WO2004099418A1

WO2004099418A1 - Fused protein

Info

Publication number: WO2004099418A1
Application number: PCT/JP2004/006393
Authority: WO
Inventors: Yoshihisa Yamashita; Takayuki Kawato
Original assignee: Nihon University
Priority date: 2003-05-12
Filing date: 2004-05-12
Publication date: 2004-11-18
Also published as: JPWO2004099418A1; JP2004329163A; WO2004099418A8

Abstract

It is intended to provide a fused protein capable of effectively preventing dental caries by producing an antibody against Streptococcus sobrinus that is one of major bacteria causative of the formation of dental caries lesions; an anti-dental caries antibody preparation; and a protein preparation. A fused protein comprising the alanine-repeat region of a high-molecular weight surface protein of S. sobrinus and the glucan-binding region of a glucan synthase is prepared. This fused protein is administered to a mammal and then an antibody against this fused protein is collected. By using the above fused protein and antibody, adhesion of S. sobrinus to tooth surface can be prevented.

Description

Specification

Fusion protein

Technical field

The present invention relates to a fusion protein, particularly to a fusion protein that induces an antibody against cariogenic bacteria.

^ Scenic technology

[0002] Conventionally, for example, fluoride has been added to dentifrice, or a sweetener substitute for sucrose has been added to confectionery to prevent dental caries.

Furthermore, in recent years, attention has been focused on a method of preventing dental caries, which induces an immune response to a cariogenic pathogen or a cariogenic substance produced by the cariogenic pathogen by vaccine administration or the like. One example of such a technology is the function of each of two substances localized on the cell surface of Streptococcus mutans (hereinafter sometimes referred to as “S. mutans”), one of the cariogenic pathogens. Non-Patent Document 1 discloses a technique for creating a fusion protein by connecting sites. Antibodies prepared using the fusion protein as an antigen have been confirmed to strongly inhibit the adhesion of S. mutans to saliva-coated hydroxyapatite.

[0003] Non-patent document 2 discloses a technique for producing a large amount of a monoclonal antibody against an adhesin (PAc) on the surface of S. mutans using a recombinant plant.

As described above, by using an immunological method that specifically acts on S. mutans, it is possible to prevent S. mutans from adhering to the tooth surface without causing damage to other cells in the oral cavity, and to prevent acidity caused by S. mutans. Generation can be suppressed.

[0004] However, the pathogens of dental caries are not limited to S. mutans, but it is thought that dental caries is induced by multiple kinds of bacteria present in the oral cavity. In particular, human carious lesions are frequently separated from S. mutans and further from Storeptococcus sobrinus.

For this reason, when the immunological method is used as described above, it is possible to cause a specific action on a specific pathogen, but on the other hand, its specificity is extremely strict, so that other than S. mutans can be used. Cannot act on pathogens. That is, even with the above antibody, Even if the adhesion of S. mutans to the tooth surface and the growth of S. mutans can be suppressed, other carious pathogens, especially S. sobrinus, will multiply instead, effectively preventing caries. I can't do it.

[0005] The object of the present invention has been made in view of the above-mentioned problems, and is effective in inducing an antibody against S. sobrinus, which is one of the main pathogens forming carious lesions. An object of the present invention is to provide a fusion protein capable of preventing caries.

Non-Patent Document l: HAO YU, 4 others, `` Effects of Antibodies against Cell Surface ProteinAntigen P Ac-- Glucosyltransf erase Fusion Protein on LJ lucan Synthesis and Ceil Adhesion of Streptococcus mutans, INF ECTION AND IMMUNITY, America, American Society for Microbi ology, June 1997, Vol. 65, No. 6, p. 2292-2298

Non-Patent Document 2: Ma, ft! L2, "Immunotherapeu1: ic potential of antibodies produced in plants", TIBTECH, 1995, Vol. 13, p. 522-527

Disclosure of the invention

[0006] As a result of intensive studies in view of the above problems, the present inventors have developed a fusion protein capable of inducing an antibody that effectively inhibits the colonization of S. sobrinus on the tooth surface.

That is, the fusion protein that is useful in the present invention is a macromolecular bacterial surface protein of Streptococcus sobrinus (hereinafter, also referred to as “S. sobrinus”).

And a glucan-binding domain of glucan synthase.

[0007] Further, the alanine repeat region is characterized by comprising the following protein (a) or (b).

(a) a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing;

(b) a protein consisting of an amino acid sequence in which one or more amino acids have been deleted, substituted or added in the amino acid sequence (a).

[0008] Further, the gnorecan binding region force S is characterized by comprising the following protein (a) or (b).

(a) a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing;

(b) one or more amino acids are deleted, substituted or added in the amino acid sequence (a) A protein consisting of a modified amino acid sequence.

[0009] Here, the alanine repeat region (hereinafter, also referred to as "A_repeat region") of the high-molecular-weight cell surface protein of S. sobrinus (hereinafter, also referred to as "PAg") may be referred to. This region constitutes a functional region of PAg, that is, a salivary binding region that binds to a salivary glycoprotein of an oral pellicle, and contains a high concentration of alanine localized near the N-terminus. In this salivary junction, S. sobrinus is involved in the initial settlement on the tooth surface.

[0010] In addition, S. sobrinus glucan synthase (hereinafter sometimes referred to as "GTF") is a method of synthesizing water-insoluble glucan from sucrose to obtain a hydroxy-treated glucan synthase from S. sobrinus saliva. The glucose binding region (hereinafter, also referred to as “glucan_binding region”) is a functional region of the enzyme that binds to glucose, which makes the adhesion to the apatite particles stronger.

[0011] The present inventors have found that the mechanism of action of an antibody against S. sobrinus induced in the oral cavity in suppressing dental caries, that is, inhibition of adhesion of bacterial cells to the tooth surface, whitening of bacterial cells bound with the antibody, Among the mechanisms of phagocytosis by blood cells and inhibition of bacterial cell metabolism, we focused on the mechanism of inhibition of bacterial adhesion to tooth surfaces. Then, a fusion protein, which is a functional region of two proteins that play an important role in the adhesion of the protein and enhances the mechanism of action, and which binds the two specific regions, is used as an antigen. And As a result, as described later, it was confirmed that the antibody obtained after administration of the fusion protein according to the present invention inhibited the attachment of S. sobrinus to the tooth surface at a high rate.

[0012] Here, the present invention relates to the binding order of the alanine repeat region and the glucose binding region, that is, which region is arranged upstream when the amino acid sequence is taken into consideration, or the other peptide that connects the two regions. Import, addition of peptides before and after the above two regions, and the like are not particularly limited. For example, the glucan synthase of S. sobrinus may be incorporated into the fusion protein, including one or more amino acids before and after the glucan binding region.

[0013] Further, the fusion protein of the present invention includes deletions, substitutions, or additions of one or more amino acids in the two regions. This is, for example, a method for replacing or deleting a specific amino acid by a point mutation performed on a recombinant DNA described later. Chillon method

A known method such as the Kunkel method can be used.

Further, for the amino acids in the two regions, for example, when the region is the C-terminal, the C-terminal is esterified or amidated, and 〇H, C 0〇H, Some modifications such as protecting NH, SH, etc. with a suitable protecting group such as formyl group

Two

It is also possible to make a chemical modification.

[0014] The fusion protein of the present invention thus prepared can be used, for example, as a pharmaceutical composition containing the fusion protein of the present invention as an active ingredient. That is, by directly administering an effective amount of the fusion protein of the present invention capable of inducing immunity to mammals including humans, it is possible to induce an immune response in humans and the like and to carry out long-term caries prevention. Alternatively, as described below, caries can be prevented by recovering an antibody from a mammal to which the fusion protein of the present invention has been administered and administering the antibody into the oral cavity.

[0015] In this case, the fusion protein may be used as it is, but usually, a medicine containing the fusion protein as an active ingredient using a pharmaceutically acceptable additive or excipient for a pharmaceutical preparation. It is preferable to produce and use it as a drug composition. Examples of the administration route of the pharmaceutical composition include local administration capable of inducing an immune response, such as nasal mucosal administration. Therefore, the fusion protein of the present invention is used as an active ingredient of a pharmaceutical composition for local administration such as nasal immunity.

[0016] Further, the recombinant DNA according to the present invention encodes the fusion protein according to the present invention.

Further, the recombinant DNA according to the present invention has the following nucleotide sequence (a) or (b) encoding the alanine repeat region of the surface protein of the high molecular weight bacterial cell of Streptococci! S sobrinus constituting the fusion protein. And

(a) The base sequence shown in SEQ ID NO: 3 in the sequence listing.

(b) The nucleotide sequence of a DNA that hybridizes under stringent conditions with the DNA consisting of the nucleotide sequence (a).

[0017] Further, the fusion protein is characterized by having the following nucleotide sequence (a) or (b) encoding a glucan binding region of a glucan synthase of Streptococcus sobrinus constituting the fusion protein. (a) The base sequence shown in SEQ ID NO: 4 in the sequence listing.

Furthermore, an expression vector containing the recombinant DNA according to the present invention and a transformant carrying the expression vector are provided.

Here, examples of the DNA that can hybridize under stringent conditions with the nucleotide sequence represented by SEQ ID NO: 3 or SEQ ID NO: 4 include, for example, the nucleotide sequence represented by SEQ ID NO: 3 or SEQ ID NO: 4. DNA containing a base sequence having a homology of about 80% or more, preferably 90% or more is used. Hybridization can be performed, for example, according to a method described in a manual of a DIG nucleic acid detection system (Roche). In this case, stringent hybridization conditions to tolerate about 20% mismatch (guaranteing about 80% homology) include 50% formamide (deionized), 5 × SSC (sodium concentration 0%). 975M), 0.1% (w / v) N-lauroylsarcosine, 0.02% (w / v) SDS, temperature is 42 ° C. Increasing the hybridization temperature by 1 ° 4 ° C further reduces mismatch by 1%.

The recombinant DNA of the present invention can be isolated from genomic DNA derived from S. sobrinus, genomic DNA library, and cDNA derived from S. sobrinus by a known method.

Using a DNA ligase or the like, the combined DNA, synthetic DNA, or deviation may be used. In order to prepare a DNA that can hybridize with the nucleotide sequence represented by SEQ ID NO: 3 or SEQ ID NO: 4 under stringent conditions, for example, using a commercially available kit or the like, a known method such as the Kunkel method is used. The conversion of the base sequence can be carried out according to the method of or a method analogous thereto.

[0020] Although the fusion protein can be easily and massively purified by using the above transformant, the fusion protein is not limited to one prepared by introducing the above recombinant DNA into the transformant. Needless to say. A known method of protein synthesis, for example, condensing amino acids having a suitably protected amino group and side chain functional group on a resin for protein synthesis in accordance with the above-mentioned amino acid sequence, and after completion of the condensation reaction, various protections By removing the groups and further performing the intramolecular disulfide bond formation reaction in a highly diluted solution, the present invention It is also possible to synthesize a fusion protein.

[0021] The expression vector of the present invention may be any of a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis, a Bataterio phage such as λ phage, and an animal virus such as retrovirus / less and baculoinoleth. ,. An expression vector containing a promoter, an enhancer, a splicing signal, a polymerase addition signal, a selection marker and the like depending on the host cell can be used.

[0022] The host cell used in the transformant of the present invention may be, for example, any of bacteria such as Escherichia coli, yeast, insect cells, insects, and animal cells.

Furthermore, the antibody preparation of the present invention includes an antibody against the above-mentioned fusion protein. That is, the antibody against the fusion protein according to the present invention has an inhibitory action on the attachment of S. sobrinus to the tooth surface, and the action is based on the antibody containing the antibody produced by other mammals including humans. It is also effective when it is administered into the oral cavity as a preparation.

The antibody contained in the antibody preparation of the present invention can be produced according to a known antibody or antiserum production method. For example, in the case of a polyclonal antibody, the fusion protein is administered to a mammal together with the carrier itself or a carrier and a diluent, and the antibody-containing substance is collected from the immunized mammal and the antibody is separated and purified. To get by. Examples of the mammal to be immunized include a mouse, a rat, a heron, a sheep, a goat, and a chick. For example, in the case of domestic animals such as chickens and chickens, it is possible to collect milk, eggs, and the like as they are, and administer them into the oral cavity as a food containing an antibody against the fusion protein. In particular, since a large amount of milk can be recovered from the seaweed, it can be separated and purified for use. In this case, a human artificial chromosome (HAC) is immunized by administering the fusion protein to a human polyclonal antibody-producing HAC protein or the like, which is prepared through a known method such as cell fusion or nuclear transfer, to thereby produce a human antibody. It may be good. As described above, it is desirable to obtain an antibody involved in inhibiting adhesion to the tooth surface as a polyclonal antibody that is simultaneously prepared.However, antibody-producing cells are recovered from an immunized animal, and the monoclonal antibody is purified by a known method. May be produced. Examples of the form of the antibody preparation according to the present invention include an oral ointment, a jelly preparation, a mouthwash, and a spray. BRIEF DESCRIPTION OF THE FIGURES

[0024] [Fig. 1] (a) is a diagram illustrating the PAgA gene region, (b) is a diagram illustrating the configuration of pQE80L-pagA, and (c) is a diagram illustrating the gtfl-GB gene region. FIG. 2D is a diagram illustrating the configuration of one GB of pQE80L-pagA-gt fl.

FIG. 2 is an SDS-PAGE image of Escherichia coli expressing the fusion protein.

FIG. 3 is an SDS-PAGE image of the purified fusion protein.

FIG. 4 is a graph showing the relationship between the number of bacteria adhering to hydroxyapatite and the amount of IgG antibody added.

BEST MODE FOR CARRYING OUT THE INVENTION

Next, an embodiment of the present invention will be described with reference to the drawings. In the drawings referred to in the following description, the same parts as those in the other drawings are indicated by the same reference numerals.

[Example 1] Construction of fusion protein expression vector

(1) Preparation of a DNA fragment encoding the A-repeat region of PAg (hereinafter sometimes referred to as “PAgA”)

This fragment was obtained by performing a PCR reaction on chromosomal DNA isolated from S. sobrinus strain OMZ176 using the following forward primer 1 and reverse primer 1.

[0026] The synthesis of the primers was performed using a DNA synthesizer. Reverse primer 1: ATATGAGCTCCTTCTTGTACTGAGCAAGC (including the base sequence described in SEQ ID NO: 6 in the sequence listing, including the Sacl site)

The PCR reaction was performed for 30 cycles at 98 ° C for 10 seconds, 60 ° C for 30 seconds, and 72 ° C for 1.0 minute.

[0027] As a result, as shown in Fig. 1 (a), the BamHI site and the 3 'end of the PAgA-encoding gene region (hereinafter sometimes referred to as "pag Aj") DNA fragment 1 having a Sacl site was prepared. (2) Preparation of DNA fragment encoding glucan-binding region of GTF_I

The gene region encoding the glucan-binding region of the water-insoluble glucan synthase GTF-I, a type of GTF derived from S. sobrinus (hereinafter sometimes referred to as “gtfl-GB”), is S The chromosomal DNA isolated from S. sobrinus strain OMZ176 was obtained by performing a PCR reaction using the following forward primer ₂ and reverse primer ₂ .

[0028] The synthesis of the primers was performed using a DNA synthesizer.

Forward primer 2: ATATGAGCTCCTATACTACTTCGGTAAAGAC (including the base ligation and Sacl site described in SEQ ID NO: 7 in the sequence listing)

Reverse primer 2: TTTTAAGCTTAGTTCCAGCCACGGTAGAT (base sequence described in SEQ ID NO: 8 in Sequence Listing, including Hindm site)

The PCR reaction was performed for 30 cycles at 98 ° C for 10 seconds, 65 ° C for 30 seconds, and 72 ° C for 2.0 minutes.

As a result, as shown in FIG. 1 (c), a DNA fragment 2 having a Sacl site at the 5 ′ end and a Hindlll site at the 3 ′ end of gtf GB was prepared.

(3) Insert pagA and gtfI_GB into the vector

The DNA fragment obtained by the above (1) and (2) was incorporated into a plasmid expression vector PQE80L (manufactured by Qiagen) encoding six consecutive His residues as follows.

[0030] The DNA fragment obtained in the above (1) and pQE80L are cleaved by restriction enzymes BamHI and Sacl, respectively, and subjected to electrophoresis in each reaction solution after cleavage. Cut out the band used for integration and dissolve each DNA fragment from the gel.

Out and purified.

Then, the purified DNA fragment (1) and the purified vector were ligated using DNA ligase (Takara Shuzo Co., Ltd.). As a result, as shown in FIG. 1 (b), the vector PQE80L-pagA into which the pagA gene region was inserted was created.

[0031] In addition, the DNA fragment obtained in the above (2) and the vector pQE80L_pagA were subjected to a cleavage reaction using the restriction enzymes Sacl and Hindlll. About the reaction solution after cutting Also, electrophoresis was performed as described above, and the corresponding band was cut out and eluted and purified.

Further, the purified DNA fragment (2) and the purified pQE80L_pagA were ligated using a DNA license (Takara Shuzo Co., Ltd.). As a result, as shown in FIG. 1 (d), a vector pQE80L_pagA—gtfl—GB into which a gtfl—GB gene region was further inserted was created.

[Example 2] Preparation of transformant, expression of fusion protein, and purification of fusion protein

(1) Preparation of transformant and expression of fusion protein

The transformant obtained in the above [Example 1] was mixed with competent Escherichia coli DH5_ and transformed. The obtained transformant was cultured for 1 晚 in a 2 X YT medium supplemented with ampicillin so that the concentration of ampicillin became 100 zg / ml, and this culture solution was newly prepared in a 2 X YT medium (ampicillin). (100 μg / ml) at a ratio of 1:20 and cultured at 37 ° C. for 1 hour. Further, IPTG (isopropylthiogalactoside) was added to this culture solution to a final concentration of ImM, followed by culturing at 37 ° C for 3 hours to induce expression.

[0032] Thereafter, the culture solution was precipitated at 3500 X g for 20 minutes by centrifugation to collect bacteria, and then washed three times with PBS (phosphate-buffered saline).

(2) Confirmation of fusion protein expression by SDS-PAGE

The cells obtained as in (1) were lysed by adding 2X SDS-PAGE sample buffer, heated at 100 ° C for 5 minutes, and electrophoresed on a 10% polyacrylamide gel. . After electrophoresis at 100 V (constant voltage) for 1 hour, an image of the gel stained with protein using Coomassie brilliant blue is shown in FIG.

[0033] In the figure, lane M is a marker lane, lane 1 is a lane in which a lysis reaction solution of cells cultured by heating IPTG as described above is migrated, and lane 2 is a lane in which IPTG is dissolved. This is a lane in which a lysis reaction solution of bacterial cells cultured without addition, that is, without inducing expression, was electrophoresed.

As shown in the figure, in lane 1, a thick band near 82 kDa appeared in lane 2, which was not confirmed, and the expression of a fusion protein of about 82 kDa was confirmed.

(3) Purification of fusion protein The cells obtained as in (1) were lysed and purified using a Ni-nitilotriacetic acid (Ni-NTA) resin column (Qiagen). This operation was performed in accordance with Qiagen's Manual.

[0034] Briefly, the cells are dissolved in cells (100 mM NaHPO, 10 mM Tris-Cl, 8 mM

twenty four

Mure a, pH 8) was added and suspended in 5 ml per gram of cells, and the cells were disrupted by centrifugation at 10,000 X g for 20 minutes to 30 minutes. Furthermore, 2X SDS-PAGE sample buffer was added to the mixture to dissolve it, heated at 100 ° C for 5 minutes, and the lysate was mixed with the column bed, introduced into the column, and purified. went. Buffer (1 OOmMNaHPO, 10 mM Tris-Cl, 8Murea, pH 6.3) is passed through the column after the adsorption reaction to remove unadsorbed substances.

twenty four

Washed. Thereafter, Buffers of the same composition adjusted to pH 5.9 and pH 4.5 were flowed in order, and the protein containing His residues adsorbed on the column was eluted.

[0035] The eluted protein fraction was subjected to electrophoresis on a 10% polyacrylamide gel in the same manner as described above. After electrophoresis at 100V (constant voltage) for 1 hour, the gel image stained with protein using Coomassie Brilliant Blue is shown in FIG.

In the figure, lane M is a marker lane, lane 1 is a lane in which a lysate before purification was run, and lane 2 is a lane in which the non-protein fraction in the above purification procedure was run. And lane 3 is a lane in which the protein fraction was run.

[0036] As shown in the figure, in lane 3, as in lane 1, a thick band appeared around 82kDa, and expression of the fusion protein to which six His residues had been added was confirmed. In addition, bands of proteins other than the fusion protein appearing in lanes 1 and 2 can hardly be confirmed, and other proteins are removed by elution under pH 4.5 conditions, and the fusion protein is purified and purified. It was confirmed that.

[Example 3] Preparation of antibody and confirmation of effect of inhibiting S. sobrinus from adhering to tooth surface components (1) Preparation of antibody

Antibodies were prepared by administering the fusion protein prepared in Example 2 to rabbits (Japanese white, female). The fusion protein was administered by intradermal injection together with 0.3 mg of a complete Freund's adjuvant six times every two weeks, and IgG antibody was purified and obtained from the blood. For purification of IgG antibody, use Affi-Gel Protein A MAPS II Kit (Bio-Rad) And the method described in the manual. That is, Affi-Gel protein A agarose equilibrated with the binding buffer (adjusted to pH 9.0) attached to the kit was packed in the column. Then, an equivalent amount of binding buffer was added to the serum of the rabbit immunized with the fusion protein, and then added to the column to allow the rabbit IgG to be adsorbed to Affi-Gel protein A agarose. After thoroughly washing the column with the equilibration buffer, elute IgG is eluted with the elution buffer (adjusted to pH 3.0) included in the kit, dialyzed with phosphate buffered saline (pH 7.4), and concentrated to 1 Omg / ml. It was used as a purified IgG antibody.

(2) Experiment to control adhesion of S. sobrinus to tooth surface components

The results of an experiment performed using the IgG antibody prepared in (1) to confirm the effect of inhibiting S. sobrinus from adhering to tooth surface components are shown in FIG. 4 and Table 1.

[Table 1]

Antibody addition amount Number of adherent bacteria (10 ⁷ )

anti PAgA-GTF-IGB IgG preimmunized IgG

control 1 .06 ± 0.08

n = 3 mean ≠ SD

*: P <0. 05

[0038] FIG. 4 is a hydroxyapatite lOmg coated with saliva, S. sobrinus (bacterial number 3 X 1 0 ⁷⁾ and Ka卩E IgG antibodies, 3 hours, measured after incubation at 37 ° C for the hydroxyapatite 4 is a graph showing the relationship between the number of bacteria adherent to the cells and the amount of IgG antibody added g). Table 1 shows the measured values of the number of adherent bacteria at each amount of IgG antibody added.

[0039] The anti-PAgA-GTF-IGB IgG in the figure is an IgG antibody prepared as described in (1) above, and is a preimmunized IgG (hereinafter sometimes referred to as "preimm. IgG"). Is an IgG antibody purified from the blood of non-immunized egrets to which no fusion protein is administered. contorol is a measured value when no IgG antibody was added. Saliva coated hydroxyapatite The, for the same state as the tooth surface in the oral cavity, the ceramic beads surfaced with Bruno tight a tooth surface component (manufactured by diameter 80 _beta m, Biorad Corp.) soaked in saliva, 1 hour, 37 ° The one kept at C was used. The number of adherent bacteria was determined by fluorescently labeling S. sobrinus with BCECF-AM (2 ', 7_bis [2_carboxyethyl] _5 [6] _carboxyfluorescemacetoxymethyl thyl ester) and attaching to hydroxyapatite after the attachment reaction time. Was obtained by measuring with a photo counter.

[0040] As shown in Table 1 and Figure 4, preimm IgG deposition number of bacteria during addition can 1. 0 X 10 ⁷ -. To 0.7 of which was a X 10 ^7, anti PAgA-GTF- When IGB IgG was added, the ratio was 0.6 × 10 7 —0.2 × 10 ⁷ , and there was a statistically significant difference in the number of adherent bacteria at each amount of IgG added (P 0.05). From this, it was confirmed that the adhesion of S. sobrinus to saliva-coated hydroxyapatite was significantly suppressed by anti-PAgA-GTF-IGB IgG.

Industrial availability

As described in detail above, according to the fusion protein of the present invention, for example, by administering to a human as a pharmaceutical composition containing the fusion protein of the present invention as an active ingredient, the immune response of a human or the like can be improved. When induced, antibodies are produced in the oral cavity or in the blood for a long period of time, making it possible to prevent caries. Alternatively, by administering the fusion protein according to the present invention, it becomes possible to efficiently generate and recover a plurality of types of antibodies involved in inhibiting the adhesion of S. sobrinus to the tooth surface from mammals.

[0042] According to the recombinant DNA, vector and transformant of the present invention, efficient production of a fusion protein becomes possible.

According to the antibody preparation of the present invention, by intraoral administration, the adhesion of S. sobrinus to the tooth surface is inhibited, or the metabolism of bacteria is inhibited, and the phagocytosis of bacteria by leukocytes and the like is brought about. , Prevent caries. Therefore, it is possible to easily prevent caries without administering a vaccine containing the fusion protein by subcutaneous injection or the like for the purpose of caries prevention by the antibody.

Claims

The scope of the claims

[1] A fusion protein of Streptococcus sobrinus, which contains an alanine and a turnover region of a high-molecular-weight cell surface protein and a glucan-binding region of a glucan synthase.

[2] The fusion protein according to claim 1, wherein the alanine repeat region comprises the following protein (a) or (b):

[3] The fusion protein according to claim 1 or 2, wherein the gnorecan binding region comprises the following protein (a) or (b).

[4] A recombinant DNA encoding the fusion protein according to any one of claims 1 to 3.

[5] The nucleotide sequence of the following ( _a ) or (b), which encodes an alanine repeat region of a surface protein of a macromolecular bacterium of Streptococcus sobrinus constituting the fusion protein. The recombinant DNA according to item 4.

(a) The base sequence shown in SEQ ID NO: 3 in the sequence listing.

6. The method according to claim 4, wherein the fusion protein has the following nucleotide sequence (a) or (b) encoding a glucan binding region of a glucan synthase of Streptococcus sobrinus constituting the fusion protein. 6. The recombinant DNA according to item 5.

(a) The base sequence shown in SEQ ID NO: 4 in the sequence listing.

[7] The expression containing the recombinant DNA according to any one of claims 4 to 6 above. vector.

[8] A transformant carrying the expression vector according to claim 7.

[9] An antibody preparation comprising an antibody against the fusion protein according to any one of claims 1 to 8.