUPING AND METHOD FOR PRODUCING RELIEF PATTERNS AND RELIEF PICTURES
DE69233482T2 (en) 1991-05-17 2006-01-12 Merck & Co., Inc. Method for reducing the immunogenicity of antibody variable domains
DE4118120A1 (en) 1991-06-03 1992-12-10 Behringwerke Ag TETRAVALENT BISPECIFIC RECEPTORS, THEIR PRODUCTION AND USE
WO1994004679A1 (en) 1991-06-14 1994-03-03 Genentech, Inc. Method for making humanized antibodies
US20020037558A1 (en) * 1991-10-23 2002-03-28 Kin-Ming Lo E.coli produced immunoglobulin constructs
US6329507B1 (en) 1992-08-21 2001-12-11 The Dow Chemical Company Dimer and multimer forms of single chain polypeptides
US5837821A (en) 1992-11-04 1998-11-17 City Of Hope Antibody construct
JPH08507201A (en) 1992-12-04 1996-08-06 バイオジェン,インコーポレイテッド Lymphotoxin-β, lymphotoxin-β complexes, their pharmaceutical preparation and therapeutic use
JP3312357B2 (en) * 1992-12-11 2002-08-05 ザ ダウ ケミカル カンパニー Multivalent single chain antibody
IL108776A (en) 1993-03-11 1999-11-30 Genentech Inc Method for cell lysis or inhibition of cell growth a bispecific molecule binding tnf-r1 and fas antigen a pharmaceutical composition containing it and its use
CA2163345A1 (en) 1993-06-16 1994-12-22 Susan Adrienne Morgan Antibodies
US5429746A (en) 1994-02-22 1995-07-04 Smith Kline Beecham Corporation Antibody purification
US6312691B1 (en) * 1996-01-26 2001-11-06 Jeffrey L. Browning Lymphotoxin-α/β complexes and anti-lympotoxin-β receptor antibodies as anti-tumor agents
PL185364B1 (en) 1995-01-26 2003-04-30 Biogen Complexes of alpha/beta lymphotoxin and antibodies against receptors for beta lymphotoxin ised as anticarcinogenic factors
US5731168A (en) * 1995-03-01 1998-03-24 Genentech, Inc. Method for making heteromultimeric polypeptides
US5641870A (en) * 1995-04-20 1997-06-24 Genentech, Inc. Low pH hydrophobic interaction chromatography for antibody purification
US5925351A (en) * 1995-07-21 1999-07-20 Biogen, Inc. Soluble lymphotoxin-β receptors and anti-lymphotoxin receptor and ligand antibodies as therapeutic agents for the treatment of immunological disease
EP0861440A1 (en) * 1995-09-22 1998-09-02 Immunomedics, Inc. Recombinant proteins having multiple disulfide bonds and thiol-substituted conjugates thereof
US5834597A (en) 1996-05-20 1998-11-10 Protein Design Labs, Inc. Mutated nonactivating IgG2 domains and anti CD3 antibodies incorporating the same
AU3968897A (en) 1996-08-02 1998-02-25 Bristol-Myers Squibb Company A method for inhibiting immunoglobulin-induced toxicity resulting from the use of immunoglobulins in therapy and in vivo diagnosis
US7247302B1 (en) 1996-08-02 2007-07-24 Bristol-Myers Squibb Company Method for inhibiting immunoglobulin-induced toxicity resulting from the use of immunoglobulins in therapy and in vivo diagnosis
US7255854B1 (en) * 1996-10-25 2007-08-14 Biogen, Inc. Use of lymphotoxin-β receptor blocking agents for the treatment of antibody mediated immunological diseases
US6348581B1 (en) 1996-10-31 2002-02-19 The Dow Chemical Company High affinity humanized anti-TAG-72 monoclonalantibodies
WO1998023289A1 (en) 1996-11-27 1998-06-04 The General Hospital Corporation MODULATION OF IgG BINDING TO FcRn
US6063905A (en) * 1997-01-07 2000-05-16 Board Of Regents, The University Of Texas System Recombinant human IGA-J. chain dimer
IL131746A0 (en) * 1997-03-14 2001-03-19 Method for integrating genes at specific sites in mammalian cells via homologous recombination and vectors for accomplishing the same
US20030207346A1 (en) * 1997-05-02 2003-11-06 William R. Arathoon Method for making multispecific antibodies having heteromultimeric and common components
US20020062010A1 (en) 1997-05-02 2002-05-23 Genentech, Inc. Method for making multispecific antibodies having heteromultimeric and common components
US20030060444A1 (en) * 1997-06-25 2003-03-27 Celltech Therapeutics, Ltd. Cell activation process and reagents therefor
US6165476A (en) 1997-07-10 2000-12-26 Beth Israel Deaconess Medical Center Fusion proteins with an immunoglobulin hinge region linker
GB9720054D0 (en) 1997-09-19 1997-11-19 Celltech Therapeutics Ltd Biological products
CA2315944A1 (en) 1997-12-24 1999-07-08 Diatech Pty. Ltd. Bifunctional molecules
IL137489A0 (en) 1998-01-30 2001-07-24 Univ New York Pharmaceutical compositions containing inhibitors of the lymphotoxin pathway
US7060667B1 (en) * 1998-01-30 2006-06-13 Biogen Idec Ma, Inc. Treatment of follicular lymphomas using inhibitors of the LT pathway
CZ121599A3 (en) 1998-04-09 1999-10-13 Aventis Pharma Deutschland Gmbh Single-chain molecule binding several antigens, process of its preparation and medicament in which the molecule is comprised
US6284536B1 (en) 1998-04-20 2001-09-04 The Regents Of The University Of California Modified immunoglobin molecules and methods for use thereof
GB9809951D0 (en) 1998-05-08 1998-07-08 Univ Cambridge Tech Binding molecules
GB9809839D0 (en) 1998-05-09 1998-07-08 Glaxo Group Ltd Antibody
NZ510831A (en) * 1998-08-31 2002-12-20 Biogen Inc Method of modulating memory effector T-cells and compositions
DE69931944T2 (en) * 1998-10-09 2007-02-08 Biogen Idec Ma Inc., Cambridge REVERSE OF VIRAL-INDUCED SYSTEMIC SHOCKS AND RESPIRATORY SYNDROME THROUGH BLOCKING OF THE LYMPHOTOXIN BETA ACTIVATION PATH
US6576746B2 (en) 1998-10-13 2003-06-10 Immunomedics, Inc. Site-specific labeling of disulfide-containing targeting vectors
US6737056B1 (en) * 1999-01-15 2004-05-18 Genentech, Inc. Polypeptide variants with altered effector function
AU3316600A (en) * 1999-02-22 2000-09-21 Torben F. Orntoft Gene expression in bladder tumors
ES2309012T3 (en) 1999-10-29 2008-12-16 Genentech, Inc. COMPOSITIONS OF THE ANTI-PSCA ANTIBODY AND ITS PROCEDURES AGAINST CANCERIGENE CELLS THAT EXPRESS PSCA.
AU3607301A (en) 2000-03-03 2001-09-12 Kyowa Hakko Kogyo Kk Gene recombinant antibody and its fragment
GB0020953D0 (en) 2000-08-24 2000-10-11 Smithkline Beecham Biolog Vaccine
DE10045591A1 (en) 2000-09-15 2002-04-04 Klaus Pfizenmaier Site-specific, antibody-mediated activation of proapoptotic cytokines - AMAIZe (Antibody-Mediated Apoptosis Inducing Cytokines)
AR035352A1 (en) 2000-10-13 2004-05-12 Biogen Inc ANTI-LT-BETA-R HUMANIZED ANTIBODIES
GB0029407D0 (en) 2000-12-01 2001-01-17 Affitech As Product
CN1494553A (en) 2001-01-29 2004-05-05 IDECҩ�﹫˾ Modified antibodies and method of use
US7319139B2 (en) 2001-01-29 2008-01-15 Biogen Idec, Inc. TAG-72 specific CH2 domain deleted antibodies
EP2301971A1 (en) 2001-02-20 2011-03-30 ZymoGenetics, L.L.C. Antibodies that bind both BCMA and TACI
AUPR395801A0 (en) 2001-03-26 2001-04-26 Austin Research Institute, The Antibodies against cancer
US20020155109A1 (en) * 2001-04-20 2002-10-24 Lynch David H. Bispecific antibodies that bind TRAIL-R1 and TRAIL-R2
KR101008758B1 (en) 2001-09-18 2011-01-14 제넨테크, 인크. Compositions and Methods for the Diagnosis and Treatment of Tumor
US20040014690A1 (en) * 2002-02-13 2004-01-22 Zhenkun Ma Macrolides with activity against methicillin-resistant staphylococcus aureus
US7317091B2 (en) 2002-03-01 2008-01-08 Xencor, Inc. Optimized Fc variants
US20040132101A1 (en) 2002-09-27 2004-07-08 Xencor Optimized Fc variants and methods for their generation
MY139983A (en) * 2002-03-12 2009-11-30 Janssen Alzheimer Immunotherap Humanized antibodies that recognize beta amyloid peptide
EP2366718A3 (en) 2002-06-28 2012-05-02 Domantis Limited Ligand
CA2491480A1 (en) * 2002-07-01 2004-01-08 Biogen, Inc. Humanized anti-lymphotoxin beta receptor antibodies
WO2004026427A2 (en) * 2002-09-17 2004-04-01 Gtc Biotherapeutics, Inc. Isolation of immunoglobulin molecules that lack inter-heavy chain disulfide bonds
CN101987871A (en) 2002-09-27 2011-03-23 赞科股份有限公司 Optimized fc variants and methods for their generation
EP1578447A4 (en) 2002-10-31 2009-06-03 Genentech Inc Methods and compositions for increasing antibody production
WO2004050847A2 (en) 2002-11-27 2004-06-17 Gtc Biotherapeutics, Inc. Modified antibodies stably produced in milk and methods of producing same
BR0317573A (en) * 2002-12-20 2005-11-22 Biogen Idec Inc Beta lymphotoxin receptor agents in combination with chemotherapeutic agents
EP1583503A4 (en) * 2002-12-20 2006-08-09 Biogen Idec Inc Multivalent lymphotoxin beta receptor agonists and therapeutic uses thereof
ATE517638T1 (en) 2003-01-31 2011-08-15 Immunomedics Inc METHOD AND PREPARATIONS FOR ADMINISTERING THERAPEUTIC AND DIAGNOSTIC AGENTS
WO2005007809A2 (en) 2003-05-30 2005-01-27 Alexion Pharmaceuticals, Inc. Antibodies and fusion proteins that include engineered constant regions
WO2005000898A2 (en) * 2003-06-27 2005-01-06 Biogen Idec Ma Inc. Use of hydrophobic-interaction-chromatography or hinge-region modifications for the production of homogeneous antibody-solutions
EP1663306A2 (en) 2003-09-05 2006-06-07 Genentech, Inc. Antibodies with altered effector functions
WO2005028433A2 (en) * 2003-09-15 2005-03-31 Research Development Foundation CRIPTO ANTAGONISM OF ACTIVIN AND TGF-β SIGNALING
EP1756162A1 (en) * 2004-03-23 2007-02-28 Biogen Idec MA Inc. Receptor coupling agents and therapeutic uses thereof
CA2561264A1 (en) 2004-03-24 2005-10-06 Xencor, Inc. Immunoglobulin variants outside the fc region
WO2006074399A2 (en) * 2005-01-05 2006-07-13 Biogen Idec Ma Inc. Multispecific binding molecules comprising connecting peptides
EP1838736B1 (en) 2005-01-05 2013-03-06 Biogen Idec MA Inc. Cripto binding molecules
GB0514779D0 (en) 2005-07-19 2005-08-24 Celltech R&D Ltd Biological products
CA2650379A1 (en) 2006-04-28 2007-11-08 Biogen Idec Ma Inc. Composition and methods for the detection of cripto-3

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995009917A1 (en) 1993-10-07 1995-04-13 The Regents Of The University Of California Genetically engineered bispecific tetravalent antibodies
US6011138A (en) 1997-02-20 2000-01-04 Idec Pharmaceuticals Corporation Gamma-1 anti-human CD23 monoclonal antibodies
WO1998052976A1 (en) 1997-05-21 1998-11-26 Biovation Limited Method for the production of non-immunogenic proteins
US6590080B1 (en) 1997-09-19 2003-07-08 Frank Koentgen Catalytic antibodies and a method of producing same
WO2000034317A2 (en) 1998-12-08 2000-06-15 Biovation Limited Method for reducing immunogenicity of proteins
WO2002002781A1 (en) 2000-06-30 2002-01-10 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Heterodimeric fusion proteins
WO2002088170A2 (en) 2001-04-26 2002-11-07 Biogen, Inc. Cripto blocking antibodies and uses thereof
WO2003083041A2 (en) 2002-03-22 2003-10-09 Biogen, Inc. Cripto-specific antibodies

Non-Patent Citations (24)

* Cited by examiner, † Cited by third party
Title
ANGAL ET AL., MOL. IMMUNOL., vol. 30, 1993, pages 105
BENKOVIC ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 5355 - 5358
COCHRAN ET AL., J. AM. CHEM. SOC., vol. 110, 1988, pages 7888 - 7890
COLOMA; MORRISON, NATURE BIOTECHNOLOGY, vol. 15, 1997, pages 159
DURFOR ET AL., J. AM. CHEM. SOC., vol. 110, 1988, pages 8713 - 8714
HILVERT ET AL., J. AM. CHEM. SOC., vol. 110, 1988, pages 5593 - 5594
HILVERT ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 4953 - 4955
IVERSON ET AL., SCIENCE, vol. 243, 1989, pages 1184 - 1188
J IMMUNOL METHODS, vol. 269, 2002, pages 81 - 98
JACKSON ET AL., J. AM CHEM. SOC., vol. 110, 1988, pages 4841 - 4842
JACOBS ET AL., J. AM. CHEM. SOC., vol. 109, 1987, pages 2174 - 2176
JANDA ET AL., SCIENCE, vol. 241, 1988, pages 1188 - 1191
KABAT, E; WU, TT; PERRY, HM; GOTTESMAN, KS; FOELLER, C: "Sequences of Proteins of Immunological Interest", 1991, BETHESDA, US DEPARTMENT OF HEALTH AND HUMAN SERVICES, NIH
MOURATOU ET AL., J. OF IMMUNOLOGICAL METHODS., vol. 269, 2002, pages 147
NAPPER ET AL., SCIENCE, vol. 237, 1987, pages 1041 - 1043
NORDERHAUG ET AL., EUR. J. IMMUNOL., vol. 21, 1990, pages 2370
PAUL ET AL., SCIENCE, vol. 244, 1989, pages 1158 - 1162
POLLACK ET AL., J. AM. CHEM. SOC., vol. 111, 1989, pages 5961 - 5962
REYMOND, J.L., JOURNAL OF IMMUNOLOGICAL METHODS, vol. 269, 2002, pages 125
ROUX ET AL., J. IMMUNOL., vol. 161, 1998, pages 4083
See also references of EP1641827A2
SHOKAT ET AL., ANGEW. CHEM. INT. ED. ENGL., vol. 27, 1989, pages 269 - 271
SHOKAT ET AL., CHEM. INT. ED. ENGL., vol. 27, 1988, pages 269 - 271
TRAMONTANO ET AL., J. AM. CHEM. SOC., vol. 110, 1988, pages 2282

Cited By (129)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8853366B2 (en) 2001-01-17 2014-10-07 Emergent Product Development Seattle, Llc Binding domain-immunoglobulin fusion proteins
US8093357B2 (en) 2002-03-01 2012-01-10 Xencor, Inc. Optimized Fc variants and methods for their generation
US8124731B2 (en) 2002-03-01 2012-02-28 Xencor, Inc. Optimized Fc variants and methods for their generation
US8734791B2 (en) 2002-03-01 2014-05-27 Xencor, Inc. Optimized fc variants and methods for their generation
US7662925B2 (en) 2002-03-01 2010-02-16 Xencor, Inc. Optimized Fc variants and methods for their generation
US8093359B2 (en) 2002-09-27 2012-01-10 Xencor, Inc. Optimized Fc variants and methods for their generation
US9193798B2 (en) 2002-09-27 2015-11-24 Xencor, Inc. Optimized Fc variants and methods for their generation
US8188231B2 (en) 2002-09-27 2012-05-29 Xencor, Inc. Optimized FC variants
US8039592B2 (en) 2002-09-27 2011-10-18 Xencor, Inc. Optimized Fc variants and methods for their generation
US8809503B2 (en) 2002-09-27 2014-08-19 Xencor, Inc. Optimized Fc variants and methods for their generation
US8858937B2 (en) 2002-09-27 2014-10-14 Xencor, Inc. Optimized Fc variants and methods for their generation
US9353187B2 (en) 2002-09-27 2016-05-31 Xencor, Inc. Optimized FC variants and methods for their generation
US8383109B2 (en) 2002-09-27 2013-02-26 Xencor, Inc. Optimized Fc variants and methods for their generation
US10184000B2 (en) 2002-09-27 2019-01-22 Xencor, Inc. Optimized Fc variants and methods for their generation
US10183999B2 (en) 2002-09-27 2019-01-22 Xencor, Inc. Optimized Fc variants and methods for their generation
US10113001B2 (en) 2003-03-03 2018-10-30 Xencor, Inc. Fc variants with increased affinity for FcyRIIc
US8084582B2 (en) 2003-03-03 2011-12-27 Xencor, Inc. Optimized anti-CD20 monoclonal antibodies having Fc variants
US9657106B2 (en) 2003-03-03 2017-05-23 Xencor, Inc. Optimized Fc variants
US8388955B2 (en) 2003-03-03 2013-03-05 Xencor, Inc. Fc variants
US10584176B2 (en) 2003-03-03 2020-03-10 Xencor, Inc. Fc variants with increased affinity for FcγRIIc
US8735545B2 (en) 2003-03-03 2014-05-27 Xencor, Inc. Fc variants having increased affinity for fcyrllc
US9663582B2 (en) 2003-03-03 2017-05-30 Xencor, Inc. Optimized Fc variants
US9051373B2 (en) 2003-05-02 2015-06-09 Xencor, Inc. Optimized Fc variants
US7700097B2 (en) 2003-06-27 2010-04-20 Biogen Idec Ma Inc. Purification and preferential synthesis of binding molecules
US8603473B2 (en) 2003-06-27 2013-12-10 Biogen Idec Ma Inc. Modified binding molecules comprising connecting peptides
US9714282B2 (en) 2003-09-26 2017-07-25 Xencor, Inc. Optimized Fc variants and methods for their generation
US11820830B2 (en) 2004-07-20 2023-11-21 Xencor, Inc. Optimized Fc variants
US8101720B2 (en) 2004-10-21 2012-01-24 Xencor, Inc. Immunoglobulin insertions, deletions and substitutions
US8338574B2 (en) 2004-11-12 2012-12-25 Xencor, Inc. FC variants with altered binding to FCRN
US9803023B2 (en) 2004-11-12 2017-10-31 Xencor, Inc. Fc variants with altered binding to FcRn
US9200079B2 (en) 2004-11-12 2015-12-01 Xencor, Inc. Fc variants with altered binding to FcRn
US10336818B2 (en) 2004-11-12 2019-07-02 Xencor, Inc. Fc variants with altered binding to FcRn
US8802820B2 (en) 2004-11-12 2014-08-12 Xencor, Inc. Fc variants with altered binding to FcRn
US11198739B2 (en) 2004-11-12 2021-12-14 Xencor, Inc. Fc variants with altered binding to FcRn
US8318907B2 (en) 2004-11-12 2012-11-27 Xencor, Inc. Fc variants with altered binding to FcRn
US8324351B2 (en) 2004-11-12 2012-12-04 Xencor, Inc. Fc variants with altered binding to FcRn
US8852586B2 (en) 2004-11-12 2014-10-07 Xencor, Inc. Fc variants with altered binding to FcRn
US8367805B2 (en) 2004-11-12 2013-02-05 Xencor, Inc. Fc variants with altered binding to FcRn
US8546543B2 (en) 2004-11-12 2013-10-01 Xencor, Inc. Fc variants that extend antibody half-life
US8883973B2 (en) 2004-11-12 2014-11-11 Xencor, Inc. Fc variants with altered binding to FcRn
US8021661B2 (en) 2005-01-05 2011-09-20 Biogen Idec Ma Inc. Cripto binding molecules
US8084026B2 (en) 2005-01-05 2011-12-27 Biogen Idec Ma Inc. Multispecific binding molecules comprising connecting peptides
WO2006074399A2 (en) * 2005-01-05 2006-07-13 Biogen Idec Ma Inc. Multispecific binding molecules comprising connecting peptides
WO2006074399A3 (en) * 2005-01-05 2006-12-07 Biogen Idec Inc Multispecific binding molecules comprising connecting peptides
EP1874816A2 (en) * 2005-04-26 2008-01-09 MedImmune, Inc. Modulation of antibody effector function by hinge domain engineering
AU2006239851B2 (en) * 2005-04-26 2011-06-16 Medimmune, Llc Modulation of antibody effector function by hinge domain engineering
EP1874816A4 (en) * 2005-04-26 2010-08-25 Medimmune Inc Modulation of antibody effector function by hinge domain engineering
US8697396B2 (en) 2005-04-26 2014-04-15 Medimmune, Llc Modulation of antibody effector function by hinge domain engineering
US10576149B2 (en) 2005-04-26 2020-03-03 Lindis Biotech Gmbh Combination of the application of antibodies for immunostimulation together with glucocorticoids
US8008443B2 (en) 2005-04-26 2011-08-30 Medimmune, Llc Modulation of antibody effector function by hinge domain engineering
US10071158B2 (en) 2005-04-26 2018-09-11 Lindis Biotech Gmbh Combination of the application of antibodies for immunostimulation together with glucocorticoids
US8309690B2 (en) 2005-07-01 2012-11-13 Medimmune, Llc Integrated approach for generating multidomain protein therapeutics
US10143748B2 (en) 2005-07-25 2018-12-04 Aptevo Research And Development Llc B-cell reduction using CD37-specific and CD20-specific binding molecules
US10307481B2 (en) 2005-07-25 2019-06-04 Aptevo Research And Development Llc CD37 immunotherapeutics and uses thereof
US9040041B2 (en) 2005-10-03 2015-05-26 Xencor, Inc. Modified FC molecules
US7973136B2 (en) 2005-10-06 2011-07-05 Xencor, Inc. Optimized anti-CD30 antibodies
US9574006B2 (en) 2005-10-06 2017-02-21 Xencor, Inc. Optimized anti-CD30 antibodies
US8409568B2 (en) 2005-10-14 2013-04-02 Medimmune, Llc Mutant antibody Fc domains and fusion proteins thereof
US9567389B2 (en) 2005-10-14 2017-02-14 Medimmune, Llc Cell display of antibody libraries
WO2007048037A2 (en) * 2005-10-21 2007-04-26 Amgen Inc. METHODS FOR GENERATING MONOVALENT IgG
WO2007048037A3 (en) * 2005-10-21 2007-07-19 Amgen Inc METHODS FOR GENERATING MONOVALENT IgG
US8193322B2 (en) 2005-10-21 2012-06-05 Amgen Inc. Methods for generating monovalent IgG
EP2465871A1 (en) * 2005-10-21 2012-06-20 Amgen, Inc Methods for generating monovalent IgG
US8409577B2 (en) 2006-06-12 2013-04-02 Emergent Product Development Seattle, Llc Single chain multivalent binding proteins with effector function
WO2007146968A2 (en) * 2006-06-12 2007-12-21 Trubion Pharmaceuticals, Inc. Single-chain multivalent binding proteins with effector function
JP2015070842A (en) * 2006-06-12 2015-04-16 エマージェント プロダクト デベロップメント シアトル, エルエルシー Single-chain multivalent binding proteins
WO2007146968A3 (en) * 2006-06-12 2008-06-19 Trubion Pharmaceuticals Inc Single-chain multivalent binding proteins with effector function
JP2017060485A (en) * 2006-06-12 2017-03-30 アプティーボ リサーチ アンド デベロップメント エルエルシー Single-chain multivalent binding protein
JP2009539413A (en) * 2006-06-12 2009-11-19 トゥルビオン・ファーマシューティカルズ・インコーポレーテッド Single-chain multivalent binding protein with effector function
US9803020B2 (en) 2006-08-14 2017-10-31 Xencor, Inc. Optimized antibodies that target CD19
US11618788B2 (en) 2006-08-14 2023-04-04 Xencor, Inc. Optimized antibodies that target CD19
US8524867B2 (en) 2006-08-14 2013-09-03 Xencor, Inc. Optimized antibodies that target CD19
US10626182B2 (en) 2006-08-14 2020-04-21 Xencor, Inc. Optimized antibodies that target CD19
US9040042B2 (en) 2006-09-18 2015-05-26 Xencor, Inc. Optimized antibodies that target HM1.24
US8394374B2 (en) 2006-09-18 2013-03-12 Xencor, Inc. Optimized antibodies that target HM1.24
AU2008234248C1 (en) * 2007-03-29 2015-01-22 Genmab A/S Bispecific antibodies and methods for production thereof
AU2008234248B2 (en) * 2007-03-29 2014-07-10 Genmab A/S Bispecific antibodies and methods for production thereof
EP2626372A1 (en) * 2007-03-29 2013-08-14 Genmab A/S Bispecific antibodies and methods for production thereof
US9212230B2 (en) 2007-03-29 2015-12-15 Genmab A/S Bispecific antibodies and methods for production thereof
CN101802015B (en) * 2007-03-29 2015-05-06 根马布股份公司 Bispecific antibodies and methods for production thereof
US10906991B2 (en) 2007-03-29 2021-02-02 Genmab A/S Bispecific antibodies and methods for production thereof
JP2010522701A (en) * 2007-03-29 2010-07-08 ゲンマブ エー/エス Bispecific antibody and method for producing the same
WO2008119353A1 (en) * 2007-03-29 2008-10-09 Genmab A/S Bispecific antibodies and methods for production thereof
JP2014239689A (en) * 2007-03-29 2014-12-25 ゲンマブ エー/エス Bispecific antibodies and methods for production thereof
CN104497143B (en) * 2007-03-29 2020-08-25 健玛保 Bispecific antibody and method for producing same
US8940298B2 (en) 2007-09-04 2015-01-27 The Regents Of The University Of California High affinity anti-prostate stem cell antigen (PSCA) antibodies for cancer targeting and detection
WO2009032949A3 (en) * 2007-09-04 2009-12-30 The Regents Of The University Of California High affinity anti-prostate stem cell antigen (psca) antibodies for cancer targeting and detection
WO2009036209A3 (en) * 2007-09-14 2009-05-07 Amgen Inc Homogeneous antibody populations
EP3418299A1 (en) * 2007-09-14 2018-12-26 Amgen Inc. Homogeneous antibody populations
US9828438B2 (en) 2007-09-26 2017-11-28 Ucb Pharma S.A. Dual specificity antibody fusions
US10100130B2 (en) 2007-09-26 2018-10-16 Ucb Biopharma Sprl Dual specificity antibody fusions
US8629246B2 (en) 2007-09-26 2014-01-14 Ucb Pharma S.A. Dual specificity antibody fusions
US11427650B2 (en) 2007-09-26 2022-08-30 UCB Biopharma SRL Dual specificity antibody fusions
US9309327B2 (en) 2007-09-26 2016-04-12 Ucb Pharma S.A. Dual specificity antibody fusions
WO2009043051A2 (en) * 2007-09-27 2009-04-02 Biogen Idec Ma Inc. Cd23 binding molecules and methods of use thereof
WO2009043051A3 (en) * 2007-09-27 2009-06-25 Biogen Idec Inc Cd23 binding molecules and methods of use thereof
US11932685B2 (en) 2007-10-31 2024-03-19 Xencor, Inc. Fc variants with altered binding to FcRn
US9101609B2 (en) 2008-04-11 2015-08-11 Emergent Product Development Seattle, Llc CD37 immunotherapeutic and combination with bifunctional chemotherapeutic thereof
US10407513B2 (en) 2008-09-26 2019-09-10 Ucb Biopharma Sprl Biological products
WO2010079149A1 (en) * 2009-01-09 2010-07-15 Ipk Gatersleben Fusion antibody
US11401348B2 (en) 2009-09-02 2022-08-02 Xencor, Inc. Heterodimeric Fc variants
US10280214B2 (en) 2009-11-05 2019-05-07 Hoffmann-La Roche Inc. Glycosylated repeat-motif-molecule conjugates
EP2496603B1 (en) * 2009-11-05 2018-07-18 F. Hoffmann-La Roche AG Glycosylated repeat-motif-molecule conjugates
US10759844B2 (en) 2010-03-25 2020-09-01 Ucb Biopharma Sprl Disulfide stabilised antibodies and fragments thereof
US9045529B2 (en) 2010-03-25 2015-06-02 Ucb Pharma S.A. Disulfide stabilized antibodies and fragments thereof
WO2011117648A3 (en) * 2010-03-25 2011-11-17 Ucb Pharma S.A. Disulfide stabilised antibodies and fragments thereof
US10597464B2 (en) 2010-04-20 2020-03-24 Genmab A/S Heterodimeric antibody Fc-containing proteins and methods for production thereof
US11866514B2 (en) 2010-04-20 2024-01-09 Genmab A/S Heterodimeric antibody Fc-containing proteins and methods for production thereof
US9150663B2 (en) 2010-04-20 2015-10-06 Genmab A/S Heterodimeric antibody Fc-containing proteins and methods for production thereof
US11492371B2 (en) 2011-10-27 2022-11-08 Genmab A/S Production of heterodimeric proteins
US10344050B2 (en) 2011-10-27 2019-07-09 Genmab A/S Production of heterodimeric proteins
US10494437B2 (en) 2012-10-05 2019-12-03 Kyowa Kirin Co., Ltd Heterodimer protein composition
US9714291B2 (en) 2012-10-05 2017-07-25 Kyowa Hakko Kirin Co., Ltd Heterodimer protein composition
GB2519786A (en) * 2013-10-30 2015-05-06 Sergej Michailovic Kiprijanov Multivalent antigen-binding protein molecules
US10865253B2 (en) 2014-12-19 2020-12-15 Genmab A/S Rodent bispecific heterodimeric proteins
US11352426B2 (en) 2015-09-21 2022-06-07 Aptevo Research And Development Llc CD3 binding polypeptides
US11779651B2 (en) 2015-10-25 2023-10-10 Sanofi Bivalent, bispecific binding proteins for prevention or treatment of HIV infection
US11129905B2 (en) 2015-10-25 2021-09-28 Sanofi Bivalent, bispecific binding proteins for prevention or treatment of HIV infection
US11192960B2 (en) 2016-04-13 2021-12-07 Sanofi Trispecific and/or trivalent binding proteins
US11932704B2 (en) 2016-04-13 2024-03-19 Sanofi Trispecific and/or trivalent binding proteins
US10882922B2 (en) 2016-04-13 2021-01-05 Sanofi Trispecific and/or trivalent binding proteins
WO2019074973A3 (en) * 2017-10-10 2019-06-13 Sanofi Anti-cd38 antibodies and combinations with anti-cd3 and anti-cd28 antibodies
US11186649B2 (en) 2017-10-10 2021-11-30 Sanofi Anti-CD38 antibodies and methods of use
EP4249068A3 (en) * 2017-10-10 2023-11-22 Sanofi Anti-cd38 antibodies and combinations with anti-cd3 and anti-cd28 antibodies
US11365261B2 (en) 2017-10-10 2022-06-21 Sanofi Anti-CD38 antibodies and methods of use
WO2020028721A1 (en) * 2018-08-01 2020-02-06 City Of Hope Tag72 targeted chimeric antigen receptor modified t cells for treatment of tag72-positive tumors
CN112771079A (en) * 2018-08-01 2021-05-07 希望之城公司 TAG72 targeting chimeric antigen receptor modified T cells for treating TAG72 positive tumors
US11530268B2 (en) 2018-10-09 2022-12-20 Sanofi Trispecific anti-CD38, anti-CD28, and anti-CD3 binding proteins and methods of use for treating viral infection
US11613576B2 (en) 2019-04-09 2023-03-28 Sanofi Trispecific binding proteins, methods, and uses thereof

Also Published As

Publication number Publication date
EP1641826A2 (en) 2006-04-05
AU2004252171B2 (en) 2011-04-21
AU2011201880A1 (en) 2011-05-19
US20050163782A1 (en) 2005-07-28
NZ544924A (en) 2009-03-31
JP2010273686A (en) 2010-12-09
CA2529945A1 (en) 2005-01-06
JP2007535296A (en) 2007-12-06
JP5068072B2 (en) 2012-11-07
JP2010280683A (en) 2010-12-16
AU2004252171A1 (en) 2005-01-06
EP1641827A2 (en) 2006-04-05
US20090041758A1 (en) 2009-02-12
NZ544923A (en) 2009-02-28
US8603473B2 (en) 2013-12-10
US7700097B2 (en) 2010-04-20
WO2005000898A2 (en) 2005-01-06
JP5091476B2 (en) 2012-12-05
AU2004252170A1 (en) 2005-01-06
WO2005000898A3 (en) 2005-09-09
WO2005000899A3 (en) 2005-08-11
CA2530388A1 (en) 2005-01-06
AU2004252170B2 (en) 2011-01-27
JP2007535297A (en) 2007-12-06
US20050163783A1 (en) 2005-07-28

Similar Documents

Publication Publication Date Title
US8603473B2 (en) Modified binding molecules comprising connecting peptides
US8084026B2 (en) Multispecific binding molecules comprising connecting peptides
JP2007535297A5 (en)
US9738707B2 (en) Heterodimeric Fc regions, binding molecules comprising same, and methods relating thereto
JP2007535296A5 (en)
US8618252B2 (en) Neonatal Fc receptor (FcRn)-binding polypeptide variants, dimeric Fc binding proteins and methods related thereto
US8021661B2 (en) Cripto binding molecules
US20090258420A1 (en) Altered polypeptides, immunoconjugates thereof, and methods related thereto
EP2158318A2 (en) Single-chain fc (scfc) regions, binding polypeptides comprising same, and methods related thereto
CN1842538B (en) Modified binding molecules comprising connecting peptides

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200480024454.7

Country of ref document: CN

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2530388

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2006517785

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2004252171

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 544924

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2004777279

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2004252171

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2004777279

Country of ref document: EP

DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)