WO2004108897A2 - Banques d'arnsi - Google Patents

Banques d'arnsi Download PDF

Info

Publication number
WO2004108897A2
WO2004108897A2 PCT/US2004/017552 US2004017552W WO2004108897A2 WO 2004108897 A2 WO2004108897 A2 WO 2004108897A2 US 2004017552 W US2004017552 W US 2004017552W WO 2004108897 A2 WO2004108897 A2 WO 2004108897A2
Authority
WO
WIPO (PCT)
Prior art keywords
segment
dna
promoter
sirna
molecule
Prior art date
Application number
PCT/US2004/017552
Other languages
English (en)
Other versions
WO2004108897A3 (fr
Inventor
Christophe Beraud
Amer Mushtaq Mirza
Original Assignee
Cytokinetics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cytokinetics, Inc. filed Critical Cytokinetics, Inc.
Publication of WO2004108897A2 publication Critical patent/WO2004108897A2/fr
Publication of WO2004108897A3 publication Critical patent/WO2004108897A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1086—Preparation or screening of expression libraries, e.g. reporter assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1096—Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/111—Antisense spanning the whole gene, or a large part of it
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00—Production
    • C12N2330/30—Production chemically synthesised
    • C12N2330/31—Libraries, arrays

Definitions

  • the invention resides in the fields of molecular genetics and functional genomics.
  • siRNAs are relatively short, at least partly double stranded, RNA molecules that serve to inhibit expression of a complementary mRNA transcript. It has been proposed that siRNAs act by inducing endonuclease-mediated degradation of a complementary mRNA transcript.
  • siRNAs Principles for design and use of siRNAs generally are described by WO 99/32619, Elbashir, EMBO J. 20, 6877-6888 (2001) and Nykanen et al, Cell 107, 309-321 (2001); WO 01/29058.
  • siRNAs Although siRNAs have shown much promise as agents for suppressing regulation of genes the delivery of an siRNA to a cell presents certain difficulties in view of the double stranded nature of siRNAs and the fact that RNAs are not naturally transcribed in a double stranded fo ⁇ nat.
  • One means of delivery is to prepare siRNAs in vitro and deliver siRNAs directly rather than in the form of DNA encoding an siRNA.
  • such an approach is limited in the intracellular level and persistence of siRNA that can be achieved.
  • siRNAs can also be synthesized within a cell by preparing a vector in which a segment of DNA encoding the siRNA is inserted flanking a pair of promoters that are oriented to drive transcription of the inserted segments in opposite orientations. Transcription from such promoters produces two complementary RNA strands that can subsequently anneal to form the desired dsRNA.
  • DNA segments encoding the strands of the siRNA are separately inserted downstream of a single promoter. In this system, the sense and antisense strands of the siRNA are cotranscribed to generate a single RNA strand that is self- complementary and thus can form dsRNA.
  • a vector for expression of an siRNA comprising providing a first DNA molecule comprising a segment encoding a strand of an siRNA and a loop segment at the 3' end, extending the 3' end of the loop with a polymerase to form a second DNA molecule duplexed with the first DNA molecule, the second DNA molecule encoding the complementary strand of the siRNA, denaturing the duplexed first and second DNA molecules to form a single-stranded DNA molecule comprising the second DNA molecule fused to the 3' end of the first DNA molecule, synthesizing a second strand complementary to the single-stranded DNA molecule forming a double stranded DNA molecule, and cloning at least a fragment of the double stranded molecule into a vector in operable linkage with a promoter whereby transcription of the vector forms a transcript comprising a segment having the siRNA strand sequence, the loop segment or its complement, and the complement
  • the providing step is performed by synthesizing the first DNA molecule using solid-phase synthesis.
  • the first DNA molecule of the providing step is formed by ligation of the loop segment to the 3' end of the segment encoding a strand of an siRNA.
  • Some methods further comprise amplifying the double stranded DNA molecule of the synthesizing step".
  • the primer binding to the primer binding site on the second DNA molecule can further comprise a 5' segment comprising a strand of a type IIs restriction endonuclease recognition site whereby digestion of the double stranded DNA molecule with the type IIs restriction endonuclease removes the complement of the transcription termination segment from the second DNA molecule.
  • the first DNA molecule further comprises the complement of a primer binding site at the 5' end
  • the second DNA molecule comprises the primer binding site at its 3' end
  • the synthesizing step is performed using a primer binding to the primer binding site.
  • the first DNA molecule can further comprise a transcription termination segment optionally within the complement of the primer binding site, and the second DNA molecule can further comprise the complement of the transcription termination segment.
  • the first DNA molecule can also further comprise a strand of a restriction enzyme recognition site optionally within the complement of the primer binding site.
  • the siRNA strand has a random sequence.
  • a plurality of first DNA molecules encoding different siRNA strand sequences are synthesized, each of the different sequences being a random sequence, and the method forms a plurality of vectors encoding different siRNAs.
  • Some methods further comprise transforming the plurality of vectors into a population of cells and identifying which cells develop a change in a property responsive to suppression of expression of a gene by an siRNA.
  • the siRNA strands are a normalized population selected from a random population by hybridization to a nucleic acid library.
  • the nucleic acid library is an mRNA library or a cDNA library.
  • Some methods further comprise contacting the DNA segments encoding the siRNA strands with a nucleic acid library under hybridization conditions, and selecting the DNA segments that hybridize to the nucleic acid library. Some methods further comprise linking the DNA segments that hybridize to the nucleic acid library to the loop segment to provide the plurality of first DNA molecules.
  • members of the library are conjugated to an immobilizable tag and the selecting comprises immobilizing the nucleic acid library to a solid support; contacting the DNA segments with the immobilized nucleic acid library under hybridization conditions; washing the immobilized nucleic acid library to remove unhybridized or weakly hybridized DNA segments; and eluting the hybridized DNA segments.
  • the immobilizable tag is biotin.
  • the washing comprises adding progressively lower salt concentrations of wash buffer to the immobilized nucleic acid library.
  • the salt is NaCl.
  • the providing step comprises providing an RNA molecule comprising a segment encoding the complementary strand of the siRNA strand sequence flanked at its 5' end by an RNA segment having the complement of the loop sequence, and at its 3' end by an RNA segment having the complement of the primer binding site sequence, extending a primer bound to the RNA segment having the complement of the primer binding site sequence with reverse polymerase to generate the first DNA molecule complexed with the RNA molecule, and digesting the RNA molecule to leave the first DNA molecule free of the RNA molecule.
  • each member of the mRNA or cDNA population is linked to an immobilizable tag.
  • the immobilizable tag is biotin.
  • the random nucleic acid library is a library of DNA segments encoding random RNA sequences.
  • the library of DNA segments is linked to an immobilizable tag.
  • the immobilizable tag is biotin.
  • the DNA segments are linked to the immobilizable tag via a nuclease-resistant DNA segment, a disulphide bond, and a nuclease resistant linker.
  • Some methods further comprise contacting hybrids of the DNA segments and mRNA or cDNA population with a single-stranded nuclease to digest unhybridized DNA segments and unhybridized members of the mRNA or cDNA population. Additional methods further comprise subjecting the hybrids to denaturing conditions to separate the DNA segments from the members of the mRNA or cDNA population to which the DNA segments hybridized.
  • Other methods further comprise immobilizing the DNA segments via the immobilizable tag.
  • Some methods further comprise cleaving the disulfide bond to separate the DNA segments from the immobilizable tag.
  • DNA constructs comprising a Pol III promoter; a segment encoding .an RNA molecule; a transcriptional termination segment; and at least one regulatory element, wherein the promoter, the segment encoding an RNA molecule, the termination segment and the at least one regulatory element are in operable linkage such that a stimulus can act via the at least one regulatory element to induce the promoter to initiate transcription of the segment encoding an RNA molecule, transcription being terminated by the transcriptional termination segment.
  • the RNA molecule is an siRNA.
  • the promoter contains a tet operator segment.
  • the promoter is a type III Pol III promoter
  • a tet operator segment is located in the promoter.
  • the tet operator segment is tet 01.
  • the tet operator segment is tet 02.
  • the transcriptional termination segment is a U6 Pol III terminator.
  • RNA expression vectors wherein each vector contains: a Pol III promoter; a segment encoding an RNA molecule, the RNA molecule sequence differing between vectors; a transcriptional termination segment; and at least one regulatory element; wherein the promoter, the segment encoding an RNA molecule, the termination segment and the at least one regulatory element are in operable linkage such that a stimulus can act via the at least one regulatory element to induce the promoter to initiate transcription of the segment encoding an RNA molecule, transcription being terminated by the transcriptional termination segment.
  • each promoter contains a tet operator segment, i some libraries each promoter is a U6 promoter.
  • RNA molecules comprising providing a cell containing a DNA construct comprising a Pol III promoter, a segment encoding an RNA molecule, a transcriptional termination segment, and at least one regulatory element, wherein the promoter, the segment encoding an RNA molecule, the termination segment and the at least one regulatory element are in operable linkage such that a stimulus can act via the at least one regulatory element to induce the promoter to initiate transcription of the segment encoding an RNA molecule, transcription being terminated by the transcriptional termination segment; and providing the stimulus, which acts via the regulatory element to induce the Pol III promoter.
  • the promoter contains a tet operator segment, the cell expresses the tet repressor, and the stimulus is provided by removing tetracycline from the culture media.
  • RNA molecules comprising synthesizing a library of random RNA segments; cloning the segments into a population of DNA constructs containing a Pol III promoter, a segment encoding an RNA molecule, a transcriptional termination segment, and at least one regulatory element, wherein the promoter, the segment encoding an RNA molecule, the termination segment and the at least one regulatory element are in operable linkage such that a stimulus can act via the at least one regulatory element to induce the promoter to initiate transcription of the segment encoding an RNA molecule, transcription being terminated by the transcriptional termination segment; transforming a population of cells with the population of DNA constructs containing the random RNA segments; providing a stimulus that acts via the at least one regulatory element to induce the promoter; and screening or selecting for a desired phenotype.
  • the promoter contains a tet operator segment. In some methods the promoter is the U6 promoter. In some methods the promoter is the U6 promoter and a tet operator segment is located between the proximal sequencing element and the TATA box. Some methods further comprise the steps of recovering a DNA construct from a cell which exhibits the desired phenotype; and sequencing the RNA segment contained in the construct, h some methods the RNA segments are siRNA.
  • Figure 1 shows steps of an exemplary a method of synthesizing a library of siRNA molecules using a cDNA as a starting molecule.
  • Figure 2 shows steps of an exemplary a method of synthesizing a library of siRNA molecules using a cDNA as a starting molecule.
  • Figures 3A-3D show a method of normalizing a siRNA library.
  • Figure 4 shows a construct for expressing a green fluorescent protein gene using an inducible Tet O2 sequence in the promoter.
  • Figures 5A and 5B show cells transfected with an inducible GFP expression vector. Panel A shows fluorescence and panel B shows all cells in the fields of the A panels. [0023] Figure 6 shows relative GFP expression in transfected cells using an inducible promoter.
  • Figure 7 shows a U6 promoter cassette.
  • Figure 8 shows the sequence of an inducible Pol III promoter construct.
  • Figure 9 shows an inducible U6-siRNA cassette construct.
  • Figure 10 shows relative expression of a nucleic acid segment in cells transfected with the construct.
  • Figure 11 shows steps 1-3 of an exemplary method of normalizing an siRNA library.
  • Figure 12 shows steps 4-7 of an exemplary method of normalizing an siRNA library.
  • Figure 13 shows elution of specific oligonucleotides from an immobilized library of nucleic acid described in Example 3.
  • siRNAs have a double stranded region and optionally single stranded overhangs. For such siRNAs, sequence identity between the siRNA and a target sequence in a transcript to be regulated is determined by comparing the double stranded region of the siRNA with the target sequence.
  • the terms “modulating expression” “inhibiting expression” “ and “silencing” refer to the ability of an siRNA to inhibit translation of a gene.
  • siRNA inhibits expression of a transcript or protein if the level of transcript of protein is reduced by at least 10% and preferably to an undetectable extent compared with a control cell or organism in which the siRNA inhibitor is absent.
  • a strand of an siRNA having the same polarity as a transcript is referred to as the sense strand, and the other strand of an siRNA as the antisense strand.
  • a target site is a segment of nucleotides in a polynucleotide to be bound by the siRNA. Not every nucleotide in the target site necessarily matches the siRNA sequence.
  • RNA inhibitor includes the RNA itself and DNA encoding the RNA.
  • patient includes human and other mammalian subjects that receive either prophylactic or therapeutic treatment.
  • naked polynucleotide refers to a polynucleotide not complexed with colloidal materials. Naked polynucleotides are sometimes cloned in a plasmid vector.
  • random includes fully random and partially random segments.
  • compositions or methods "comprising" one or more recited elements may include other elements not specifically recited.
  • a composition that comprises a siRNA expression vector both the siRNA expression vector and transformation reagents or a pharmaceutical carrier may include other elements not specifically recited.
  • a composition that comprises a siRNA expression vector both the siRNA expression vector and transformation reagents or a pharmaceutical carrier may include other elements not specifically recited.
  • designations of one strand of a duplex and its complement are arbitrary and could be reversed.
  • the complement of a primer binding site may itself be a primer binding site
  • the complement of a loop segment is itself a loop segment.
  • the discrete components of the expression vectors are operably linked.
  • “Operably linked” and “in operable linkage” means that the elements cooperatively function to achieve their intended task.
  • a promoter and a segment encoding an siRNA molecule are operably linked if the siRNA construct is transcribed when the promoter is activated.
  • a promoter and a transcription termination segment are operably linked, if transcription of an RNA molecule initiated by the promoter is terminated when the RNA polymerase reaches the termination sequence.
  • sequence element and “segment” may be used interchangeably, and both refer to a nucleic acid molecule of a certain sequence.
  • a tet operator sequence element may also be referred to as a tet operator segment.
  • a "loop segment” can refer to the part of an siRNA molecule that is single stranded and connects the two annealed, complementary regions or alternatively can refer to the region of a DNA molecule that encodes this part of an siRNA molecule.
  • binding site refers to a section of DNA that is recognized and bound by another molecule in a sequence-specific fashion.
  • a primer binding site is a section of nucleic acid that is recognized by a primer nucleic acid molecule, preferably DNA, that anneals to the primer binding site.
  • a restriction site is a section of DNA that is cleaved by a sequence-specific restriction endonuclease enzyme.
  • regulatory element means a DNA segment that is recognized in a sequence-specific fashion by a transcription factor protein.
  • the promoter is either activated or repressed depending on the identity of the transcription factor.
  • the invention provides methods of preparing a vector expressing an siRNA starting from a single template sequence encoding one strand of the siRNA.
  • the strand of siRNA encoded by the template can be random. Methods of the invention are thus suitable for generating large libraries of random siRNAs in which one strand of each siRNA can be synthesized simultaneously in a solid phase synthesis procedure. Libraries of random siRNAs are useful tools for characterizing genes. By expressing random siRNAs in different cells, different genes are inactivated in the different cells. The resulting changes in phenotype can be correlated with the genes inactivated thereby characterizing the gene.
  • the invention also provides methods and constructs for expression of RNA molecules, including siRNA, from various promoters.
  • a preferred expression system comprises an inducible Pol III promoter in operable linkage with DNA encoding the RNA to be expressed and a Pol III termination site.
  • the starting material for the methods is a DNA molecule having at least two components.
  • One component is a segment encoding a strand of the siRNA to be expressed from the vector.
  • the other component is a loop segment at the 3' end.
  • the loop segment can self-anneal to form a hairpin loop.
  • the DNA molecule containing these components is referred to in the claims as the first DNA molecule.
  • the 3' end of the loop segment of the first DNA molecule can be extended by a polymerase using the remainder (i.e., non-self annealed portion) of the first DNA molecule as a template.
  • Klenow or reverse transcriptase are particularly suitable polymerases for performing extension from a self-annealed template. Extension results in synthesis of a second DNA molecule fused to the 3' end of the first DNA molecule.
  • the sequence of the second DNA molecule is complementary to the non-self annealed portion of the first DNA molecule which acted as a template in synthesis of the second DNA molecule.
  • the combined second DNA molecule and first DNA molecule thus have at least the following components from 5' to 3': the segment encoding the strand of the siRNA, the loop segment, and the complement of the strand of the siRNA.
  • the extension of a self-priming DNA molecule encoding one strand of an siRNA thus generates the second strand of the siRNA.
  • the self-priming reaction leaves a duplex of second molecule bound to the complementary portion of the first molecule.
  • the duplex is then denatured to form a single-stranded molecule in which the second DNA molecule remains fused to the 3' end of the first DNA molecule.
  • the denaturation can be effected by raising the temperature above the melting point or uses of denaturing chemical solvents.
  • the single stranded molecule thus has a segment encoding a strand of an siRNA and its complement separated by the loop region.
  • the single-stranded DNA molecule serves as a template for synthesis of a second complementary strand forming a double stranded molecule.
  • the double stranded molecule can be amplified by PCR.
  • second strand synthesis and PCR can be performed together.
  • the resulting molecule is a double-stranded DNA fragment in which one strand comprises the segments encoding a strand of an siRNA and its complement separated by the loop region, and the other strand is complementary to the first strand.
  • the fragment or a subfragment thereof containing the siRNA strand and its complement are then subcloned into an expression vector under control of a promoter.
  • transcript comprising a segment having the siRNA strand sequence and its complement separated by a segment having the complement of sequence of the loop region.
  • the transcript can self- anneal by pairing of the segment having the siRNA strand and its complement forming a double-stranded siRNA in which the two annealed strands are joined by the RNA segment having the loop sequence.
  • the loop region can be cleaved after expression by an endogenous or exogenously supplied RNA cleavage moiety (an endonuclease, e.g., Dicer, or a ribozyme).
  • Fig. 1 shows an exemplary scheme for performing the above method.
  • the first DNA molecule (sscDNA) (1) has the following components from 5' to 3': a strand of a type II restriction endonuclease recognition site (REI), a transcription termination segment (TTS/A5); the complement of a primer binding site (-CPBS) (overlapping the restriction endonuclease site and part of the transcription termination segment), a segment encoding a strand of an siRNA and a loop segment.
  • the first DNA molecule is extended from the 3' end of the annealed loop segment using Klenow. Extension generates a second DNA molecule (C-sscDNA) fused to the 3' end of the first DNA molecule (sscDNA) (2).
  • the components of the second DNA molecule are from 3' to 5': the complementary strand of the type II restriction endonuclease recognition site (CREl), the complement of the transcription termination segment (CTTS/T5), the primer binding site (PBS) (overlapping the complement of the transcription termination segment (c-TTS/T5) and partially overlapping the complementary strand of the type II restriction endonuclease recognition site (CREl), and the complement of the segment encoding the strand of siRNA (C-siRNA).
  • the first and second DNA molecules form a duplex (dscDNA) whose two strands are joined by the loop segment .
  • the duplex (dscDNA) is then denatured to form a single stranded molecule (ssDNA) (3).
  • the components of this single stranded molecule from 5' to 3' are: the restriction endonuclease cleavage site (-RE1), the transcription termination segment (TTS/A5), the complement of the primer binding site (CPBS), the segment encoding the a strand of the siRNA (-siRNA), the loop segment, the segment encoding the complement of the strand of the siRNA (C-siRNA), and the primer binding site (PBS), overlapping the complement of the transcription termination segment (CTTS/T5) and the complementary strand of the type II restriction endonuclease recognition site (REI).
  • the duplex then undergoes second strand synthesis using a primer (4), followed by amplification using a pair of primers (4) and (7).
  • the first primer (4) has a 5' tail comprising a strand of a recognition site for a type IIs restriction endonuclease (RE2).
  • RE2 type IIs restriction endonuclease
  • Amplification generates a double stranded molecule with strands (5) and (6).
  • Strand 6 is the same as single stranded molecule - (ssDNA) (3) other than strand 6 has an additional segment containing a complementary strand to the type IIs restriction endonuclease recognition site (CRE2) at its 3' end.
  • CRE2 type IIs restriction endonuclease recognition site
  • Strand 5 is the strand complementary to the single- stranded DNA molecule (ssDNA) (3), having the following components from 5' to 3' order: the strand of the type IIs restriction endonuclease site (RE2), the strand of the type II restriction endonuclease site (REI), the transcription termination segment (A5/TTS), a segment encoding the siRNA strand (siRNA), the complement of the loop segment of strand Y (C-Loop), a segment encoding the complement of the siRNA strand (C-siRNA), and a primer binding site (PBS) which is bound by a primer (7), containing the complement of the transcription termination segment (CTTS/T5)) and the complementary strand of the type II restriction endonuclease site (CREl).
  • ssDNA single- stranded DNA molecule
  • Amplified molecules containing strands 5 and 6 are then digested with enzymes REI and RE2, REI being a type II and RE2 a type IIs restriction enzyme.
  • the digestion with RE2 is performed first.
  • the enzyme cuts distal from its recognition site as shown by the arrow.
  • the cleavage cuts both strands, thereby removing the REI recognition site and the transcription termination segment (A5) from the 5' end of strand 5.
  • Cleavage by the REI enzyme then cuts both strands at the site shown by the vertical arrow at the right of the figure.
  • the effect of the double digestion is to leave a double stranded molecule having ends generated by the RE2 cleavage at one end and by the REI cleavage at the other end.
  • This double stranded molecule can be directionally cloned into an expression vector (8) having recognition sites for RE2 and REI downstream from a promoter.
  • the transcript (9) comprises from 5' to 3' a strand of the siRNA, the complement of the loop segment, the complement to the strand of the siRNA and a short tail region (UU) formed by partial transcription of the termination segment.
  • UU short tail region
  • the first DNA molecule can be synthesized by solid state synthesis using a DNA synthesizer. Certain positions on the molecule can be randomized by including a pooled mixture of nucleotide for the corresponding coupling cycles. For complete randomization of a position all four natural nucleotides are present; two or three nucleotides can be present for partial randomization.
  • the first DNA molecule can be synthesized by reverse transcription of an RNA precursor (ssRNA), which is in turn made by solid state synthesis.
  • Fig. 2 shows an exemplary scheme for synthesizing the first DNA molecule (ssDNA) from an RNA precursor (ssRNA).
  • RNA precursor (10) has the following components from 5' to 3': a segment encoding the complement of the first DNA molecule loop sequence (C-Loop), a segment encoding the complementary strand of the siRNA strand sequence of the first DNA molecule (C-siRNA), and a primer binding site (PBS) overlapping the complement of a transcription termination segment (CTTS/T5) and a strand complementing the type II restriction endonuclease site of the first DNA molecule (CREl).
  • a DNA primer specific for the primer binding site of the RNA molecule (11) is annealed to the RNA molecule (ssRNA)(10) and extended via a reverse transcription reaction resulting in an RNA:DNA duplex (ssRNA:sscDNA) (13) of the RNA molecule (ssRNA) (10) and the complementary strand (12), the first DNA molecule (sscDNA)(l).
  • the RNA molecule (ssRNA)(13) is digested from the duplex (ssRNA: sscDNA) via RNase H or an enzyme with similar activity, leaving the first DNA molecule (sscDNA) (1) ready for extension and amplification as shown in Fig. 1.
  • An siRNA has a double stranded region and optionally single stranded overhangs at the ends.
  • the double stranded region is preferably between 10-30, 15-25, 17-23, 19-21, or 19-23 nucleotides in length.
  • the double-stranded region is formed by pairing of segments (siRNA) and (C-siRNA) in Fig. 1.
  • Single stranded regions, if present, are preferably 1-5 nucleotides in length.
  • Single stranded overhangs can be introduced by partial transcription of the termination segment and/or asymmetric cleavage of the loop segment or its complement.
  • the siRNA can have defined sequences or can be fully or partially random.
  • siRNAs having defined sequences have one strand (the antisense strand) that is fully or partly complementary to a predetermined target gene of interest.
  • Such siRNAs are used, for example, to suppress expression of the target gene.
  • the sense strands of such siRNAs shows substantial sequence identity (e.g., at least 75, 80, 85, 95 and preferably 100%) to a segment of an RNA transcript sequence of a target gene. Any residues not complementary to the transcript sequence preferably occur in the 5 ' or 3' end of the siRNA.
  • siRNAs having fully random sequences are designed without regard to a particular target gene.
  • each position (with the possible exception of single stranded overhangs) can be occupied by any of the four natural bases. Collections of random siRNAs are used, for example, in functional genomics to identify genes involved in detectable phenotypes of interest.
  • siRNAs having partially random sequences are designed such that at least one position can be occupied by at least two alternative bases.
  • Partially random siRNAs are usually designed without a particular intended target gene sequence, but with a class of target genes, particular target organism or partial target gene sequence in mind.
  • target mammalian cytochrome P450 genes which have been shown to be GC rich in the third position of codons
  • increasing the proportion of G and/or C in the center segment of the first DNA molecule yields siRNAs with a higher likelihood of having affinity for mammalian cytochrome P450 genes.
  • the Plasmodium falciparum genome is particularly AT rich (-80%).
  • partially random siRNAs with a bias toward AT residues are more likely to recognize Plasmodium RNA transcripts than siRNAs having fully random sequences.
  • the first DNA molecule that forms the starting material for synthesis of an siRNA expression vector contains a loop segment at the 3' end.
  • the loop segment or its complement is carried through various intermediates to the final siRNA product.
  • the loop segment comprises a short inverted repeat nucleotidesequence with one or more unpaired bases separating the inverted repeat regions.
  • GAATTCCGCC SEQ ID NO: 13
  • GGCGGAATTC SEQ ID NO: 14
  • the loop segment is capable of self-annealing to a loop, its sequence is not critical.
  • the loop segment can be designed to be GC rich for greater stability.
  • the loop segment can have a GC content of at least 55%, 75%, or 90%, 95%.
  • the loop segment should be sufficiently long to form a stable loop.
  • the loop segment is less than 10, 20 or 50 nucleotides in length. Formation of a loop can be confirmed by conformational gel analysis.
  • the 3' loop segment is designed such that when annealed a cleavage site is present.
  • the cleavage site can be that for a RNA endonuclease or a ribozyme.
  • the RNA endonuclease or ribozyme can be supplied exogenously by introducing a second vector encoding the endonuclease or ribozyme.
  • the endonuclease or ribozyme is optionally under inducible control.
  • the first DNA molecule contains the complement of a primer binding site (CPBS).
  • CPBS primer binding site
  • the complement of the primer binding site serves as a template for generation of a primer site used in second strand synthesis.
  • the complement of the primer binding sites itself serves as a primer binding site in the amplification step of Fig. 1.
  • the length and sequence of the priming site are determined by conventional principles for primer selection.
  • the primer binding site overlaps fully or partially the Type II restriction endonuclease site and the transcription termination segment shown in the sscDNA molecule of Fig. 1.
  • the exemplary scheme shown in Fig. 1 employs two primers that bind to the primer binding site and its complement.
  • one of the primers (Primer A) contains a 5' tail that is not complementary to a template.
  • the tail region contains one strand of a type IIs restriction endonuclease site.
  • Type IIs restriction endonucleases have asymmetric recognition sites that are distinct and usually upstream from their actual cleavage sites. Examples of type IIs restriction endonucleases are Fok I, Bsm Bl, Bsa I, Bsm I, Sap I, Eco 571, Bpm I, and Bsg I..
  • the type IIs endonuclease is chosen such that cleavage occurs between the complement of the transcription te ⁇ nination segment and siRNA segment of DNA molecule X, as shown in Fig. 1.
  • one strand of a transcription termination segment contains a run of about 5 adenine residues (A's) and the other strand a complementary run of about 5 thymidine residues (T's).
  • the run of A's and T's is often immediately preceded (i.e., 5' on the strand containing the T's) with a GC rich region with palindromic symmetry.
  • the run of A's occurs on the transcribed strand, and the GC region is 3' to the A's on the transcribed strand. Transcription usually terminates within the run of A's leaving an RNA ending in one or more uridine (U) residues.
  • the exemplary scheme shown in Fig. 1 shows one way of transferring a DNA molecule encoding both strands of an siRNA to an expression vector.
  • a transcription termination segment is removed from one end of the molecule, and the resulting molecule is transferred into an expression vector by directional cloning such that the end of the DNA molecule lacking a transcription termination segment is closest to the promoter.
  • the transcription termination segment can be left at the left end of molecule Z shown in Fig. 1 and the both ends of the molecule cut with the same restriction enzyme (REI in Fig. 1).
  • the resultant fragment can insert in both orientations with respect to the promoter allowing transcription of both strands.
  • Both prokaryotic and eukaryotic expression vectors such as mammalian, insect, fungal or viral, can be used.
  • the particular expression vector used to transport the genetic information into the cell is selected with regard to the intended use of the siRNA, e.g., expression in plants, animals, bacteria, fungus, protozoa.
  • Elements typically included in the expression vectors include a promoter, an enhancer, an origin of replication, unique restriction sites in nonessential regions of the plasmid to allow insertion of recombinant sequences, and one or more genes encoding selectable markers, e.g., antibiotic resistance, to permit selection of bacteria that harbor recombinant plasmids.
  • a typical expression cassette within a vector contains a promoter operably linked to a downstream nucleic acid sequence encoding the siRNA, and signals required, e.g., for efficient polyadenylation of the transcript. Additional elements of the cassette may include, e.g., enhancers, and heterologous spliced intronic signals.
  • some expression systems have markers for selection of stably transfected cell lines such as neomycin, thymidine kinase, hygromycin B phosophotransferase, and dihydrofolate reductase.
  • Regulatory elements from eukaryotic viruses are often used in eukaryotic expression vectors, e.g., SV40 vectors, papilloma virus vectors, and vectors derived from Epstein-Barr virus.
  • the elements that are typically included in the expression vectors also include a replicon that functions in E. coli, a gene encoding antibiotic resistance to permit selection of bacteria that harbor recombinant plasmids, and unique restriction sites in nonessential regions of the plasmid to allow insertion of recombinant sequences.
  • Suitable bacterial and eukaryotic promoters are described, e.g., in Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd ed. 1989); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); and Current Protocols in Molecular Biology (Ausubel et al, eds., 1994).
  • the promoter used to direct expression of an siRNA nucleic acid depends upon the particular application. Either a constitutive or an inducible promoter is used, depending on the particular use of the clone encoding the siRNA.
  • Exemplary eukaryotic promoters include the CaMV 35 S plant promoter, SV40 early promoter, SV40 late promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedron promoter, or other promoters shown effective for expression in eukaryotic cells.
  • Pol III promoters including U6, HI, and 7SK are of particular use in the methods of the invention.
  • Promotors and optionally other regulatoiy elements used can be selected to restrict expression to distinct cell types. For example thy-1, neural enolase, prion or PDGF promoters may be used to express siRNAs in cells of the central nervous system.
  • the promoter can include elements that are responsive to transactivation, e.g., hypoxia response elements, GA14 response elements, lac repressor response element, and small molecule control systems such as tet-regulated systems, the RU-486 system, ecdysone- regulated systems, and others (see, e.g., Gossen & Bujard, Proc. Nat'lAcad. Sci. USA 89:5547 (1992); Oligino et al., Gene Ther. 5:491-496 (1998); Wang et al., Gene Ther. 4:432- 441 (1997); Neering et al, Blood 88:1147-1155 (1996); and Rendahl et al, Nat. Biotechnol. 16:757-761 (1998)).
  • elements that are responsive to transactivation e.g., hypoxia response elements, GA14 response elements, lac repressor response element, and small molecule control systems such as tet-regulated systems, the
  • Elements of the tet operon which confers tetracycline resistance in E. coli and other gram negative bacteria, have been used to design systems for the regulation of gene expression in a wide variety of eukaryotic cells and organisms. These systems are based upon the strong affinity of the tet repressor protein (TetR) for the tet operator DNA sequences (tetOl, and tetO2) in the absence of tetracycline. This interaction inhibits the expression of the tetR and tetA genes, encoding the tet repressor and tet proteins respectively.
  • TetR tet repressor protein
  • Tet proteins are localized in the bacterial inner membrane and confer tetracycline resistance by catalyzing the efflux of the antibiotic as a complex with a divalent metal ion, such as Mg+2, in an energy dependent exchange for protons. Binding tetracycline induces a conformation change in the TetR protein, reducing its affinity for the tetO binding sites. The reduction of affinity results in the release of the TetR protein from the tet operator sequence, allowing expression of the tet and tet repressor proteins.
  • a divalent metal ion such as Mg+2
  • Tet-regulated systems can be used to control the expression of a variety of genetic constructs, including genes, gene fragments, or siRNAs, upon transfection into a wide variety of eukaryotic cells, including yeast, plant, amphibian, insect, and mammalian cells. As the tet elements are prokaryotic in origin, they have little effect on resident gene expression in target cells or tissue.
  • tet-regulated systems include tet repression systems (Gossen and Bujard, PNAS USA 89:5547 (1992)), tet trans-activator systems (Gossen et al, Science 268:1766 (1995)), tet reversed activator systems (Gossen, Biotechniques, 19:213 (1995)), autoregulatory tet systems (Shockett et al., Proc NatAcad Sci USA 92:6522 (1995)), and tet systems with reduced basal activity (Deutschle et al., Mol Cell. Bio., 15:1907 (1995)).
  • a population of nucleic acids encoding siRNA segments can be normalized to enrich the population for nucleic acids complementary to a nucleic acid library of interest. Enrichment is particularly useful for libraries of random siRNA segments in which most members are not complementary to a natural mRNA. Such an enrichment step reduces or eliminates siRNA segments lacking complementarity to any potential target mRNA. Screening of the enriched libraries increases the proportion of cells transformed with such libraries that undergo phenotypic changes due to siRNA suppression. Nucleic acids encoding siRNAs can be normalized at any stage of the method, but are preferably normalized before other extension or amplification steps are performed.
  • normalization can be performed on nucleic acid segments encoding siRNAs and a hairpin loop region added to the nucleic acid segments surviving enrichment, thus forming the first DNA molecules of the invention.
  • the same normalization strategy can also be used in other methods of screening random nucleic acid sequences.
  • Normalization is performed, for example, by contacting nucleic acid molecules encoding siRNA strands with a nucleic acid library of interest under hybridization conditions. Hybridization generates double-stranded nucleic acid molecules in which nucleic acid segments encoding siRNAs are annealed to complementary sequences of the nucleic acid library of interest. Following hybridization, different methods can be performed to complete the normalization process.
  • single-stranded nucleic acid molecules of the mixture are subjected to enzyme-mediated degradation.
  • the double-stranded molecules surviving degradation can then be denatured via heat or chemical-based methods.
  • the siRNAs encoded by the resulting population of nucleic acid molecules are those capable of specifically binding to nucleotide sequences of the library of interest.
  • the library used for normalization can be a DNA or RNA libraries, including mRNA and cDNA libraries. Libraries can be synthesized or obtained from commercial sources. Libraries of particular interest include species, or tissue, or developmental stage- specific libraries. Libraries from different sources can be combined to obtain a library containing substantially all expressed sequences from a given organism.
  • Figure 3 depicts an exemplary method for normalizing nucleic acids encoding siRNA molecules.
  • the method is performed on a DNA segment encoding a random population of siRNA strands.
  • the DNA segment is linked to other components as shown in Fig. 3.
  • a biotin molecule or other immobilization tag
  • the linker molecule is attached via a cleavable disulfide bond to a segment of nuclease-resistant DNA, which is attached to the 5' end of the DNA segment a random 21-mer siRNA strand (3 A).
  • the molecule is hybridized to an mRNA library of interest resulting in an RNA:DNA hybrid molecule (3B).
  • the mixture is then subjected to single-stranded nucleic acid digestion, e.g., via SI or mung bean nuclease, which degrades unannealed portions of the mRNA molecules and DNA molecules that have failed to hybridize to mRNA (3C).
  • the released DNA can be subject to further rounds of enrichment.
  • the remaining duplexes are heat-denatured and the released DNA molecules of the invention are subjected to capture on a solid support such as streptavidin beads to remove them from the denatured complementary mRNA (3D).
  • the hairpin adaptor (loop segment) can be ligated to the 3' end of the DNA molecule for subsequence formation of the complementary DNA sequence via Klenow enzyme activity.
  • the biotin tag is removed by cleavage of the disulfide bond.
  • the cleavage is performed after other extension and amplification steps.
  • all steps can be performed in solution without use of an immobilizable tag or the disulfide bond.
  • Figures 11-12 depict an alternative method for normalizing nucleic acids encoding siRNA molecules.
  • the nucleic acid library of interest can be from a variety of sources, such as mRNA or cDNA, in single-stranded or double-stranded form, and from one or more cell lines or tissues.
  • a double-stranded library can used in double stranded form, or alternatively can be rendered to a single-stranded form by PCR, primer extension, melting, or other techniques.
  • the nucleic acid library of interest can be used intact, or alternatively can be sheared physically or chemically, or can be digested with DNase I or a similar enzyme to yield smaller, more uniform length, fragments.
  • a nucleic acid library of interest is conjugated with an immobilization tag that specifically binds to another molecule attached to a solid support.
  • a nucleic acid library of interest can be conjugated with biotin.
  • biotin is the conjugate
  • the nucleic acid library of interest is co : incubated with and thus immobilized onto streptavidin-coated particles such as magnetic beads or streptavidin-coated colloidal paramagnetic microbeads, as depicted in Figure 11.
  • the nucleic acid library of interest coated onto particles is then incubated with a randomized oligonucleotide library that is to be normalized.
  • the buffer used for this binding step can be, for example, an array of salt and formamide concentrations, depending on the melting temperatures of the oligonucleotides of interest, to facilitate specific binding of the randomized oligonucleotide library to the immobilized nucleic acid library of interest and to minimize non-specific binding.
  • the mixture of the randomized oligonucleotide library and the immobilized nucleic acid library of interest is denatured and allowed to renature.
  • the denaturation/renaturation process can be performed, for example, by heating the mixture to a temperature sufficient to denature all binding between the nucleic acid library of interest and the immobilized nucleic acid library of interest. Typical temperatures for such denaturation are 50°C, 65°C, 75°C, 85°C, 95°C, and higher. Temperatures above 85°C are preferred when the immobilized nucleic acid library of interest and/or randomized oligonucleotide library is GC-rich, such as for example over 55% GC-rich.
  • the immobilized nucleic acid library of interest and/or randomized oligonucleotide library contains hairpins or other secondary structures.
  • molecules such as formamide and urea can be used to denature the immobilized nucleic acid library of interest and the randomized oligonucleotide library.
  • the immobilized nucleic acid library of interest and randomized oligonucleotide library are allowed to specifically bind.
  • temperature is the method used for denaturation, specific binding is achieved through cooling the mixture.
  • the mixture is allowed to cool slowly, such as less than 1°C per minute until a desired temperature is reached.
  • Slow cooling can be achieved by placing a tube containing the heated mixture in a thermocycler programmed to drop the temperature of the reaction at a pre-programmed rate. Alternatively, slow cooling can be achieved through placing a heated tube containing the mixture at room temperature.
  • specific binding is achieved through decreasing the concentration of the denaturing molecule. The concentration of the denaturing molecule can be decreased through methods such as dilution or dialysis.
  • the bound beads are washed with buffers of progressively decreasing salt concentrations and/or increasing stringency to dissociate and wash away weakly bound or non-specifically bound randomized ohgonucleotides.
  • the bound beads are washed with 300mM and then lOOmM NaCl buffers.
  • randomized ohgonucleotides partially anneal to members of the nucleic acid library of interest but with less affinity than randomized ohgonucleotides that have perfect complementarity with a member of the library.
  • the specifically bound randomized ohgonucleotides are then eluted with a low or no salt buffer, optionally containing formamide.
  • the eluted and normalized randomized ohgonucleotides are then used for subsequent production and cloning of a siRNA library, as described in other sections herein.
  • the end product is that DNA segments encoding different random siRNAs cloned into multiple copies of the same vector.
  • the resulting library can be transformed into a population of cells. Usually only one vector goes into any one cell. Thus, different cells in the population receive vectors with different inserts and express different random siRNAs.
  • the libraries of cells expressing different random siRNAs generated by this approach can have at least 10 6 , 10 8 or 10 8 members.
  • Semi-random libraries can also be constructed that are biased toward targeting particular genes.
  • the random siRNA sequences can be synthesized using a solution of nucleotides that contains the same ratio of GC:AT nucleotides as a host cell that the library will be expressed in. Introducing this type of bias into the semi-random library increases the likelihood that a member of the library targets a transcript in the host cell. For example, the ratio of the frequency of GC:AT base pairs in the human genome is 0.41:0.59.
  • siRNA library constructed in which 20.5% of the nucleotides in the synthesis mixture are G, 20.5% are C, 29.5% are A, and 29.5% are T yields a larger percentage of members of the library that by chance target a human gene than if all nucleotides in the synthesis mixture were present as 25% of the total.
  • siRNAs can be delivered to cells (bacterial, fungal, insect, mammalian) or tissues using methods such as lipofection, microinjection, ballistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, agent-enhanced uptake of DNA, calcium phosphate transfection, polybrene, protoplast fusion, electroporation, plasmid vectors, viral vectors, both episomal and integrative. h general, it is only necessary that the particular genetic engineering procedure used be capable of successfully introducing at least one nucleic acid sequence into the host cell capable of expressing the siRNA or choice.
  • Lipofection, cationic lipo some-mediated transfection techniques are described e.g., in U.S. Patent Nos. 5,049,386, US 4,946,787, and US 4,897,355. Additionally, lipofection reagents, including EasyFector, PrimeFector, GenePorterTM, Lipo feet AMINETM 2000, Lipofectamine PLUSTM, CellFECTIN® are commercially available.
  • DNA or RNA are precipitated to the surface of small (1-4 ⁇ m metal (e.g., gold or tungsten, depending upon the mode of acceleration used) particles.
  • the particles are accelerated by one of several means, including movement through an electric field, explosive charge, or helium gas pulse, to penetrate tissues to a depth of several cell layers.
  • particle guns or “gene guns”
  • biolistic devices such as the Helios Gene Gun from Bio-Rad, and the Accel Gene Delivery Device by Agacetus, Inc., are commercially available.
  • Nucleic acids encoding siRNA can also be delivered using viral vector delivery systems, including DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell.
  • viral vector delivery systems including DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell.
  • RNA or DNA viral based systems for the delivery of nucleic acids encoding randomized siRNAs take advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus.
  • Conventional viral based systems for the delivery of siRNAs could include retroviral, lentiviral, adenoviral, adeno-associated, herpes-simplex virus and TMV-like viral vectors for gene transfer.
  • Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long term expression of the inserted transgene. Additionally
  • Lentiviral vectors are retrovirus vectors that are able to transducer or infect non-dividing cells and typically produce high viral titers. Selection of a retrovirus gene transfer system would therefore depend on the target tissue. Retroviral vectors are comprised of cw-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum cis-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression.
  • Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), murine stem cell virus (MSCV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immuno-deficiency virus (HIV), and combinations thereof (see, e.g Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J Virol. 66:1635-1640 (1992); Sommerfelt et al, Virol. 176:58-59 (1990); Wilson et al, J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224 (1991); PCT/US94/05700).
  • MuLV murine leukemia virus
  • MSCV murine stem cell virus
  • GaLV gibbon ape leukemia virus
  • SIV simian immunodeficiency virus
  • HAV human immuno-
  • Adenoviral based systems are typically used.
  • Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titer and levels of expression have been obtained. This vector can be produced in large quantities in a relatively simple system.
  • Adeno-associated virus (“AAV") vectors are also used to transducer cells with target nucleic acids (see, e.g., West et al, Virology 160:38-47 (1987); U.S. Patent No. 4,797,368; WO 93/24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest.
  • Packaging cells are used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells , which package adenovirus, and ⁇ 2 cells or PA317 cells, which package retrovirus.
  • Viral vectors used in gene therapy are usually generated by producer cell that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host, other viral sequences being replaced by an expression cassette for the protein to be expressed. The missing viral functions are supplied in trans by the packaging cell line. For example, AAV vectors typically only possess ITR sequences from the AAV genome which are required for packaging and integration into the host genome.
  • Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences.
  • the cell line is also infected with adeno virus as a helper.
  • the helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid.
  • the helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by e.g, heat treatment to which adenovirus is more sensitive than AAV.
  • a viral vector is typically modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the viruses outer surface.
  • the ligand is chosen to have affinity for a receptor l ⁇ iown to be present on the cell type of interest.
  • Han et al., Proc. NatAcad. Sci. USA 92:9741-9751 (1995) reported that Moloney murine leukemia virus can be modified to express human heregulin fused to gp70, and the recombinant virus infects certain human breast cancer cells expressing human epidermal growth factor receptor.
  • filamentous phage can be engineered to display antibody fragments (e.g., FAB or Fv) having specific binding affinity for virtually any chosen cellular receptor.
  • FAB fragment-binding protein
  • Fv antibody fragment-binding protein
  • a preferred expression system expresses siRNA molecules from an inducible Pol III promoter.
  • the same expression system can be used for any type of RNA including anti-sense RNA molecules.
  • Use of a Pol III promoter is advantageous in achieving substantially uniform transcriptional termination.
  • Pol III promoters can be made inducible as noted above, and described in further detail below by incorporation of at least one regulatory element into a Pol III promoter.
  • a stimulus can act via the regulatory element to induce the Pol III promoter containing the regulatory element to initiate transcription of an RNA molecule in operable linkage with the promoter. Transcription terminates in a substantially uniform manner at a transcription termination segment.
  • Inducible Pol III promoters thus have the combined properties of substantially uniform termination and inducibility.
  • RNA molecules expressed by Pol III promoters results in more uniform and reproducible phenotypic effects than if each RNA expressed from the construct were of variable length.
  • siRNAs expressed by Pol III promoters achieve more uniform gene silencing effects than when expressed by Pol II promoters due to their uniform length. Inducibility is also advantageous because it allows one to compare the time required for different changes of phenotype resulting from expression of a population of RNAs in different cells.
  • silencing of one gene by an siRNA construct can cause the desired phenotype to arise within 30 minutes of induction while silencing of a different gene by a different siRNA construct can cause the desired phenotype to arise only after several hours or days.
  • Inducibility is also advantageous in analyzing phenotypes that would otherwise be lethal, since the level of induction can be modulated.
  • a tetracycline-inducible library of siRNA constructs can be induced with different levels of tetracycline to allow for identification of constructs that cause a phenotype at one level of induction but are lethal to the host cell at a higher level of induction.
  • the components of a vector containing an inducible Pol III promoter for expressing an siRNA are a Pol III promoter, a segment encoding an siRNA to be expressed, a transcription termination segment and one or more regulatory elements within the Pol III promoter.
  • the segment encoding the RNA molecule to be expressed is positioned between the promoter and transcription termination segment, as depicted in Figure 9.
  • the at least one regulatory element is positioned within the promoter as described in more detail below, and is depicted in Figure 8.
  • the components are not usually linked to one another in nature.
  • an artificial siRNA construct may be placed downstream from an artificially constructed inducible Pol III promoter and upstream of a naturally occurring Pol III terminator segment.
  • Pol III promoters fall into three subtypes, generally l ⁇ iown as type I, type II, and type III Pol III promoters.
  • Type III Pol III promoters have three distinct sequence elements, l ⁇ iown as a distal sequencing element (DSE), a proximal sequencing element (PSE), and a TATA box (see Paule et al., Nucleic Acids Res. Mar 15;28(6):1283-98 (2000)).
  • DSE distal sequencing element
  • PSE proximal sequencing element
  • TATA box see Paule et al., Nucleic Acids Res. Mar 15;28(6):1283-98 (2000).
  • the U6 Pol III promoter has these elements, positioned at approximately -230, -70, and -25, respectively, relative to the start of transcription.
  • Other examples of type III Pol III promoters are HI, and 7SK.
  • Types I and II Pol III promoters have different sets of sequence elements that recruit a different set of transcription factors (see Paule, Id.). Distinct sequence elements in promoters recruit transcriptional activators or repressors that affect the frequency with which the promoter is activated.
  • a "Pol III promoter” means a promoter that recruits RNA Polymerase III to initiate transcription.
  • the term includes naturally occurring type I, type II, or type III Pol III promoters, and variants thereof.
  • the distinct sequence elements of a Pol III promoter are interspersed by spacer DNA.
  • the composition of spacer DNA is not critical. For example, there is significant sequence flexibility that can occur in the intervening nucleotides between the DSE, PSE, and TATA box elements of type III Pol III promoters. Regulatory elements can thus be inserted into spacer DNA without disrupting the capacity of a promoter to initiate transcription.
  • a tet operator segment can be positioned between the PSE and the TATA box of a type III Pol III promoter, as depicted in Figure 8.
  • the promoter is placed in operable linkage with a DNA segment encoding an mRNA molecule, which is in turn followed downstream by and in operable linkage with a termination segment. Binding of the tet repressor to the regulatory element between the PSE and the TATA box effectively blocks transcription initiation.
  • the transcription factor(s) that bind to the PSE such as SNAPc
  • TATA binding protein are unable to interact functionally when the tet repressor is bound to the regulatory element between the two sites.
  • tet Ol sequence is ACTCTATCATTGATAGAGT (SEQ ID NO: 15), whereas the tet 02 sequence is TCCCTATCAGTGATAGAGA (SEQ ID NO: 16).
  • Other regulatory elements that can be placed in a promoter include an ecdysone response element, and a progesterone response element. When placed in a cell that expresses the ecdysone receptor (Ecr) and the product of the ultraspiracle gene (USP), an ecdysone response element recruits Ecr-USP heterodimers that activate transcription.
  • Ecr ecdysone receptor
  • USP ultraspiracle gene
  • Ecr-USP heterodimers only bind DNA and activate transcription when they are bound to the steroid hormone ecdysone. Ecdysone can therefore be used as a stimulus to activate a Pol III promoter containing an ecdysone response element.
  • inducible expression systems see for example Ryding et al, J. Endocrinol. Oct;171(l):l-14 (2001); Harvey et al, Curr. Opin. Chem. Biol. Aug;2(4):512-8 (1998); and Albanese et al., Semin. CellDev. Biol. Apr; 13(2): 129-41 (2002).
  • a progesterone response element can be inserted into a promoter and will impart inducibility to the promoter in the presence of RU-486 and the progesterone receptor, (see Wang et al, Proc. Natl. Acad. Sci. U S A. 1994 Aug 16;91(17):8180-4).
  • Transcription factors can also be fused to other domains such as transcriptional activation or repression domains.
  • the tet repressor gene can also be fused with a gene encoding a transcriptional activator.
  • the resulting chimeric protein binds to tet operator sequences and activates transcription upon binding DNA (see Herr, Cold Spring Harbor Symposia on Quantitative Biology 63, 599-607 (1998); and Wang et al., Proc. Natl. Acad. Sci. USA. 91(17):8180-4 (1994)).
  • the heterologous transcription factor should be present in the cell or in vitro transcription/translation mixture.
  • a cell line that is used for creating a library of constructs inducible by tetracycline can be first transformed with a constitutively expressing tet repressor construct, as described in Example 2.
  • the tet repressor cDNA can be included in the Pol III construct used for expressing siRNA.
  • Any DNA segment can be placed into the construct for expression by the promoter.
  • examples include genes encoding proteins, RNA genes such as snRNA and tRNA, as well as DNA segments or artificial genes, such as those encoding antisense and siRNA molecules.
  • the discrete length of the expressed RNA molecules results from the utilization of Pol III transcriptional terminators. RNA Pol III terminates transcription after the second or third thymine upon encountering a stretch of four or more thymine nucleotides surrounded by a GC-rich nucleotide context.
  • RNA molecules expressed by the construct has a discrete size. For example, a 100 base pair siRNA molecule expressed using a Pol III promoter and Pol III termination segment is generated almost exclusively as 100 and 101 nucleotide RNA molecules if the second thymine in the terminator sequence is nucleotide number 100.
  • a variety of transcriptional terminator sequences can be placed in the construct, such as the U6 terminator.
  • U6 terminator For descriptions of other Pol III terminator sequences, see Gunnery et al., JMolBiol. Feb 26;286(3):745-57 (1999) and Chu et al., JMol Biol. Feb 26;286(3):745-57 (1999).
  • RNA molecules transcribed by a Pol II promoter is more heterogeneous in length because Pol II recognizes polyadenylation signals as a means of terminating transcription. Once Pol II recognizes a polyadenylation signal, it terminates transcription and allows polyA polymerase to add adenine ribonucleotides to the 3' end of the transcript. Anywhere from 10 to over 200 adenine ribonucleotides are added to each Pol II- generated transcript.
  • polyA polymerase adds adenine ribonucleotides without any complementary template to read from, and because the cofactor polyA-binding protein (PABP) variably influences the ultimate length of the transcript, polyA polymerase adds a different number of adenine ribonucleotides to transcripts expressed from the same physical piece of DNA.
  • PABP cofactor polyA-binding protein
  • DNA encoding siRNAs are usually transformed directly into cells, it is possible to express DNA encoding siRNAs in vitro, isolate the siRNA expression products, and then insert the siRNA molecules into cells. Insertion of siRNA molecules into cells can be accomplished using techniques such as lipofection, electroporation,a nd microinjection. siRNAs can be transformed using many of the techniques applicable to DNA encoding an siRNA. The siRNA molecules inserted into cells using these methods can be synthesized in vitro, for example, using a Pol III promoter-Pol III terminator expression vector.
  • siRNA expression vectors produced by the methods of the invention have a wide variety of uses including research, diagnostic and therapeutic applications.
  • siRNAs produced by methods of the invention can be used to characterize gene function by determining a property resulting from suppression or silencing of a gene.
  • the property can be a phenotype detectable by visualization of the cell or a molecular change detectable by molecular analysis of a cell extract.
  • Phenotypes that can be correlated with gene silencing or suppression include changes in level of protein(s) or mRNAs, proliferation rates of transformed cells vs.
  • apoptosis assays e.g., DNA laddering and cell death, expression of genes involved in apoptosis
  • signal transduction assays e.g., changes in intracellular calcium, cAMP, cGMP, IP3, changes in hormone or neurotransmitter release
  • receptor assays e.g., estrogen receptor and cell growth
  • growth factor assays e.g., EPO, hypoxia and erythrocyte colony forming unit assays
  • enzyme production assays e.g., FAD -2 induced oil desaturation and respiration assays, pathogen resistance assays, e.g., insect, bacterial, parasite, and viral resistance assays
  • chemical production assays e.g., penicillin production, transcription assays, e.g., reporter gene assays
  • protein production assays e.
  • the genes responsible for a desired property can be determined by a subtractive hybridization technique.
  • Cells transformed with an siRNA library are screened for the desired property.
  • cDNA libraries are made from those transformed cells having the desired property These libraries are used as drivers to subtract complementary DNA from cDNA libraries prepared from untransformed cells. The remaining DNA is enriched for cDNAs whose lack of expression is associated with the desired property.
  • These cDNAs can be sequenced and analyzed by standard molecular biology techniques.
  • siRNA encoding siRNA from clonal isolates of cells having the desired property.
  • the siRNA encoding region of such vectors is sequenced.
  • the sequence is then compared with genomic sequences in a database to identify genes that might be regulated by the siRNA.
  • the lack of expression of these genes is then associated with the desired property.
  • the sequence of the siRNA can also be used to design probes or primers to screen a cDNA or genomic library for complementary DNA segments. Suppression of expression of these DNA segments is also associated with the desired property.
  • DNA probe arrays and associated materials for this purposes are commercially available from Affymetrix among others.
  • This approach detects both mRNAs whose expression is suppressed by an siRNA and mRNAs whose expression levels changes (either up or down) responsive to suppression of other mRNAs.
  • the differentially expressed mRNAs identified by this analysis are associated with the desired property, hi the case of mRNAs expressed at lower levels in transformed cells with the desired property than control cells, then lack of expression of the mRNA correlates with the desired property.
  • the procedure used to identify cells having a desired property depends on the nature of the desired property. If the property is presence or absence of a cell surface antigen, the property can be detected uses conventional immunological binding assays, such as ELISA. If the property is cell proliferation rate, cells with the desired property can be identified using tritiated thymidine or tritiated 5-bromo-deoxyuridine incorporation. Other properties, such as resistance to a drug, or lack of dependence on a nutritional supplement can be selected by propagating transformed cells in the presence of the drug or absence of the nutritional supplement. Other properties, such as cell morphology or anchorage dependence can be detected by visual or miscroscopic observation.
  • an inducible Pol III promoter is advantageous for gene identification assays.
  • a population of cells can be transformed with a library of random siRNA sequences cloned into inducible Pol III expression constructs.
  • the integration of the random siRNA library construction and the inducible Pol III promoter construction creates random siRNA libraries that are simultaneously induced in individually isolated cell transformants.
  • a random siRNA library cloned into inducible Pol III expression vectors can be transformed into a population of cells.
  • a selectable marker in the vector allows colonies that have retained the construct to be picked and arrayed into multi-well plates.
  • Each well contains a clonal population of cells containing an expression vector that can inducibly express a randomly generated siRNA sequence.
  • An exogenous stimulus is added to the cells to stimulate transcription of the siRNA vectors, such as tetracycline.
  • a desired phenotype is screened or selected for by comparing each independent transformant colony to each other and to control cells.
  • siRNAs produced using the methods of the invention also have therapeutic applications, particularly in the area of gene therapy.
  • An expression vector encoding an siRNA can be used to prevent the translation of genes causing undesirable or deadly conditions such as viral infections, malignancies, or dominant inherited diseases.
  • the siRNA typically as a defined sequence chosen to be complementary to a particular target gene to be suppressed.
  • bone marrow cells from an HTV-infected individual can be collected and transformed with one or more siRNA expression vectors, thereby producing one or more HIV virus-specific siRNAs.
  • the transformed bone marrow cells, now "educated” to destroy HIV mRNA transcripts, are then reintroduced to the patient's bone marrow where they can replicate, forming a cell population capable of protecting against HTV.
  • Other viruses that can be attacked using this approach include hepatitis, herpes and human papilloma viruses.
  • siRNAs are designed to suppress expression of mutant oncogenes without affecting expression of a wildtype allele. Transformation with expression vectors encoding such siRNAs is useful for suppressing cancers caused by expression of the mutant oncogene.
  • siRNAs from an inducible Pol III promoter is advantageous for clinical applications.
  • Inducible Pol III promoters can be cloned into gene therapy vectors. Such vectors produce siRNA molecules only when induced and only of a specifically designed size. This reduces a source of clinical variability based on transcriptional differences between cells of the same type in different patients and different cell types in the same patient. It also reduces heterogeneity of siRNAs expressed from the same vector.
  • siRNAs can be designed to suppression expression of dominant inherited diseases.
  • dominant inherited diseases are achondroplasia, Alagille syndrome, Alzheimer disease (AD), amyotrophic lateral sclerosis (ALS), BRCA1 and BRCA2 hereditary breast/ovarian cancer, familial idiopathic basal ganglia calcification (FIBGC), branchiootorenal (BOR) syndrome, cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL), Charcot-Marie-tooth neuropathies types 1 and 2(CMT types 1 and 2), congenital contractural arachnodactyly (CCA), craniosynostosis syndromes (FGFR-Related), DRPLA, GTP cyclohydrolase 1 (GTPCH1)- deficient Dopa-responsive dystonia (DRD), early-onset primary dystonia (DYT1), facioscapulohumeral muscular dyst
  • DRD
  • genetic libraries are synthesized to induce expression of other molecules such as a diverse set of mR ⁇ A molecules.
  • Use of inducible Pol III promoters and Pol III transcriptional te ⁇ riinators allows for each mR ⁇ A to have an identical 3' untranslated region and eliminates differential phenotypic effects based on transcript stability arising from different lengths of 3' untranslated regions.
  • Antisense molecules can be expressed in a similar manner to siRNAs. Once colonies transformed with antisense R ⁇ As have been identified as having a desired phenotype, the vector encoding the gene or artificial construct that causes the desired phenotype can be isolated and sequenced as described above.
  • Quantitative PCR was used to determine the relative expression of GFP in HeLa cells with and without tetracycline added. Two sets of cells were transfected with the CMV- GFP construct. One set also expresses the tet repressor (HeLa::TR) while the other set does not (HeLa), as depicted in Figure 6. Cells cultured in the absence of tetracycline (-T) or with tetracycline (+T) are indicated. C3 denotes those cells transfected with a control vector from which GFP is expressed under the control of a pol II promoter (CMV).
  • CMV pol II promoter
  • TOeGFP denotes those cells transfected with a GFP-expressing vector where GFP is expressed under the control of a tet-repressible pol II promoter (CMV-TO).
  • CMV-TO tet-repressible pol II promoter
  • An inducible Pol III - siRNA expression vector system was constructed to demonstrate inducible expression of RNA molecules from Pol III promoters with a downstream Pol III terminator.
  • the construct was designed as a portable cassette which can be cloned, for example, with restriction sites or by Gateway recombination when flanked by the appropriate sites, into any vector of interest.
  • the cassette can be moved into the appropriate vector for either transient transfection, or retrovirus, lentivirus, or adenovirus infection. Due to its portable nature, it is not limited to these vector platforms.
  • the cassette was constructed in pBluescript II SK by PCR cloning with primers specific for the U6, HI, and 7SK Pol III promoters.
  • PCR primers of SEQ ID NO: 1 and SEQ ID NO: 2 were used to amplify the human U6 promoter from a preparation of HeLa cell genomic DNA.
  • the PCR product was gel purified, digested with BamHI and PSTI, and cloned into pBluescript II SK cut with BamHI and PSTI.
  • the sequence of the cloned U6 promoter PCR product is SEQ ID NO: 3.
  • HI, and 7SK Pol III promoters were cloned in a similar manner.
  • the resulting vpBluescript II SK-U6 vector was cut with PSTI and Xhol.
  • the ohgonucleotides of SEQ ID NOs: 4 and 5 were annealed, digested with PSTI and Xhol, and the products gel purified and ligated with PSTI/XhoI-cut pBluescript II SK-U6 vector to yield the constitutive U6 cassette, depicted in Figure 7.
  • the cassette can be subcloned using BamHI and Xhol into any desired vector.
  • Digestion with the appropriate restriction enzyme allows directional cloning of an adapted hairpin oligo to allow directional cloning of a 3'-TT overhang.
  • the synthetic hairpin sequences can be:
  • the two oligos are annealed and cloned into the Pstl and BseRl digested U6 vector. Following introduction of the cassette into cells either alone or using an appropriate vector transcription of the following hairpin with a TT-3' overhang results:
  • the constitutive U6 cassette was rendered inducible by performing site directed mutagenesis between the TATA box and the PSE to introduce tetracycline operator sites (tetOl or tetO2), as depicted in Figures 8 and 9.
  • Figure 8 depicts the placement of the tet Ol and tet O2 segments between the PSE and TATA box.
  • a desired siRNA sequence can be cloned into the restriction sites such that the U6 promoter is upstream of the siRNA sequence and the U6 terminator is downstream of the siRNA sequence.
  • a randomized siRNA library can be cloned into the U6 siRNA cassette.
  • FIG. 9 is a schematic depiction of a tet-inducible U6-siRNA expression vector.
  • RNA segment is referred to as K2X, see SEQ ID NO: 8.
  • TO1K2X represents those cells transfected with a vector carrying the tet-inducible U6-siRNA expression vector with a tet Ol segment in the promoter (described above).
  • TO2K2X represents those cells transfected with a vector carrying the Tet-inducible U6- siRNA expression vector with a Tet O2 segment in the promoter (also described above).
  • the primers used in the quantitative PCR are SEQ ID NOs: 9 and 10, corresponding to sense and antisense primers, respectively, that amplify K2X.
  • the quantitative PCR of the K2X sequence was performed using the Taqman ® method, with SEQ JJD NO: 11 as the dual labeled probe. Methods of quantitative PCR using the Taqman ® methods are well known. For examples, see Ryu et al., MicrobiolImmunol.;47(10):693-9 (2003) and Perelygina et al, J Virol Methods. ;109(2):245-51 (2003).
  • the data indicate that the K2X segment is inducibly expressed in cells carrying the tet Ol and tet O2 inducible U6-siRNA expression vector containing the K2X segment.
  • Lanes 1-6 of Figure 10 correspond to HeLa cells expressing a tet repressor cDNA, while lanes 7-12 correspond to HeLa cells not transfected with a tet repressor cDNA vector.
  • Lanes 1-2 and 7- 8 are controls not containing the K2X segment.
  • Lanes 3-4 demonstrate that the K2X segment, cloned into a tet Ol -modulated vector (SEQ ID NO: 6) is expressed at a 2.7-fold higher level upon addition of tetracycline to the cells than cells in the absence of tetracycline.
  • Lanes 5-6 demonstrate that the K2X segment, cloned into a tet O2-modulated vector (SEQ ID NO: 7) is expressed at a 4.1-fold higher level upon addition of tetracycline to the cells than cells in the absence of tetracycline. The data indicated that tet O2 is able to more tightly repress the expression of the K2X segment than tet Ol.
  • a circular single-stranded library of known content was created by digestion of a plasmid of l ⁇ iown sequence. This was accomplished by digestion of the circular single- stranded plasmid with 50 mU of DNase I for 30 minutes at 37°C. The library was digested such that the majority of DNA fragments were below 500 bases in length as determined by gel electrophoresis on a 2% agarose gel. The resulting DNA was fractionated to remove the majority of fragments below 40 nucleotides in length.
  • This linearized single-stranded DNA library of l ⁇ iown sequence was end-labeled with biotin using terminal transferase (Roche).
  • biotinylated single-stranded DNA library was immobilized onto streptavidin coated paramagnetic microbeads.
  • Non-biotinylated single-stranded DNA was removed by suspending the beads in a microcolumn exposed to a magnetic field and washing away unbound material with lOmM Tris, lmM EDTA, pH 7.4.
  • the first pool was designed to hybridize to the single-stranded DNA library. This pool contained 21mer and 35mer ohgonucleotides that are 100%) complementary to sequences within the library.
  • the second pool was designed to not hybridize to the single-stranded DNA library. This pool contained 30mer and 25mer ohgonucleotides that do not have complementarity to any sequence contained within the library.
  • a 41mer oligonucleotide was also designed that contained a stretch of 21 nucleotides at the 3 '-end that have 100% identity to a sequence within the library; however, the 20 nucleotides at the 5 '-end do not have sequence identity to the library.
  • the library on paramagnetic microbeads was immobilized on a microcolumn exposed to a magnetic field and was washed three times with one volume (lOOuL) of lOmM Tris, lmM EDTA, pH 7.4.
  • a 12% polyacrylamide/urea gel was used to visualize the ohgonucleotides eluted from the microcolumn. The results of the experiment are shown in figure 13.
  • Lane A is a control showing the migration pattern and quantity of the five ohgonucleotides described above.
  • the column was then washed three times with 300mM NaCl, lOmM Tris, lmM EDTA, pH 7.4, followed by three washes with a higher stringency buffer containing lOOmM NaCl, lOmM Tris, lmM EDTA, pH 7.4 to remove non-specifically bound ohgonucleotides.
  • a gradient of decreasing stringency buffer can be applied to the immobilized nucleic acid library.
  • the column was eluted with elution buffer (10% formamide, lOmM Tris, lmM EDTA, pH 7.4) and heated to 70°C.
  • Lane C contains the three specific 21, 35, and 41mer sequences.
  • the migration of these ohgonucleotides is not directly parallel with the markers in lane A because the gel exhibited a "smile" pattern due to heat/salt conditions.
  • the column was further eluted with three more volumes of elution buffer heated to 70°C. The eluent was collected and run on Lane D.
  • SEQ ID NO: 1 (ck2089) 5 'GAATTCGGATCCAAGGTCGGGCAGGAAGAGGGCCTA-3 '
  • SEQ ID NO: 2 (ck2090) 5 'AGGCCTAAGCTTCTGCAGTTTCCACAAGATATATAAAG-3 '
  • SEQ ID NO: 9 CACATTTCGGAGACATCCAAGAG
  • SEQ ID NO: 10 GAGGTGGATCCGCTTGTCA
  • SEQ ID NO: 11 TCTACGCGGCGATCCAGCGC
  • SEQ ID NO: 12 GAATTCCGCCTGGCGGAATTC

Abstract

La présente invention porte sur des méthodes permettant d'exprimer un ARNsi à partir d'une seule matrice codant un brin de l'ARNsi. Ces méthodes conviennent particulièrement à la génération d'importantes banques d'ARNsi aléatoires dans lesquels un brin de chaque ARNsi peut être synthétisé simultanément selon une procédure de synthèse en phase solide. Cette invention concerne également des méthodes visant à normaliser les banques d'ARNsi à enrichir pour les ARNsi d'intérêt ainsi que des méthodes permettant d'exprimer ces ARNsi.
PCT/US2004/017552 2003-06-02 2004-06-02 Banques d'arnsi WO2004108897A2 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US47557603P 2003-06-02 2003-06-02
US60/475,576 2003-06-02
US52004403P 2003-11-13 2003-11-13
US60/520,044 2003-11-13

Publications (2)

Publication Number Publication Date
WO2004108897A2 true WO2004108897A2 (fr) 2004-12-16
WO2004108897A3 WO2004108897A3 (fr) 2006-05-26

Family

ID=33514056

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/017552 WO2004108897A2 (fr) 2003-06-02 2004-06-02 Banques d'arnsi

Country Status (1)

Country Link
WO (1) WO2004108897A2 (fr)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005059157A2 (fr) * 2003-12-11 2005-06-30 The Board Of Trustees Of The Leland Stanford Junior University Procedes et compositions destines a la preparation d'arn en epingle a cheveux
EP1687323A2 (fr) * 2003-08-08 2006-08-09 Invitrogen Corporation Methodes et compositions pour clonage direct de molecules d'acides nucleiques
EP2002037A2 (fr) * 2006-03-07 2008-12-17 The Trustees of the University of Pennsylvania BANQUES D'ARNi ALÉATOIRES, LEURS PROCÉDÉS DE GÉNÉRATION, ET PROCÉDÉS DE CRIBLAGE LES METTANT EN OEUVRE
WO2011030312A1 (fr) 2009-09-10 2011-03-17 Institut National De La Sante Et De La Recherche Medicale (Inserm) Nouveaux inhibiteurs de stearoyl-coa-desaturase-1 et leurs utilisations
WO2011100752A3 (fr) * 2010-02-15 2011-11-17 Cascade Biosystems, Inc. Procédés et matériaux pour l'évaluation de l'expression d'arn
WO2011100749A3 (fr) * 2010-02-15 2011-11-17 Cascade Biosystems, Inc. Procédés et matériaux de détection d'infections virales ou microbiennes
US8278048B2 (en) 2008-08-15 2012-10-02 Cascade Biosystems, Inc. Detecting nucleic acid
US8551701B2 (en) 2010-02-15 2013-10-08 Cascade Biosystems, Inc. Methods and materials for detecting genetic or epigenetic elements
US8623616B2 (en) 2010-02-15 2014-01-07 Cascade Biosystems, Inc. Methods and materials for detecting contaminated food products
WO2015148582A1 (fr) * 2014-03-25 2015-10-01 Arcturus Therapeutics, Inc. Oligomères d'una sélectifs d'allèle de transthyrétine, pour inactivation génique
AU2014202015B2 (en) * 2006-03-07 2016-06-02 The Trustees Of The University Of Pennsylvania Random RNAi libraries, methods of generating same, and screening methods utilizing same
US9856475B2 (en) 2014-03-25 2018-01-02 Arcturus Therapeutics, Inc. Formulations for treating amyloidosis
US10421964B2 (en) 2015-07-23 2019-09-24 Arcturus Therapeutics, Inc. UNA oligomers and compositions for treating amyloidosis
US10519447B2 (en) 2015-04-01 2019-12-31 Arcturus Therapeutics, Inc. Therapeutic UNA oligomers and uses thereof
US10683500B2 (en) 2014-03-25 2020-06-16 Arcturus Therapeutics, Inc. UNA oligomers having reduced off-target effects in gene silencing

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2007512838A (ja) 2003-12-01 2007-05-24 インヴィトロジェン コーポレーション 組換え部位を含む核酸分子およびその使用方法

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030059944A1 (en) * 2001-09-13 2003-03-27 Carlos Lois-Caballe Method for expression of small antiviral RNA molecules within a cell
US20040115815A1 (en) * 2002-07-24 2004-06-17 Immusol, Inc. Single promoter system for making siRNA expression cassettes and expression libraries using a polymerase primer hairpin linker

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030059944A1 (en) * 2001-09-13 2003-03-27 Carlos Lois-Caballe Method for expression of small antiviral RNA molecules within a cell
US20040115815A1 (en) * 2002-07-24 2004-06-17 Immusol, Inc. Single promoter system for making siRNA expression cassettes and expression libraries using a polymerase primer hairpin linker

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
MCREYNOLDS ET AL J BIOL CHEM. vol. 252, no. 6, 1977, pages 1840 - 1843 *
ROUGEON ET AL J BIOL CHEM. vol. 252, no. 7, 1977, pages 2209 - 2217 *
ROUGEON ET AL PNAS. USA. vol. 73, 1976, pages 3418 - 3422 *
SALZMAN ET AL J VIROLOGY. vol. 30, no. 3, 1979, pages 946 - 950 *
SEN ET AL NATURE GENOMICS. vol. 36, February 2004, pages 183 - 189, XP002323763 *
UHLMANN. GENE. vol. 71, 1988, pages 29 - 40, XP000941756 *

Cited By (47)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1687323A4 (fr) * 2003-08-08 2009-08-12 Life Technologies Corp Methodes et compositions pour clonage direct de molecules d'acides nucleiques
EP1687323A2 (fr) * 2003-08-08 2006-08-09 Invitrogen Corporation Methodes et compositions pour clonage direct de molecules d'acides nucleiques
WO2005059157A3 (fr) * 2003-12-11 2006-04-27 Univ Leland Stanford Junior Procedes et compositions destines a la preparation d'arn en epingle a cheveux
WO2005059157A2 (fr) * 2003-12-11 2005-06-30 The Board Of Trustees Of The Leland Stanford Junior University Procedes et compositions destines a la preparation d'arn en epingle a cheveux
US9982256B2 (en) 2006-03-07 2018-05-29 The Trustees Of The University Of Pennsylvania Random RNAi libraries, methods of generating same, and screening methods utilizing same
AU2007223980B2 (en) * 2006-03-07 2014-01-09 The Trustees Of The University Of Pennsylvania Random RNAi libraries, methods of generating same, and screening methods utilizing same
EP2002037A4 (fr) * 2006-03-07 2010-03-10 Univ Pennsylvania BANQUES D'ARNi ALÉATOIRES, LEURS PROCÉDÉS DE GÉNÉRATION, ET PROCÉDÉS DE CRIBLAGE LES METTANT EN OEUVRE
JP2015212310A (ja) * 2006-03-07 2015-11-26 ザ トラスティーズ オブ ザ ユニバーシティ オブ ペンシルバニア ランダムＲＮＡｉライブラリ、その生成方法、及びそれを使用したスクリーニング方法
US9163231B2 (en) 2006-03-07 2015-10-20 The Trustees Of The University Of Pennsylvania Random RNAi libraries, methods of generating same, and screening methods utilizing same
AU2014202015B2 (en) * 2006-03-07 2016-06-02 The Trustees Of The University Of Pennsylvania Random RNAi libraries, methods of generating same, and screening methods utilizing same
JP2009528840A (ja) * 2006-03-07 2009-08-13 ザ・トラスティーズ・オブ・ザ・ユニバーシティ・オブ・ペンシルバニア ランダムＲＮＡｉライブラリ、その生成方法、及びそれを使用したスクリーニング方法
EP2543738A3 (fr) * 2006-03-07 2013-04-24 The Trustees Of The University Of Pennsylvania Bibliothèques ARNi aléatoires, leurs procédés de génération et procédés de criblage les utilisant
JP2013090634A (ja) * 2006-03-07 2013-05-16 Trustees Of The Univ Of Pennsylvania ランダムＲＮＡｉライブラリ、その生成方法、及びそれを使用したスクリーニング方法
EP2002037A2 (fr) * 2006-03-07 2008-12-17 The Trustees of the University of Pennsylvania BANQUES D'ARNi ALÉATOIRES, LEURS PROCÉDÉS DE GÉNÉRATION, ET PROCÉDÉS DE CRIBLAGE LES METTANT EN OEUVRE
US9677120B2 (en) 2008-08-15 2017-06-13 Cascade Biosystems, Inc. Detecting nucleic acid
US8278048B2 (en) 2008-08-15 2012-10-02 Cascade Biosystems, Inc. Detecting nucleic acid
US8865407B2 (en) 2008-08-15 2014-10-21 Cascade Biosystems, Inc. Detecting nucleic acid
US11254970B2 (en) 2008-08-15 2022-02-22 Cascade Biosystems, Inc. Detecting nucleic acid
US8632974B2 (en) 2008-08-15 2014-01-21 Cascade Biosystems, Inc. Detecting nucleic acid
US10619193B2 (en) 2008-08-15 2020-04-14 Cascade Biosystems, Inc. Detecting nucleic acid
WO2011030312A1 (fr) 2009-09-10 2011-03-17 Institut National De La Sante Et De La Recherche Medicale (Inserm) Nouveaux inhibiteurs de stearoyl-coa-desaturase-1 et leurs utilisations
US8597886B2 (en) 2010-02-15 2013-12-03 Cascade Biosystems, Inc. Methods and materials for detecting viral or microbial infections
US10113204B2 (en) 2010-02-15 2018-10-30 Cascade Biosystems, Inc. Methods and materials for detecting viral or microbial infections
US9150921B2 (en) 2010-02-15 2015-10-06 Cascade Biosystems, Inc. Methods and materials for detecting genetic or epigenetic elements
US9150935B2 (en) 2010-02-15 2015-10-06 Cascade Biosystems, Inc. Methods and materials for detecting viral or microbial infections
US11254969B2 (en) 2010-02-15 2022-02-22 Cascade Biosystems, Inc. Methods and materials for assessing RNA expression
US8623616B2 (en) 2010-02-15 2014-01-07 Cascade Biosystems, Inc. Methods and materials for detecting contaminated food products
US9399802B2 (en) 2010-02-15 2016-07-26 Cascade Biosystems, Inc. Methods and materials for detecting contaminated food products
US9428814B2 (en) 2010-02-15 2016-08-30 Cascade Biosystems, Inc. Methods and materials for detecting viral or microbial infections
US8551701B2 (en) 2010-02-15 2013-10-08 Cascade Biosystems, Inc. Methods and materials for detecting genetic or epigenetic elements
US9689037B2 (en) 2010-02-15 2017-06-27 Cascade Biosystems, Inc. Methods and materials for detecting genetic or epigenetic elements
WO2011100752A3 (fr) * 2010-02-15 2011-11-17 Cascade Biosystems, Inc. Procédés et matériaux pour l'évaluation de l'expression d'arn
US10968483B2 (en) 2010-02-15 2021-04-06 Cascade Biosystems, Inc. Methods and materials for detecting genetic or epigenetic elements
US8470533B2 (en) 2010-02-15 2013-06-25 Cascade Biosystems, Inc. Methods and materials for assessing RNA expression
US9150932B2 (en) 2010-02-15 2015-10-06 Cascade Biosystems, Inc. Methods and materials for detecting contaminated food products
US10167521B2 (en) 2010-02-15 2019-01-01 Cascade Biosystems, Inc. Methods and materials for detecting contaminated food products
US10329619B2 (en) 2010-02-15 2019-06-25 Cascade Biosystems, Inc. Methods and materials for detecting genetic or epigenetic elements
US10927421B2 (en) 2010-02-15 2021-02-23 Cascade Biosystems, Inc. Methods and materials for detecting contaminated food products
US10927420B2 (en) 2010-02-15 2021-02-23 Cascade Biosystems, Inc. Methods and materials for detecting viral or microbial infections
WO2011100749A3 (fr) * 2010-02-15 2011-11-17 Cascade Biosystems, Inc. Procédés et matériaux de détection d'infections virales ou microbiennes
US10604758B2 (en) 2014-03-25 2020-03-31 Arcturus Therapeutics, Inc. Therapeutic oligomers for treating amyloidosis
US10683500B2 (en) 2014-03-25 2020-06-16 Arcturus Therapeutics, Inc. UNA oligomers having reduced off-target effects in gene silencing
US9982259B2 (en) 2014-03-25 2018-05-29 Arcturus Therapeutics, Inc. Transthyretin allele selective UNA oligomers for gene silencing
US9856475B2 (en) 2014-03-25 2018-01-02 Arcturus Therapeutics, Inc. Formulations for treating amyloidosis
WO2015148582A1 (fr) * 2014-03-25 2015-10-01 Arcturus Therapeutics, Inc. Oligomères d'una sélectifs d'allèle de transthyrétine, pour inactivation génique
US10519447B2 (en) 2015-04-01 2019-12-31 Arcturus Therapeutics, Inc. Therapeutic UNA oligomers and uses thereof
US10421964B2 (en) 2015-07-23 2019-09-24 Arcturus Therapeutics, Inc. UNA oligomers and compositions for treating amyloidosis

Also Published As

Publication number Publication date
WO2004108897A3 (fr) 2006-05-26

Similar Documents

Publication Publication Date Title
Petkovic et al. RNA circularization strategies in vivo and in vitro
AU2014205648B2 (en) Templates, libraries, kits and methods for generating molecules
Liang et al. Short intronic repeat sequences facilitate circular RNA production
WO2004108897A2 (fr) Banques d'arnsi
Mariner et al. Human Alu RNA is a modular transacting repressor of mRNA transcription during heat shock
Boden et al. Enhanced gene silencing of HIV‐1 specific siRNA using microRNA designed hairpins
CN112384620B (zh) 用于筛选和鉴定功能性lncRNA的方法
EP2576780A1 (fr) PROCÉDÉ DE PRÉPARATION ET D'AMPLIFICATION DE BIBLIOTHÈQUES REPRÉSENTATIVES DE L'ADNc ET SPÉCIFIQUES À UN BRIN D'ADNc POUR UN SÉQUENÇAGE À HAUT RENDEMENT, LEUR UTILISATION, TROUSSE CORRESPONDANTE ET CARTOUCHES DESTINÉES À UNE TROUSSE D'AUTOMATISATION
WO2009112844A1 (fr) Procédé de préparation d’une bibliothèque d’arnsh
WO2005014810A1 (fr) Procede efficace de production d'adn de nucleotide en forme d'haltere
JP2006515158A (ja) ｓｉＲＮＡ発現カセットを合成するための方法およびキット
US9708603B2 (en) Method for amplifying cDNA derived from trace amount of sample
Gou et al. Primer extension-based method for the generation of a siRNA/miRNA expression vector
CN111613272B (zh) 程序化框架gRNA及其应用
WO2005023990A2 (fr) Therapie photodynamique induite par trans-epissage
US8846350B2 (en) MicroRNA affinity assay and uses thereof
AU2003243094A1 (en) Randomised dna libraries and double-stranded rna libraries, use and method of production thereof
Lützelberger et al. Strategies to identify potential therapeutic target sites in RNA
Vyakhireva et al. siRNA-mediated gene silencing
AU784832B2 (en) Self-cleaving RNA sequences and their use for the control of protein synthesis
WO2011158784A1 (fr) Procédé pour une analyse parallèle à grande échelle d'acides nucléiques
Rice et al. Simple, robust strategies for generating DNA-directed RNA interference constructs
Dinh et al. Alternative approach to generate shRNA from cDNA
Mischiati et al. Inhibition of HIV-1 LTR-driven in vitro transcription by molecular hybrids based on peptide nucleic acids mimicking the NF-κB binding site
JP2007524395A (ja) 標的依存性の環状化及びトポロジー的結合が可能なポリヌクレオチド

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase