WO2004111243A1

WO2004111243A1 - Stabilisation of mrna transcripts

Info

Publication number: WO2004111243A1
Application number: PCT/FI2004/000368
Authority: WO
Inventors: Fred Fenel; Suvi Taira; Elina Hienonen; Martin ROMANTSCHUK
Original assignee: Carbozyme Oy
Priority date: 2003-06-19
Filing date: 2004-06-15
Publication date: 2004-12-23

Abstract

The invention concerns messenger RNA (mRNA) stabilising elements, which, when fused to selected nucleic acid elements, extend the half life of the selected nucleic acid elements or recombinant messenger RNA formed. The invention also relates to a method for enhancing protein production by fusing messenger RNA stabilising elements to selected nucleic acid sequences, which are able to express the desired protein. The messenger RNA stabilising elements are preferably from the hrpA gene.

Description

Stabilisation of mRNA transcripts

Field of the invention

The invention concerns the field of recombinant DNA. More particularly, the invention concerns messenger RNA (mRNA) stabilising elements, 5 which, when fused to selected nucleic acid elements, extend the half life of the selected nucleic acid element or recombinant messenger RNA formed. The invention also relates to a method for enhancing protein production by fusing messenger RNA stabilising elements to selected nucleic acid sequences, which are able to express the desired protein.

o Background of the invention

Production of heterologous proteins in various prokaryotic hosts is a central way to commercially utilise recombinant DNA technology. Also eukaryotic host can be used, but so far they have been utilised to a lesser extent for commercial production. The produced proteins may be expressed in very 5 low concentrations in their natural hosts, and various methods are commonly used in order to enhance their expression particularly in heterologous host. These methods include for instance

1 ) choosing a production host that possesses advantageous properties, such as being easily culturable, fast growing, non-pathogenic etc., and op- 0 timising the culturing conditions,

2) using an efficient promoter and efficient translation start signals,

3) stabilising the formed transcript by using Rnase deficient strains or 3' messenger RNA stabilising elements,

4) optimising the codon usage to match the host organism's codon 5 usage, and

5) stabilising the protein product by using protease deficient strains.

Depending on the gene and the gene product to be expressed, several different steps can limit the rate of protein production. Messenger RNA stability is an in-built property of a defined gene transcript, and transcripts with 0 very short half-life may yield in relatively low expression level of the desired gene product, even though an efficient promoter is used for driving its expression. Messenger RNA decay in bacteria occurs mainly from the two ends of the transcript. 3' end of messenger RNA is (in E. coli) vulnerable to two 3' exo- Rnases, PNP and Rnase II. The net degradation of messenger RNA, however, 5 occurs with a 5' to 3' polarity. The initial step in the 5'-3' degradation is endo- Rnase cleavage near the 5' terminus by Rnase E or sometimes with Rnase III, which is followed by degradation by the exo-Rnases in 3'-5' direction. Secondary structures present at both ends of the transcript are important for the degradation speed influencing the steady state level of transcripts, however deg- radation process has a loose primary or secondary structure specificity.

Efforts in order to increase the messenger RNA stability in a production host has taken advantage of two strategies: inactivating some of the natural Rnases present in the production host, and fusing 3' hairpin loops that stabilise the transcript to the gene to be expressed. Both of these have their limi- tations. Rnase negative strains are not available for all production hosts, and inactivation of multiple Rnases in the same strain may lead to decreased viability of the bacterium and inefficient protein production in general. The 3' hairpin loops affect only the RNA degradation proceeding from the 3' end of the transcript, leaving the 5' end as vulnerable to Rnases as it was before manipula- tion.

US 4,910,141 , H.C. Wong and S. Chang, Cetus Corp., describes a method for extending the half-life of mRNAs by using a positive retroregulatory element which is ligated to the 3' end of the DNA sequence encoding the RNA. The document mentions the cry gene of Bacillus thuriengiensis as a suitable retroregulatory element, based on the long half-life its mRNA is reported to have. The half life of PenP mRNA is shown to extend from about two minutes to six minutes upon the use of the positive retroregulatory element.

GB 2,183,655A, CF. Higgins and N.H. Smith, describes a method for increasing the half-life of an mRNA sequence by utilising recombinant DNA having a repetative extragenic palindromic (REP) sequence immediately downstream (3') of the DNA encoding sequence corresponding to the said mRNA sequence. The REP sequence comprises 30 to 60 nucleotides forming a stem loop; as an example the histidine transport operon of Salmonella ty- phimurium is disclosed. EP 726,319B1, McMaster University, describes methods for enhancing the translation of mRNA by coupling specific nucleotide sequences at the 5' and 3' ends of a nucleic acid molecule transcribable to or which itself is the mRNA. According to the document, the nucleotide sequence at the 5' end is effective to increase the rate of translation initiation of the mRNA molecule while the nucleotide sequence at the 3' end is effective to increase the period of translation of the mRNA molecule. The nucleotide sequence of the 3' end is provided by the 3' untranslated region of a gene, particularly that of β prolactin. Alternatively, enhancement of the translation of the mRNA can be effected by coupling to a nucleic acid at the 3' end thereof a nucleotide sequence of the 3' untranslated region of prolactin. WO 01/49838, Hadasit Medical Research Services & Development, describes an isolated cis-acting regulatory nucleic acid sequence comprising the 3' untranslated region of parathyroid hormone (PTH) gene. According to the document, the sequence is capable of directing specific regulation of stability of mRNA encoded by a homologous or heterologous coding sequence linked to it.

WO 98/48004, Wistar Institute of Anatomy and Biology, also describes methods and compositions for stabilizing unstable gene transcripts. The document discloses constructs where a polynucleotide sequence encoding the desired gene product, or the corresponding gene transcript, is flanked by a 5' sequence and a 3' sequence of an intron comprising a hairpin structure. The intron is preferably the 2.0 kb LAT of a herpes virus.

In view of the importance of recombinant DNA technology in the production of beneficial proteins, there still remains a constant need of methods and components for improving the stability of the production systems.

Short description of the invention

It is thus an object of the present invention to provide a method for increasing the stability of nucleic acid transcripts, said method comprising the step of coupling to a first nucleic acid sequence transcribable to or which itself is an mRNA molecule a second nucleic acid sequence, the transcript of which has a longer half-life than the first one, so that the second nucleic acid sequence flanks the first nucleic acid sequence both at the 3' and 5' end.

It is also an object of the present invention to provide a method for increasing the stability of nucleic acid transcripts, said method comprising utilising a nucleic acid sequence which itself is a transcript or which is transcribed into a transcript having a half-life exceeding 10 minutes.

It is a further object of the present invention to provide the use a nucleic acid sequence the mRNA transcript of which has a half-life exceeding 10 minutes for the stabilisation of heterologous nucleic acid sequences.

It is a still further object of the present invention to provide a hybrid nucleic acid molecule which comprises a first nucleic acid sequence, transcribable to or which itself is an mRNA molecule, coupled to a second, nucleic acid sequence, the transcript of which has a longer half-life than the first one, so that the second nucleic acid sequence flanks the first nucleic acid sequence both at the 3" and 5' end. Preferably, the hybrid nucleic acid molecule further comprises an operably linked promoter. It is also an object of the present invention to provide a method for enhancing expression of a selected nucleic acid sequence, the method comprising

(a) coupling to a selected, first nucleic acid sequence transcribable to or which itself is an mRNA molecule a second nucleic acid sequence, the transcript of which has a longer half-life than the first one, so that the second nucleic acid sequence flanks the first nucleic acid sequence both at the 3' and 5' end,

(b) transforming a host cell with the nucleic acid molecule constructed in item (a), (c) culturing the host cell in conditions favoring the expression of said nucleic acid molecule, and

(d) optionally recovering the product obtained by expression of said selected nucleic acid sequence.

Short description of Figures Figure 1. Determination of half-lives of three P. syringae transcripts.

Northern blots after induction of Hrp system and cessation of RNA synthesis. Time points after addition of rifampicin are indicated on the top of each picture. Two transcripts are visualized with hrpA probe: one harbouring the coding region for HrpA and the other harbouring the coding regions for HrpA and HrpZ. A: time scale 0-35' with hrpA probe. B: repetition of the experiment shown in A, time scale 0-90'. C: Half-life of PilA transcript.

Figure 2. Graph of half-lives of hrpA, hrpZ and pilA mRNAs. Time minutes after cessation of RNA synthesis.

Figure 3. Graph of half-life of hrpAp_h mRNA. Time minutes after cessation of RNA synthesis on the x-axis.

Figure 4. Northern blots of hrpA negative P. syringae strains complemented with mutagenised hrpA gene in plasmid. Mutants carry a 15 bp insertion at various locations in the hrpA gene (see Fig 4C for location #). 4A, mutations at the 3' non-coding region: Lane A: wild type hrpA gene, B: #283, C: #250, D: #202, E: #350, F: #321 , G: wild type, H:# 270. 4B: mutations throughout the hrpA gene. Lane A: wild type, 4B: #6, C: #17, D: #167, E #:203, F: #227, G: #268, H: #321. 4C: locations of the 15 bp insertions in the hrpA gene. The lollypops coloured black (or in color blue) have been shown to reduce dramatically the accumulation of hrpA mRNA.

Figure 5 shows HrpA-neo-constructs. A: hrpA 5' non-coding region fused with neo and its 3' UTR, B: hrpA 5' non-coding region and 15 first amino acid coding region fused with neo insert and C: hrpA with neo insert. Lines and white boxes represent sequences derived from hrpA, shaded box represents neo gene. Fusion was done at the first ATG codon in A, codon 15 in B and at codon 57 in C. The 5' region contains hrpA promoter and ribosome-binding site.

Figure 6 shows accumulation of Neo transcript produced from hrpA promoter in P. syringae. Lane A: a construct harbouring hrpA 5' non-coding region preceding neo gene. B: a construct harbouring hrpA 5' non-coding region, 15 amino terminal amino-acids coding region fused in frame with neo, followed by 3' non-coding region of hrpA. C: a construct where neo gene has been fused in frame in the middle of hrpA gene.

Figure 7 shows increased production of HrpA-Neo fusion proteins as a result of stabilised mRNA transcripts. Immunoblot of proteins produced by various hφA-neo fusion-harbouring P. syringae strains. Detection with anti- NPT serum. Lane 1 : negative control = strain without any fusion. 2: the construct in Fig 5B. 3: a construct harbouring the hrpA 5' non-coding region and 113 amino terminal amino acids in fusion with neo. 4: The construct in Fig 5A. 5: The construct in Fig 5C. 6: A construct that contains the same elements as in lane 5, except that NPT is preceded with ribosome binding site derived from E. coli.

Figure 8. Determination of the half-life of HrpA-Neo transcript probed with neo probe. Time points after addition of rifampicin are indicated on the top.

Figure 9 presents a graph of the half-life of the hrpA-Neo transcript. Figure 10. Determination of the half-life of hrpA-gfp transcript. Time points after addition of rifampicin (150 μg/ml) are indicated on the top.

Figure 11 presents a graph of the half-life of the hrpA-gfp transcript. Figure 12. Determination of hrpAp_h-neo fusion transcript half-life. hrpA sequences are flanking neo gene. Figure 13. The HrpA sequence of Pseudomonas syringae pv. tomato DC 3000. The ends contain constructed EcoRI and BamHI sites, the promotor is shown by a box, the transcription initiation point is marked with an asterix and the ribosome binding site is underlined.

Figure 14. The HrpAp sequence of Pseudomonas syringae pv. phaseolicola race 4. The numbers refer to GenBank entry L41862. The initia- tion and termination codons are bolded.

Detailed description of the invention

The present invention resides in the use of certain types of nucleic acid sequences which transcribed into mRNA are stable as transcript stabilising elements. When such a nucleic acid sequence is fused to a second nucleic acid sequence, the stability and half-life of the second nucleic acid sequence can be considerably extended. Preferably, the first nucleic acid sequence is fused to the second nucleic acid sequence so that it flanks the second nucleic acid sequence at both ends. The longer half-lives and more stable transcripts provided by the invention can be utilised for obtaining better steady state level of the desired transcript, higher expression and hence better yield of desired proteins both in vivo and in vitro.

According to the invention, nucleic acid sequences forming mRNA transcripts having a long half-life are used for the protection of the second nucleic acid. Examples of suitable nucleic acid sequences include, but are not limited to, nucleic acid sequences belonging to the type III secretion system (TTSS) of pathogenic microorganisms, which in connection with the present invention have been found to have extraordinary long half-lives, even above 40 minutes. Typically, the half-life of bacterial transcripts is substantially less than 10 minutes. Type III secretion systems (TTSS) have been found in both plant and animal pathogens. Among plant pathogens, i.e. bacteria from the genus Erwinia, Pseudomonas, Ralstonia and Xanthomonas have been found to have a type III secretion system, animal pathogens using the TTSS include bacteria from the genus Yersinia, Salmonella, Shigella and Escherichia (Hueck, CJ. (1998) Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiol. Mol. Biol. Rev., 62, 379-433).

Type III secretion systems (TTSS) deliver so-called effector proteins into the host cytoplasm (Galan, J.E. and Collmer, A. (1999) Type III secretion machines: bacterial devices for protein delivery into host cells. Science 284, 1322-1328). Effector proteins are translocated to the host cell by bacterial appendages termed needles and pili, through which the proteins travel (Lin, Q, He, S-H. (2000) Role of Hrp pilus in type III protein secretion in Pseudomonas syringae. Science 294:2556-2558; Li, C-M., Brown, I., Mansfield, J., Stevens, C, Boureau, T., Romantschuk, M., Taira, S. (2001) The Hrp pilus of Pseudomonas syringae elongates from its tip and acts as a conduit for translocation of the effector protein HrpZ. EMBO J. 21: 1909-1915).

The type III secretion system is very complex in function and consists of more than ten proteins. In plant pathogens, TTSS is encoded by hrp genes (hypersensitive reaction and pathogenesis; Alfano, J.R. and Collmer, A. (1997) The type III (Hrp) secretion pathway of plant pathogenic bacteria: traf- ficking harpins, Avr proteins, and death. J. Bacteriol., 179, 5655-62). The hrp genes cover an about 20 kb region in the chromosome or plasmid. Nine of the hrp genes are well-conserved and corresponding genes are easily identified in TTSS gene clusters in animal pathogens. The conserved genes are designated as hrc genes (hrp conserved). Eight of the hrc genes show homology with genes of the flagella system, and therefore the type III secretion system and the flagella system are believed to have a common evolutionary origin.

TTSS resembles a cylinder with a needle-like appendage. The cylinder extends through the bacterial membrane and cytoplasm, hence the proteins secreted by TTSS are not transported via the periplasm. The needle-like appendage varies in appearance between different bacterial species. In plant pathogens, it is usually long, even several micrometers (the bacterial cell is, usually, about 1 micrometer). In plant pathogenic Pseudomonas syringae the structural subunit of the appendage is encoded by hrpA gene. In animal pathogens, the appendage is normally extremely short. The proteins are se- creted through the needle-like appendage. No clear and uniform secretion signal that target the effector proteins to the TTSS channel has been found, and therefore, the signal has been under a great deal of debate. It has even been suggested that the secretion signal may reside in the mRNA secondary structure, but recent studies speak in favour of a protein-based secretion signal. The pilin proteins participating in TTSS show great variances between microbial species and even bacterial strains. A computerized homology determination for a Hrp protein from Pseudomonas syringae pv. tomato DC3000 and Pseudomonas syringae pv. phaseolicola, respectively, shows no similarity on DNA level. Nevertheless, in connection with the present invention, the mRNA transcripts of both proteins have been shown to have long half-lifes and to function as mRNA stabilising elements. Therefore, mRNA transcripts of TTSS proteins having an unusually long half-life are suitable for use in accordance with the present invention.

The nucleic acid sequences of the hrpA genes from pv. tomato and pv. phaseolicola are presented in the sequence listing as SEQ ID No. 1 and SEQ ID No. 2, respectively.

In accordance with the present invention, it is essential that the nucleic acid sequence used for stabilisation of a desired gene sequence, is more stable as compared to said gene sequence to be stabilised. However, the exact half-life is not important. For instance, by increasing the half-life of the tran- script by ten times, a correspondingly bigger yield can be obtained. For recombinant protein production, however, also a considerable smaller increase in yield can be significant. Therefore, transcripts having shorter half-lives than those described in the examples of the present document can be of a significant value. The half-life of the transcripts that can be utilised for the purposes of the present invention can thus vary within a wide range, but should always be longer than the natural half-life of any chosen nucleic acid sequence to be translated or expressed as described herein. The half-life can, for instance, be about 8 - 60 minutes. Preferably, the half-life should exceed 10 minutes.

In connection with the present invention, stability is defined as the property to resist decomposition.

The naturally unusually stable transcript of hrpA gene of Pseudomonas syringae pv. tomato DC3000 (GenBank ID: L41861) is disclosed as a preferred embodiment. The nucleic acid sequence of said hrpA gene is disclosed in the sequence listing as SEQ ID No. 1. The type III pilus of P. syringae pv. tomato, called the Hrp pilus, is composed of HrpA pilin subunits (Roine, E., Wei, W., Yuan, J., Nurmiaho- Lassila, E.L., Kalkkinen, N., Romantschuk, M. and He, S.Y. (1997) Hrp pilus: an hrp-dependent bacterial surface appendage produced by Pseudomonas syringae pv. tomato DC3000. Proc. Natl. Acad. Sci. USA, 94, 3459-64). HrpA pilin itself uses the type III secretion route and the pilus is assembled from the tip (Li, C-M., Brown, I., Mansfield, J., Stevens, C, Boureau, T., Romantschuk, M., Taira, S. (2001) The Hrp pilus of Pseudomonas syringae elongates from its tip and acts as a conduit for translocation of the effector protein HrpZ. EMBO J. 21 : 1909-1915). Mutations in hrpA gene render the bacterium avirulent and unable to secrete proteins (Wei, W., Plovanich-Jones, A., Deng, W.-L., Jin, Q.- L., Collmer, A., Huang, H.-C and He, S.Y. (2000) The gene coding for the Hrp pilus structural protein is required for type III secretion of Hrp and Avr proteins in Pseudomonas syringae pv. tomato. Proc. Natl. Acad. Sci., 97, 2247-2252; Roine, E., Wei, W., Yuan, J., Nurmiaho-Lassila, E.L., Kalkkinen, N., Romantschuk, M. and He, S.Y. (1997) Hrp pilus: an hrp-dependent bacterial surface appendage produced by Pseudomonas syringae pv. tomato DC3000. Proc. Natl. Acad. Sci. USA, 94, 3459-64). HrpA belongs, presumably, to the class of type III proteins, which are not translocated into the cytoplasm of their host plants cells, and no HrpA-specific chaperones have been identified. The secretion signal for HrpA is in the first 15 codons. Changes made to the 5' UTR or the secretion signal of hrpA sequence often result in lower amounts of mRNA (Taira, S., Tuimala, J., Roine, E., Nurmiaho-Lassila, E.L., Savilahti, H. and Romantschuk, M. (1999) Mutational analysis of the Pseudomonas syringae pv. tomato hrpA gene encoding Hrp pilus subunit. Mol. Microbiol., 34, 737-44; Hie- nonen, E., Roine, E., Romantschuk, M., Taira, S. (2002) Secretion signal and mRNA stability of HrpA: a type III secretion dependent pilin of Pseudomonas syringae. Mol. Genetics & Genomics, 266:971-978). hrpA hence codes for the major structural unit of the Hrp pilus. HrpA pilin is a type III secretion dependent protein and also an indispensable part of the type 111 secretion system. In connection with the present invention, it has been found that hrpA mRNA has an unusually long half-life, approximately 40 min. In addition to the 5" region, also the 3' untranslated region was found to effect the stability of hrpA mRNA. Further, hrpA mRNA was shown to be remarkably stable also when produced under the inducible LacZ promotor in Escherichia coli, where no type III secretion system is present. The extreme stability of hrpA mRNA is hence an inherent property and independent of pseudomonas-specific elements.

Furthermore, in connection with the present invention it has been found that hrpA mRNA can be utilised for the protection of heterologous mRNA. In a preferred embodiment of the present invention, heterologous mRNAs are stabilized by flanking them with the stable hrpA mRNA.

The inventors have thus proved that mRNAs that have naturally long half-lives can be used as mRNA stabilising elements. Especially when fused at both 5' and 3' ends of a desired gene and the resulted construct placed down streams of a chosen promoter, the half-life of the transcribed messenger RNA can be markedly extended. For use, a nucleic acid construct is formed, which nucleic acid construct carries a chosen promoter fused with a protector gene producing mRNA with long half-life, such as the hrpA gene, in such way that the natural transcription initiation site of the promoter is exactly replaced by the transcription initiation site of the protector gene, preferably followed by 5' portion of the protector gene, followed by the desired gene either with translation start signal or in frame with protector gene's open reading frame, which is followed by the 3' region of the protector gene including the transcription termination signal.

Suitable promoters are well-known in the art, and the selection of an appropriate promoter for any given host, nucleic acid construct, reaction condition etc. is part of the know-how of a person skilled in the art.

The desired gene can in connection with the present invention be any gene or gene fragment, the enhanced expression of which will provide benefit to human or animals. As mentioned, the desired gene can be either in protein fusion with the protector, or translated from its own ribosome-binding site and start codon. Both fusion proteins and proteins encoded only by the desired gene can hence be produced.

The DNA construct is suitable for use both in vivo and in vitro. In a preferred embodiment, it is used for improving protein yields. However, it can also be used for other purposes.

The construct is schematically presented below:

termination

Chosen hrpA 5' region Desired gene hrpA 3' region promoter

messenger RNA

protein product

SD= Ribosome-binding site

As shown in the examples of the present application, the hrpA transcripts of Pseudomonas syringae pv. tomato DC3000 and Pseudomonas syringae pv. phaseolicola, respectively, were found to have half-lifes of 40 minutes resp. 25 minutes, when the mRNA was expressed in the native host, P. syringae. Furthermore, the hrpA transcript of Pseudomonas syringae pv. to- mato DC3000 was found to have a half-life of 40 minutes when produced from lacZ promoter in E. coli DH5 at 28°C, and only slightly less at 37°C.

Production of Hrp-dependent proteins is controlled by temperature as well as other abiotic factors. To study whether mRNA stability might be involved in the control of the production of TTSS dependent proteins, the half-life of hrpA mRNA was measured at the elevated temperature of 28°C, in addition to the normally used temperature of 18°C hrpA mRNA was stable also at this higher temperature with a half-life of 33 min. The stabilising secondary structures of hrpA mRNA thus seems to be stable also at an elevated temperature.

For studying whether the stable hrpA transcript could be used for stabilizing heterologous mRNAs, a Neo gene cassette encoding neomysin phospho transferase from Tn5 was inserted between the 5' and 3' regions that were determined to be responsible for the long half-life. Only partial protection of the transcript was then detected. Inserting neo into the middle of the intact hrpA mRNA did however protect neo against degradation.

The half-life of a heterologous mRNA, a neo transcript, was about 40 minutes, when the neo gene was fused with hrp A fragments as described in the examples, in P. syringae, production being driven from the native hrpA promoter. The formed transcript harbours the native 5' non-coding end and amino-terminal portion of the hrpA coding region (212 bases of hrpA transcript), open reading frame of the Neo protein fused with hrpA in frame, and carboxy-terminal portion and 3' non-coding region of the native hrpA transcript, encoded by 216 bp 3' end of the hrpA gene.

The accumulation of hrpA-neo fusion transcript increased step-wise, when the transcript carried only short 5' non-coding portion of hrpA followed by neo, 5' non-coding portion + half of the amino-terminal hrpA coding region fol- lowed by neo, or 5' non-coding portion + half of the amino-terminal hrpA coding region followed by neo + carboxy-terminal portion and 3' non-coding portion of hrpA being placed after the neo gene. The observation was done in P. syringae and the expression was driven from the hrpA promoter. The accumulation of mRNA was accompanied with increased production of HrpA-Neo fu- sion protein.

Regions important for hrpA transcript accumulation were mapped to 5' and 3' portions of the transcript, however the best mRNA accumulation results were achieved when the entire hrpA gene was flanking the neo gene as described in the example. In the following, the invention will be described in greater detail by means of examples. These examples are only intended to illustrate the invention and should not be construed to limit the scope of protection in any way. Example 1

Transcripts and determination of their half-lives

Bacterial strains and growth conditions

Bacterial strains used in this study were E. coli DH5 , Pseudomo- nas syringae pv. tomato DC3000 (D. Cuppels, London, Ontario, Canada) and its hrpA derivative (Roine et al., 1997 supra) and for mRNA half-life studies the original rifampicin sensitive DC 3000 isolate (D. Cuppels, London, Ontario, Canada). Plasmids were introduced to Pseudomonas by triparental mating using pRK2013 as the helper plasmid (Figurski, D. H._τ and Helinski, D. R. (1979) Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc Natl Acad Sci U S A 76: 1648-52) or by electroporation in the case of the rifampicin sensitive strain. Hrp-inducing medium (Huynh, T.V., Dahlbeck, D. and Staskawicz, B.J. (1989) Bacterial blight of soybean: regulation of a pathogen gene determining host cultivar specificity. Science, 245, 1374-7) or Kings B (King, E.O., Ward, M.K. and Raney, D.E. (1954) Two simple media for the demonstration of pyocyanin and fluorescein. J. Lab. Clin. Med., 22, 301-307,) was used as culture media for Pseudomonas and LB for E. coli. Pseudomonas strains were grown at 28°C and for Hrp-induction at 28°C or 18°C, and E. coli strains at 37°C

Plasmid constructs

PCR reactions were done with PFU polymerase (Promega, U.S.) and standard methods were used for making the DNA manipulations, transformations and conjugations (Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Figurski and Helinski, 1979 supra). Insertion mutant library with Notl restriction sites in various locations of the hrpA gene (Taira, S., Tuimala, J., Roine, E., Nurmiaho-Lassila, E.L., Savilahti, H. and Romantschuk, M. (1999) Mutational analysis of the Pseudomonas syringae pv. tomato hrpA gene encoding Hrp pilus subunit. Mol. Micro- biol., 34, 737-44) was used to make neo-hrpA fusion plasmids. The neo cartridge of Tn5 was amplified by PCR with GAG ACA GGA TGA GGG CGG CCG CCA TGA TTG AAC AAG ATGG, or in the case of neo being out of frame with hrpA CAA GAT GGC GGC CGC TGA TCA ATA GAC AGG ATG as the 5' primer (stop codon created in italics), and AAT TCC AGG CGG CCG CTC AGA AGA ACTC as the 3' primer, when hrpA sequences were included at the 3' end of the construct, and GGT GGA ATT CAA ATC TCG TGA TGG, when no hrpA sequences were included. These oligonucleotides introduce Not\ restriction sites to the PCR product. When using the latter, a fusion protein is obtained, whereas the former will produce only the protein encoded by the desired gene.

Transcript half-life analysis

Total RNA was isolated from logarithmically growing bacteria (OD_δoo = 0,3-0,6 after 3 hr induction in hrp-inducing medium), by hot phenol method (von Gabain, A., Belasco, J. G., Schottel, J. L., Chang, A. C, and Cohen, S. N. (1983) Decay of mRNA in Escherichia coli: investigation of the fate of specific segments of transcripts. Proc Natl Acad Sci USA 80: 653-7). The samples were stored under ethanol at -70°C, and run in formaline containing agarose gels (1.4% agarose); the method is essentially described in Sambrook, J., Fritsch, E., and Maniatis, T. (1989). Molecular cloning: a laboratory manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. The amount of total RNA in each lane was about 25 μg, and even loading was verified by staining the gel with EtBr in order to visualise the ribosomal RNA species. The RNA was transferred to positively charged nylon membranes

(Roche # 1417240) by capillary blotting in 20XSSC (Sambrook et al.). The transcripts were detected by hybridisation with DIG-labelled probes (Roche # 1363514 for detection and Roche # 1636090 for probe synthesis). The transfer, hybridisation and detection methods essentially followed the manufacturers instructions. The probe was antisense-labelled by the following protocol: DNA region to be labelled was amplified by PCR with forward and reverse primers. The PCR product was run in an agarose gel, and the product was cut from the gel. A 50-25 μg slice of the band-containing agarose was subjected to second PCR-reaction with reverse primer only, and DIG labelled NTP mix, buffer and enzyme mix from the probe synthesis kit. PilA probe was made using oligonucleotides CGG GAT CCT TTA CAC TGA TTG AAC TG and AAT CAA AGC TTA GTT TTT AAC, and P. syringae DC3000 chromosomal DNA as a template. For hrpA probes oligonucleotides ATA TAG GAT CCT GCA AAG ACG CTG GAA CC and TAG AAT TCG GGG TAC CTC CTC AAG GTA G were used. For transcript half-life studies rifampicin (Duchefa # R0146) was used in final concentration of 150 μg/ml in order to stop de novo transcription. Samples from the transcription-arrested cultures were taken at defined time points, dipped in liquid nitrogen and stored on ice prior RNA isolation. Quantifi- cation of the hybridisation signals was done using Tina 2.0 (Raytest) program, from multiple exposures in order to avoid artefacts derived from saturation of the film.

Half-lives of transcripts hrpA and hrpAZ hrpA mRNA is transcribed as two transcripts, one containing hrpA alone (400 bp) and the other containing hrpAZ (1700 bp). The half-lives of both transcripts hrpA, hrpAZ, and as a control, pilA, were determined. pilA encodes a pilin for the type IV pilus (Roine, E., Nunn, D. N., Paulin, L., and Romantschuk, M. (1996) Characterization of genes required for pilus expression in Pseudomonas syringae pathovar phaseolicola. J Bacteriol 178: 410-7), se- creted by the type II secretion system. The hrp genes of the rifampicin sensitive Pst DC3000 strain were first induced by growing the cultures in Hrp- inducing medium at 18°C and transcription was then inhibited with rifampicin. In the first experiment, samples were taken from time points ranging from 0 to 35 min after cessation of de novo transcription. Based on the first experiment, the mRNA half-life of hrpAZ was estimated to be 11 min (Figures IA, 2, and data not shown) and pilA half-life 6 min (Figures IC and 2), whereas the hrpA transcript signal did not appear to reduce at all. In the second experiment, samples were taken over a 90 min period. During the first 40 min, when the signal for hrpAZ was still visible, the hrpA signal remained fairly stable and after this time point the signal decreased faster (Figure 2). The half-life of the hrpA transcript was estimated to be 40 min from the early time points and 20 min from the later time points (Figures IB, 2, and data not shown).

The results are shown in Figures 1 and 2. In the Figures, the time points after addition of rifampicin are indicated on the top of each picture. 1A: time scale 0-35' with hrpA probe. 1B: time scale 0-90' with hrpA probe. Half-life for HrpA transcript was calculated to be 40 minutes. 1C: Half-life of PilA transcript (6 minutes). Figure 2: Half-life curves combined in the same graph.

In order to study the role of mRNA stability in temperature regula- tion, the half-life of hrpA at 28°C was also measured. The half-life was long (approximately 33 min from time points 10-50 min.) also at the higher temperature (Figure 2).

Example 2

Half-life of hrpAp transcript To determine whether the long half-life was a common feature of hrp genes, example 1 was repeated by using the microorganism Pseudomonas syringae pv. phaseolicola (Figure 14). Cloning and plasmid transfer techniques are described in example 1. EcoRI and Hindlll restriction sites have been constructed at the ends and a Notl restriction site has been inserted at nucleotides 186-193. The hrpA gene from Pseudomonas syringae pv. phaseolicola race 4, hereafter referred to as hrpAp , was amplified using standard PCR techniques with the following oligonucleotides: CTCGAATTCACAACCTCCTCAAAG, TCAAAAGCTTGCAGATCTGATTTT, GCGTCAAGGCGGCCGCCGACCGCAAC, CGGTCGGCGGCCGCCTTGACGCTGTTG by which EcoRI and Hindlll restriction sites were constructed at the ends of the fragment, and a Notl restriction site was constructed to replace nucleotides 186-193. The amplified DNA fragment was cloned into pDN18-N (Taira et al, 1999 supra). The DNA construct was transferred into P. syringae pv. tomato and its half-life was determined with same methology as in example 1 using a hrpAp probe.

The results corresponded to those in example 1. A graph of the hrpAp half-time is presented in Figure 3.

Example 3

Stabilisation of heterologous transcript

In order to study the stabilising effects of hrpA mRNA, a neo gene with its STOP codon and its own 3' UTR or 3' region of hrpA gene was inserted into different places in the hrpA gene (Figure 5), the microorganisms were cul- tured as described in example 1 and the amounts of formed proteins and their transcripts were measured (Figure 6 and data not shown). Both the 5' and 3' regions of hrpA mRNA were shown to influence transcript stability, and therefore neo was fused in the middle of the hrpA gene (aa 57 of hrpA, mutant 167) (Figure 5, see also figure legend 4C). When the full-length hrpA mRNA was present the amount of protein and mRNA were significantly higher compared to the constructs only harbouring an intact 5' region or 5' UTR and 3' UTR regions of hrpA (Figure 6 and data not shown). In these mutants neo with or without its 3' UTR was inserted in an hrpA deletion mutant from which amino acids from 15 to the last were deleted (mutants 6 and 268, see figure legend 4C). The mRNA of the construct with the full-length hrpA mRNA was also highly stable like the wild type hrpA mRNA. The amount of protein produced was also high when neo was inserted out of frame in mutant 167. Quantification of protein production was done by immunoblotting

(Western blotting). For immunoblotting, the proteins were separated in a 12- 14% SDS PAGE (Laemmli, U. 1970, Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685) and transferred to PV.DF membrane (Schleicher & Shcuell # 10413096) following the manufacturers recommendation. For protein detection, antiserum raised against purified HrpA pili (Roine, E., Saarinen, J., Kalkkinen, N. and Romantschuk, M., 1997, Purified HrpA of Pseudomonas syringae pv.. tomato DC3000 reassembles into pili. FEBS Lett., 417, 168-72), and a commercial neomycin phosphotransferase (NPT) antiserum that recognises the product of neo gene (5'-3') were used. The bound antibodies were detected by monoclonal anti- rabbit IgG alkaline phosphatase conjugate (Sigma #A2556) and a standard colour reaction (NBT/BCIP, Promega #S381C, S380C).

The amount of samples in each lane is typically cells derived from 10-20 /I bacterial culture at mid logarithmic phase (OD_δoo = 0.5-1). Figure 5 shows the structure of three HrpA-NPT-constructs and Figure 6 shows the accumulation of Neo transcripts from these constructs.

Figure 7 shows the increased production of HrpA-Neo fusion proteins as a result of stabilised mRNA transcripts by various hrpA-neo fusion- harbouring P. syringae strains. As negative control, a strain without any fusion was used (lane 1 ). The constructs are the construct in Fig 5B (lane 2), a construct harbouring the hrpA 5' non-coding region and 113 amino terminal amino acids in fusion with neo (lane 3), the construct in Fig 5A (lane 4), the construct in Fig 5C (lane 5), a construct that contains the same elements as in lane 5, except that NPT is preceded with ribosome binding site derived from E. coli (lane 6). Example 4

Half-life of heterologous neo transcript

Determination of the half-life of a HrpA-Neo transcript, constructed as described in example 1 , probed with neo probe was carried out as outlined in example 1. The transcript harbours the native 5' non-coding end and amino- terminal portion of the hrpA coding region (212 bases of hrpA transcript), open reading frame of the Neo protein fused with hrpA in frame, and carboxy- terminal portion and 3' non-coding region of the native hrpA transcript, encoded by 216 bp 3' end of the hrpA gene (see also Figure 13). A northern blot is presented in Figure 8. Time points after addition of rifampicin is indicated on the top. Figure 9 presents a graph of the half-life. The result shows that the half-life is about 40 minutes.

Example 5

Stabilisation of heterologous transcript Example 3 was repeated by inserting gfp into the hrpA gene. GFP was amplified using oligonucleotides GCA GGA ATG CGG CCG CAG CTT ATT TGT ATA GTT CAT and AAA GAG GAG GCG GCC GCA ATG CGT AAA GGA which create Notl restriction sites at both ends of the amplified fragment. pAG408 (Suarez, A., Guttler, A., Stratz, M., Staendner, L.H., Timmis, K.N. and Guzman, CA. (1997) Green fluorescent protein-based reporter systems for genetic analysis of bacteria including monocopy applications. Gene 196, 69- 74) was used as a template. GFP was cloned in the middle of the hrpA gene as described in example 1 and transcript half-life analysis was performed as described in example 1. GFP probe was generated using the oligonucleotides for GFP amplification (above). Again, the amount of protein produced was significantly higher when both the 5' and 3' sequences of hrp A were present than with the 5' prime sequence only. A northern blot is presented in Figure 10. Time points after addition of rifampicin is indicated on the top. Figure 11 presents a graph of the half-life. The calculated half-life was 27 minutes. Example 6

Stabilisation and half-life of heterologous neo transcript

The neo gene cassette was then cloned into the unique Notl restriction site in the hrpAp in the same way as in example 4 (see also example 2), and the half life of the forming fusion transcript was determed in P. syringae pv. tomato DC3000, using the same methodology as in example 1 , with neo probe. Figure 12 presents a graph of the half-life of hrpAp_h. The calculated half-life was 21 minutes.

Claims

1. Method for increasing the stability of nucleic acid transcripts, comprising the step of coupling to a first nucleic acid sequence transcribable to or which itself is an mRNA molecule a second nucleic acid sequence, the transcript of which has a longer half-life than the first one, so that the second nucleic acid sequence flanks the first nucleic acid sequence both at the 3' and 5' end.

2. Method according to claim 1 , wherein said second nucleic acid sequence is a gene participating in encoding the type III secretion system in a pathogenic bacterium, or a functionally equivalent fragment thereof.

3. Method according to claim 2, wherein said second nucleic acid sequence is a hrp gene or a functionally equivalent fragment thereof.

4. Method according to claim 3, wherein said second nucleic acid sequence is the hrp A gene of Pseudomonas syringae pv. tomato DC3000 or a functionally equivalent fragment thereof.

5. Method according to claim 3, wherein said second nucleic acid sequence is the hrpA gene of Pseudomonas syringae pv. phaseolicola or a functionally equivalent fragment thereof.

6. Method according to any of claims 1-5, wherein a promoter is fused to the 5' region of the second nucleic acid sequence, including its transcription initiation site, followed by the first nucleic acid sequence, followed by the 3' region of the second nucleic acid sequence, including the transcription termination signal.

7. Method for increasing the stability of nucleic acid transcripts, utilising a nucleic acid sequence which itself is a transcript or which is transcribed into a transcript having a half-life exceeding 10 minutes.

8. Use of a nucleic acid sequence the mRNA transcript of which has a half-life exceeding 10 minutes for the stabilisation of heterologous nucleic acid sequences.

9. Hybrid nucleic acid molecule comprising a first nucleic acid sequence, transcribable to or which itself is an mRNA molecule, and a second, nucleic acid sequence, the transcript of which has a longer half-life as compared to the first one, so that the second nucleic acid sequence flanks the first nucleic acid sequence both at the 3' and 5' end.

10. Hybrid nucleic acid molecule according to claim 9, further comprising an operably linked promoter.

11. Method for enhancing expression of a selected nucleic acid sequence, comprising (a) coupling to a selected, first nucleic acid sequence transcribable to or which itself is an mRNA molecule a second nucleic acid sequence, the transcript of which has a longer half-life as compared to the first one, so that the second nucleic acid sequence flanks the first nucleic acid sequence both at the 3' and 5' end, (b) transforming a host cell with the nucleic acid molecule constructed in item (a),

(c) culturing the host cell in conditions favoring the expression of said nucleic acid molecule, and

1/15

h AZ

HrpAZ

|— »— rpAzl

Oπiln 6 min 10 16 20 25 min min rain min

B

<Λs^<p ^ << ς^>

2/15

5 10 15 20 25 30 35 40 45 50 55 60 min

FIG. 2

3/15

O u_

o o 4/15

A

B D G H

B A B C D E F G H

5/15

53,66

126 217

163 252

251223 247 285 264235 209290

, GG TCCTGc RGRC C GΑACCGkτTCGC^GGCTGCT cCACCτ GTGAG ACC AGC

229,244, 230 215262,284 249 269

lAsnThrValAlaSerAsiAlaThr euGln ysAsiilleLe LeuGlyThrGlyAspSe 214 ^ 4*

225 219336236 167 224

CCTGTCGϊGGttttGGASTTiGCACAAGCCAAteGCCAGϊ aGAGTCCGACGCCAACGGCGCGAAGCT rLeuSerValAspAlaGlnAla ysAlaSerLysGluSerAspAlaAsnGlyAlaLysLe

232

376 246 . 203 211 258 254

GATCGCGATGCAGGCCCAGGAAACAATGAA MGCaGACCATGGA'cGTGCTCAACGCCAT uIleAlaMetGlnAlaGlnGluThrMetLys ysGlnThr etAspValLeuAsnAlall

210 227 237 48 272 213

378 208 234239 245 287 298288 204248

CC&GGfccGGCAAAGAAGACTCTA IAACS^^ eGlnAlaGlyLysGluAspSerThrAsnLys ysIleSerAlaT rAlaThrAsnAlaLy

268 289 260 270283250 202 350 321

sG ylleSerTyr 375

GAGGTACCCCGAAaTtTϋC

FIG.4C 6/15

FIG. 5A

FIG. 5B

FIG. 5C

7/15

A B C

FIG.6

8/15

FIG. 7 9/15

30 60 90 120

FIG. 8

10/15

CD

11/15

0' 10' 20' 30' 40' 50' 60' 70'

FIG. 10

12/15

FIG. 11

13/15

CM g

LL

o o

|Bu6;s 14/15

GGATCCTGCAAAGACGCT GAACCGIATTCGCAGGCTGCTGCCACCTAGTGAGTACCAAGC ATCACGCTGGTAAATCTTAAGGGGCATCAAATCATGGTCGCATTTGCAGGATTAACCTC

MetValAlaPheAlaGlyLeuThrSe CAAACTCACCAACCTTGGTAACAGCGCCGTTGGCGGTGTCGGCGGCGCATTGCAGGGTGT rLysLeuThrAsnLeuGlyAsnSerAlaValGlyGlyValGlyGlyAlaLeuGlnGlyVa CAACACGGTTGCTTCCAACGCCACTCTTCAGAAAAACATTCTTTTGGGCACCGGCGACAG lAsnThrValAlaSerAsnAlaThr euGlnLysAsnlle euLeuGlyThrGlyAspSe

CCTGTCGGTTGATGCACAAGCCAAGGCCAGTAAAGAGTCCGACGCCAACGGCGCGAAGCT rLeuSerValAspAlaGlnAlaLysAlaSerLysGluSerAspAlaAsnGlyAlaLys e

GATCGCGATGCAGGCCCAGGAAACAATGAAGAAGCAGACCATGGACGTGCTCAACGCCAT uIleAlaMetGlnAlaGlnGluThrMetLysLysGl T rMetAspValLeuAsnAlall

CCAGGCCGGCAAAGAAGACTCTACCAACAAGAAGATCAGTGCCACAGCGACGAACGCTAA eGlnAlaGly ysGluAspSerThrAsnLysLysIleSerAlaThrAlaThrAsnAlaLy

AGGTATCAGTTACTAATTATTTCTGATTGCCCCCTCATCAGAGGGGGCCGCTACCTTGAG sGlylleSerTyr

GAGGTACCCCGAATTC

FIG.13

15 / 15

GATCTGATTT TTTGCAGAGC GCTGGAACCG ATTTAAGGGT CGTTACCACC TATCTGTACC AAGCAATTAC GCTGGTACAG ACCAAGGGGT ATCACGTTAT GAGCATCATA AGTTCTCTGA CTAACGCGGG GCGCGGTGTC GTTAACACAG

TGGGTGGCGC ^' TGCGCAGGGT ATCAACAGCG TCAAGAGCAG CGCCGACCGC AACATTGCAC TGACCAAAAA CACGGGTAGC ACTGACAGTA TCGATGCTAC CCGCTCGAGC ATCAGTAAAG GTGATGCCCC AAGCGCCGAG CTTGACGGCA

CTGCGAACGA AGAGAACGGC CTGCTGCGTG AGACGAGCAT GCTGGCGGGC

TTCGAAGACA AGAAAGAAGC GCTTTCCAAC CAAATCGTTG CGAGCAAGAT CCGGAACTCG GTCGTCCAGT TCTGATTTCT TGAATGCCCC CATCACACAG

AGGGGGCTGC TACTTTGAGG AGGTTGT

FIG. 14