WO2004101749A2 - Procedes pour amplifier des sequences d'acides nucleiques par ligature decalee - Google Patents

Procedes pour amplifier des sequences d'acides nucleiques par ligature decalee Download PDF

Info

Publication number
WO2004101749A2
WO2004101749A2 PCT/US2004/014325 US2004014325W WO2004101749A2 WO 2004101749 A2 WO2004101749 A2 WO 2004101749A2 US 2004014325 W US2004014325 W US 2004014325W WO 2004101749 A2 WO2004101749 A2 WO 2004101749A2
Authority
WO
WIPO (PCT)
Prior art keywords
molecule
single stranded
promoter
tail
cdna
Prior art date
Application number
PCT/US2004/014325
Other languages
English (en)
Other versions
WO2004101749A3 (fr
Inventor
Robert C. Getts
Jaime Schwalm
Original Assignee
Genisphere, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genisphere, Inc. filed Critical Genisphere, Inc.
Priority to JP2006532858A priority Critical patent/JP4599483B2/ja
Priority to AU2004239283A priority patent/AU2004239283B2/en
Priority to EP04751627A priority patent/EP1623044B1/fr
Priority to US10/554,374 priority patent/US7494789B2/en
Priority to DE602004022282T priority patent/DE602004022282D1/de
Priority to AT04751627T priority patent/ATE437964T1/de
Publication of WO2004101749A2 publication Critical patent/WO2004101749A2/fr
Publication of WO2004101749A3 publication Critical patent/WO2004101749A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
    • C12Q1/6855—Ligating adaptors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6865—Promoter-based amplification, e.g. nucleic acid sequence amplification [NASBA], self-sustained sequence replication [3SR] or transcription-based amplification system [TAS]

Definitions

  • RNA amplification techniques have been developed to overcome this problem. These techniques, however, generally suffer from a phenomenon known as amplification bias (see, e.g., U.S. Patent No. 6,582,906). In these cases, the amplified population of RNA molecules does not proportionally represent the population of RNA molecules existing in the original sample. For example, in the method disclosed by Eberwine and colleagues (see, e.g., U.S. Patent Nos.
  • a compound oligonucleotide is utilized for the amplification, wherein the compound oligonucleotide is provided with both a T7 promoter and a primer.
  • a cDNA copy is created of an initial mRNA transcript using the compound oliognucleotide, with subsequent second strand synthesis to create a cDNA that is double stranded.
  • RNA amplification is conducted via the promoter portion of the compound oligonucleotide, with transcription proceeding off of the cDNA' s second strand.
  • the Eberwine method Since the second strand is used for transcription, the Eberwine method produces amplified RNA that is antisense to the initial mRNA sequence.
  • the Eberwine method introduces a 3' bias during each of its steps due to the incomplete processivities (i.e., the inability of an enzyme to remain attached to a nucleic acid molecule) of the enzymes utilized and the positioning of the RNA polymerase promoter (see, e.g., U.S. Patent No. 6,582,906 and U.S. Patent Publication No. US2003/0104432) .
  • the compound oligonucleotide used to produce first strand cDNA places the promoter at the 5' end of the cDNA, which corresponds to the 3' end of the message.
  • This coupled with the inability of RNA polymerase to complete transcription of some templates can result in a 3 ' bias in the amplified antisense RNA population.
  • second strand cDNA synthesis by DNA polymerase is incomplete, these cDNAs will lack functional promoters, resulting in a reduced representation of the original RNA molecule (or possibly a complete absence) in the amplified population.
  • RNA amplification techniques have been developed to overcome the problem of 3' bias.
  • U.S. Patent Publication No. US2003/0104432 discloses a method for amplifying sense RNA (sRNA) wherein a single stranded or double stranded bacteriophage promoter primer is ligated to the 3' end of a first strand cDNA molecule using T4 DNA or RNA ligase. Following second strand cDNA synthesis, in vi tro transcription off the promoter is used to produce sense RNA molecules.
  • sRNA sense RNA
  • a drawback of this method is that ligation of blunt-end nucleic acid molecules is inefficient and must be performed at reduced incubation temperatures (see Sambrook et al., Molecular Cloning, A Labora tory Manual (3d ed. 2001) . As such, some cDNAs will lack functional promoter primers, resulting in a reduced representation of the original RNA molecule (or possibly a complete absence) in the amplified population following in vi tro transcription.
  • sRNA sense RNA
  • a double stranded RNA polymerase promoter is attached to the 3' end of a first strand cDNA in a staggered (also known as "sticky-end") ligation reaction.
  • Applicants have discovered that attaching a promoter to the 3' end of a first strand cDNA via a staggered ligation reaction is more efficient than attachment via a blunt-end ligation reaction, resulting in the production of sRNA molecules that better reflect the relative abundance of each mRNA transcript in a mixture of mRNA transcripts than those obtained by prior art methods.
  • One aspect of the present invention is directed to a method for producing a sRNA molecule, comprising: providing a single stranded cDNA molecule having 5' and 3' ends; attaching an oligodeoxynucleotide tail onto the 3' end of the single stranded cDNA molecule; providing a double stranded RNA polymerase promoter having a sense strand and antisense strand, wherein the sense strand comprises a single stranded 3 ' overhang comprising a sequence complementary to the oligodeoxynucleotide tail; annealing the double stranded RNA polymerase promoter to the oligodeoxynucleotide tail by complementary base pairing with the 3' overhang sequence; ligating the 5' end of the antisense strand of the double stranded RNA polymerase to the 3' end of the oligodeoxynucleotide tail; and initiating RNA transcription using an RNA polymerase which recognizes the double
  • kits for the production of sense RNA molecules from nucleic acid templates wherein a double stranded RNA polymerase promoter is attached to the 3 ' end of a first strand cDNA in a staggered ligation reaction.
  • another aspect of the present invention is directed to a kit for producing at least one sRNA molecule, comprising: a double stranded RNA polymerase promoter having a sense strand that comprises a single stranded 3' overhang sequence; and instructional materials for producing sRNA molecules using the double stranded promoter.
  • the kit further comprises at least one enzyme for attaching an oligodeoxynucleotide tail onto the 3 ' end of a single stranded cDNA molecule, wherein the oligodeoxynucleotide tail is complementary to the single stranded 3 ' overhang sequence of the double stranded RNA polymerase promoter; and at least one enzyme for ligating the double stranded promoter onto the 3' end of the cDNA molecule.
  • FIGS. la-f together are a flowchart depicting an embodiment of the methods of the present invention.
  • FIG. 2 is a photograph depicting various amounts of sRNA produced by the methods of the current invention visualized on a 1% agarose denaturing gel stained with ethidium bromide.
  • the present invention relates to methods and kits for the generation of sRNA molecules.
  • sRNA molecule "mRNA molecule” and "cDNA molecule” are each intended to cover a single molecule, a plurality of molecules of a single species, and a plurality of molecules of different species.
  • the methods comprise attaching an oligodeoxynucleotide tail onto the 3' end of a single stranded cDNA molecule and ligating onto the oligodeoxynucleotide tail a double stranded promoter whose sense strand contains a single stranded 3' overhang containing a sequence complementary to the oligodeoxynucleotide tail.
  • the use of a 3' overhang containing a sequence complementary to the 3 ' oligonucleotide tail properly orients the promoter and cDNA molecule for efficient staggered ligation.
  • the resulting promoter- containing single stranded cDNA is then used in an in vitro transcription reaction with RNA polymerase to produce sRNA molecules.
  • Such sRNA molecules represent amplified copies of the original mRNA transcript from which the single stranded cDNA was obtained.
  • the methods of the present invention are distinct from currently available technologies that incorporate a promoter sequence onto the 5' end of first strand cDNA molecules.
  • RNA transcription proceeds in the same direction as first strand cDNA synthesis relative to the original mRNA transcript, resulting in the production of antisense RNA molecules containing a bias in favor of nucleotides proximal to the 3' polyA tail of the original mRNA transcripts.
  • the methods of the present invention allow genetic information at both ends of the original mRNA transcripts to be copied and amplified.
  • the resulting sRNA molecules are more representative of the entire length of each original mRNA transcript and better reflect the relative abundance of each mRNA transcript in a mixture of mRNA transcripts than those obtained by prior art methods.
  • the methods of the current invention can also be coupled with random priming without the introduction of any added priming bias.
  • the sRNA molecules may contain polyA tails for more efficient use in downstream assays. Additionally, because the methods of the present invention utilize complementary base pairing to properly orient the promoter at the 3' end of the cDNA molecule prior to ligation, they are more efficient than those methods that attach promoters to cDNA molecules using blunt-end ligation at reduced temperatures (e.g., US2003/0104432) .
  • Examples include the Superscript Double Strand cDNA Synthesis kit (Invitrogen, Carlsbad, CA) , the Array 50 , Array 350 and
  • RNA molecules i.e., original mRNA transcripts
  • the RNA may be obtained from any tissue or cell source, including virion, prokaryotic, and eukaryotic sources found in any biological or environmental sample.
  • the source is eukaryotic tissue, more preferably mammalian tissue, most preferably human tissue.
  • any reverse transcriptase can be used in the reverse transcription reaction, including thermostable and RNase H " reverse transcriptases .
  • an RNase H ⁇ reverse trancriptase is used.
  • Primers for first strand cDNA synthesis are available commercially or can be synthesized and purified using techniques well known in the art. Primers for first strand cDNA synthesis include single strand oligodeoxynucleotides comprising an oligodT tail at their 3' ends that anneal to any original mRNA transcript containing a 3' polyA tail (see FIG. la) . The tails generally range from about 10 to about 30 nucleotides in length, preferably from about 17 to about 24 nucleotides in length, and. Gene specific primers can also be used for first strand cDNA synthesis.
  • the reverse transcription reaction can be initiated using a random primer that anneals to various positions along the length of each original mRNA transcript.
  • the primer generally ranges from about 4 to about 20 nucleotides in length, preferably from about 6 to about 9 nucleotides in length.
  • a random primer can ultimately result in the production of sRNA molecules that are better representative of the entire length of each original mRNA transcript than those produced using an oligodT primer.
  • the use of a random primer to generate cDNA means that RNA that would otherwise be exempt from amplification, such as degraded RNA or RNA derived from bacteria, can be used to produce amplified sRNA molecules.
  • the random primer can be modified to include an oligodT sequence at its 5' end, generally ranging from about 10 to about 300 nucleotides in length, preferably from about 17 to about 24 nucleotides in length, such that amplified sRNA molecules produced during subsequent in vi tro transcription will contain polyA tails.
  • the RNA is generally degraded prior to purification of the first strand cDNA molecules (see FIG. lb) .
  • Any method that degrades RNA can be used, such as treatment with NaOH.
  • the RNA can be left intact, with the first strand cDNA molecules purified from RNA/cDNA duplexes.
  • a single stranded oligodeoxynucleotide tail is attached to the 3' end of the cDNA molecule (see FIG. lc) .
  • the oligodeoxynucleotide tail can be incorporated by any means that attaches deoxynucleotides to single stranded DNA.
  • the oligodeoxynucleotide tail is attached to the single stranded cDNA using terminal deoxynucleotidyl transferase, or other suitable enzyme, in the presence of appropriate deoxynucleotides.
  • the oligodeoxynucleotide tail is a homopolymeric tail (i.e., polydA, polydG, polydC, or polydT) . More preferably, the oligodeoxynucleotide tail is a polydT tail.
  • the tail generally ranges from about 3 to greater than 500 nucleotides in length, preferably from about 20 to about 100 nucleotides in length.
  • RNA polymerase promoter is attached to the 3' oligodeoxynucleotide tail by DNA ligation
  • the 3' oligodeoxynucleotide tail is a polydT tail
  • the 3' overhang of the promoter will contain a sequence of adenosine bases at its 3' end, generally ranging from about 3 to greater than 50 nucleotides in length, preferably from about 10 to about 30 nucleotides in length.
  • the particular nucleotide sequence of the 3' overhang sequence does not have to be perfectly (i.e., 100%) complementary to the particular nucleotide sequence of the 3' oligodeoxynucleotide tail, nor does the length of the 3' overhang sequence need to be exactly equal to the length of the 3' oligodeoxynucleotide tail, for the sequences to be considered complementary to each other.
  • Those of skill in the art will recognize that all that is required is that there be sufficient complementarity between the two sequences so that the 3' overhang can anneal to the 3' oligodeoxynucleotide tail, thus properly positioning the double stranded promoter at the 3' end of the cDNA molecule.
  • the double stranded promoter is attached to the 3' oligonucleotide tail by ligation of the 5' end of the antisense strand of the promoter to the 3' end of the oligodeoxynucleotide tail.
  • Such "staggered" ligation reactions are more efficient and can be performed at higher temperatures than blunt-end ligation reactions.
  • Any DNA ligase can be used in the ligation reaction.
  • the DNA ligase is T4 DNA ligase.
  • the double stranded RNA polymerase promoter contains a sequence specifically recognized by an RNA polymerase. Any RNA polymerase can be used, so long as a specific promoter sequence is known that is recognized by the polymerase.
  • the promoter sequence used is recognized by a bacteriophage RNA polymerase, such as T7, T3, or SP6 RNA polymerase.
  • An exemplary T7 polymerase promoter sense sequence is TAATACGACTCACTATAGGG (SEQ ID NO:l).
  • An exemplary T3 polymerase promoter sense sequence is AATTAACCCTCACTAAAGG (SEQ ID NO:2).
  • An exemplary SP6 polymerase promoter sense sequence is AATTTAAGGTGACACTAT GAA (SEQ ID NO: 3).
  • RNA polymerase promoter Following attachment of the double stranded RNA polymerase promoter to the single stranded 3' oligonucleotide tail by annealing and ligation, unincorporated double stranded promoter is preferably removed by DNA purification to prevent short amplification products from being produced.
  • In vitro transcription is then initiated by the addition of the appropriate RNA polymerase and ribonucleotides (see FIG. le) . Such transcription can result in the production of large amounts of amplified sRNA.
  • Methods and kits for performing in vitro transcription are well known in the art and include
  • second strand cDNA can be optionally synthesized by extension of the 3' overhang of the sense strand of the RNA polymerase promoter using DNA polymerase in the presence of dNTPs.
  • the DNA polymerase is Klenow enzyme.
  • second strand cDNA can be synthesized using a random primer. The random primer will anneal at various positions along the first strand cDNA and can be extended by DNA polymerase in the presence of dNTPs. These random-primed second strand cDNA fragments can be optionally ligated together to form a single second strand cDNA molecule.
  • Such second strand cDNA molecules may stabilize (e.g., remove secondary and tertiary structure) the first strand cDNA during in vitro transcription, resulting in a higher yield of sRNA molecules.
  • the resulting sRNA molecules can be subjected to additional rounds of amplification using the same methodology as just described.
  • sRNA molecules produced from oligodT-mediated first strand cDNA i.e., first round sRNA molecules
  • a random primer can be used to reverse transcribe first strand cDNA from the first round sRNA molecules.
  • Combinations and mixtures of oligodT and random primers can also be used for second round cDNA synthesis.
  • a double stranded RNA polymerase promoter is then attached to the second round single stranded cDNA molecules as described above, followed by a second round of in vi tro transcription with the appropriate RNA polymerase. Performing additional rounds of amplification allows smaller amounts of mRNA to be used in the initial round of amplification .
  • PolyA tails can be added to the 3' ends of amplified sRNA molecules that lack polyA tails (such as those produced from conventional random primed first strand cDNA) using commercially available polyA tailing kits.
  • An example of such a kit is the Poly (A) Tailing kit (Ambion) .
  • polyA polymerase available from Amersham, Invitrogen, and Ambion
  • ATP adenosine triphosphate
  • sRNA molecules in the appropriate buffer can be used to synthesize a polyA tail on the 3' ends of the sRNA molecules.
  • Adding polyA tails increases the number and type of downstream assays in which the amplified sRNA molecules can be used, as well as allowing the use of more inexpensive RNA labeling alternatives in those assays.
  • the sRNA molecules produced by the methods of the present invention can be used for any purpose mRNA is typically used for, including gene expression studies, genetic cloning, and subtractive hybridization.
  • the sRNA molecules may be first reverse transcribed into single stranded cDNA molecules using random primers, oligodT primers, or combinations thereof.
  • the reverse transcription reaction can be performed in the presence of detectably labeled nucleotides, such as fluorescently labeled nucleotides.
  • detectably labeled nucleotides such as fluorescently labeled nucleotides.
  • nucleotides include nucleotides labeled with Cy3 and Cy5.
  • the cDNA molecules are labeled post-synthesis by attaching at least one detectable label to the cDNA molecules.
  • the cDNA molecules are labeled using 3DNATM technology (Genisphere) .
  • 3DNATM technology Geneisphere
  • These dendritic reagents are further described in Nilsen et al . , J. Theor. Biol . , 187: 273-284 (1997); Stears et al . , Physiol . Genomics, 3: 93-99 (2000); and in U.S. Patent Nos. 5,175,270; 5,484,904; 5,487,973; 6,072,043; 6,110,687; and 6,117,631.
  • the labeled single stranded cDNA molecules produced from the sRNA molecules of the present invention are useful as probes for gene expression studies.
  • the cDNA molecules can be contacted with a nucleic acid microarray containing complementary polynucleotides .
  • the microarray is a GeneChip ® microarray (Affymetrix, Santa Clara, CA) . Because the sRNA molecules produced by the present methods are more representative of the entire length of each original mRNA transcript and better reflect the relative abundance of each original mRNA transcript, the results obtained for gene expression studies may be more meaningful (e.g., accurate) than those obtained using prior nucleic acid amplification techniques .
  • the present invention also provides kits to facilitate practice of the methods described herein.
  • kits can be used in various research and diagnostic applications.
  • methods and kits of the present invention can be used to facilitate a comparative analysis of expression of one or more genes in different cells or tissues, different subpopulations of the same cells or tissues, different physiological states of the same cells or tissue, different developmental stages of the same cells or tissue, or different cell populations of the same tissue.
  • analyses can reveal statistically significant differences in the levels of gene expression, which, depending on the cells or tissues analyzed, can then be used to facilitate diagnosis of various disease states .
  • kits may be prepared according to present invention.
  • a kit may include a double stranded RNA polymerase promoter, wherein the sense strand of the double stranded promoter comprises a single stranded 3' overhang sequence, and instructional materials for generating sRNA molecules using the double stranded promoter. While the instructional materials typically comprise written or printed materials, they are not limited to such. Any medium capable of storing such instructions and communicating them to an end user is contemplated by this invention. Such media include, but are not limited to, electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media
  • Such media may include addresses to internet sites that provide such instructional materials.
  • kits of the present invention may further include one or more of the following components or reagents: a reverse transcriptase; an RNase inhibitor; an enzyme for attaching an oligodeoxynucleotide tail onto the 3' end of single stranded cDNA molecules, wherein the oligodeoxynucleotide tail is complementary to the single stranded 3 ' overhang sequence of the double stranded RNA polymerase promoter (e.g., terminal deoxynucleotide transferase) ; an enzyme for ligating the double stranded RNA polymerase promoter onto the 3 ' ends of single stranded cDNA molecules (e.g., T4 DNA ligase); an enzyme for optionally synthesizing second strand cDNA (e.g., Klenow enzyme) ; and an RNA polymerase that recognizes the promoter (e.g., T7 RNA polymerase).
  • a reverse transcriptase e.g., RNase
  • kits may further include buffers, primers (e.g., oligodT primers, random primers) , nucleotides, labeled nucleotides, RNase-free water, containers, vials, reaction tubes, and the like compatible with the generation of sRNA molecules according to the methods of the present invention.
  • primers e.g., oligodT primers, random primers
  • nucleotides labeled nucleotides
  • RNase-free water RNase-free water
  • containers vials, reaction tubes, and the like compatible with the generation of sRNA molecules according to the methods of the present invention.
  • the components and reagents may be provided individually or in combination in containers with suitable storage media.
  • RNA/primer mixture was heated at 80° C for 10 minutes and immediately cooled on ice for 1-2 min.
  • the mixture was then mixed with 9 ⁇ l of a master mixture solution to bring the final volume to 20 ⁇ l containing 50 mM Tris-HCl (pH 8.3), 75 mM KC1, 3 mM MgCl 2 , 10 mM dithiothreitol (DTT), 0.5 mM each dNTP, 10 U Superase-In TM (Ambion), and 200 U
  • the reaction was purified using the MmElute PCR Purification Kit (Qiagen) according to the manufacturer's protocol.
  • the first strand cDNA molecules were eluted with 10 ⁇ l EB buffer provided by the manufacturer. Tailing of First Strand cDNA
  • the first strand cDNA molecules were heated at 80° C for 10 minutes and immediately cooled on ice for 1-2 min.
  • the cDNA molecules in 10 ⁇ l were then mixed with 15 ⁇ l of a master mixture solution to bring the final volume to 25 ⁇ l containing 6.5 ⁇ l RNase-free water, 1 X tailing buffer (10 mM Tris-HCl, pH 7.0, 10 mM MgCl 2 ) , 1.5 mM dTTP, and 30 U terminal deoxynucleotidyl transferase (Invitrogen) .
  • the mixture was briefly centrifuged and incubated at 37° C for 30 min.
  • the reaction was stopped by heating at 65° C for 15 min and cooling at room temperature for 1-2 min (this step can be omitted if proceeding directly to the heating step of the ligation reaction below) .
  • the oligodT-tailed cDNA molecules were heated at 95-100° C for 10 min and immediately cooled on ice for 1-2 min.
  • a 1:5 dilution of 6X ligation mix was prepared by combining 4 parts ligation mix dilution buffer (395 mM Tris-HCl, pH 7.5, 30 mM MgCl 2 , 30 mM ATP) with 1 part 6X ligation mix.
  • the diluted 6X ligation mix contains a 5' phosphorylated T7 Ligation Oligo (7 ng/ ⁇ l) (5'-CCC TAT AGT GAG TCG TAT TA-3 ' ; SEQ ID NO:5) and a T7 dA Bridge Oligo (13.1 ng/ ⁇ l) (5'-TAA TAC GAC TCA CTA TAG GGA AAA AAA AAA-3';SEQ ID NO: 6) in 395 mM Tris-HCl, pH 7.5, 30 mM MgCl 2 , 30 mM ATP.
  • the two oligos when annealed together, form the double stranded T7 promoter with a 3' polydA sense strand overhang.
  • the tailed cDNA molecules in 25 ⁇ l were then mixed with 5 ⁇ l diluted 6X ligation mix and 2 ⁇ l (2 U) T4 DNA ligase (Invitrogen) .
  • the mixture was briefly centrifuged and incubated at 23° C for 30 min.
  • the reaction was stopped by adding 3.5 ⁇ l 0.5 M EDTA and heating to 65° C for 10 min.
  • the reaction was adjusted to 50 ⁇ l with IX TE, pH 8.0.
  • the reaction was purified using the MmElute PCR Purification Kit according to the manufacturer's protocol.
  • the T7 promoter- ligated cDNA molecules were eluted with 10 ⁇ l EB buffer.
  • T7 dA Bridge Oligo 50 ng/ ⁇ l (SEQ ID NO: 6) was added to the T7 promoter-ligated cDNA molecules and the volume adjusted to 16 ⁇ l with RNase-water. The mixture was heated at 95° C for 10 min and immediately iced for 2 min. The mixture was then heated at 37° C for 10-15 min and then mixed with 24 ⁇ l of a master mixture solution to bring the final volume to 40 ⁇ l containing 1 X reaction buffer, 5 mM each rNTP, and 2 ⁇ l T7 RNA polymerase (MEGAscript Transcription kit, Ambion) .
  • Example 2 The methodology of Example 1 was followed, but first strand cDNA synthesis was performed using a random primer instead of oligodT 24 primer.
  • RNA/primer mixture was heated at 80° C for 10 minutes and immediately cooled on ice for 1-2 min.
  • the mixture was then mixed with 9 ⁇ l of a master mixture solution to bring the final volume to 20 ⁇ l containing 50 mM Tris-HCl (pH 8.3), 75 mM KC1, 3 mM MgCl 2 , 10 mM dithiothreitol, 0.5 mM each dNTP, 10 U Superase-In , and 200 U Superscript II reverse transcriptase.
  • the mixture was briefly centrifuged and incubated at 42° C for 2 hrs.
  • the reaction was stopped by addition of 3.5 ⁇ l 0.5 M NaOH/50 mM EDTA and heating at 65° C for 15 min. Following brief centrifugation, the reaction was neutralized with 5 ⁇ l 1 M Tris-HCl, pH 7.5 and adjusted to 50 ⁇ l with IX TE, pH 8.0.
  • the reaction was purified using the
  • Example 3 Either of the methodologies of Examples 1 and 2 was followed, but following first strand cDNA synthesis, the RNA was left intact (i.e., no base hydrolysis) prior to application of the cDNA to the M iElute purification column.
  • the first strand cDNA molecules were eluted with 10 ⁇ l EB buffer provided by the manufacturer and further processed as described in Example 1.
  • Example 4 PolyA tails are added to the amplified sRNA molecules produced by the random primer methodologies of Examples 2 and 3 using the Poly (A) Tailing kit (Ambion).
  • the PolyA-tailed sRNA is converted to labeled cDNA using the Array 350 Detection kit (Genisphere) and hybridized to microarrays by standard techniques as published in the product manual for the detection kit.
  • Example 5 Various amounts of sRNA produced by the above-described methods were visualized on a 1% agarose denaturing gel stained with ethidium bromide. As shown in FIG. 2, the methods of the present invention (identified as SenseAmp, lanes E-G) produced larger amplified RNA molecules as compared to a commercially available, Eberw e-based method (identified as MessageAmp , Ambion, lanes B-D) . Yields of up to -1000-fold amplification over starting RNA samples were achieved using the present methods. Experimental data generated from a comparison of the amplified antisense RNA (aRNA) produced using MessageAmp and the amplified sRNA produced using the present methods indicated that the present methods were more accurate than an
  • the Pearson Log correlation coefficients were 0.91 and 0.86, respectively. A perfect correlation between the unamplified and amplified samples would be reflected by a Pearson Log correlation of 1.00.
  • Example 6 Either of the oligodT methodologies of Examples 1 and 3 was followed, but the purified sRNA molecules were subjected to a second round of RNA amplification. Briefly, the in vitro transcription reaction containing the first round amplified sRNA molecules were eluted from the Rneasy ® column in 30 ⁇ l RNase-free water and re-eluted with the same eluate. The eluate was mixed with 1 ⁇ l oligodT 24 primer (50 ng/ ⁇ l) (SEQ ID NO: 4) and 2 ⁇ l random 9mer primer (25 ng/ ⁇ l) (SEQ ID NO: 6) and brought up to 37 ⁇ l with RNase-free water.
  • 1 ⁇ l oligodT 24 primer 50 ng/ ⁇ l
  • SEQ ID NO: 6 2 ⁇ l random 9mer primer
  • RNA/primer mixture was heated at 80° C for 10 minutes and immediately cooled on ice for 1-2 min. The mixture was then mixed with 23 ⁇ l of a master mixture solution to bring the final volume to 60 ⁇ l containing 50 mM Tris-HCl (pH 8.3), 75 mM KC1, 3 mM MgCl 2 , 10 mM dithiothreitol (DTT) , 0.33 mM each dNTP, 10 U
  • a kit for the production of sRNA molecules is assembled with the following components:
  • 10X Tailing Buffer 100 mM Tris-HCl, pH 7.0, 100 mM MgCl 2 ); Terminal Deoxynucleotidyl Transferase (15-30 U/ ⁇ l) ; 6X Ligation Mix containing a 5' phosphorylated T7 Ligation Oligo (35 ng/ ⁇ l) and a T7 dA Bridge Oligo (65.6 ng/ ⁇ l) in 395 mM Tris-HCl, pH 7.5, 30 mM MgCl 2 , 30 mM ATP; Ligation Mix Dilution Buffer (395 mM Tris-HCl, pH
  • kits 7.5, 30 mM MgCl 2 , 30 mM ATP); T7 dA Bridge Oligo (50 ng/ ⁇ l) ; T4 DNA Ligase (1 U/ ⁇ l) ; and Nuclease-Free Water.
  • the components are placed in numbered vials and placed in a container with a printed instruction manual for the production of amplified sRNA molecules using the kit components.
  • the kit can optionally contain Klenow enzyme (7.5 U/ ⁇ l) if second strand cDNA synthesis is desired. All publications cited in the specification, both patent publications and non-patent publications, are indicative of the level of skill of those skilled in the art to which this invention pertains. All these publications are herein fully incorporated by reference to the same extent as if each individual publication were specifically and individually indicated as being incorporated by reference.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)

Abstract

L'invention concerne des procédés et des nécessaires servant à produire des molécules d'ARN sens. Ces molécules d'ARN sens peuvent être utilisées dans diverses applications de recherche et de diagnostic, par exemple dans des études d'expressions génétiques impliquant des jeux ordonnés de microéchantillons d'acides nucléiques.
PCT/US2004/014325 2003-05-09 2004-05-07 Procedes pour amplifier des sequences d'acides nucleiques par ligature decalee WO2004101749A2 (fr)

Priority Applications (6)

Application Number Priority Date Filing Date Title
JP2006532858A JP4599483B2 (ja) 2003-05-09 2004-05-07 スタッガード（ｓｔａｇｇｅｒｅｄ）ライゲーションを使用して核酸配列を増幅する方法
AU2004239283A AU2004239283B2 (en) 2003-05-09 2004-05-07 Methods for amplification of nucleic acid sequences using staggered ligation
EP04751627A EP1623044B1 (fr) 2003-05-09 2004-05-07 Procedes pour amplifier des sequences d'acides nucleiques par ligature decalee
US10/554,374 US7494789B2 (en) 2003-05-09 2004-05-07 Methods for amplification of nucleic acid sequences using staggered ligation
DE602004022282T DE602004022282D1 (de) 2003-05-09 2004-05-07 Verfahren zur amplifikation von nukleinsäuresequenzen mittels gestaffelter ligation
AT04751627T ATE437964T1 (de) 2003-05-09 2004-05-07 Verfahren zur amplifikation von nukleinsäuresequenzen mittels gestaffelter ligation

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US46938303P 2003-05-09 2003-05-09
US60/469,383 2003-05-09

Publications (2)

Publication Number Publication Date
WO2004101749A2 true WO2004101749A2 (fr) 2004-11-25
WO2004101749A3 WO2004101749A3 (fr) 2005-02-10

Family

ID=33452281

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/014325 WO2004101749A2 (fr) 2003-05-09 2004-05-07 Procedes pour amplifier des sequences d'acides nucleiques par ligature decalee

Country Status (7)

Country Link
US (1) US7494789B2 (fr)
EP (1) EP1623044B1 (fr)
JP (1) JP4599483B2 (fr)
AT (1) ATE437964T1 (fr)
AU (1) AU2004239283B2 (fr)
DE (1) DE602004022282D1 (fr)
WO (1) WO2004101749A2 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005098044A1 (fr) * 2004-04-01 2005-10-20 Genisphere Inc. Procedes permettant l'amplification de sequences d'acides nucleiques au moyen de matrices de promoteurs
WO2006135684A2 (fr) 2005-06-10 2006-12-21 Datascope Investment Corp. Methodes et kits pour la synthese d'arn sens
WO2010060132A1 (fr) * 2008-11-03 2010-06-03 Alchemy Biosciences Pty Ltd Procédé de clonage d'adn
US7888018B2 (en) 2005-11-08 2011-02-15 Genisphere, Llc Methods and kits for nucleic acid amplification
US10731194B2 (en) 2012-03-13 2020-08-04 Swift Biosciences, Inc. Methods and compositions for size-controlled homopolymer tailing of substrate polynucleotides by a nucleic acid polymerase
WO2020183188A1 (fr) * 2019-03-12 2020-09-17 Cancer Research Technology Limited Procédés d'amplification d'acide nucléique

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7998423B2 (en) 2007-02-27 2011-08-16 Basf Corporation SCR on low thermal mass filter substrates
WO2014108850A2 (fr) * 2013-01-09 2014-07-17 Yeda Research And Development Co. Ltd. Analyse de transcriptome à haut débit

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5215899A (en) * 1989-11-09 1993-06-01 Miles Inc. Nucleic acid amplification employing ligatable hairpin probe and transcription
US5194370A (en) * 1990-05-16 1993-03-16 Life Technologies, Inc. Promoter ligation activated transcription amplification of nucleic acid sequences
PT1056884E (pt) * 1998-02-27 2002-06-28 Pamgene Bv Processo para a amplificacao nao especifica de acido nucleico
JP2002360249A (ja) * 2000-10-13 2002-12-17 National Institute Of Advanced Industrial & Technology マイクロアレイ及びエストロゲン類似活性化合物の活性評価方法
US20020102589A1 (en) * 2000-10-13 2002-08-01 Ryoiti Kiyama Microarrays and methods for evaluating activity of compounds having estrogen-like activity
US20030104432A1 (en) * 2001-07-27 2003-06-05 The Regents Of The University Of California Methods of amplifying sense strand RNA
GB0123401D0 (en) * 2001-09-28 2001-11-21 Novartis Forschungsstiftung Methods of inducing gene expression
DE602005017252D1 (de) * 2004-04-01 2009-12-03 Genisphere Inc Verfahren zur amplifikation von nukleinsäuren mittels promotor-templates

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of EP1623044A4 *

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005098044A1 (fr) * 2004-04-01 2005-10-20 Genisphere Inc. Procedes permettant l'amplification de sequences d'acides nucleiques au moyen de matrices de promoteurs
US8802867B2 (en) 2004-04-01 2014-08-12 Genisphere, Llc Method for producing a sense RNA molecule
AU2006258004B2 (en) * 2005-06-10 2012-09-06 Genisphere, Llc Methods and kits for sense RNA synthesis
JP2008543284A (ja) * 2005-06-10 2008-12-04 データスコープ・インヴェストメント・コーポレイション センスｒｎａ合成のための方法およびキット
US7550264B2 (en) 2005-06-10 2009-06-23 Datascope Investment Corporation Methods and kits for sense RNA synthesis
EP1893626A4 (fr) * 2005-06-10 2011-09-14 Genisphere Llc Methodes et kits pour la synthese d'arn sens
US8097418B2 (en) 2005-06-10 2012-01-17 Genisphere, Llc Methods and kits for sense RNA synthesis
EP1893626A2 (fr) * 2005-06-10 2008-03-05 Datascope Investment Corp. Methodes et kits pour la synthese d'arn sens
WO2006135684A2 (fr) 2005-06-10 2006-12-21 Datascope Investment Corp. Methodes et kits pour la synthese d'arn sens
US9752172B2 (en) 2005-06-10 2017-09-05 Genisphere, Llc Methods and kits for sense RNA synthesis
US7888018B2 (en) 2005-11-08 2011-02-15 Genisphere, Llc Methods and kits for nucleic acid amplification
WO2010060132A1 (fr) * 2008-11-03 2010-06-03 Alchemy Biosciences Pty Ltd Procédé de clonage d'adn
US10731194B2 (en) 2012-03-13 2020-08-04 Swift Biosciences, Inc. Methods and compositions for size-controlled homopolymer tailing of substrate polynucleotides by a nucleic acid polymerase
WO2020183188A1 (fr) * 2019-03-12 2020-09-17 Cancer Research Technology Limited Procédés d'amplification d'acide nucléique

Also Published As

Publication number Publication date
US7494789B2 (en) 2009-02-24
DE602004022282D1 (de) 2009-09-10
AU2004239283A1 (en) 2004-11-25
ATE437964T1 (de) 2009-08-15
JP2007515938A (ja) 2007-06-21
EP1623044B1 (fr) 2009-07-29
JP4599483B2 (ja) 2010-12-15
AU2004239283B2 (en) 2010-01-28
US20070072182A1 (en) 2007-03-29
EP1623044A4 (fr) 2007-11-07
WO2004101749A3 (fr) 2005-02-10
EP1623044A2 (fr) 2006-02-08

Similar Documents

Publication Publication Date Title
US8802867B2 (en) Method for producing a sense RNA molecule
US8653251B2 (en) Methods and kits for nucleic acid amplification
AU2006258004B2 (en) Methods and kits for sense RNA synthesis
US20070048741A1 (en) Methods and kits for sense RNA synthesis
WO2006081222A2 (fr) Amplification isotherme d'adn
EP1623044B1 (fr) Procedes pour amplifier des sequences d'acides nucleiques par ligature decalee
EP1624059A2 (fr) Procédé de préparation de molécules d'acide nucléique ayant une structure secondaire diminuée

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2004751627

Country of ref document: EP

Ref document number: 2004239283

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 171838

Country of ref document: IL

Ref document number: 2006532858

Country of ref document: JP

ENP Entry into the national phase

Ref document number: 2004239283

Country of ref document: AU

Date of ref document: 20040507

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2004239283

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2004751627

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2007072182

Country of ref document: US

Ref document number: 10554374

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 10554374

Country of ref document: US