WO2004098533A2 - Vectors and cells for preparing immunoprotective compositions derived from transgenic plants - Google Patents

Vectors and cells for preparing immunoprotective compositions derived from transgenic plants Download PDF

Info

Publication number
WO2004098533A2
WO2004098533A2 PCT/US2004/014182 US2004014182W WO2004098533A2 WO 2004098533 A2 WO2004098533 A2 WO 2004098533A2 US 2004014182 W US2004014182 W US 2004014182W WO 2004098533 A2 WO2004098533 A2 WO 2004098533A2
Authority
WO
WIPO (PCT)
Prior art keywords
plant
antigen
fruit
vector
protein
Prior art date
Application number
PCT/US2004/014182
Other languages
French (fr)
Other versions
WO2004098533A3 (en
Inventor
Guy A. Cardineau
Hugh Stanley Mason
Joyce M. Vaneck
Dwayne D. Kirk
Amanda Maree Walmsley
Original Assignee
Boyce Thompson Institute For Plant Research
Dow Agrosciences, Llc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Boyce Thompson Institute For Plant Research, Dow Agrosciences, Llc filed Critical Boyce Thompson Institute For Plant Research
Priority to AU2004235813A priority Critical patent/AU2004235813B2/en
Priority to AT04751538T priority patent/ATE473271T1/en
Priority to NZ543348A priority patent/NZ543348A/en
Priority to CA002524293A priority patent/CA2524293A1/en
Priority to DE602004028004T priority patent/DE602004028004D1/en
Priority to EP04751538A priority patent/EP1620550B1/en
Priority to BRPI0410340-8A priority patent/BRPI0410340A/en
Publication of WO2004098533A2 publication Critical patent/WO2004098533A2/en
Publication of WO2004098533A3 publication Critical patent/WO2004098533A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/117Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8257Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
    • C12N15/8258Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon for the production of oral vaccines (antigens) or immunoglobulins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67General methods for enhancing the expression
    • C12N15/68Stabilisation of the vector

Definitions

  • the present invention generally relates to the field of plant molecular biology as it applies to the recombinant production of plant-made vaccines.
  • Vaccines produced in plant systems offer a number of advantages over conventional production systems.
  • Conventionally produced vaccines strains live and vectored may revert towards virulence or carry biological contaminants from the production process.
  • Subunit vaccines may be difficult to produce and purify due to protein instability issues and will not be glycosylated when produced in prokaryotes.
  • Plant cell production avoids the need for animal-sourced components in growth media essentially eliminating the risk of transmitting pathogenic contaminants from the production process.
  • Plant cells are capable of post translational glycosylation, and plant cell growth media is generally less expensive and easier to handle and prepare compared to conventional growth media presently used in the manufacture of vaccines.
  • Systemic immunity to a particular pathogen results from activation of the immune system in response to antigen presented by a particular pathogenic organism or via a vaccine designed to protect against a particular pathogenic agent. Exposure to a pathogen is often through mucosal surfaces that are constantly exposed and challenged by pathogenic organisms.
  • Mucosal and oral immunity results from the production of slgA (secretory IgA) antibodies in secretions that bathe all mucosal surfaces of the respiratory tract, gastrointestinal tract and the genitourinary tract and in secretions from all secretory glands. McGhee, J. R. et al., Annals N.Y. Acad. Sci. 409, (1983). These slgA antibodies act to prevent colonization of pathogens on a mucosal surface (Williams, R. C. et al., Science 177, 697 (1972); McNabb, P. C. et al., Ann. Rev. Microbiol.
  • slgA can be stimulated either by local immunization of the secretory gland or tissue or by presentation of an antigen to either the GALT (gut-associated lymphoid tissue or Peyer's patches) or the BALT (bronchial- associated lymphoid tissue).
  • GALT gut-associated lymphoid tissue or Peyer's patches
  • BALT bronchial- associated lymphoid tissue
  • M Cells cover the surface of the GALT and BALT and may be associated with other secretory mucosal surfaces. M cells act to sample antigens from the luminal space adjacent to the mucosal surface and transfer such antigens to antigen-presenting cells (dendritic cells and macrophages), which in turn present the antigen to a T lymphocyte (in the case of T-dependent antigens), which process the antigen for presentation to a committed B cell.
  • M cells act to sample antigens from the luminal space adjacent to the mucosal surface and transfer such antigens to antigen-presenting cells (dendritic cells and macrophages), which in turn present the antigen to a T lymphocyte (in the case of T-dependent antigens), which process the antigen for presentation to a committed B cell.
  • B cells are then stimulated to proliferate, migrate and ultimately be transformed into an antibody-secreting plasma cell producing IgA against the presented antigen.
  • the antigen is taken up by M cells overlying the GALT and BALT, a generalized mucosal immunity results with slgA against the antigen being produced by all secretory tissues in the body.
  • Oral immunization is therefore a most important route to stimulate a generalized mucosal immune response and, in addition, leads to local stimulation of a secretory immune response in the oral cavity and in the gastrointestinal tract.
  • Mucosal immunity can also be advantageously transferred to offspring. Immunity in neonates may be passively acquired through colostrum and/or milk. This has been referred to as lactogenic immunity and is an efficient way to protect animals during early life. slgA is the major immunoglobulin in milk and is most efficiently induced by mucosal immunization.
  • the M cells overlying the Peyer's patches of the gut-associated lymphoid tissue are capable of taking up a diversity of antigenic material and particles (Sneller, M. C. and Strober, W., J. Inf. Dis. 154, 737 (1986). Because of their abilities to take up latex and polystyrene spheres, charcoal, microcapsules and other soluble and particulate matter, it is possible to deliver a diversity of materials to the GALT independent of any specific adhesive-type property of the material to be delivered.
  • Vectors and cells useful for producing transgenic plant-derived immunoprotective antigens, and improved methods of antigen production would greatly facilitate the development, manufacture and efficacy plant-produced vaccines.
  • the invention is based on plant optimized sequences encoding an immunoprotective antigen of interest.
  • the invention is based on a plant optimized DNA sequence encoding the HN antigen of Newcastle Disease Virus or a DNA sequence encoding the HA antigen of Avian Influenza Virus.
  • the invention also includes a recombinant expression vector for effecting expression of an immunoprotective antigen gene in a plant cell, as well as plant cells and transgenic plants comprising the expression vector, as well as vaccines comprising a protein product of the expression vector.
  • the invention also relates to methods of protecting against the effects of a pathogen utilizing the vaccines of the invention.
  • the invention further relates to methods of producing an antigen in a transgenic plant.
  • the invention provides for an isolated plant optimized nucleotide sequence encoding the HN antigen of Newcastle Disease Virus comprising the sequence of SEQ ID NO: 1, as well as a recombinant expression vector comprising SEQ ID NO: 1.
  • the vector is selected from the group consisting of pCHN, pGHN, pGHN151, pGHN153, pMHN, pUHN.
  • the vector comprises a plant-functional promoter is operably linked to SEQ ID NO: 1.
  • the invention also provides for a recombinant expression vector for expressing an immunoprotective antigen in a plant cell comprising a DNA sequence encoding the HA antigen of Avian Influenza Virus, wherein the vector is pCHA
  • the invention further provides for a transgenic plant cell for expression of an immunogenic antigen comprising a vector of the invention.
  • the plant cell includes a tomato plant cell or a tobacco plant cell, as well as a cell from any of the plant species described hereinbelow.
  • the invention further provides for a transgenic plant comprising a vector of the invention.
  • the invention also provides for a vaccine comprising a recombinant viral antigenic protein and a pharmaceutically acceptable carrier, wherein the viral antigenic protein is the HN antigen of Newcastle Disease virus produced by a vector of the invention , and wherein the vaccine is capable of eliciting an immune response upon administration to an animal.
  • the HN protein of the vaccine comprises SEQ ID NO:2.
  • the HN protein of the vaccine can be produced in a plant cell.
  • the invention also provides for a vaccine comprising a recombinant viral antigenic protein and a pharmaceutically acceptable carrier, wherein the viral antigenic protein is the HA antigen of Avian Influenza Virus produced by a vector of the invention, and wherein the vaccine is capable of eliciting an immune response upon administration to an animal.
  • the HA antigen of the vaccine is produced in a plant cell.
  • the invention also provides for a method for protecting an animal against NewCastle
  • the effective amount of the vaccine is at a range of l ⁇ g to 50 ⁇ g per kilogram of body weight.
  • the invention also provides for a method of producing an antigen in a transgenic plant comprising the steps of: a) producing a transgenic plant comprising a vector encoding the antigen; b) incubating the plant under conditions wherein the plant expresses the antigen; and wherein the plant is incubated prior to the onset of ripening.
  • the plant comprises a fruit that ripens.
  • the plant is a tomato plant.
  • the fruit of the plant is harvested prior to the onset of ripening.
  • the antigen is isolated from the harvested fruit.
  • the antigen is selected from the group consisting of HN antigen of Newcastle Disease Virus, HA antigen of Avian Influenza Virus, LTB, NVCP, zona pellucida glycoprotein and HBsAg.
  • Map of pBBV-PHAS-iaaH that contains the plant selectable marker PAT includes the constitutive CsVMV (cassava vein mosaic virus) promoter and is terminated by the MAS 3' (mannopine synthase) element.
  • LB and RB left and right T-DNA border elements from Agrobacterium delineate the boundaries of the DNA that is integrated into the plant genome.
  • FIG. 1 Map of pCP!H which is a "template vector" used as a starting plasmid for a variety of plant expression vectors for expressing immunoprotective antigens.
  • FIG. 1 Map of pCHN expression vector for NDV HN protein.
  • This vector comprising the HN expression cassette includes the constitutive CsVMV promoter and is terminated by the soybean vspB 3' element.
  • FIG. 1 Map of pgHN expression vector for NDV HN protein.
  • This vector comprising the HN expression cassette includes the tuber-specific GBSS promoter with TEV 5' UTR and is terminated by the soybean vspB 3' element.
  • FIG. 6 Map of pgHN151 expression vector for NDV HN protein.
  • the HN expression vector or cassette includes the tuber-specific GBSS promoter with its native 5' UTR and intron, and is terminated by the soybean vspB 3' element.
  • the vector is derived from pBBV-PHAS-iaaH, which contains the plant selectable marker PAT, includes the CsVMV promoter and is terminated by the MAS 3' element.
  • LB and RB, left and right T-DNA border elements delineate the boundaries of the DNA that is integrated into the plant genome.
  • FIG. 7 Map of pgHN153 expression vector for NDV HN protein.
  • the HN expression vector includes the tuber-specific GBSS promoter with its native 5' UTR and intron, and is terminated by the bean phaseolin 3 ' element.
  • the vector is derived from pBBV-PHAS-iaaH, which contains the plant selectable marker PAT, includes the CsVMV promoter and is terminated by the MAS 3' element.
  • LB and RB, left and right T-DNA border elements delineate the boundaries of the DNA that is integrated into the plant genome.
  • FIG. 1 Map of pMHN expression vector for NDV HN protein.
  • the vector is derived from pBBV-PHAS-iaaH, which contains the plant selectable marker PAT, includes the CsVMV promoter and is terminated by the MAS 3' element.
  • LB and RB, left and right T-DNA border elements delineate the boundaries of the DNA that is integrated into the plant genome.
  • FIG. 9 Map of pCHA expression vector for the HA gene of the AIV A / turkey / Wisconsin / 68 (H5N9).
  • Figure 10 The DNA (SEQ ID NO: 3) and protein (SEQ ID NO: 4) sequences of the HA gene of AIV A/turkey/Wisconsin/68 (H5N9).
  • Figure 13 HA expression in transgenic NT1 cell lines using pGPTV-HAO or pCHA.
  • Figure 14 Repeated assays of pCHA-transformed NTl cell lines.
  • Figure 15. Western blot for AIV HA expression in pCHA-transformed NTl cell lines.
  • Figure 17 HA expression in leaves of pCHA-transformed potato plants.
  • Figure 18 HA expression in tubers of soil-grown pCHA-transformed potato plants.
  • Figure 20 Expression of HN per cell mass in pCHN-transformed NTl lines.
  • Figure 21 Stability of expression of HN in pCHN-transformed NTl cell lines.
  • Figure 22 Western blot of pCHN-transformed NTl cells using HN-specific antibodies.
  • Figure 25 Expression of HN in pMHN- and pCHN-transformed NTl cell lines.
  • Figure 26 HN expression in pCHN-transformed potato.
  • Figure 27 Particle behavior of HN antigen extracted from pCHN-transformed potato tubers.
  • Figure 28 HN expression in microtubers of pGHN-transformed potato plants.
  • FIG. 29 Expression of HN in tubers of pGHN -and pGHN151-transformed potato plants.
  • FIG. 30 T-DNA region from the construct pCHN.
  • Figure 31 Effect of ripening on wild type TA234 tomato fruit pH.
  • Figure 32 Effect of ripening on wild type TA234 tomato fruit total soluble protein.
  • FIG. 33 Southern analysis ofT 0 CHN tomato lines.
  • Figure 34 Total RNA from wild type and transgenic tomato fruit.
  • Figure 35 ELISA analysis of HN concentration in ripening CHN tomato fruit.
  • Figure 36 Western analysis of crude protein extracts from wild type and transgenic tomato fruit and leaves and NTl cell extracts.
  • Figure 37 Haemagglutination activity in the fruit and leaves of CHN tomatoes.
  • Figure 38 Change in maturing fruit diameter. "Week” indicates the amount of time post pollination. Points indicate the mean of three measurements while the bars indicate the standard errors of the means.
  • FIG 39 Change in fruit mass of maturing tomato fruit. "Week” indicates the amount of time post pollination. Each point represents the mean of the three measurements while the bars indicate the standard errors of the means.
  • Figure 40 Water loss from maturing tomato fruit upon lyophilization. "Week” indicates the amount of time post pollination. Points represent the mean of three measurements while the bars indicate the standard errors of the means.
  • FIG 41 Concentration of HN per gram of fresh tomato fruit. "Week” indicates the amount of time post pollination. Bars represent the average of three samples. Bars labeled with the same
  • FIG 42 Amount of HN in maturing tomato fruit. "Week” indicates the amount of time post pollination. Bars represent the average of three replicate HN contents multiplied by the masses.
  • Figure 43 The regulated biological agent (pCHN) insert in CHN- 18 master seed.
  • Figure 44 DNA sequence of the whole gene insert in CHN-18 master seed (SEQ ID NO: 12).
  • Figure 45 pCHA vector sequence (SEQ ID NO: 24).
  • Figure 46 pMHN vector sequence (SEQ ID NO: 25).
  • Figure 47 pCHN vector sequence (SEQ ID NO: 26).
  • FIG. 48 Construction of pUHN.
  • SEQ ID NOS: 1 and 2 shown in Figure 1, are the plant optimized coding sequence and protein sequence of the HN gene of NDV strain "Lasota”.
  • SEQ ID NOS: 3 and 4 shown in Figure 10, are the DNA and protein sequences of the HA gene of AIV A/turkey/Wisconsin/68 (H5N9).
  • SEQ ID NO: 5 is a PCR primer used to end-tailor the CsVMV promoter on pCP!H.
  • SEQ ID NO: 6 is a PCR primer used to end-tailor the CsVMV promoter on pCP!H.
  • SEQ ID NO: 7 is a mutagenic primer used to create a Nco I site.
  • SEQ ID NO: 8 is a forward primer complimentary to the 5' region.
  • SEQ ID NO: 9 is a mutagenic primer used to create a Xhol I site.
  • SEQ ID NO: 10 is a PCR labeled probe made by using the primer HNa.
  • SEQ ID NO: 11 is a PCR labeled probe made by using the primer HNb.
  • SEQ ID NO: 12 is the DNA sequence of the whole gene insert in CHN-18 master seed.
  • SEQ ID NO: 13 is the DNA sequence encoding Hepatitis B virus Strain Gly D surface antigen, complete cds. (GenBank accession AF 134148).
  • SEQ ID NO: 14 is the protein sequence of Hepatitis B virus Strain Gly D surface antigen. (GenBank accession AAD31865).
  • SEQ ID NO: 15 is the DNA sequence encoding Homo sapiens zona pellucida glycoprotein 3
  • SEQ ID NO: 16 is the protein sequence of Homo sapiens zona pellucida glycoprotein 3 preproprotein (sperm receptor) (ZP3). (GenBank accession NP_009086).
  • SEQ ID NO: 17 is the DNA sequence encoding Avian influenza virus hemagglutinin (HA) mRNA, complete cds. (GenBank accession U67783).
  • SEQ ID NO: 18 is the protein sequence of Avian influenza virus hemagglutinin (HA). (GenBank accession AAC58999).
  • SEQ ID NO: 19 is the DNA sequence encoding Newcastle disease virus hemagglutinin- neuraminidase (HN), mRNA, complete cds. (GenBank accession AY510092).
  • SEQ ID NO: 20 is the protein sequence of Newcastle disease virus hemagglutinin- neuraminidase (HN). (GenBank accession AAS10195).
  • SEQ ID NO: 21 is the DNA sequence encoding Gallus gallus zona pellucida glycoprotein 3 (sperm receptor) (ZP3), mRNA. (GenBank accession NM_204389).
  • SEQ ID NO: 22 is the protein sequence of Gallus gallus zona pellucida glycoprotein 3 (sperm receptor) (ZP3). (GenBank accession NP_989720).
  • SEQ ID NO: 23 is the DNA sequence of Duck hepatitis B virus. (GenBank accession X58569).
  • SEQ ID NO: 24 is the DNA sequence of vector pCHA.
  • SEQ ID NO: 25 is the DNA sequence of vector pMHN.
  • SEQ ID NO: 26 is the DNA sequence of vector pCHN.
  • an immunogen or immunoprotective antigen is a non-self substance that elicits a humoral and/or cellular immune response in healthy animals such that the animal is protected against future exposure to a pathogen bearing the immunogen.
  • the pathogens are typically agents such as viruses, bacteria, fungi and protozoa. Immunogens may also be antigenic portions of pathogens including cell wall components and viral coat proteins.
  • an immunoprotective particle is a particle or vesicle derived from a transgenic plant cell that expresses an immunogen that, when appropriately administered to an animal, provides protection against future exposure to a pathogen bearing the immunogen.
  • vaccination or vaccinating is defined as a means for providing protection against a pathogen by inoculating a host with an immunogenic preparation of a pathogenic agent, or a non-virulent form or part thereof, such that the host immune system is stimulated and prevents or attenuates subsequent host reactions to later exposures of the pathogen.
  • Providing protection refers to stimulating an immune response as defined hereinbelow.
  • a vaccine is a composition used to vaccinate an animal that contains at least one immunoprotective antigenic substances.
  • a pathogenic organism is a bacterium, virus, fungus, or protozoan that causes a disease or medical condition in an animal which it has infected.
  • an adjuvant is a substance that accentuates, increases, or enhances the immune response to an immunogen or antigen.
  • an increase, or accentuation or enhancement means a 2-fold or more, for example, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or 1000-fold or more increase in the amount of antibody produced, for example, in the response to an antigen administered in the presence of an adjuvant as compared to in the absence of an adjuvant.
  • An increase, accentuation or enhancement also means at least 5% or more antibody production, for example, 5, 6, 10, 20, 30, 40, 50, 60 70, 80, 90 or 100% or more, for example, in response to an antigen administered in the presence versus the absence of an adjuvant.
  • Adjuvants typically enhance both the humoral and cellular immune response but an increased response to either in the absence of the other qualifies to define an adjuvant.
  • adjuvants and their uses are well known to immunologists and are typically employed to enhance the immune response when doses of immunogen are limited or when the immunogen is poorly immunogenic or when the route of administration is sub-optimal.
  • the term 'adjuvanting amount' is that quantity of adjuvant capable of enhancing the immune response to a given immunogen or antigen.
  • the mass that equals an adjuvanting amount will vary and is dependant on a variety of factors including but not limited to the characteristics of the immunogen, the quantity of immunogen administered, the host species, the route of administration, and the protocol for administering the immunogen.
  • the adjuvanting amount can readily be quantified by routine experimentation given a particular set of circumstances. This is well within the ordinarily skilled artisan's purview and typically employs the use of routine dose response determinations to varying amounts of administered immunogen and adjuvant. Responses are measured by determining serum antibody titers raised in response to the immunogen using enzyme linked immunosorbant assays, radio immune assays, hemagglutination assays and the like.
  • transgenic plant cell refers to a plant cell which stably expresses a foreign gene, wherein the foreign gene is integrated into the plant cell chromosome and does not carry with it a viral vector sequence unique to a virus, where the foreign gene is passed onto the next cell generation and is capable of being expressed from the host plant cell chromosome.
  • transgenic plant material refers to a “transgenic cell suspension” comprising one or a plurality of “transgenic plant cells” obtained by well-known cell culture techniques (Street, HE. 1973, Plant tissue and cell culture: botanical monographs. Vol II, University of California, Berkeley).
  • a “trangenic plant” refers to a plant, the cells of which stably express a
  • transgenic plant comprises a "plurality of transgenic plant cells”.
  • a “transgenic plant” refers to the whole plant, or a part thereof including, but not limited to roots, stems, leaves, stalks, seeds, fruit, tubers, flowers, pollen, and the like.
  • heterologous foreign genes include, but are not limited to, Norwalk virus capsid protein (NVCP), Avian Influenza hemagglutination antigen (AIV-HA), Newcastle Disease Virus neuraminidase (NDV-HN), zona pellucida glycoprotein 3 (ZP3), and Hepatitis B surface Antigen (HBsAg).
  • NVCP Norwalk virus capsid protein
  • AIV-HA Avian Influenza hemagglutination antigen
  • NDV-HN Newcastle Disease Virus neuraminidase
  • ZP3 zona pellucida glycoprotein 3
  • HBsAg Hepatitis B surface Antigen
  • Transgenic plant is herein defined as a plant cell culture, plant cell line, plant, or progeny thereof derived from a transformed plant cell or protoplast, wherein the genome of the transformed plant contains foreign DNA, introduced by laboratory techniques, not originally present in a native, non-transgenic plant cell of the same species.
  • the terms "transgenic plant " and “transformed plant” have sometimes been used in the art as synonymous terms to define a plant whose DNA contains an exogenous DNA molecule.
  • an "edible plant” refers to a plant which may be consumed by an animal, has nutritional value and is not toxic.
  • An “edible plant” may be a "food” which is a plant or a material obtained from a plant which is ingested by humans or other animals.
  • the term "food” is intended to include plant material which may be fed to humans and other animals or a processed plant material which is fed to humans and other animals.
  • Materials obtained from a plant are intended to include a component of a plant which is eventually ingested by a human or other animal.
  • Examples of "edible plant” include, but are not limited to, tomato plants, rice plants, wheat plants, corn plants, carrot plants, potato plants, apple plants, soybean plants, alfalfa plants, medicago plants, vegetable plants, and fruit plants or any of the edible plants described herein.
  • an "edible plant” is “capable of being ingested for its nutritional value", which refers to a plant or portion thereof that provides a source of metabolizable energy, supplementary or necessary vitamins or co-factors, roughage or otherwise beneficial effect upon ingestion by an animal.
  • the animal to be treated by the methods of the present invention is an herbivore capable of bacterial-aided digestion of cellulose, such a food might be represented by a transgenic grass plant.
  • Other edible plants include vegetables and fruits.
  • transgenic lettuce plants for example, do not substantially contribute energy sources, building block molecules such as proteins, carbohydrates or fats, nor other necessary or supplemental vitamins or cofactors
  • a lettuce plant transgenic for the nucleic acid molecules described herein used as food for an animal would fall under the definition of a food as used herein if the ingestion of the lettuce contributed roughage to the benefit of the animal, even if the animal could not digest the cellulosic content of lettuce.
  • An "edible plant” therefore excludes tobacco.
  • immune response refers to a response made by the immune system of an organism to a substance, which includes but is not limited to foreign or self proteins.
  • a “mucosal immune response” results from the production of secretory IgA (slgA) antibodies in secretions that bathe all mucosal surfaces of the respiratory tract, gastrointestinal tract and the genitourinary tract and in secretions from all secretory glands (McGhee, J. R. et al., 1983, Annals NY Acad. Sci. 409).
  • slgA antibodies act to prevent colonization of pathogens on a mucosal surface (Williams, R. C. et al., Science 111, 697 (1972); McNabb, P. C. et al., Ann. Rev. Microbiol. 35, 477 (1981)) and thus act as a first line of defense to prevent colonization or invasion through a mucosal surface.
  • the production of slgA can be stimulated either by local immunization of the secretory gland or tissue or by presentation of an antigen to either the gut-associated lymphoid tissue (GALT or Peyer's patches) or the bronchial- associated lymphoid tissue (BALT; Cebra, J. J.
  • Membranous microfold cells otherwise known as M cells, cover the surface of the GALT and BALT and may be associated with other secretory mucosal surfaces.
  • M cells act to sample antigens from the luminal space adjacent to the mucosal surface and transfer such antigens to antigen-presenting cells (dendritic cells and macrophages), which in turn present the antigen to a T lymphocyte (in the case of T-dependent antigens), which process the antigen for presentation to a committed B cell.
  • B cells are then stimulated to proliferate, migrate and ultimately be transformed into an antibody-secreting plasma cell producing IgA against the presented antigen.
  • an “immune response” may be measured using techniques known to those of skill in the art.
  • serum, blood or other secretions may be obtained from an organism for which an "immune response" is suspected to be present, and assayed for the presence of the above mentioned immunoglobulins using an enzyme-linked immuno-absorbant assay (ELISA; U.S. Pat. No. 5,951,988; Ausubel et al., Short Protocols in Molecular Biology 3 rd Ed. John Wiley & Sons, Inc. 1995).
  • ELISA enzyme-linked immuno-absorbant assay
  • a protein of the present invention can be said to stimulate an "immune response" if the quantitative measure of immunoglobulins in an animal treated with a protein of interest detected by ELISA is statistically different (for example, is increased or decreased by 2-fold or more, for example, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or 1000-fold or more increase or decrease in the amount of antibody produced.
  • An increase or decrease also means at least 5% or more antibody production, for example, 5, 6, 10, 20, 30, 40, 50, 60 70, 80, 90 or 100% or more, or at least 5% or more of a decrease in antibody production) from the measure of immunoglobulins detected in an animal not treated with a protein of interest, wherein said immunoglobulins are specific for the protein of interest.
  • a statistical test known in the art and useful to determining the difference in measured immunoglobulin levels includes, but is not limited to ANOVA, Student's T-test, and the like, wherein the P value is at least ⁇ 0.1, ⁇ 0.05, ⁇ 0.01, ⁇ 0.005, O.001, and even O.0001.
  • an “immune response” may be measured using other techniques such as immunohistochemistry using labeled antibodies which are specific for portions of the immunoglobulins raised during the "immune response".
  • Tissue e.g., ovarian tissue
  • a protein of interest has been administered according to the invention may be obtained and processed for immunohistochemistry using techniques well known in the art (Ausubel et al., Short Protocols in Molecular Biology 3 rd Ed. John Wiley & Sons, Inc. 1995).
  • Microscopic data obtained by immunohistochemistry may be quantitated by scanning the immunohistochemically stained tissue sample and quantitating the level of staining using a computer software program known to those of skill in the art including, but not limited to NIH Image (National Institutes of Health, Bethesda, MD).
  • a protein of the present invention can be said to stimulate an "immune response" if the quantitative measure of immunohistochemical staining in an animal treated with a protein of interest is statistically different (as defined by an increase or decrease discussed hereinabove) from the measure of immunohistochemical staining detected in an animal not treated with the protein of interest, wherein said histochemical staining requires binding specific for that protein.
  • a statistical test known in the art may be used to determine the difference in measured immunohistochemical staining levels including, but not limited to ANOVA, Student's T-test, and the like, wherein the P value is at least ⁇ 0.1, ⁇ 0.05, ⁇ 0.01, O.005, ⁇ 0.001, and even ⁇ 0.0001.
  • a "mucosal immune response" may be "detected” using any of the above referenced techniques.
  • an ELISA assay may be employed using anti-IgA antibodies to detect and measure the mucosal-specific immunoglobulins (Dickinson, B.L. & Clements, J.D. Dissociation of Escherichia coli heat-labile enterotoxin adjuvanticity from ADP- ribosyltransferase activity. Infect Immun 63, 1617-1623 (1995)).
  • a “humoral immune response” comprises the production of antibodies in response to an antigen or antigens.
  • a cellular immune response includes responses such as a helper T-cell (CD4 + ) response and a cytotoxic T-cell lymphocyte (CD8 + ) response.
  • a mucosal immune response (or secretory immune response) comprises the production of secretory (slgA) antibodies.
  • An immune response can comprise one or a combination of these responses.
  • “animal” refers to an organism classified within the phylogenetic kingdom Animalia. As used herein, an “animal” also refers to a mammal.
  • Animals useful in the present invention, include, but are not limited to mammals, marsupials, mice, dogs, cats, cows, humans, deer, horses, sheep, livestock, poultry, chickens, turkeys, ostrich, fish, fin fish, shell fish, and the like.
  • “monocotyledonous” refers to a type of plant whose embryos have one cotyledon or seed leaf.
  • Examples of “monocots” include, but are not limited to lilies; grasses; corn; grains, including oats, wheat and barley; orchids; irises; onions and palms.
  • dicotyledonous refers to a type of plant whose embryos have two seed halves or cotyledons.
  • examples of “dicots” include, but are not limited to tobacco; tomato; the legumes including alfalfa; oaks; maples; roses; mints; squashes; daisies; walnuts; cacti; violets and buttercups.
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • plasmid refers to a circular double stranded nucleic acid loop into which additional nucleic acid segments can be ligated.
  • Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
  • Other vectors e.g., non-episomal mammalian vectors
  • vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors".
  • expression vectors of utility in recombinant nucleic acid techniques are often in the form of plasmids.
  • plasmid and vector can be used interchangeably as the plasmid is the most commonly used form of vector.
  • promoter refers to a sequence of DNA, usually upstream (5') of the coding region of a structural gene, which controls the expression of the coding region by providing recognition and binding sites for RNA polymerase and other factors which may be required for initiation of transcription. The selection of the promoter will depend upon the nucleic acid sequence of interest.
  • a "plant-functional promoter” refers to a “promoter” which is capable of supporting the initiation of transcription in plant cells.
  • Plant-functional promoters useful in the present invention include, but are not limited to the 35 S promoter of the cauliflower mosaic virus (CaMV); promoters of seed storage protein genes such as ZmalOKz or Zmagl2, light inducible genes such as ribulose bisphosphate carboxylase small subunit (rbcS), stress induced genes such as alcohol dehydrogenase (Adhl), or "housekeeping genes” that express in all cells (such as Zmact, a maize actin gene); the tomato E8 promoter; ubiquitin; mannopine synthetase (mas); rice actin I; soybean seed protein glycinin (Gyl); soybean vegetative storage protein (vsp); and granule-bound starch synthase (gbss).
  • Other "plant-functional promoters” include promoters for genes which are known to give high expression in edible plant parts, such as the patatin gene promoter from potato.
  • operably linked refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner.
  • a control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.
  • a promoter sequence is "operably-linked” to a gene when it is in sufficient proximity to the transcription start site of a gene to regulate transcription of the gene.
  • administered refers to the delivery of the transgenic plant material, cells, compositions, and pharmaceutical formulations of the present invention to an animal in such a manner so to guarantee that the "delivered” material contacts a mucosal surface of the animal to which it was administered.
  • Routes of "delivery” useful in the present invention include, but are not limited to oral delivery, nasal delivery, intraperitoneal delivery, intramuscular, intravenous or subcutaneous delivery rectal or vaginal delivery (e.g., by suppository, or topical administration), or a route of delivery wherein the delivered material directly contacts a mucosal surface (i.e., "mucosal delivery”).
  • pharmaceutically acceptable means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredient(s). The characteristics of the carrier will depend on the route of administration.
  • a “mucosal surface”, “mucosal membrane”, or “mucosa” refers to the well known medical definition of these structures, which is the surface or lining of a structure comprising an epithelium, lamina intestinal, and, in the digestive tract, a layer of smooth muscle.
  • mucosal surfaces include, but are not limited to the inner coat of the bronchi, the mucous layer of the tympanic cavity, the inner mucous coat of the colon, the inner layer of the ductus deferens, the inner coat of the esophagus, the mucous coat of the small intestine, the mucous coat of the larynx, the mucous membrane of the tongue, the pituitary membrane, the mucous membrane of the oral cavity, the mucous membrane of the pharynx, the inner mucous layer of the trachea, the lining of the auditory tube, the mucous layer of the uterine tube, the inner layer of the ureter, the inner layer of the urethra, the endometrium, the mucous membrane of the vagina, the mucous layer of the stomach, the inner coat of the urinary bladder, and the mucous membrane of the seminal vesicle.
  • a “carrier” refers to an inert and non-toxic material suitable for accomplishing or enhancing delivery of the vaccine of the present invention into an animal.
  • a carrier include, but are not limited to water, phosphate buffered saline, or saline, and further may include an adjuvant.
  • Adjuvants such as incomplete Freund's adjuvant, aluminum phosphate, aluminum hydroxide, or alum are materials well known in the art.
  • the present invention also provides pharmaceutical and veterinary compositions comprising an immunoprotective particle of the present invention in combination with one or more pharmaceutically acceptable adjuvants carriers, diluents, and excipients.
  • Such pharmaceutical compositions may also be referred to as vaccines and are formulated in a manner well known in the pharmaceutical vaccine arts.
  • administering is defined as the introduction of a substance into the body of an animal and includes oral, nasal, rectal, vaginal and parenteral routes.
  • the claimed compositions may be administered individually or in combination with other therapeutic agents via any route of administration, including but not limited to subcutaneous (SQ) intramuscular (IM), intravenous (IV), mucosal, nasal or oral.
  • SQ subcutaneous
  • IM intramuscular
  • IV intravenous
  • mucosal nasal or oral.
  • the compositions may be administered via the SQ or IM route. Especially preferred is the mucosal route, and most preferred is the oral route.
  • an effective amount or dosage of the vaccine is an amount necessary to stimulate an innate immune response as defined herein and as detected by the assays described herein as in a human or animal sufficient for the human or animal to effectively resist a challenge mounted by a pathogen.
  • an effective amount or dosage of the vaccine causes an increase in the amount of antibody that binds to the immunoprotective antigen of the vaccine.
  • an increase means a 2-fold or more, for example, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or 1000-fold or more increase in the amount of antibody produced by the vaccinated subject as compared to an unvaccinated subject.
  • An increase also means at least 5% or more antibody production, for example, 5, 6, 10, 20, 30, 40, 50, 60 70, 80, 90 or 100% or more, by a vaccinated subject as compared to an unvaccinated subject.
  • the dosages administered to such human or animal will be determined by a physician or veterinarian in light of the relevant circumstances including the particular immunoprotective particle or combination of particles, the condition of the human or animal, and the chosen route of administration.
  • the dosage ranges presented herein are not intended to limit the scope of the invention in any way and are presented as general guidance for the skilled practitioner.
  • the effective dosage can be estimated initially either in cell culture assays, or in animal models, usually mice, rabbits, dogs, or pigs. The animal model is also used to achieve a desirable concentration range and route of administration. Such information can then be used to determine useful dosages and routes for administration in humans.
  • the exact dosage is chosen by the individual physician in view of the patient to be treated. Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect. Additional factors which may be taken into account include the severity of the disease state; age, weight and gender of the subject; diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long acting pharmaceutical compositions might be administered every 3 to 4 days, every week, or once every two weeks depending on half-life and clearance rate of the particular formulation.
  • an antigenic composition of the invention will depend on many factors including, but not limited to the species, age, and general condition of the human or animal to which the composition is administered, and the mode of administration of the composition.
  • An effective amount of the composition of the invention can be readily determined using only routine experimentation. In vitro and in vivo models (for example poultry) can be employed to identify appropriate doses.
  • 0.1, 1.0, 1.5, 2.0, 5, 10, or 100 mg/kg of an antigen will be administered to a large mammal, such as a baboon, chimpanzee, or human.
  • co-stimulatory molecules or adjuvants can also be provided before, after, or together with the antigenic compositions.
  • the dosage of antigen is administered in the range of lng to 0.5 mg/kg bodyweight, more preferably, 1 mg to 50 mg/kg of body weight.
  • the efficacy of an edible vaccine according to the invention is determined by demonstrating that the administration of the vaccine prevents or ameliorates the symptoms of the disease being treated or caused by the pathogen of interest, by at least 5% , preferably 10-20% and more preferably, 25-100%.
  • "Bird” is herein defined as any warm-blooded vertebrate member of the class Aves having forelimbs modified into wings, scaly legs, a beak, and bearing young in hard-shelled eggs.
  • preferred groups of birds are domesticated chickens, turkeys, ostriches, ducks, geese, and cornish game hens.
  • a more preferred group is domesticated chickens and turkeys.
  • the most preferred bird for purposes of this invention is the domesticated chicken, including broilers and layers.
  • the methods and compositions of the present invention are directed toward immunizing and protecting humans and animals, preferably domestic animals, such as birds (poultry), cows, sheep, goats, pigs, horses, cats, dogs and llamas, and most preferably birds.
  • domestic animals such as birds (poultry), cows, sheep, goats, pigs, horses, cats, dogs and llamas, and most preferably birds.
  • Certain of these animal species can have multiple stomachs and digestive enzymes specific for the decomposition of plant matter, and may otherwise readily inactivate other types of oral vaccines.
  • ingestion of transgenic plant cells, and compositions derived therefrom can result in immunization of the animals at the site of the oral mucosa including the tonsils.
  • fruit refers to the ovary of an angiosperm flower and the associated structures (e.g. the receptacle or parts of the floral tube) that enlarge and develop to form a mass of tissue surrounding the seeds.
  • the particular tissues that are involved in fruit development vary with the species, but tissues involved in fruit development according to the invention, are always derived from the maternal parent of the progeny seeds.
  • ripe refers to a stage of fruit development that is characterized by changes in pigmentation, the conversion of acids and starches to free sugars, and breakdown of cell walls that results in softening of the fruit.
  • fruit ripening conditions refer to conditions under which the developmental processes involved in fruit ripening can occur, including cell division and expansion of maternal tissues that occurs after fertilization of ovaries.
  • production of ethylene is a chemical signal that stimulates the genetic program for ripening in climacteric fruits such as tomato.
  • prior to the onset of fruit ripening refers to a stage in fruit development wherein less than 10% (for example, 9.9, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.5%) of the fruit has undergone a change in pigmentation.
  • Primary to the onset of fruit ripening also refers to a stage in fruit development wherein less than 10% (for example, 9.9, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.5%) of the acids and starches of a fruit are converted to sugar.
  • Prior to the onset of fruit ripening also refers to a stage in fruit development wherein less than 10% (for example, 9.9, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.5%) of the cell wall material of a fruit is degraded.
  • incubating includes growing a plant either in the field or in a controlled or uncontrolled laboratory or indoor setting.
  • an antigen is produced in a plant by “incubating”, as defined herein, the plant under conditions wherein said plant expresses the antigen prior to the onset of fruit ripening.
  • the invention relates to sequences encoding an antigen of interest, for example a plant optimized sequence encoding HN antigen of Newcastle Disease Virus or HA antigen of Avian Influenza Virus.
  • the invention also relates to vectors, plant cells, transgenic plants and vaccines comprising the plant optimized sequences of the invention.
  • the invention further relates to methods of protecting against viral infection, for example infection by Newcastle Disease Virus of Avian Influenza Virus.
  • the invention also relates to methods of antigen production in transgenic plants.
  • a heterologous foreign gene of the invention can be any gene of interest including but not limited to Norwalk virus capsid protein (NVCP) (Genbank Accession Number: M87661, GenBank #AF093797, Genome for Norwalk Virus, Genbank Accession Number AAB50466, for NV capsid protein), Avian Influenza hemagluttination antigen (AIV-HA) (Genbank Accession Number U67783 and AAC58999), Newcastle Disease Virus neuraminidase (NDV- HN)(Genbank Accession Numbers NM-204389, NP-989720, NP-009086, and NM-007155) (Genbank Accession Number: AY510092 and AAS10195), zona pellucida glycoprotein 3(ZP3), Hepatitis B surface Antigen (HBsAg) (Genbank Accession Numbers AF134148, AAD31865, X58569, GenBank #
  • Newcastle's disease virus is a member of the Paramyxovirus genus of the Paramyxoviridae. Viruses in this genus are enveloped negative-strand RNA viruses that also include parainfluenza viruses like Sendai, respiratory syncytial, mumps and measles viruses (Kingsbury et al., 1978, Intervirology, 10: 137-152). Virions are characterized by the presence of two surface glycoproteins including hemagglutinin neuraminidase (HN) a 74 kDA protein and a smaller fusion (F) protein.
  • HN hemagglutinin neuraminidase
  • F smaller fusion
  • HN is involved in two important functions including cell attachment by recognition of sialic acid containing cell receptors, and neuraminidase activity cleaving sialic acid from progeny virus particles to prevent self-agglutination.
  • the F protein mediates virus-to- cell and cell-to-cell fusion and hemolysis. See Scheid, A., and Choppin, P.W. (1973) J. Virology. 11, 263-271; Scheid, A, and Choppin, P.W. (1974) Virology 57, 470-490; Lamb, R.A., and Kolakofsky, D. (1996). Paramyxoviridae: the viruses and their replication, p.577-604. In B.N. Fields, D.M.
  • Avian influenza virus is described in Suarez et al., Virus Res. 1997, 51:115 and Socket., Can. Med. Assoc. J., 1998, 158:369, incorporated herein by reference in their entirety.
  • the hemagglutinin gene of avian influenza virus is described in Barun et al., 1998, Nuc. Acids. Res., 16:4181, incorporated herein by reference in its entirety.
  • An expression cassette according to the invention comprises a DNA sequence encoding at least one immunoprotective antigen operably linked to transcriptional and translational control regions functional in a plant cell.
  • the invention provides plant expression cassettes that are useful for expressing immunoprotective antigen transgenes in plants. These cassettes comprise the following elements that are operably linked from 5' to 3':
  • Promoters useful in this embodiment are any known promoters that are functional in a plant. Many such promoters are well known to the ordinarily skilled artisan. Such promoters include promoters normally associated with other genes, and/or promoters isolated from any bacterial, viral, eukaryotic, or plant cell. It may be advantageous to employ a promoter that effectively directs the expression of the foreign coding sequence in the cell or tissue type chosen for expression.
  • the use of promoter and cell type combinations for protein expression is generally known to those of skill in the art of molecular biology, for example, see Sambrook et al, In: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989.
  • the promoters employed may be constitutive, or inducible, and can be used under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins or peptides.
  • the term "constitutive" used in the context of a promoter means that the promoter is capable of directing transcription of an operably linked nucleic acid sequence in the absence of a stimulus (e.g., heat shock, chemicals, etc.).
  • an "inducible" promoter is one which is capable of directing a level of transcription of an operably linked nucleic acid sequence in the presence of a stimulus (e.g., heat shock, chemicals, etc.), wherein the level of the transcription is different from that in the absence of the stimulus.
  • inducible also refers to expressed in the presence of an exogenous or endogenous chemical (for example an alcohol, a hormone, or a growth factor), in the presence of light and/or in response to developmental changes.
  • inducible also refers to expressed in any tissue in the presence of a chemical inducer.
  • chemical induction refers to the physical application of a exogenous or endogenous substance (including macromolecules e.g. proteins, or nucleic acids) to a plant or a plant organ (e.g.
  • Some exemplary plant functional promoters which can be used to express a structural gene of the present invention, are among the following: CaMV 35S and 19S promoters (US 5,352,605 and US 5,530,196); patatin promoter (US 5,436,393); a B33 promoter sequence of a patatin gene derived from Solanum tuberosum, and which leads to a tuber specific expression of sequences fused to the B33 promoter (US 5,436,393); tomato E8 promoter (WO 94/24298); tomato fruit promoters (US 5,556,653); -a plant ubiquitin promoter system (US 5,614,399 and 5,510,474); 5 cis-regulatory elements of abscisic acid-responsive gene expression (US 5,824,865); promoter from a badnavirus, rice tungro bacilliform virus (RTBV) (US 5,824,857); a chemically inducible promoter fragment from the 5' flanking region adjacent the coding region of a tobacco
  • polygalacturonase promoter (US 5,689,053); a seed coat-specific cryptic promoter region (US 5,824,863); a chemically inducible nucleic acid promoter fragment isolated from the tobacco PR- la gene inducible by application of a benzo-l,2,3-thiadiazole, an isonicotinic acid compound, or a salicylic acid compound (US 5,689,044); promoter fragment isolated from a cucumber chitinase/lysozyme gene that is inducible by application of benzo- 1,2,3 -thiadiazole (US 5,654,414); a constitutive promoter from tobacco that directs expression in at least ovary, flower, immature embryo, mature embryo, seed, stem, leaf and root tissues (US 5,824,872); alteration of gene expression in plants (US 5,223,419); a recombinant promoter for gene expression in monocotyledenous plants (US 5,290,924); method for using TMV to over
  • WO 94/24294 method of using transactivation proteins to control gene expression in transgenic plants (US 5,801,027); DNA molecules encoding inducible plant promoters and tomato Adh2 enzyme (US 5,821,398); synthetic plant core promoter and upstream regulatory element (WO 97/47756); monocot having dicot wound inducible promoter (US 5,684,239); selective gene expression in plants (US 5,110,732); CaMV 35S enhanced mannopine synthase promoter and method for using the same (US 5,106,739); seed specific transcription regulation (US 5,420,034); seed specific promoter region (US 5,623,067); DNA promoter fragments from wheat (US 5,139,954); chimeric regulatory regions and gene cassettes for use in plants (WO 95/14098); production of gene products to high levels (WO 90/13658); HMG promoter expression system and post harvest production of gene products in plants and plant cell cultures (US 5,670,349); gene expression system comprising the promoter region of the alpha amylase
  • a preferred group of promoters is the cassava vein mosaic virus promoters described in US Patent Application Serial Number 09/202,838, herein incorporated by reference in its entirety; the phaseolin promoters described in US Patent Number 5,591,605, herein incorporated by reference in its entirety; rice actin promoters described in US Patent Number 5,641,876, herein incorporated by reference in its entirety; the per 5 promoter described in WO 98/56921, herein incorporated by reference in its entirety; and the gamma zein promoters described in WO 00/12681.
  • a promoter DNA sequence is said to be "operably linked" to a coding DNA sequence if the two are situated such that the promoter DNA sequence influences the transcription of the coding DNA sequence.
  • the promoter DNA sequence would be operably linked to the coding DNA sequence if the promoter DNA sequence affects the expression of the protein product from the coding DNA sequence.
  • the present invention also includes DNA sequences having substantial sequence homology with the disclosed sequences encoding immunoprotective antigens such that they are able to have the disclosed effect on expression.
  • substantial sequence homology is used to indicate that a nucleotide sequence (in the case of DNA or RNA) or an amino acid sequence (in the case of a protein or polypeptide) exhibits substantial, functional or structural equivalence with another nucleotide or amino acid sequence.
  • sequences having substantial sequence homology will be de minimis; that is they will not affect the ability of the sequence to function as indicated in the present application.
  • Sequences that have substantial sequence homology with the sequences disclosed herein are usually variants of the disclosed sequence, such as mutations, but may also be synthetic sequences.
  • sequences having 95% homology to the sequences specifically disclosed herein will function as equivalents, and in many cases considerably less homology, for example 75% or 80%, will be acceptable. Locating the parts of these sequences that are not critical may be time consuming, but is routine and well within the skill in the art.
  • Exemplary techniques for modifying oligonucleotide sequences include using polynucleotide-mediated, site-directed mutagenesis. See Zoller et al. (1984); Higuchi et al. (1988); Ho et al. (1989); Horton et al.
  • the invention provides for a plant optimized sequence encoding an immunoprotective antigen of interest.
  • a plant-optimized coding sequence is designed with hybrid codon preference reflecting tomato and potato codon usage (Ausubel F., et al., eds. ( ⁇ 994)Current Protocols in Molecular Biology, vol. 3 , p. A.1C.3 Haq TA, Mason HS, Clements JD, Arntzen CJ (1995).
  • a plant optimized sequence of the invention can be prepared as described in U.S. 5,380,831, incorporated by reference herein in its entirety.
  • the frequency of codon usage for a target plant of interest is used to adjust the codon usage frequency of a target gene of interest, for example, NDV HN.
  • the native sequence is scanned for sequence motifs that might result in interference with expression in the target plant, such as poly-A addition sites, Shaw/Kamen degradation sites, splice junction sites, and anything related to RNA termination or potential hairpin formation, etc. Runs of A/T sequences are often avoided. In one embodiment, it is preferable to keep strings of A/T to four or fewer in a row, if possible, since most regulatory sites tend to contain runs of A's and T's (e.g. AATAAA consensus poly-A or ATTTA Shaw/Kamen). In general it is useful to scan for about 16 putative poly-A addition sequences based on identified sites from plants found in the literature.
  • C/G runs it is useful to search for C/G runs since they can stabilize hairpin stem formation. Since monocots tend to favor third position C's and G's somewhat more than dicots, the relevance of identification of C/G runs may depend on the host plant target for expression. In one embodiment wherein a gene is expressed in both dicots and monocots,an overall plant codon usage frequency is used as a basis for sequence optimization.
  • membrane anchor sequence contemplates that which the ordinarily skilled artisan understands about the term.
  • Membrane anchor sequences include transmembrane protein sequences and are found in many naturally occurring proteins. Such membrane anchor sequences vary in size but always are comprised of a series of amino acids with lipophilic or aliphatic side chains that favor the hydrophobic environment within the membrane.
  • the anchor sequences integrate and become embedded in the cell membrane and function to anchor, or loosely attach the protein to a cellular membrane component allowing hydrophilic portions of the protein to be exposed to, and interact with, the aqueous milieu inside or outside of the cell.
  • the various DNA fragments may be manipulated, so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame.
  • Adapters or linkers may be employed for joining the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like.
  • cloning is employed, so as to amplify a vector containing the promoter/gene of interest for subsequent introduction into the desired host cells.
  • a wide variety of cloning vectors are available, where the cloning vector includes a replication system functional in E. coli and a marker which allows for selection of the transformed cells.
  • Illustrative vectors include pBR322, pUC series, pACYC184, Bluescript series (Stratagene) etc.
  • the sequence may be inserted into the vector at an appropriate restriction site(s), the resulting plasmid used to transform the E. coli host (e.g., E. coli strains HB101, JM101 and DH5 ⁇ ), the E.
  • DNA sequence to be used in the final construct may be restricted and joined to the next sequence, where each of the partial constructs may be cloned in the same or different plasmids.
  • Vectors are available or can be readily prepared for transformation of plant cells.
  • plasmid or viral vectors should contain all the DNA control sequences necessary for both maintenance and expression of a heterologous DNA sequence in a given host.
  • control sequences generally include a leader sequence and a DNA sequence coding for translation start- signal codon, a translation terminator codon, and a DNA sequence coding for a 3' UTR signal controlling messenger RNA processing. Selection of appropriate elements to optimize expression in any particular species is a matter of ordinary skill in the art utilizing the teachings of this disclosure.
  • the vectors should desirably have a marker gene that is capable of providing a phenotypical property which allows for identification of host cells containing the vector.
  • the activity of the foreign coding sequence inserted into plant cells is dependent upon the influence of endogenous plant DNA adjacent to the insert.
  • the insertion of heterologous genes appears to be random using any transformation technique; however, technology currently exists for producing plants with site specific recombination of DNA into plant cells (see WO 91/09957). Any method or combination of methods resulting in the expression of the desired sequence or sequences under the control of the promoter is acceptable.
  • the present invention is not limited to any particular method for transforming plant cells.
  • Plant cell wall-degrading enzymes such as pectin-degrading enzymes, are used to render the recipient cells more susceptible to transformation by electroporation than untreated cells.
  • friable tissues such as a suspension culture of cells, or embryogenic callus, or immature embryos or other organized tissues directly. It is generally necessary to partially degrade the cell walls of the target plant material to pectin-degrading enzymes or mechanically wounding in a controlled manner. Such treated plant material is ready to receive foreign DNA by electroporation.
  • microprojectile bombardment Another method for delivering foreign transforming DNA to plant cells is by microprojectile bombardment.
  • microparticles are coated with foreign DNA and delivered into cells by a propelling force.
  • micro particles are typically made of tungsten, gold, platinum, and similar metals.
  • An advantage of microprojectile bombardment is that neither the isolation of protoplasts (Cristou et al, 1988, Plant Physiol, 87:671-674,) nor the susceptibility to Agrobacterium infection is required.
  • An illustrative embodiment of a method for delivering DNA into maize cells by acceleration is a Biolistics Particle Delivery System, which can be used to propel particles coated with DNA or cells through a screen onto a filter surface covered with corn cells cultured in suspension.
  • the screen disperses the particles so that they are not delivered to the recipient cells in large aggregates.
  • cells in suspension are preferably concentrated on filters or solid culture medium.
  • immature embryos or other target cells may be arranged on solid culture medium.
  • the cells to be bombarded are positioned at an appropriate distance below the macroprojectile stopping plate.
  • bombardment transformation one may optimize the prebombardment culturing conditions and the bombardment parameters to yield the maximum numbers of stable transformants. Both the physical and biological parameters for bombardment are important in this technology. Physical factors are those that involve manipulating the DNA/microprojectile precipitate or those that affect the flight and velocity of the microprojectiles.
  • Biological factors include all steps involved in manipulation of cells before and immediately after bombardment, the osmotic adjustment of target cells to help alleviate the trauma associated with bombardment, and also the nature of the transforming DNA, such as linearized DNA or intact supercoiled plasmids.
  • Agrobacterium-mediated transfer is a widely applicable system for introducing foreign
  • DNA into plant cells because the DNA can be introduced into whole plant tissues, eliminating the need to regenerate an intact plant from a protoplast.
  • Agrobacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art. See, for example, the methods described in Fraley et al, 1985, Biotechnology, 3:629; Rogers et al, 1987, Meth. in Enzymol, 153:253-277. Further, the integration of the Ti-DNA is a relatively precise process resulting in few rearrangements.
  • the region of DNA to be transferred is defined by the border sequences, and intervening DNA is usually inserted into the plant genome as described in Spielmann et al, 1986, Mol. Gen. Genet., 205:34; Jorgensen et al, 1987, Mol. Gen. Genet., 207:471.
  • Modern Agrobacterium transformation vectors are capable of replication in E. coli as well as Agrobacterium, allowing for convenient manipulations.
  • recent technological advances in vectors for Agrobacterium-mediated gene transfer have improved the arrangement of genes and restriction sites in the vectors to facilitate construction of vectors capable of expressing various proteins or polypeptides.
  • Convenient multi-linker regions flanked by a promoter and a polyadenylation site for direct expression of inserted polypeptide coding genes are suitable for present purposes.
  • Agrobacterium containing both armed and disarmed Ti genes can be used for the transformations.
  • Transformation of plant protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments (see, e.g., Potrykus et al, 1985, Mol. Gen. Genet., 199: 183; Marcotte et al, Nature, 335:454, 1988).
  • Application of these systems to different plant species depends on the ability to regenerate the particular species from protoplasts.
  • NT-1 and BY-2 are preferred because these lines are particularly susceptible to handling in culture, are readily transformed, produce stably integrated events and are amenable to cryopreservation.
  • the tobacco suspension cell line, NT-1 is suitable for the practice of the present invention.
  • NT-1 cells were originally developed from Nicotiana tabacum L.cv. bright yellow 2.
  • the NT-1 cell line is widely used and readily available; though, any tobacco suspension cell line is consistent with the practice of the invention. It is worth noting that the origins of the NT-1 cell line are unclear. Moreover, the cell line appears variable and is prone to change in response to culture conditions.
  • NT-1 cells suitable for use in the examples below are available from the American Type Culture Collection under accession number ATCC No. 74840. See also US Pat No 6,140,075, herein incorporated by reference.
  • the washed cells are placed in buffer in a range of about 0.01 gm/ml to about 5.0 gm/ml, preferably in a range of about 0.1 gm/ml to about 0.5 gm/ml (washed wet weight cells per volume of buffer).
  • buffer in a range of about 0.01 gm/ml to about 5.0 gm/ml, preferably in a range of about 0.1 gm/ml to about 0.5 gm/ml (washed wet weight cells per volume of buffer).
  • Many commercially available sonication instruments are consistent with the invention and sonication times range from about 5 to about 20 seconds, preferably about 15 to about 20 seconds.
  • the resulting particles are membrane vesicles that may range in size from a few microns to several hundred microns and expose the recombinant, immunoprotective, anchored proteins.
  • An immunoprotective agent or antigen of interest is expressed and isolated according to methods well known in the art and described in the examples herein below.
  • a method of producing an antigen of interest comprises preparing a transgenic plant comprising a vector encoding the antigen.
  • the plant is incubated under conditions wherein the plant expresses the antigen prior to the onset of ripening of the plant.
  • the plant has a fruit that ripens (including but not limited to tomato, banana, citrus, melon, strawberry, pineapple, stonefruit, mango, pumpkin, squash etc..)
  • the antigen produced according to this method can be isolated from the plant, or from the fruit of the plant prior to administration. Alternatively, the antigen is not isolated from the plant but is administed in a crude, food-processed or raw form. The details of this method are described in the Examples below.
  • the present invention also provides for a transgenic plant transformed with the constructs of the invention.
  • Plants that can be used for practice of the present invention include any dicotyledon and monocotyledon. These include, but are not limited to, tobacco, tomato, potato, eggplant, pepino, yam, soybean, pea, sugar beet, lettuce, bell pepper, celery, carrot, asparagus, onion, grapevine, muskmelon, strawberry, rice, sunflower, rapeseed/canola, wheat, oats, maize, cotton, walnut, spruce/conifer, poplar and apple, berries such as strawberries, raspberries, alfalfa and banana.
  • dicotyledons are typically employed, although monocotyledon transformation is also applicable especially in the production of certain grains useful for animal feed. It is particularly advantageous in certain disease prevention for human infants to produce a vaccine in a juice for ease of administration to humans such as juice of tomato, soybean, and carrot, or milk. Cells and seeds derived from these plant vaccines are also useful according to the invention.
  • Potato varieties FL 1607 (“Frito Lay 1607") and Desiree, and tomato variety Tanksley TA234TM2R are particularly preferred varieties, which have been transformed with binary vectors using the methods described herein. Of these transformed varieties, Desiree is the only commercial variety; the other varieties can be obtained from Frito-Lay (Rhinelander, WI) and Steve Tanksley (Dept. of Plant Breeding, Cornell Univ.). Potato variety FL1607 allows rapid transformation but is not a good agronomic variety as it suffers from hollow heart.
  • Tomato is preferred as a model system for expression of foreign proteins because of its ease of genetic transformation, and because fruit-specific, ripening dependent promoters are available for regulated expression (Giovannoni et al, 1989).
  • the invention includes whole plants, plant cells, plant organs, plant tissues, plant seeds, protoplasts, callus, cell cultures, and any group of plant cells organized into structural and/or functional units capable of expressing at least a polynucleotide of the invention.
  • whole plants, plant cells, plant organs, plant tissues, plant seeds, protoplasts, callus, cell cultures, and any group of plant cells produce 0.001, 0.01, 1, 5, 10, 25, 50, 100, 500, or 1000 ⁇ g of polypeptide of the invention per gram of total soluble plant material.
  • Food plant produced antigens provide a less expensive source of antigen, that does not require animal-sourced components, for the preparation of vaccines.
  • the vaccines according to the invention are useful for protection against a pathogen of interest and against viral infection.
  • the invention provides for methods of administering a vaccine according to the invention to a mammal to prevent viral infection.
  • a vaccine is administered orally (either by feeding or by oral gavage) to ensure inducing a mucosal immune response as well as to take advantage of cost and convenience.
  • an oral administration step entails consuming a transgenic plant or plant part according to the invention.
  • An edible vaccine according to the invention can be in the form of a plant part, an extract, a juice, a liquid, a powder or a tablet.
  • An vaccine according to the invention may also be administered by via an intranasal route in the form of a nasal spray.
  • a vaccine according to the invention may be administered orally, intraperitoneally, intramuscularly, intravenously, or subcutaneously.
  • compositions comprising an edible vaccine admixed with a physiologically compatible carrier.
  • physiologically compatible carrier refers to a physiologically acceptable diluent such as water, phosphate buffered saline, or saline, and further may include an adjuvant.
  • adjuvants such as incomplete Freund's adjuvant, aluminum phosphate, aluminum hydroxide, or alum are materials well known in the art.
  • compositions In addition to the active ingredients, these pharmaceutical compositions may contain suitable pharmaceutically acceptable carrier preparations which can be used pharmaceutically.
  • compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration.
  • Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for ingestion by the patient.
  • compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are carbohydrate or protein fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethyl cellulose; and gums including arabic and tragacanth; and proteins such as gelatin and collagen.
  • disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
  • Dragee cores are provided with suitable coatings such as concentrated sugar solutions, which may also contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
  • Push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating such as glycerol or sorbitol.
  • Push-fit capsules can contain active ingredients mixed with a filler or binders such as lactose or starches, lubricants such as talc or magnesium stearate, and, optionally, stabilizers.
  • the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers.
  • compositions for parenteral administration include aqueous solutions of active compounds.
  • the pharmaceutical compositions of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiologically buffered saline.
  • Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • suspensions of the active solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
  • the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • compositions of the present invention may be manufactured in a manner known in the art, e.g. by means of conventional mixing, dissolving, granulating, dragee- making, levitating, emulsifying, encapsulating, entrapping or lyophilizing processes.
  • the pharmaceutical composition may be provided as a salt and can be formed with many acids, including but not limited to hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc... Salts tend to be more soluble in aqueous or other protonic solvents that are the corresponding free base forms.
  • the preferred preparation may be a lyophilized powder in lmM-50 mM histidine, 0.1%-2% sucrose, 2%-7% mannitol at a pH range of 4.5 to 5.5 that is combined with buffer prior to use.
  • compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in an effective amount to achieve the intended purpose.
  • the determination of an effective dose is well within the capability of those skilled in the art.
  • the therapeutically effective dose can be estimated initially either in cell culture assays, or in animal models, usually birds, mice, rabbits, dogs, or pigs.
  • the animal model is also used to achieve a desirable concentration range and route of administration. Such information can then be use to determine useful doses and routes for administration in humans.
  • a therapeutically effective dose refers to that amount of protein or its antibodies, antagonists, or inhibitors which prevent or ameliorate the symptoms or conditions, for example caused by viral infection.
  • Therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, eg, ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population). The dose ratio between therapeutic and toxic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED50. Pharmaceutical compositions which exhibit large therapeutic indices are preferred.
  • the data obtained from cell culture assays and animals studies is used in formulating a range of dosage for human use.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage varies within this range depending upon the dosage from employed, sensitivity of the patient, and the route of administration.
  • the exact dosage is chosen by the individual physician or veterinarian in view of the patient to be treated. Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect. Additional factors which may be taken into account include the severity of the disease state; age, weight and gender of the subject; diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long acting pharmaceutical compositions might be administered every 3 to 4 days, every week, or once every two weeks depending on a half-life and clearance rate of the particular formulation.
  • compositions contain from about 0.5% to about 50% of the compounds in total, depending on the desired doses and the type of composition to be used.
  • the amount of the compounds is best defined as the effective amount, that is, the amount of each compound which provides the desired dose to the subject in need of such treatment.
  • the activity of the adjunctive combinations does not depend on the nature of the composition, so the composition is chosen and formulated solely for convenience and economy. Any of the combinations may be formulated in any desired form of composition.
  • Dosage amounts may vary from 0.1 to 100,000 micrograms of recombinant protein; transformed plant cell, or transformed transgenic plant per subject per day, for example, lug, lOug, lOOug, 500 ug, lmg, lOmg, and even up to a total dose of about lg per subject per day, depending upon the route of administration.
  • the dosage is in the range of 1 ng to ).5 mg per kilogram bodyweight.
  • the dosage is in the range of l ⁇ g to 50 ⁇ g per kilogram bodyweight.
  • the dosage is in the range of 1 to 25 ⁇ g per kilogram bodyweight.
  • the dosage is in the range of 2 to 25 ⁇ g per kg body weight.
  • the dosage is in the range of 2 to 15 ⁇ g per kg bodyweight.
  • HN antigen is administered subcutaneously in a range of 2.5 to 5 ⁇ g, and IN/ocularly in a range of .5 to 12 ⁇ g;
  • HA antigen is administered subcutaneously at a dose of 1 to 5 mg, IN/ocuraly in a range of 24 to 26 ⁇ g;
  • VP2 antigen is administered subcutaneously in a range of 8 to 17 ⁇ g, and
  • LT antigen is administered orally in a range of 50 to 100 ng, subcutaneously in a range of 2-10 ⁇ g and IN/ocularly in a range of 2 to 10 ⁇ g;
  • Guidance as to particular dosages and methods of delivery is provided in the literature.
  • the efficacy of a vaccine according to the invention is determined by demonstrating that the administration of the vaccine prevents or ameliorates the symptoms of the viral infection being treated or prevented or the symptoms induced by the pathogen of interest, by at least 5% , preferably 10-20% and more preferably, 25-100%.
  • the efficacy of a vaccine according to the invention is determined by measuring antibody production in response to vaccination with a plant derived protein of interest, detection of the production of antibody in response to vaccination with a plant derived protein of interest, wherein the antibody inhibits hemagluttination, and assessing the mortality of a subject that has been inoculated and then challenged with a vaccine comprising an immunoprotective antigen of the invention (all as described hereinbelow).
  • a plant-optimized coding sequence was designed with hybrid codon preference reflecting tomato and potato codon usage (Ausubel F., et al., eds. (1994)Current Protocols in Molecular Biology, vol. 3 , p. A.1C.3 Haq TA, Mason HS, Clements JD, Amtzen CJ (1995) Oral immunization with a recombinant bacterial antigen produced in transgenic plants. Science 268:714-716). The designed sequence is shown in Figure 1.
  • the synthetic HN gene was assembled by a commercial supplier (Retrogen) and was received in two separate plasmids containing either the 5' (p4187-4203-l) or 3' (p42111-4235-lc-l) half of the gene cloned into pCR-Blunt.
  • Plasmid construction Binary vectors for Agrobacterium-mediated plant transformations were constructed based on vector pBBV-PHAS-iaaH shown in Figure 2, which uses the plant selection marker phosphinothricin acetyl transferase (PAT), described in US Patent Nos:
  • / ⁇ Hgene and the phaseolin promoter sequence were deleted by digestion of pBBV-P ⁇ AS-iaa ⁇ with Pad and religated to form pCVMV-PAT; then the single Hindlll site was deleted by filling it with Klenow enzyme and religating to form pCP!H.
  • the CsVMV promoter was end-tailored by PCR using primers CVM-Asc (5*-ATGGCGCGCCAGAAGGTAATTATCCAAG SEQ ID NO:5) and CVM-Xho (5*-ATCTCGAGCCATGGTTTGGATCCA SEQ ID NO:6) on template pCP!H, and the product was cloned in EcoRV-digested, T-tailed pBluescriptKS to make pKS- CVM7.
  • a map of pCP!H is shown in Figure 3.
  • the HN expression cassette pKS-CHN was constructed by ligating the vector pKS-CVM7/NcoI-EcoRI with 3 insert fragments: the HN 5' half on Ncol/Pstl, the HN 3' half on Pstl/Kpnl, and the soybean vspB 3' element on Kpnl-EcoRI (Haq 1995).
  • the binary T-DNA vector pCHN was then assembled by ligation of the vector pCP!H/AscI-EcoRI and the AscI-EcoRI fragment of pKS-CHN.
  • a map of pCHN is shown in Figure 4.
  • GBSS granule bound starch synthase
  • a mutagenic primer "GSS-Nco” (5'- tgccatggtgatgtgtggtctacaa SEQ ID NO: 7) was used to create a Nco I site overlapping the translation initiation codon, along with forward primer "GSS-1.8F” (5'-gatctgacaagtcaagaaaattg SEQ ID NO:8) complimentary to the 5' region at -1800 bp; the 1825 bp PCR product was cloned in T-tailed pBluescriptKS to make pKS-GBN, and sequenced.
  • a mutagenic primer "GSS-Xho” (5'-agctcGAGCTGTGTGAGTGAGTG SEQ ID NO:9) was used to create a Xhol site just 3' of the transcription start site along with primer "GSS-1.8F”; the 1550 bp PCR product was cloned in T-tailed pBluescriptKS to make pKS-GBX, and sequenced.
  • the HN gene was inserted into ⁇ TH252A NcoI-KpnI by ligation with the HN 5' half on Ncol/Pstl and the HN 3' half on Pstl/Kpnl to make ⁇ HN252A.
  • the binary T-DNA vector pgHN was made by ligation of the vector pGLTB (shown in Figure 11) digested with Nsil and EcoRI with the fragments pHN252A/NsiI-KpnI and pTH210/KpnI-EcoRI.
  • a map of pgHN is shown in Figure 5.
  • the binary T-DNA vector pgHN151 was made by ligation of the vector pCLT105 (shown in Figure 12) with fragments pTH251A/HindIII-NcoI and pHN252A/NcoI-KpnI. A map of pgHN151 is shown in Figure 6.
  • a GBSS promoter expression cassette containing the GBSS 5 'UTR with its intron and the bean phaseolin 3' element (described in US Patent Nos. 5,270,200; 6,184,437; 6,320,101, herein incorporated by reference) was constructed.
  • pCP!H was digested at the unique Kpnl site, blunted with T4 DNA polymerase, and religated to make pCP!HK, which has the Kpnl site removed.
  • pCPIHK was digested with Nsil, followed by blunting with T4 DNA polymerase, and then digestion with Pad.
  • the resulting vector was ligated with a 2848 bp fragment from pgHN151 digested with Sad, followed by blunting with T4 DNA polymerase, and then digestion with Pad, to make pgHN 153.
  • a map of pgHN 153 is shown in Figure 7.
  • a chimeric constitutive promoter (4OCS ⁇ MAS US pat Nos: 5,001,060; 5,573,932 and 5,290,924 herein incorporated by reference) was used to construct another expression vector for HN. Plasmid, pAGM149, was digested with EcoRV and partial digestion with BamHI. This fragment was ligated with pCHN digested with Pmel/Pstl and the 5' half of the synthetic HN gene obtained by digestion of pKS-CHN with BamHI Pstl. The resulting pMHN is shown in Figure 8.
  • a plasmid containing the HA gene of AIV A/turkey/Wisconsin/68 was obtained from David Suarez (SEPRL, Athens, GA). It was end-tailored by PCR to add restriction sites Ncol at the 5' and Kpnl at the 3' end, and inserted into the vector pIBT210.1 (Haq et al., 1995), containing the 35S promoter, TEV 5'-UTR, and vspB 3' end. The expression cassette was transferred to the binary vector pGPTV-Kan (Becker et al., Plant Mol Biol 1992; 20: 1195-7) by digestion with Hindlll and EcoRI (partial), to make pIBT-HAO.
  • the HA gene/vspB3' end fragment from pIBT-HAO was obtained by digestion with Ncol and EcoRI (partial), and inserted into pKS-CVM7 to make pKS-CHA.
  • the cassette containing the CsVMV promoter, HA gene, and vspB3' end was obtained from pKS-CHA by digestion with Ascl and EcoRI (partial), and ligated with pCP!H to make pCHA, shown in Figure 9.
  • a dicot expression vector containing the plant-optimized nucleotide sequence of NDV- HN was constructed.
  • the completed construct contained the gene cassette; Arabidopsis thaliana (At) Ubiquitin 3 (Ubi3) promoter v2/ Newcastle Disease Virus Hemagluttin Neuraminidase (NDV-HN)/ vspb 3 'UTR :: Cassava Vein Mosaic Virus (CsVMV) promoter/ PAT selectable marker/ Arabidopsis thaliana (At) ORF 25 3 'UTR in a binary expression vector.
  • Arabidopsis thaliana Arabidopsis thaliana
  • Ubi3 Ubiquitin 3
  • NDV-HN Newcastle Disease Virus Hemagluttin Neuraminidase
  • vspb 3 'UTR : Cassava Vein Mosaic Virus (CsVMV) promoter/ PAT selectable marker/ Arabidopsis thaliana (
  • the expression cassette was assembled by completing a 3-way ligation ( Figure48).
  • the binary vector pCGUS was modified by removing the CsVMV promoter and GUS gene.
  • a restriction enzyme digest with the enzymes HinDIII and Kpnl (New England Biolabs) liberated a DNA fragment of 8310 bp.
  • the NDV-HN gene was isolated from the plasmid pCHN as an Ncol/ Kpnl (New England Biolabs) restriction enzyme digestion DNA fragment of 1731 bp.
  • the AtUbi3 promoter v2 was isolated from pDAB7121 as an Ncol / Hindlll (New England Biolabs) restriction enzyme digestion. The resulting reaction produced a DNA fragment of 1732 bp.
  • the DNA of all three enzyme digestions was excised from agarose gel via the "QiaexII Gel Extraction Kit” (Qiagen). A 3-way ligation was completed using equimolar concentrations of all three DNA fragments. The ligation was catalyzed by the "T4 DNA Ligase” (New England Biolabs). The resulting ligation product was transformed into "One Shot Top 10 Chemically Competent E. coli. " (Invitrogen). Two colonies were isolated from this transformation. Initial screening via restriction enzyme digestion indicated that both clones produced the expected DNA banding pattern. The restriction enzyme reactions that were completed used the following enzymes; EcoRV, Fspl, HinDIII, Ncol, Sad, Seal (New England Biolabs) .
  • the NDV-HN / pCGUS border and pCGUS/ AtUbi3 'promoter v2 border were PCR amplified using the "FailSafe PCR Kit" (Epicenter). Two reactions for the NDV-HN / pCGUS border were completed using the FailSafe buffer's B and C with the PCR primers Kpnl 5' (act aat act taa tga taa ca) and Kpnl 3' (ata cac tac etc cac atg tt).
  • the PCR reactions for the pCGUS / AtUbi3' promoter v2 border were completed using FailSafe buffer's B and C with the PCR primers HinDIII 5' (tgccggttttcaggtaac ata) and HinDIII 3' (agt tag gcc cga ata gtt tga a). All of the PCR reactions produced DNA fragments of the expected length ( ⁇ 600bp).
  • the PCR amplifications of the border regions were cloned into the "TOPO TA cloning kit with pCR2.1-TOPO" (Invitrogen). Clones containing the amplified border region were identified via an EcoRI restriction enzyme digestion (New England Biolabs).
  • NT-1 culture Three to 4 days prior to transformation, a 1 week old NT-1 culture was sub-cultured to fresh medium by adding 2 ml of the NT-1 culture into 40 ml NT-1 media. The sub-culture was maintained in the dark at 25 + 1°C on a shaker at 100 rpm.
  • KH 2 PO 4 - 60 g Agrobacterium tumefaciens containing the expression vector of interest was streaked from a glycerol stock onto a plate of LB medium containing 50 mg/l spectinomycin.
  • the bacterial culture was incubated in the dark at 30°C for 24 to 48 hours.
  • One well-formed colony was selected, and transferred to 3 ml of YM medium containing 50 mg/L spectinomycin.
  • the liquid culture was incubated in the dark at 30°C in an incubator shaker at 250 rpm until the OD 600 was 0.5 - 0.6. This took approximately 24 hrs.
  • YM in powder form can be purchased (Gibco BRL; catalog #10090-011). To make liquid culture medium, add 11.1 g to 1 liter water.)
  • acetosyringone On the day of transformation, 1 ⁇ l of 20 mM acetosyringone was added per ml of NT-1 culture. The acetosyringone stock was made in ethanol the day of the transformation. The NT-1 cells were wounded to increase the transformation efficiency.
  • the suspension culture was drawn up and down repeatedly (20 times) through a 10 ml wide-bore sterile pipette. Four milliliters of the suspension was transferred into each of 10, 60 x 15 mm Petri plates. One plate was set aside to be used as a non-transformed control. Approximately, 50 to 100 ⁇ l of Agrobacterium suspension was added to each of the remaining 9 plates. The plates were wrapped with parafilm then incubated in the dark on a shaker at 100 rpm at 25 + 1°C for 3 days.
  • NTC medium NT-1 medium containing 500 mg/L carbenicillin, added after autoclaving. They were mixed, then centrifuged at 1000 rpm for 10 min in a centrifuge equipped with a swinging bucket rotor. The supernatant was removed, and the resultant pellet was resuspended in 45 ml of NTC. The wash was repeated. The suspension was centrifuged, the supernatant was discarded, and the pellet was resuspended in 40 ml NTC.
  • NTC medium NT-1 medium containing 500 mg/L carbenicillin, added after autoclaving
  • NTCB10 medium solidified with 8g/l Agar/Agar; supplemented with 10 mg/l bialaphos, added after autoclaving. Plates were wrapped with parafilm then maintained in the dark at 25° + 1°C. Before transferring to the culture room, plates were left open in the laminar flow hood to allow excess liquid to evaporate. After 6 to 8 weeks, putative transformants appeared. They were selected and transferred to fresh NTCB5 (NTC medium solidified with 8g/l Agar/Agar; supplemented with 5 mg/l bialaphos, added after autoclaving). The plates were wrapped with parafilm and cultured in the dark at 25° ⁇ l°C.
  • Putative transformants appeared as small clusters of callus on a background of dead, non- transformed cells. These calli were transferred to NTCB5 medium and allowed to grow for several weeks. Portions of each putative transformant were selected for ELISA analysis. After at least 2 series of analysis by ELISA, lines with the highest antigen levels were selected. The amount of callus material for each of the elite lines was then multiplied in plate cultures and occasionally in liquid cultures. The resulting transformed NT-1 cell lines expressed and accumulated the HN protein from Newcastle Disease Virus (Lasota strain), or transformed cell line CHA expressed the HA protein from Avian Influenza Virus. These lines contain an undetermined number of copies of the T-DNA region of the plasmids stably integrated into the nuclear chromosomal DNA. The transgenic CHN NT-1 cells accumulate HN at levels up to 1% of total soluble protein as determined by HN-specific ELISA.
  • Transgenic NTl cell and potato lines selected for Bialaphos® resistance were propagated and evaluated for HN expression by ELISA.
  • High-expressing NTl cell lines were established in liquid suspension culture.
  • Potato lines containing a constitutive promoter construct (pCHN, pMHN) were screened for expression in leaf tissue, and selected lines were transferred to soil and cultured in a greenhouse to obtain tubers for evaluation.
  • Potato lines containing a tuber- specific GBSS promoter construct pGHN, pGHN151, pGHN153
  • HN in NTl cell lines assayed from callus growing on solid media is shown in Figure 19.
  • the highest expressing lines were CHN-5 (8.5 ng/ ⁇ g TSP) and CHN-18 (6.2 ng/ ⁇ g TSP).
  • Lines CHN-1 and CHN-5 were established in liquid suspension culture.
  • the expression of HN per unit cell mass in these cultures is shown in Figure 20.
  • Line CHN-5 showed expression of HN at 6.7 ⁇ g per g cell mass.
  • the same cell lines shown in Figure 20 were evaluated multiple times, and some new lines assayed at the last time point, stability of expression of HN in the NTl lines ( Figure 21).
  • HN expression in pMHN-transformed NTl lines using the (4ocs) ⁇ MAS promoter HN expression in several NTl cell lines transformed with pMHN, compared to pCHN- transformed NTl cell lines, is shown in Figure 25. Expression in pMHN-transformed lines was at least as high as in pCHN-transformed lines, with the highest accumulation of HN observed at approximately 30 ⁇ g per gram cell mass. Maximal HN expression in pCHN- transformed NTl cells was less than 20 ⁇ g per gram cell mass. Bialaphos® resistant NTl cell lines were also generated and assayed for HA expression by ELISA as described previously.
  • NT-1 tobacco suspension cultures (non-trans genie and transgenic lines) were maintained in 250 ml Erlenmeyer flasks. Initially, the cells were cultured in a modified liquid Linsmaier and Skoog medium (LS) (1965).
  • the medium, designated LSg contained LS salts and vitamins, 30 g l "1 glucose, and 0.05 mg l "1 2,4-dichlorophenoxyacetic acid (2,4-D). The pH of the medium was adjusted to 5.8.
  • the cultures were transferred to fresh medium weekly by transferring 6 ml of 7-day-old cultures into 50 ml of LSg medium.
  • KCMS contained Murashige and Skoog (MS) (1962) salts, 1.3 mg l "1 thiamine, 200 mg l "1 KH 2 PO 4 , 30 g l "1 sucrose, 0.2 mg f 1 and 0.1 mg l *1 kinetin.
  • NT-1 medium contained MS salts, 180 mg l "1 KH 2 PO 4 , 0.5 mg l "1 2-N- morpholinoethanesulfonic acid, 1 mg l '1 thiamine, 100 mg l "1 myoinositol, 30 g l "1 sucrose, and 2.21 mg l "1 2,4-D.
  • the pH of both media was adjusted to 5.7.
  • 2 ml of a 7-day-old culture were transferred into 48 ml of either KCMS or NT-1. All suspension cultures were maintained in the dark at 25°C on an orbital shaker at 100 rpm
  • Preculture Three days after subculture (late exponential growth period), the cells were precultured in their respective medium (LSg, KCMS, or NT-1) by replacing one third of the medium with IM mannitol (for final concentration of 0.3 M), for 24 to 72 h.
  • the vitrification solution designated PVS2/100% contained 30% glycerol, 15% ethylene glycol, and 15% DMSO in a 0.4 M sucrose solution.
  • a PVS2/20% solution was made by diluting PVS2/100%. Both solutions were adjusted to a pH of 5.8, autoclaved, then stored at 4°C.
  • the vitrified cells were thawed in a 40°C water bath for 3 - 5 sec, then immediately diluted with 7 ml of cold 1.2 M sucrose. The cells were kept on wet ice for 20 min, then centrifuged for 3 min at 7500 - 8000 rpm. Cells were transferred to 2 layers of filter paper (42.5 mm Whatman) on LSg or NT-1 solidified medium containing
  • 0.75% agarose (Invitrogen Life Technologies, Carlsbad, CA) in 60 x 15 mm tissue culture plates. The cultures were maintained at 25°C in the dark. Two days after plating, the cells were transferred to fresh NT-1 solidified medium. Transgenic lines were initially plated on medium without a selection agent until cell growth was well established and covered a small plate. They were then transferred to medium containing the appropriate selection.
  • the cells were transferred to fresh medium approximately every 2 wk.
  • the cells were removed from the filter paper and transferred to larger plates (100 x 15 mm).
  • the cells were transferred to NT-1 medium solidified with 8 g l "1 Agar (Sigma, St. Louis, MO) for maintenance.
  • NT-1 cells expressing either HN, HA or null control were harvested directly from cell culture and filtered to remove excess media by placing a Spectramesh 30 filter in a Buchner funnel and pouring cells and media through the filter using a slight vacuum. 0.5 grams of cells were placed in 2 mis of buffer (Dulbeccos Phosphate Buffered Saline and ImM EDTA), and then sonicated for 15 to 20 seconds on ice. Sonication was performed using a Branson 450 sonifier with a replaceable microtip at output control of 8, duty cycle 60 for varying amounts of time. Sonicates were then placed on ice until use.
  • buffer Dulbeccos Phosphate Buffered Saline and ImM EDTA
  • Plant-derived HN extracted without detergent was used as the antigen in hemagglutination inhibition assays to determine if polyclonal antibody produced to native virus could recognize and inhibit agglutination of RBC's by the plant-derived HN.
  • the results indicate that native antibody will recognize the hemagglutination epitope of the plant-derived HN in a similar manner as native virus (Table 2).
  • the data from Table 2 also demonstrates that control NT-1 cells or NT-1 cells expressing a non-hemagglutinating protein do not agglutinate red blood cells nor are affected by NDV specific serum.
  • extracts of plant- derived protein were diluted to 4 HA units, and then treated with NDV specific polyclonal antisera. Four HA units is the standard amount of virus used for titration of serum. Table 2
  • HAI hemagglutination inhibition
  • Stock virus is diluted such that 4HA units, a 1 :4 dilution of the stock will generate a positive HA but a dilution of 1 :8 will not hemagglutinate. This is the concentration of virus used to titer antibody, the endpoint dilution of antibody that will interfere with 4 HA units of virus is considered to be the HAI titer of the antibody preparation.
  • Quantitative ELISA for HN is performed by coating plates on the day prior to running the assay. 50 ⁇ l per well of Capture Antibody (Rabbit anti-HN in 50% glycerol, diluted (1 :500) in 0.0 IM Borate Buffer) is added to each well of each flat bottom 96-well microtiter plate. The plate is covered and incubated at 2°C - 7°C overnight, (12-18 hours). The coated ELISA plate(s) are allowed to equilibrate to room temperature (approximately 20-30 minutes) and then washed three times with 200-300 ⁇ l per well per wash with PBS-T.
  • Capture Antibody Rabbit anti-HN in 50% glycerol, diluted (1 :500) in 0.0 IM Borate Buffer
  • HN Reference antigen (Ag) in 1% Skim Milk Blocker is added to a concentration of 250 ng HN/ml; experimental antigens are diluted in 1% Blocker.
  • the HN ELISA plate(s) are washed one time with PBS-T and 100 ⁇ l per well of diluted HN Reference Antigen and HN Test Samples are added to Row B. 50 ⁇ l per well of 1% Blocker is added to all remaining wells.
  • the samples are serially diluted down the plate by transferring 50 ⁇ l per well from row B to row G, mixing 4-5 times with the pipette before each transfer.
  • the plate(s) are covered and incubated 1 hour (+10 minutes) at 37°C ⁇ 2°C; and the ELISA plate(s) are washed three times with PBS-T.
  • Fifty ⁇ l of NDV HN 4A Ascites Fluid in 50% glycerol (1 :2000) in 3% Blocker is added to each well and the plates are covered and incubated 1 hour (+10 minutes) at 37°C ⁇ 2°C.
  • the ELISA plate(s) are washed three times with PBS-T and 50 ⁇ l of rabbit anti- Mouse IgG in 50% glycerol (1 :3000) in 3% Blocker is added to each well. The plates are covered and incubated 1 hour (+ 10 minutes) at 37°C ⁇ 2°C. ELISA plate(s) are washed three times with PBS-T and 50 ⁇ l of ABTS Peroxidase Substrate Solution (equilibrated at RT (room temperature) for at least 30 minutes) is added to each well. The plates are covered and incubated at RT in the dark for 15-20 minutes.
  • Optical Density (OD) of the wells are read at a wavelength of 405 nm (with a 492nm Reference Filter).
  • the initial dilution of the HN Reference Antigen should be within 0.7 - 1.0 OD, this serves as the positive control for the ELISA.
  • the plates are coated on the day prior to running the assay.
  • Fifty ⁇ l per well of Capture Antibody (goat anti-Hav5 in 50% glycerol, diluted (1 :1000) in 0.0 IM Borate Buffer) is added to each well of flat bottom 96-well microtiter plate(s)).
  • the plate(s) are covered and incubate at 2°C - 7°C overnight, (12-18 hours).
  • the coated ELISA plate(s) is(are) allowed to equilibrate to room temperature (approximately 20-30 minutes) and is(are) then washed three times with 200-300 ⁇ l per well per wash with PBS-T.
  • the entire plate is blocked to prevent non-specific reactions by adding 200 ⁇ l per well of 3% Skim Milk Blocking Solution.
  • the plate(s) is(are) then incubated for 2 hours (+ 10 minutes) at 37°C ⁇ 2°C (covered with a plate cover or equivalent).
  • AIV-HA (allanotoic fluid) reference Antigen is added in 1% Skim Milk Blocker to a concentration of 1000 ng HA/ml and experimental antigens are diluted in 1% Blocker.
  • the HA ELISA plate(s) are washed one time with PBS-T and 100 ⁇ l per well of diluted HA reference antigen and HA Test Samples are added to Row B. 50 ⁇ l per well of 1% Blocker is added to all remaining wells.
  • the samples are serially diluted down the plate by transferring 50 ⁇ l per well from row B to row G, mixing 4-5 times with the pipette before each transfer.
  • the plate(s) are covered and incubated 1 hour (+10 minutes) at 37°C ⁇ 2°C.
  • the ELISA plate(s) are washed three times with PBS-T.
  • Fifty ⁇ l of chicken anti-AIV polyclonal antisera in 50% glycerol (1 :2000) in 3% Blocker is added to each well and the plates are covered and incubated 1 hour (+10 minutes) at 37°C ⁇ 2°C.
  • the ELISA plate(s) are washed three times with PBS-T and then 50 ⁇ l of goat anti-chicken IgG in 50% glycerol (1 :3000) in 3% Blocker is added to each well. The plates are covered and incubated 1 hour (+ 10 minutes) at 37°C ⁇ 2°C. The ELISA plate(s) are washed three times with PBS-T and 50 ⁇ l of ABTS Peroxidase Substrate Solution (equilibrated at RT for at least 30 minutes) is added to each well. The plate(s) are covered and incubated at RT in the dark for 15-20 minutes.
  • the Optical Density (OD) of the wells read at a wavelength of 405 nm (with a 492nm Reference Filter).
  • the initial dilution of the HA Reference Antigen should be within 0.7 - 1.0 OD, this serves as the positive control for the ELISA.
  • Plates are coated with rabbit ⁇ -NDV pooled antiserum (Mixed 1 :2 with 50% glycerol in water) diluted (1 :2000) in 0.01 M borate buffer (100 ⁇ l/well). Plates are incubated overnight at 2- 7°C, covered and then equilibrated for approximately 20-30 minutes at room temperature. Plates are washed 3X with PBS-T (IX PBS + 0.05% Tween-20) at 300 ⁇ l/well with the Titertek M96 plate washer or equivalent. Plates are blocked with 5% skim milk in PBS-T (Blocking Buffer) (200 ⁇ l/well) and incubated for 2 hours at 37°C.
  • PBS-T Locking Buffer
  • NDV allantoic fluid is diluted 1 :200 in Blocking Buffer. lOO ⁇ l/well of the diluted antigen is added to the plate, and plates are incubated for 1 hour at 37 °C. Plates are washed 3X with PBS-T at 300 ⁇ l/well with the Titertek M96 plate washer or equivalent.
  • Test chicken serum samples are diluted (1:50). Negative control serum is diluted (1:50) (Neg. Control 27NOV00). Positive control serum is diluted (1 :10,000 or 1 :20,000) (SPAFAS Chicken ⁇ -NDV serum). All serum samples are diluted in Blocking Buffer.
  • Plates are coated with Rabbit ⁇ -HA pooled antiserum diluted (1:1000) in 0.01 M borate buffer and incubated overnight at 2-7°C, covered. Plates are equilibrated for approximately 20- 30 minutes at room temperature and then washed 3X with PBS-T (PBS Stock + 0.05% Tween- 20) at 300 ⁇ l/well using the Titertek M96 plate washer or equivalent. The plates are blocked with 5% skim milk in PBS-T (Blocking Buffer) (200 ⁇ l/well) and incubated for 1 hour at 37 °C. The plates are washed IX with PBS-T at 300 ⁇ l/well using the Titertek M96 plate washer or equivalent.
  • Inactivated T/W/68 AIV Allantoic Fluid is diluted (1 : 100) in Blocking Buffer and 1 OO ⁇ l/well of the diluted antigen is added to the plate. Plates are incubated for 1 hour at 37°C. The plates are washed 3X with PBS-T at 3 OO ⁇ l/well using the Titertek M96 plate washer or equivalent. Test chicken serum samples are diluted (1:50). Negative control serum is diluted (1 :50). Positive control serum is diluted (1 :25600) (USDA/SEPRL Chicken ⁇ -AIV (T/W/68 antiserum) All serum is diluted in Blocking Buffer.
  • Goat ⁇ -Chicken IgG (H&L)- HRP is diluted (1 :3000) in Blocking Buffer and 100 ⁇ l/well of the diluted conjugate is added to each plate. Once the conjugate is added to the plates, the ABTS substrate is equilibrated at RT in the dark. The plates are incubated for 1 hour at 37°C and then washed 3X with PBS-T at
  • HA and HN protein were prepared and inoculated into rabbits. New Zealand White rabbits 3 months of age were inoculated with HA- AIV or HN-NDV according to the dose schedule provided in Table 3.
  • CFA Complete Freund's Adjuvant
  • Incomplete Freund's Adjuvant was used for all booster inoculations.
  • the antibody titers induced by both proteins are provided in Table 4. The results indicate that after two inoculations HAI antibody titers were induced by both proteins.
  • the titers of the AIV-HA inoculated rabbits were higher than those induced by the NDV-HN protein. This may be significant since the AIV/HA protein had lower overall biological activity (hemagglutination) per unit of AIV-HA protein than NDV-HN (Table 3 column 4). This may indicate that the AIV-HA protein derived from plants is more potent per unit of protein than the NDV-HN protein considering that the quantitation methods from both proteins are accurate. It also suggests that the AIV-HA protein formulated in this manner would be immunogenic in chickens. Table 3 Dose levels for inoculation into rabbits
  • HN protein was inoculated into chickens that were 2 days of age and 10 days of age.
  • the dose concentrations used for these studies are provided in Table 5. All vaccine inoculum were formulated with the soluble fraction of NT-1 cells grown 15-20 days in shaker flasks at 25°C.
  • Adjuvant used in both trials was MPL-TDM from Corixa, Inc. Intranasal groups were given MPL alone as the adjuvant.
  • Example 9 Challenge in Poultry
  • HN protein was formulated to have high hemagglutination activity to total soluble protein ratios. These materials were then inoculated by SQ, intranasal (IN) and by oral routes. The results indicate that both HA-AIV and HN-NDV protein derived from NT-1 cells will induce hemagglutination inhibition (HAI) antibody in rabbits when formulated in this manner.
  • HN-NDV derived from NT-1 inoculated by SQ route in chickens will induce (HAI) antibodies and protect against virulent NDV challenge.
  • a high titer response after challenge is indicative of a good sensitizing immunization, yet, it is not unprecedented with native or recombinant derived NDV antigen that birds will be protected without a detectable HAI or ELISA antibody titer (Winterfield, R. W., Dhillon, A. S., and L.J. Alby, 1979. Vaccination of Chickens against Newcastle Disease with Live and Inactivated Newcastle Disease Virus. Poultry. Sci. 59: 240-246). It is proposed that either a cellular immune response or a local immune response is involved with providing immune protection in a vaccinated bird where no humoral antibody response can be detected
  • Adjuvant also seems to be an important feature in formulating the antigen in these trials. Although the adjuvant effect was not evident when using higher doses of NT-1 derived NDV- HN (compare groups 3 and 4, Table 6 with groups 6 and 7, Table 8), there was a clear adjuvant effect when using a low dose of NDV-HN (compare groups 4 and 5, Table 8). In addition, although there was 100% mortality in groups inoculated by intranasal route, the group that received adjuvant had 2 birds (#923 and #1088) that did not die until day 8, which was 3 days after all negative control birds had succumbed to challenge (Table 9).
  • HN-NDV derived from transformed NT-1 cells is efficacious against virulent challenge to NDV.
  • the immune response to the plant derived antigen has several similarities to immune response to native antigen. 1) Although the antibody titers are higher for native antigen pre-challenge, a 20 ug dose inoculated SQ will provide protection against challenge for both native and plant derived antigen. 2) Antibody titers must have similar duration of response in that in both studies challenge was performed 24 days and 31 days post vaccination. 3) All birds producing a positive HAI antibody response (above background) at the end of the vaccination schedule and post challenge were protected from NDV associated pathology.
  • HN-NDV antigen derived from transgenic NT-1 cell culture will protect against virulent challenge when administered SQ. Furthermore, despite feeding several milligrams of antigen in the oral treatment groups, no HAI antibody was induced in the systemic compartment and no protection against challenge was observed. Thus, as previous data have shown, antigens that do not have a natural affinity or invasiveness for the antigen presenting sites on the mucosal surface need to be targeted to those sites with the aid of a protein that does sensitize the mucosal surface.
  • Binary vectors pCHN, pgHN, pMHN and pCHA were used to transform potato (cv. Desiree) and transgenic tubers analysed for expression of the recombinant HN antigen from NDV, or the recombinant HA antigen from Avian Influenza Virus. Plant material. In vitro plants of Solanum tuberosum cv Desiree were provided by Dr. Steven Slack, Department of Plant Pathology, Cornell University.
  • CM shoot propagation medium
  • MS salts Murashige and Skoog, 1962
  • 100 mg/l myoinositol 100 mg/l myoinositol
  • thiamine 20 g/l sucrose
  • 8g/l Agar/Agar Sigma Chemical Co., St. Louis, MO; catalog # A-1296.
  • the pH of the medium was adjusted to pH 5.7 before the addition of the Agar/Agar.
  • One nodal explant was placed in each test tube and maintained at 24° + 1°C under a photoperiod of 16h (light)/8 h (dark) at 74 ⁇ E m ' V.
  • Agrobacterium preparation Agrobacterium tumefaciens containing the gene construct of interest was streaked from a glycerol stock maintained at -80°C onto Petri plates of LB medium which contained 10 g/l bacto tryptone, 5 g/l yeast extract, lOg/l NaCl, 50 mg/l spectinomycin, and 15g/l Difco Bacto Agar (Difco Laboratories, Detroit, MI; catalog #DF 0140-01). Four well- formed colonies were picked with a sterile pipet tip, then added to 50 ml of YM medium (Gibco BRL cat.# 10090-011) containing 50 mg/l spectinomycin.
  • Cultures were grown in a shaking incubator at 28°C and 100 m for 24 hrs, or until the culture reached an OD 600 of 0.5 - 0.7. It takes approximately 24 hrs to reach this OD. When the desired OD was reached, the cells were centrifuged at 8000 ⁇ m for 10 min at 20°C.
  • the pellet was resuspended in MS liquid medium (MS salts, 2 mg/l glycine, 0.5 mg/l nicotinic acid, 0.5 mg/l pyridoxine, 0.4 mg/l thiamine, 0.25 mg/l folic acid, 0.05 mg/l d-biotin, 100 mg/l myoinositol, 30 g/l sucrose, pH 5.6) at the same original volume as the YM selective medium.
  • MS liquid medium MS salts, 2 mg/l glycine, 0.5 mg/l nicotinic acid, 0.5 mg/l pyridoxine, 0.4 mg/l thiamine, 0.25 mg/l folic acid, 0.05 mg/l d-biotin, 100 mg/l myoinositol, 30 g/l sucrose, pH 5.6
  • CIM medium designated CIM which contained MS salts, 2 mg/l glycine, 0.5 mg/l nicotinic acid, 0.5 mg/l pyridoxine, 0.4 mg/l thiamine, 0.25 mg/l folic acid, 0.05 mg/l D-biotin, 100 mg/l myoinositol, 30 g/l sucrose (grade II; PhytoTechnology Laboratories, Shawnee Mission, KS), 1 mg/l benzyladenine (BA), 2 mg/l naphthaleneacetic acid (NAA) (added after autoclaving), and 6 g/l Agar/Agar (PhytoTechnology Laboratories, Shawnee Mission, KS).
  • CIM which contained MS salts, 2 mg/l glycine, 0.5 mg/l nicotinic acid, 0.5 mg/l pyridoxine, 0.4 mg/l thiamine, 0.25 mg/l folic acid, 0.05 mg/l D-bio
  • the pH of the medium was adjusted to 5.6 before the addition of the Agar/Agar.
  • One hundred explants were cultured per 100 x 20 mm Petri plates. All cultures were maintained at 24° + 1°C under a photoperiod of 16h (light)/8 h (dark) at 74 ⁇ E m-V 1 .
  • the pH of the medium was adjusted to 5.9 before the addition of the Agar/Agar. Twenty-five internode segments were cultured per 100 x 20 mm Petri plate and the plates were sealed with Nesco film (Karlan Research Products, Santa Rosa, CA). Explants were transferred weekly for 1 month, then every 10 - 14 days. All cultures were maintained at 24° + 1°C under a photoperiod of 16h (light)/8 h (dark) at 74 ⁇ E m ' V.
  • regenerants When regenerants were approximately 0.5 - 1 cm in length, they were excised and transferred to bialaphos selective rooting medium which contained the same components as CM with the addition of 500 mg/l carbenicillin (added after autoclaving) and 5 mg/l bialaphos (added after autoclaving). Five regenerants were cultured per GA7 Magenta box. Once the shoots rooted, the shoot tip from each plant was transferred to CM in test tubes for maintenance.
  • Microtubers were induced on plant material for an early indication of expression in tubers. This was especially applicable for transgenic lines containing genes driven by the tuber-specific promoter, GBSS. Nodal segments were placed on microtuber medium which contained 1/2 strength MS salts, 5 mg/l kinetin, 80 g/l sucrose, 0.25 mM ancymidol (added after autoclaving), 9g/l Agar/Agar. The pH of the medium was adjusted to 5.85 prior to the addition of the Agar/Agar. The cultures were maintained in the dark at 18°C. The microtubers were analyzed by ELISA for antigen expression levels.
  • Genomic DNA was isolated from leaves from 3 - 4-week-old putative transformants.
  • Leaf samples were homogenized at room temperature in 500 ⁇ l of an extraction buffer containing 200 mM Tris HCI (pH 7.5), 250 mM NaCl, 25 mM EDTA, and 0.5% SDS. They were allowed to remain at room temperature for 1 hr, then centrifuged at 12,000 ⁇ m for 5 min. The supernatant was removed to a new tube, 500 ⁇ l of isopropanol was added, then the samples either remained at room temperature for 5 - 10 min, or were placed at -20°C overnight. They were then centrifuged at 13,000 ⁇ m for 5 min, and the supernatant was discarded. The resultant pellet was washed with 70% ethanol, dried, then resuspended in 100 ⁇ l of TE buffer.
  • the primer set was designed such that the forward primer was in the CVMV promoter and the reverse primer (PAT R2) was in the PAT gene which resulted in a product size of approximately 500 bp. Amplified DNA fragments were run on a 1% agarose gel, stained with ethidium bromide, and visualized under a UV light.
  • Leaf material was harvested into tubes then placed on ice. Lines with the highest antigen levels were selected for propagation, then transferred to the greenhouse.
  • HN expression in pCHN-transformed potato plants Potato (Solanum tuberosum L. cv. Desiree) plants were transformed with pCHN, and regenerated Bialaphos® resistant plants were screened for expression of HN in leaves by ELISA.
  • Several lines were selected based on leaf expression ( Figure 26), propagated, and transplanted to soil for greenhouse culture. At maturity, tubers were harvested, extracted, and assayed for HN content by ELISA ( Figure 26). HN accumulation varied among individual tubers from the same line, but in general expression was correlated with the HN content of leaves within each line ( Figure 26). The best expression was observed in tubers of lines 6, 21, 27, and 34, with the highest accumulation observed at ⁇ 11 ⁇ g HN per g fresh tuber mass.
  • HN expression in potato plants transformed with pGHN and pGHN151 Potato (Solanum tuberosum L. cv. Desiree) plants were transformed with pGHN or pGHNl 51 , and regenerated Bialaphos® resistant plants were screened for expression of HN in microtubers by ELISA.
  • Potato (Solanum tuberosum L. cv. Desiree) plants were transformed with pGHN or pGHNl 51 , and regenerated Bialaphos® resistant plants were screened for expression of HN in microtubers by ELISA.
  • Several pGHN-transformed lines were selected based on microtuber expression (Figure 28), propagated, and transplanted to soil for greenhouse culture. Transformation with pGHN151 was relatively inefficient, resulting in only one line that showed expression in microtubers (GHN151-6), which was transplanted to soil for greenhouse culture.
  • tubers were harvested, extracted, and assayed for HN content by ELISA ( Figure 28).
  • HN accumulation varied among individual tubers from the same line, but in general expression was correlated with the HN content of microtubers within each line (Figure 29). The best expression was observed in tubers of lines GHN-1, 30, 47, and 54, with the highest accumulation observed at ⁇ 40 ⁇ g HN per g fresh tuber mass. Expression in tubers of line GHN151-6 varied between 6 and 12 ⁇ g HN per g fresh tuber mass. It is possible that the intron-containing GBSS promoter construct pGHN151 was unstable in transgenic plants or in Agrobacterium, resulting in poor expression with this construct.
  • FIG. 16 shows expression of HA in microtubers of pCHA transformed microtubers, which ranged up to 700 ng/g fresh weight. This is similar to the accumulation observed in pGPTV-HAO-transformed tubers (HA gene driven by CaMV 35S promoter), which was maximal at 1 ug/g fresh weight. Selected lines were transplanted to soil and grown in the greenhouse. Leaves of soil-grown plants were sampled and assayed by ELISA ( Figure 17). Expression of HA in leaves was very poor ( ⁇ 0.025 ng/ ⁇ g TSP), which is consistent with the earlier assays with leaves of tissue culture plants.
  • Tubers of mature plants were harvested, extracted, and evaluated for HA expression by ELISA. Accumulation of HA in tubers was maximally 500 ng/g fresh weight (Figure 18). The expression observed in microtubers produced in vitro was well correlated with the expression in soil-grown tubers ( Figures 16 and 18), thus the microtuber is a good model for expression of HA with pCHA.
  • Binary vectors pCHN, pMHN, and pUHN were used to transform tomato (variety TA234) and transgenic fruit and leaves analysed for expression of the recombinant HN protein from Newcastle Disease Virus.
  • TA234 Plant material. Seeds from a tomato line designated TA234 were used for transformations.
  • the source of light for these cultures and those described throughout this report was a mixture of cool and warm fluorescent bulbs (F40CW and F40WW) (Philips Lighting Co., www.lighting.philips.com/index.htm).
  • the seed cultures were maintained for 6 - 8 days depending upon the stage of cotyledon growth. Cotyledons were excised before the first true leaves emerged. If cotyledon sections were longer than 1 cm, they were cut into two 0.5 cm segments. Cotyledon sections were placed on feeder layer plates which were prepared one day prior to transformation.
  • the feeder layer consisted of NTl suspension cultured cells plated on KCMS medium (See below) which had been subculrured (2 mis of cells :48 ml of liquid KCMS) 7 days prior to plating.
  • the plated suspension culture was covered with a sterile 7 cm Whatman filter paper. Cotyledon sections were placed on top of the filter paper.
  • Agrobacterium preparation Agrobacterium tumefaciens containing the gene construct of interest was streaked from glycerol stocks maintained at -80°C onto fresh plates of LB medium (See Appendix) containing the appropriate antibiotic. For DAS constructs, 50 mg/l spectinomycin was added to the LB medium. The cultures were incubated for 24 - 48 hrs at 28°C. The duration of the incubation time was dependent upon colony size. If pin-point colonies developed after 24 hrs, the cultures were incubated for an additional day.
  • Cotyledon explants were cultured on the feeder layer plates 1 day prior to infection with Agrobacterium. For infection, they were incubated in the Agrobacterium suspension for 10 min, then the suspension was removed. The explants were blotted on sterile paper towels, then placed with the adaxial sides down on the original feeder plate cultures. They were maintained at 19°C in the dark for 48 hrs of cocultivation. Plant regeneration: After cocultivation, cotyledon explants were cultured with the adaxial sides up on selective 2Z medium containing 3 mg/l bialaphos. The cultures were maintained at 24 + 2°C under a 16-hr photoperiod of cool white fluorescent lights.
  • Plants that rooted on selective rooting medium were selected for ELISA analysis.
  • Leaf material was harvested, transferred to 2 ml conical screw cap tubes, and placed on ice.
  • ELISA was performed at least twice before selecting the lines containing the highest antigen level. The elite lines were propagated and transferred to the greenhouse.
  • YM in powder form can be purchased (Gibco BRL; catalog #10090-011). To make liquid culture medium, add 11.1 g to 1 liter water.
  • Example 12 Tomato as a Production System of Edible Vaccines
  • a HN expression cassette that includes the promoter of the Casava vein mosaic virus (CsVMV) and terminated by the 3' element of the Soybean
  • VSP Vegetative Storage Protein
  • BTI The Boyce Thompson Institute for Plant Research
  • the vector carries the gene encoding the plant selection marker phosphinothricin acetyl transferase (PAT, described in US Patent Nos: 5,879,903; 5,637,489; 5,276,268; and 5,273,894) (Figure 30).
  • PAT phosphinothricin acetyl transferase
  • Agrobacterium-mediated transformation of tomato cotyledons was performed according to Frary and Earle [12] by the Van Eck Laboratory (BTI). Regenerating explants were transferred to fresh medium every 3 weeks. Green shoots were transferred to GA-7 boxes (Magenta Co ⁇ oration, Chicago, IL) containing rooting media (MS salts 4.3 g, 1 ml/1 Nitsch vitamins 1000X, 30 g/l sucrose, 8 g/l difco bacto agar, pH 6.0, supplemented with 50 mg/l kanamycin, 300 mg/l timentin and 4 mg/l IBA) when they were approximately 1 cm tall. Rooted plantlets were transferred to soil and maintained at 28°C under a 12 hours photoperiod.
  • Crude protein extracts were made by homogenizing 1 mg of fresh leaf, fruit or NTl cell material per 5 ⁇ L of PBS or 1 mg of dried leaf, fruit or NTl cell material per 10 ⁇ L of PBS in a QBiogene (Carlsbad, CA, USA) Fast Prep machine. Insoluble material was removed by centrifugation at 14,000 ⁇ m in an Eppendorf 5415C microcentrifuge at 4°C for 5 minutes. The resulting sample supernatants were kept on ice during analysis and subsequently stored at -80°C.
  • microtiter plates (Costar 3590, Fisher Scientific, PA, USA check) were coated with 100 ⁇ l per well of a 1 in 1,000 dilution of SPAFAS chicken anti-NDV polyclonal antibody (Benchmark Biolabs, NE) in 0.01 M borate buffer. The plates were covered and incubated overnight at 4°C. The plates were equilibrated to room temperature for 30 minutes then washed three times with 300 ⁇ l per well phosphate buffered saline with 0.05% Tween-20 (PBST).
  • PBST Tween-20
  • the top four lines based on HN expression in the leaves were used for fruit analysis.
  • 1% 1,5 naphthalenedisulfonic acid, disodium salt hydrate), 3 ml CTAB buffer, and 10 ml buffer- saturated phenol (pH 4.3) were added to a 50 ml falcon tube and heated at 70°C in a water bath for 10 minutes. About 3.5 g of individual tomato fruit were ground in liquid nitrogen then added to the heated tube and vortexed vigorously for 30 seconds. Ten milliliters of chloroform:isoamylalcohol (24: 1) was added. The resulting slurry was vortexed for 30 seconds before centrifuging for 20 minutes at 10,000 ⁇ m at 4°C.
  • the aqueous phase was transferred to a 50mL falcon tube, mixed with 2 volumes of ethanol, and precipitated for 15 minutes at room temperature.
  • the extract was then centrifuged for 15 minutes at 10,000 ⁇ m at 4°C before the supernatant was discarded.
  • the resulting nucleic acid pellet was resuspended in 2 ml DEPC treated water, mixed with an equal volume of 4 M LiCl, and precipitated at -20°C overnight.
  • the extract was centrifuged at 10,000 ⁇ m at 4°C for 20 minutes.
  • the supernatant containing genomic DNA was removed to a different tube, precipitated with 2 volumes of ethanol and stored at -20°C overnight.
  • RNA pellet was resuspended in DEPC treated water and stored at -20°C. The following day, the DNA pellet was centrifuged down at 10,000 ⁇ m at 4°C for 20 minutes and resuspended in water containing 1 ⁇ g/ml Rnase A.
  • DNA were digested with 5 units of restriction enzyme EcoRI per ⁇ g DNA at 37°C for 20 to 24 hours. Uncut and digested samples were run overnight in a 1.0% TA ⁇ agarose gel. The gel was prepared for transfer by one 20 minute depurination wash (0.25 HC1), two 30 minute denaturation washes (1.5 M NaCl, 0.5 NaOH) and two 30 minute neutralization washes (0.5 M TrisHCl, pH 7, 3 NaCl). DNA was then transferred to a nylon membrane (Zeta-Probe blotting membranes, Bio-Rad, Hercules, CA, USA) by capillary transfer and fixed by UV cross-linkage using a Bio-Rad GS Gene Linker.
  • EcoRI restriction enzyme
  • a PCR labeled probe was made by using the primer set HNa (CCG AGC AGT TTC ACA AGT GG, S ⁇ Q ID NO: 10) and HNb (CCT GAT CTT GCT TCA CGT ACA, S ⁇ Q ID NO:l 1) on a pCHN template.
  • DIG labeled dCTP was inco ⁇ orated into the 1734 bp amplicon using the Roche Molecular Biochemical DIG PCR Probe Synthesis kit according to manufacturer's instructions. The amplification was performed over 37 cycles using an iCycler Gradient Thermo Cycler (BioRad, Hercules, CA, USA).
  • the template was initially melted at 94°C for 5 minutes followed by 35 cycles of 94°C for 30 seconds, 56°C for 30 seconds, and 72°C for 90 seconds. A final extension step was performed at 72°C for 5 minutes before soaking at 4°C.
  • Hybridization bottles and 10 ml DIG Easy Hyb (Roche Scientific, Mannheim, Germany) per membrane were pre-warmed to 45°C in a hybridization oven. Membranes were prehybridized for 60 minutes at 45°C and hybridized overnight at 45°C with a probe concentration of 5 ⁇ l/ml DIG Easy Hyb.
  • RNA from tomato transformants and wild type plants were denatured with formaldehyde/formamide and run for two hours in a 1% agarose 3-(N- mo ⁇ holino) propanesulfonic acid (MOPS) formaldehyde gel at 80V.
  • MOPS propanesulfonic acid
  • RNA was transferred to zeta probe membrane (BioRad, Hercules, CA, USA) by upward capillary action and fixed by UV cross-linkage. The membrane was then stained with 0.04% methylene blue in 0.5M sodium acetate to determine if RNA transfer was successful and to confirm that RNA concentrations in all samples were similar.
  • a PCR labeled, DNA probe was made using the primer set HNa and HNb on a pCHN template. DIG labeled dCTP was inco ⁇ orated into the 1734 bp amplicon as per manufacturer's instructions (PCR DIG Probe Synthesis kit, Roche Scientific, Mannheim,
  • the amplifications were performed as described for Southern analysis. Hybridization bottles and 10 ml DIG Easy Hyb (Roche) per membrane were pre- warmed to 45°C in a hybridization oven. Membranes were pre-hybridized for at least 90 minutes at 45°C and hybridized overnight with a probe concentration of 7.5 ⁇ l/ml DIG Easy Hyb. Post hybridization washes and detection were performed as per manufacturer's instructions (Roche - DIG wash and block buffer set and DIG Luminescent Detection Kit). Labeled membranes were visualized after exposure to film.
  • the separated proteins were transferred from the gel to a PVDF membrane using a BioRad Trans Blot Cell (50 V for 2 hours or overnight at 7 V). All membrane washes were performed in PBST (PBS + 0.1% Tween-20) at room temperature unless otherwise stated. The membrane was blocked with 5% skim milk + PBS + 0.1% Tween-20 overnight at 4°C or for two hours at room temperature using slow rotation in a hybridization incubator (Fisher Scientific, Tustin, CA, USA).
  • the membrane was washed twice briefly before incubating for one hour at 37°C with a 1 in 50,000 dilution of the primary antibody, mouse anti-HN Mabl4F antiserum (Benchmark Biolabs) in 1 % skim milk + PBS + 0.1% Tween-20.
  • the membrane was briefly rinsed in PBST before a 15 minute wash and three 5 minute washes then incubated in a 1 in 30,000 dilution of an anti-rabbit IgG horseradish peroxidase (HRP) conjugate (Sigma) for an hour at 37°C with slow rotation.
  • HRP horseradish peroxidase
  • the membrane was rinsed, then subjected to a 15 minute wash and three 5 minute washes. Detection was performed using the Amersham ECL + kit as per manufacturer's instructions.
  • the cells were pelleted and the supernatant aspirated to leave the packed RBC pellet.
  • the pellet was then diluted in 1 % DPBS- (volume to volume).
  • DPBS- volume to volume
  • Four hundred microliters of the 1% RBC solution was transferred to a small tube, 1.6 ml of deionized water was added before being vortexed at high speed for 20 seconds to lyse the cells.
  • a cRBC solution was not used unless the absorbance at 540 nm of the lysed cells was 0.4 - 0.5.
  • a 96-well, U bottom plate (Falcon) was sprayed with antistatic spray before 50 ⁇ l per well of DPBS was added.
  • Fruit ripening is a developmentally and genetically regulated process that is characterized by many biochemical and physiological changes, including increases in the rate of ethylene biosynthesis and respiration, chlorophyll degradation, pigment accumulation, textural modifications such as fruit softening, changes in the levels of sugars and organic acids, and production of volatile aromatic compounds (Brady CJ. Annu Rev. Plant Physiol 1987; 38: 155- 178).
  • There is a distinct relationship between fruit pH and solids content mainly sugars, Benton Jones J. Tomato plant culture: in the field, greenhouse, and home garden. New York: CRC Press, 1999).
  • the degree of ripeness is also a factor that affects pH. Ripening of wild type
  • the four lines expressing the highest level of HN in leaf tissue had varying phenotypes.
  • the phenotypes of lines CHN-1, CHN- 12 and CHN-32 were indistinguishable from control plants while line CHN- 10 showed traits indicative of polyploidy such as thick, wrinkly leaves and late flower set and fruit development. Comparing the intensity of signals between the plasmid controls and the genomic samples in Southern analysis, the lines had between 1 and 4 copies of the transgene (Figure 33) with CHN-1 having two copies, CHN- 10 four copies, CHN- 12 having one copy, and CHN-32 having 2 copies. Since CHN- 10 is likely a polyploid line, it will not be used in further studies or for production of vaccine batches.
  • HN tomato crop would therefore be at the green or early breaker stage.
  • the 78 kDa band was designated HN monomers, the smaller bands degradation products.
  • the 90 kDa band was thought a different glycosylation form and the 120 kDa and larger bands as HN polymers.
  • Western analysis of transgenic fruit at different stages was difficult due to the low expression of HN, however two bands around 78 and 70 kDa were visible. These bands were also present in the leaves of transgenic tomato plants and in the NTl cell line 119 but were not present in the tomato or NTl cell line negative controls.
  • NF represents tomato fruit negative control - wild type fruit; NL tomato leaf negative control - wild type leaf; NNT NTl cell negative control - non-transformed cell lines; 119, transgenic NTl cell line 119; L10, leaf from transgenic tomato line 10; L32, leaf from tomato line 32; HN, animal derived Lasota NDV virus; M, Bio-Rad's precision plus protein all blue standard; 1-1, fruit from line CHN-1, stage 1 of ripening; 1-3, fruit from line CHN-1, stage 3 of ripening; 1-6, fruit from line CHN-1, stage 6 of ripening; 32-1, fruit from line CHN-32, stage 1 of ripening; 32-3, fruit from line CHN-32, stage 3 of ripening; 32-6, fruit from line CHN-32, stage 6 of ripening; 10-1, fruit from CHN-10, stage 1 of ripening. Protein size is give in kDa.
  • Haemagglutination assays of the freeze-dried green fruit and leaves of the transgenic tomato revealed haemagglutination activity in all lines (Figure 37). Activity was highest in the leaves in lines CHN-1, CHN- 12 and CHN-32 with CHN-10 being the only line to have higher activity in the fruit. Line CHN-32 displayed the highest haemagglutination activities of 512 and 2,048 in the fruit and leaves ( Figure 37a) as well as the highest haemagglutination activity of 10,928 units per microgram HN ( Figure 37b).
  • the CHN-1 line had the second highest haemagglutination activities of 128 and 256 in the fruit and leaves as well as the second highest activity of 3,994 units per ⁇ g HN ( Figure 37a and b). Despite being mis-processed during transcription, the synthetic HN gene was translated into a functional protein.
  • CHN-10 had higher HN activity in the fruit, the target organ for animal trials and vaccine delivery, the probable polyploid status of this line in addition to its slowness to flower and fruit made it an unlikely candidate for future studies.
  • HN expression levels and HN activity in the four lines were chosen for future analysis.
  • the fruit of red-fleshy tomato varieties is said to be mature when it has completed growth but is still completely green.
  • This stage of ripeness is known as "green” or "stage one". Tomatoes are usually picked at this stage then ripened with ethylene.
  • the stages following include “breakers” or “stage two” when there is a definite break in color from green to tannish- yellow or pink (vine ripened tomatoes are picked at this stage); "turning" or “stage three” when more than 10% but less than 30% (for example, 11, 12, 13, 14, 15, 20, 25, 29%) of the surface of the tomato shows a definite change in color from green to tannish-yellow, pink or red; "pink” or “stage four” when more than 30% but less than 60% (for example, 31, 32, 33, 34, 35, 40, 45, 50, 55, 59%) of the surface of the fruit is pink or red in color; "light red” or “stage five” when more than 60% but less than 90% (for example, 61,
  • HN Newcastle disease virus haemagglutinin neuraminidase
  • CsVMV Casava Vein Mosaic Virus promoter
  • HN ELISA HN ELISA.
  • SPAFAS chicken ⁇ -NDV polyclonal antibody diluted 1:1500 in 0.01M borate buffer was used to coat a 96 well ELISA plate.
  • One hundred microliters of the dilution was pipetted into each well before the plate was covered, and left overnight at 4°C. The next morning the plate was allowed to equilibrate for 30 minutes at 24°C, before being washed three times with PBST (0.05% tween).
  • PBST 0.05% tween
  • a solution of 3% skim milk was made and 200 ⁇ l added to each well. The plate was placed at 37°C and allowed to block for two hours.
  • a coring tool size 1 was pushed through the center of the tomato along the horizontal axis. Any gelatinous material or seeds were excluded from the sample.
  • NDV HN standard curve lOO ⁇ l of 232ng/ml NDV purified stock (1:80) was pipetted into the second well of the second row. Fifty microliters of 1% skim milk was pipetted into the remaining wells of the second row and each of the wells in rows 3-8 of the microtiter plate. Fifty microliters of each plant sample was then added to the 1% skim milk in wells 3-11 of the second row. The purified NDV as well as the plant samples were then serially diluted down the plate by pipetting 50 ⁇ l out of row two and into row three and so on down the plate. The samples were mixed in the wells by pipetting up and down after each dilution step. The initial concentration of the samples was a 40-fold dilution. The plate was placed back into the 37°C incubator for 1 hour.
  • the plate was washed three times with PBST and the primary antibody added.
  • the primary antibody NDV HN Mab 4 A was diluted to a concentration of 1 :250 in 1% skim milk and lOO ⁇ l added to each well. This was allowed to incubate for one hour at 37°C.
  • the plate was washed three times with PBST and the secondary antibody goat anti-mouse IgG, was added to each well at a concentration of 1:3000 in 1% skim milk. This was allowed to incubate for one hour at 37°C.
  • the plate was washed four times with PBST and 50 ⁇ l TMB substrate was added to each well. After five minutes had elapsed the TMB was neutralized with IN H 2 SO 4 . The plate was then read on a spectrophotometer at a wavelength of 450nm.
  • the percent water loss was determine by removing the seeds from each tomato fruit, measuring the mass, freezing at -20°C, lyophilizing, then reweighing the tomato fruit.
  • the HN content of a tomato fruit at each of the maturation stages selected was calculated by multiplying the fruit HN concentration by the fruit mass.
  • the data generated from this study was used to calculate the possible number of doses produced from the CHN elite lines if fruit were harvested at stage one or at four weeks post pollination. In this model it was assumed that the same number of fruit would be produced from a plant harvested when fruit were at stage three and a plant harvested when fruit were four weeks post pollination and that one dose would be 50 ⁇ g of antigen.
  • Fruit size is affected by genetics, temperature, day length and plant age. The small standard errors of our means indicated that genetics is not presently an issue with regards to plant-by-plant variation in fruit size. However the effect of stress (due to change in temperature, day length and plant age) means that fruit size may not always prove an accurate indication of time post pollination. Large temperature fluctuations, day length and plant age should therefore be kept in mind, when approximating time of pollination using fruit size.
  • Tomato therefore is capable of expressing large quantities of HN when harvested at an optimal time in fruit maturation.
  • Master Seed Passage Master Seed passage 2 was used for DNA extraction.
  • DNA extraction and PCR Amplification DNA extraction was performed as described herein. PCR amplification for the HN and PAT gene expression cassettes were conducted separately. There was a 24 bp overlap between the PCR products of HN and PAT expression cassettes.
  • PCR reaction contained 2.5 units of Takara Ex Tag DNA polymerase (Takara Shuzo Co, Shiga, Japan, catalog # RR001 A), 0.2 ⁇ M of each primers (CHN01 /CHN03), 5 ⁇ L of 1 OX reaction buffer containing MgCl 2 , 0.2 mM of each dNTP, and 200 ng of genomic DNA.
  • the PCR was performed with a Gen Amp PCR 9700 system, manufactured by Applied Biosystem (Foster City, CA) at the following condition: 94 °C for 5 min for 1 cycle, 94 °C for 30 sec, 60 °C 30 sec and 72 °C for 3 min 30 sec for 40 cycles, 72 °C for 7 min.
  • PCR reaction For PAT gene cassette amplification, a 50 ⁇ L PCR reaction contained 2.5 units of Takara
  • Ex Tag DNA polymerase (Takara Shuzo Co, Shiga, Japan, catalog # RR001 A), 0.2 ⁇ M of each primers (CHN02/CHN04), 5 ⁇ L of 10X reaction buffer containing MgCl 2 , 0.2 mM of each dNTP, and 200 ng of genomic DNA were used.
  • the PCR was performed with a Gen Amp PCR 9700 system, manufactured by Applied Biosystem (Foster City, CA) at the following condition: 94 °C for 5 min for 1 cycle, 94 °C for 30 sec, 56 °C 30 sec and 72 °C for 2 min 30 sec fro 40 cycles, 72 °C for 7 min.
  • PCR products were purified using MiniElute PCR Purification Kit (Qiagen, Valencia, CA. Catalog # 28004) according to the manufacturer's protocol. Purified PCR products were cloned into pCR® II-TOPO vector using TOPO TA Cloning® kit (Invitrogen, Carlsbad, CA, Catalog # 051302) according to the manufacturer's protocol.
  • Plasmid DNAs containing cloned PCR products were sent to Lark Technologies Inc (Houston, TX) for sequencing using ABI PRISM® BigDyeTM Primer Cycle Sequencing Kits (Applied Biosystem, Foster City, CA). DNA sequences were analyzed using Vector NTl program (InforMax, Frederick, MD).
  • DNA sequences from the HN and PAT cassettes were assembled and compared with the sequences from a virtual plasmid map of pCHN.
  • DNA sequences of all the genetic elements including the CsVMV promoter, HN and PAT coding sequences, vspB 3' UTR, and MAS 3' UTR were identical to the ones in the virtual plasmid map pCHN.
  • the PCR product including the whole gene insert in CHN-18 Master Seed using primer CHN01/CHN02 was 4757 bp.
  • the actual cloned and sequenced PCR product including the whole gene insert in CHN-18 Master Seed was 4768 bp.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Cell Biology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention is drawn towards vectors and methods useful for preparing genetically transformed plant cells that express immunogens from pathogenic organisms which are used to produce immunoprotective particles useful in vaccine preparations. The invention includes plant optimized genes that encode the HN protein of Newcastle Disease Virus. The invention also relates to methods of producing an antigen in a transgenic plant.

Description

VECTORS AND CELLS FOR PREPARING IMMUNOPROTECTIVE COMPOSITIONS DERIVED FROM TRANSGENIC PLANTS
This application claims the benefit of U.S. Provisional Application No. 60/467,998, filed on May 5, 2003. The entire teachings of the above application is incorporated herein by reference.
Field of Invention
The present invention generally relates to the field of plant molecular biology as it applies to the recombinant production of plant-made vaccines.
Background of the Invention
Recombinant DNA technology has provided substantial improvements in the safety, quality, efficacy and cost of pharmaceutical and veterinary medicaments including vaccines. Plant produced mucosal vaccines were invented by Curtiss & Cardineau. See US Patent Numbers 5,654,184; 5,679,880 and 5,686,079 herein incorporated by reference. Others have described transgenic plants expressing immunoprotective antigens and methods for production including Arntzen, Mason and Lam. See US Patent Numbers 5,484,717; 5,914,123; 6,034,298; 6,136,320; 6,194,560; and 6,395,964 herein incorporated by reference.
Vaccines produced in plant systems offer a number of advantages over conventional production systems. Conventionally produced vaccines strains (live and vectored) may revert towards virulence or carry biological contaminants from the production process. Subunit vaccines may be difficult to produce and purify due to protein instability issues and will not be glycosylated when produced in prokaryotes.
Plant cell production avoids the need for animal-sourced components in growth media essentially eliminating the risk of transmitting pathogenic contaminants from the production process. Plant cells are capable of post translational glycosylation, and plant cell growth media is generally less expensive and easier to handle and prepare compared to conventional growth media presently used in the manufacture of vaccines. Systemic immunity to a particular pathogen results from activation of the immune system in response to antigen presented by a particular pathogenic organism or via a vaccine designed to protect against a particular pathogenic agent. Exposure to a pathogen is often through mucosal surfaces that are constantly exposed and challenged by pathogenic organisms.
Mucosal and oral immunity results from the production of slgA (secretory IgA) antibodies in secretions that bathe all mucosal surfaces of the respiratory tract, gastrointestinal tract and the genitourinary tract and in secretions from all secretory glands. McGhee, J. R. et al., Annals N.Y. Acad. Sci. 409, (1983). These slgA antibodies act to prevent colonization of pathogens on a mucosal surface (Williams, R. C. et al., Science 177, 697 (1972); McNabb, P. C. et al., Ann. Rev. Microbiol. 35, 477 (1981) and thus act as a first line of defense to prevent colonization or invasion through a mucosal surface. The production of slgA can be stimulated either by local immunization of the secretory gland or tissue or by presentation of an antigen to either the GALT (gut-associated lymphoid tissue or Peyer's patches) or the BALT (bronchial- associated lymphoid tissue). Cebra, J. J. et al., Cold Spring Harbor Symp. Quant. Biol. 41, 210 (1976); Bienenstock, J. M., Adv. Exp. Med. Biol. 107, 53 (1978); Weisz-Carrington, P. Et al., J. Immunol 123, 1705 (1979); McCaughan, G. et al., Internal Rev. Physiol 2S, 131 (1983). Membranous microfold cells, otherwise known as M Cells, cover the surface of the GALT and BALT and may be associated with other secretory mucosal surfaces. M cells act to sample antigens from the luminal space adjacent to the mucosal surface and transfer such antigens to antigen-presenting cells (dendritic cells and macrophages), which in turn present the antigen to a T lymphocyte (in the case of T-dependent antigens), which process the antigen for presentation to a committed B cell. B cells are then stimulated to proliferate, migrate and ultimately be transformed into an antibody-secreting plasma cell producing IgA against the presented antigen. When the antigen is taken up by M cells overlying the GALT and BALT, a generalized mucosal immunity results with slgA against the antigen being produced by all secretory tissues in the body. Cebra et al., supra; Bienenstock et al., supra; Weinz-Carrington et al., supra; McCaughan et al., supra. Oral immunization is therefore a most important route to stimulate a generalized mucosal immune response and, in addition, leads to local stimulation of a secretory immune response in the oral cavity and in the gastrointestinal tract.
Mucosal immunity can also be advantageously transferred to offspring. Immunity in neonates may be passively acquired through colostrum and/or milk. This has been referred to as lactogenic immunity and is an efficient way to protect animals during early life. slgA is the major immunoglobulin in milk and is most efficiently induced by mucosal immunization.
The M cells overlying the Peyer's patches of the gut-associated lymphoid tissue are capable of taking up a diversity of antigenic material and particles (Sneller, M. C. and Strober, W., J. Inf. Dis. 154, 737 (1986). Because of their abilities to take up latex and polystyrene spheres, charcoal, microcapsules and other soluble and particulate matter, it is possible to deliver a diversity of materials to the GALT independent of any specific adhesive-type property of the material to be delivered.
Vectors and cells useful for producing transgenic plant-derived immunoprotective antigens, and improved methods of antigen production would greatly facilitate the development, manufacture and efficacy plant-produced vaccines.
Summary of the Invention
The invention is based on plant optimized sequences encoding an immunoprotective antigen of interest. In particular, the invention is based on a plant optimized DNA sequence encoding the HN antigen of Newcastle Disease Virus or a DNA sequence encoding the HA antigen of Avian Influenza Virus. The invention also includes a recombinant expression vector for effecting expression of an immunoprotective antigen gene in a plant cell, as well as plant cells and transgenic plants comprising the expression vector, as well as vaccines comprising a protein product of the expression vector. The invention also relates to methods of protecting against the effects of a pathogen utilizing the vaccines of the invention. The invention further relates to methods of producing an antigen in a transgenic plant.
The invention provides for an isolated plant optimized nucleotide sequence encoding the HN antigen of Newcastle Disease Virus comprising the sequence of SEQ ID NO: 1, as well as a recombinant expression vector comprising SEQ ID NO: 1.
In one embodiment, the vector is selected from the group consisting of pCHN, pGHN, pGHN151, pGHN153, pMHN, pUHN.
In another embodiment, the vector comprises a plant-functional promoter is operably linked to SEQ ID NO: 1. The invention also provides for a recombinant expression vector for expressing an immunoprotective antigen in a plant cell comprising a DNA sequence encoding the HA antigen of Avian Influenza Virus, wherein the vector is pCHA
The invention further provides for a transgenic plant cell for expression of an immunogenic antigen comprising a vector of the invention. The plant cell includes a tomato plant cell or a tobacco plant cell, as well as a cell from any of the plant species described hereinbelow.
The invention further provides for a transgenic plant comprising a vector of the invention.
The invention also provides for a vaccine comprising a recombinant viral antigenic protein and a pharmaceutically acceptable carrier, wherein the viral antigenic protein is the HN antigen of Newcastle Disease virus produced by a vector of the invention , and wherein the vaccine is capable of eliciting an immune response upon administration to an animal.
In one embodiment, the HN protein of the vaccine comprises SEQ ID NO:2. The HN protein of the vaccine can be produced in a plant cell.
The invention also provides for a vaccine comprising a recombinant viral antigenic protein and a pharmaceutically acceptable carrier, wherein the viral antigenic protein is the HA antigen of Avian Influenza Virus produced by a vector of the invention, and wherein the vaccine is capable of eliciting an immune response upon administration to an animal. In one embodiment, the HA antigen of the vaccine is produced in a plant cell.
The invention also provides for a method for protecting an animal against NewCastle
Disease Virus or Avian Influenza Virus comprising administering an effective amount of the appropriate vaccine of the invention to an animal. According to one embodiment of the method, wherein the vaccine is administered orally, intranasaly, intraperitonealy, intramuscularly, intravenously or subcutaneously. In one embodiment of the method, the effective amount of the vaccine is at a range of lμg to 50μg per kilogram of body weight.
The invention also provides for a method of producing an antigen in a transgenic plant comprising the steps of: a) producing a transgenic plant comprising a vector encoding the antigen; b) incubating the plant under conditions wherein the plant expresses the antigen; and wherein the plant is incubated prior to the onset of ripening. In one embodiment, the plant comprises a fruit that ripens.
In another embodiment, the plant is a tomato plant.
In another embodiment, the fruit of the plant is harvested prior to the onset of ripening. According to one embodiment of this method, the antigen is isolated from the harvested fruit.
In another embodiment, the antigen is selected from the group consisting of HN antigen of Newcastle Disease Virus, HA antigen of Avian Influenza Virus, LTB, NVCP, zona pellucida glycoprotein and HBsAg.
Brief Description of the Figures
Figures la and lb. The plant optimized coding sequence (SEQ ID NO: 1) and protein sequence (SEQ ID NO: 2) of the HN gene of NDV strain "Lasota"
Figure 2. Map of pBBV-PHAS-iaaH that contains the plant selectable marker PAT (phosphinothricin acetyl transferase), includes the constitutive CsVMV (cassava vein mosaic virus) promoter and is terminated by the MAS 3' (mannopine synthase) element. LB and RB (left and right T-DNA border) elements from Agrobacterium delineate the boundaries of the DNA that is integrated into the plant genome.
Figure 3. Map of pCP!H which is a "template vector" used as a starting plasmid for a variety of plant expression vectors for expressing immunoprotective antigens.
Figure 4. Map of pCHN expression vector for NDV HN protein. This vector comprising the HN expression cassette includes the constitutive CsVMV promoter and is terminated by the soybean vspB 3' element.
Figure 5. Map of pgHN expression vector for NDV HN protein. This vector comprising the HN expression cassette includes the tuber-specific GBSS promoter with TEV 5' UTR and is terminated by the soybean vspB 3' element.
Figure 6. Map of pgHN151 expression vector for NDV HN protein. The HN expression vector or cassette includes the tuber-specific GBSS promoter with its native 5' UTR and intron, and is terminated by the soybean vspB 3' element. The vector is derived from pBBV-PHAS-iaaH, which contains the plant selectable marker PAT, includes the CsVMV promoter and is terminated by the MAS 3' element. LB and RB, left and right T-DNA border elements delineate the boundaries of the DNA that is integrated into the plant genome.
Figure 7. Map of pgHN153 expression vector for NDV HN protein. The HN expression vector includes the tuber-specific GBSS promoter with its native 5' UTR and intron, and is terminated by the bean phaseolin 3 ' element. The vector is derived from pBBV-PHAS-iaaH, which contains the plant selectable marker PAT, includes the CsVMV promoter and is terminated by the MAS 3' element. LB and RB, left and right T-DNA border elements delineate the boundaries of the DNA that is integrated into the plant genome.
Figure 8. Map of pMHN expression vector for NDV HN protein. The HN expression vector
includes the constitutive 4OCSΔMAS promoter (P2 direction) and is terminated by the soybean
vspB 3' element. The vector is derived from pBBV-PHAS-iaaH, which contains the plant selectable marker PAT, includes the CsVMV promoter and is terminated by the MAS 3' element. LB and RB, left and right T-DNA border elements delineate the boundaries of the DNA that is integrated into the plant genome.
Figure 9. Map of pCHA expression vector for the HA gene of the AIV A / turkey / Wisconsin / 68 (H5N9).
Figure 10. The DNA (SEQ ID NO: 3) and protein (SEQ ID NO: 4) sequences of the HA gene of AIV A/turkey/Wisconsin/68 (H5N9).
Figure 11. Map of pGLTB intermediate vector.
Figure 12. Map of pCLT105 intermediate vector.
Figure 13. HA expression in transgenic NT1 cell lines using pGPTV-HAO or pCHA.
Figure 14. Repeated assays of pCHA-transformed NTl cell lines. Figure 15. Western blot for AIV HA expression in pCHA-transformed NTl cell lines.
Figure 16. HA expression in microtubers of pCHA-transformed potato plantlets.
Figure 17. HA expression in leaves of pCHA-transformed potato plants.
Figure 18. HA expression in tubers of soil-grown pCHA-transformed potato plants.
Figure 19. Expression of NDV-HN in NTl cells transformed with pCHN.
Figure 20. Expression of HN per cell mass in pCHN-transformed NTl lines.
Figure 21. Stability of expression of HN in pCHN-transformed NTl cell lines.
Figure 22. Western blot of pCHN-transformed NTl cells using HN-specific antibodies.
Figure 23. HN antigen is maintained in freeze-dried pCHN-transformed NTl cells and on storage of extracts at 4°C.
Figure 24. Sucrose gradient analysis of HN antigen shows particulate character.
Figure 25. Expression of HN in pMHN- and pCHN-transformed NTl cell lines.
Figure 26. HN expression in pCHN-transformed potato.
Figure 27. Particle behavior of HN antigen extracted from pCHN-transformed potato tubers.
Figure 28. HN expression in microtubers of pGHN-transformed potato plants.
Figure 29. Expression of HN in tubers of pGHN -and pGHN151-transformed potato plants.
Figure 30. T-DNA region from the construct pCHN.
Figure 31. Effect of ripening on wild type TA234 tomato fruit pH.
Figure 32. Effect of ripening on wild type TA234 tomato fruit total soluble protein.
Figure 33. Southern analysis ofT0 CHN tomato lines.
Figure 34. Total RNA from wild type and transgenic tomato fruit. Figure 35. ELISA analysis of HN concentration in ripening CHN tomato fruit.
Figure 36. Western analysis of crude protein extracts from wild type and transgenic tomato fruit and leaves and NTl cell extracts.
Figure 37. Haemagglutination activity in the fruit and leaves of CHN tomatoes.
Figure 38. Change in maturing fruit diameter. "Week" indicates the amount of time post pollination. Points indicate the mean of three measurements while the bars indicate the standard errors of the means.
Figure 39. Change in fruit mass of maturing tomato fruit. "Week" indicates the amount of time post pollination. Each point represents the mean of the three measurements while the bars indicate the standard errors of the means.
Figure 40. Water loss from maturing tomato fruit upon lyophilization. "Week" indicates the amount of time post pollination. Points represent the mean of three measurements while the bars indicate the standard errors of the means.
Figure 41. Concentration of HN per gram of fresh tomato fruit. "Week" indicates the amount of time post pollination. Bars represent the average of three samples. Bars labeled with the same
letter are not significantly different (α=0.05). Error bars indicate the standard error of the means.
Figure 42. Amount of HN in maturing tomato fruit. "Week" indicates the amount of time post pollination. Bars represent the average of three replicate HN contents multiplied by the masses.
Bars labeled with the same letter are not significantly different (α=0.05). Error bars indicate the
standard error of the mean.
Figure 43. The regulated biological agent (pCHN) insert in CHN- 18 master seed.
Figure 44. DNA sequence of the whole gene insert in CHN-18 master seed (SEQ ID NO: 12).
Figure 45. pCHA vector sequence (SEQ ID NO: 24). Figure 46. pMHN vector sequence (SEQ ID NO: 25). Figure 47. pCHN vector sequence (SEQ ID NO: 26).
Figure 48. Construction of pUHN.
Summary of the Sequences
SEQ ID NOS: 1 and 2, shown in Figure 1, are the plant optimized coding sequence and protein sequence of the HN gene of NDV strain "Lasota".
SEQ ID NOS: 3 and 4, shown in Figure 10, are the DNA and protein sequences of the HA gene of AIV A/turkey/Wisconsin/68 (H5N9).
SEQ ID NO: 5 is a PCR primer used to end-tailor the CsVMV promoter on pCP!H.
SEQ ID NO: 6 is a PCR primer used to end-tailor the CsVMV promoter on pCP!H.
SEQ ID NO: 7 is a mutagenic primer used to create a Nco I site.
SEQ ID NO: 8 is a forward primer complimentary to the 5' region.
SEQ ID NO: 9 is a mutagenic primer used to create a Xhol I site.
SEQ ID NO: 10 is a PCR labeled probe made by using the primer HNa.
SEQ ID NO: 11 is a PCR labeled probe made by using the primer HNb.
SEQ ID NO: 12 is the DNA sequence of the whole gene insert in CHN-18 master seed.
SEQ ID NO: 13 is the DNA sequence encoding Hepatitis B virus Strain Gly D surface antigen, complete cds. (GenBank accession AF 134148).
SEQ ID NO: 14 is the protein sequence of Hepatitis B virus Strain Gly D surface antigen. (GenBank accession AAD31865).
SEQ ID NO: 15 is the DNA sequence encoding Homo sapiens zona pellucida glycoprotein 3
(sperm receptor) (ZP3), mRNA. (GenBank accession NM_007155). SEQ ID NO: 16 is the protein sequence of Homo sapiens zona pellucida glycoprotein 3 preproprotein (sperm receptor) (ZP3). (GenBank accession NP_009086).
SEQ ID NO: 17 is the DNA sequence encoding Avian influenza virus hemagglutinin (HA) mRNA, complete cds. (GenBank accession U67783).
SEQ ID NO: 18 is the protein sequence of Avian influenza virus hemagglutinin (HA). (GenBank accession AAC58999).
SEQ ID NO: 19 is the DNA sequence encoding Newcastle disease virus hemagglutinin- neuraminidase (HN), mRNA, complete cds. (GenBank accession AY510092).
SEQ ID NO: 20 is the protein sequence of Newcastle disease virus hemagglutinin- neuraminidase (HN). (GenBank accession AAS10195).
SEQ ID NO: 21 is the DNA sequence encoding Gallus gallus zona pellucida glycoprotein 3 (sperm receptor) (ZP3), mRNA. (GenBank accession NM_204389).
SEQ ID NO: 22 is the protein sequence of Gallus gallus zona pellucida glycoprotein 3 (sperm receptor) (ZP3). (GenBank accession NP_989720).
SEQ ID NO: 23 is the DNA sequence of Duck hepatitis B virus. (GenBank accession X58569).
SEQ ID NO: 24 is the DNA sequence of vector pCHA.
SEQ ID NO: 25 is the DNA sequence of vector pMHN.
SEQ ID NO: 26 is the DNA sequence of vector pCHN.
Definitions
As used herein, "an immunogen or immunoprotective antigen" is a non-self substance that elicits a humoral and/or cellular immune response in healthy animals such that the animal is protected against future exposure to a pathogen bearing the immunogen. The pathogens are typically agents such as viruses, bacteria, fungi and protozoa. Immunogens may also be antigenic portions of pathogens including cell wall components and viral coat proteins. As used herein, "an immunoprotective particle" is a particle or vesicle derived from a transgenic plant cell that expresses an immunogen that, when appropriately administered to an animal, provides protection against future exposure to a pathogen bearing the immunogen.
As used herein, "vaccination or vaccinating" is defined as a means for providing protection against a pathogen by inoculating a host with an immunogenic preparation of a pathogenic agent, or a non-virulent form or part thereof, such that the host immune system is stimulated and prevents or attenuates subsequent host reactions to later exposures of the pathogen. "Providing protection" refers to stimulating an immune response as defined hereinbelow.
As used herein, "a vaccine" is a composition used to vaccinate an animal that contains at least one immunoprotective antigenic substances.
As used herein, "a pathogenic organism" is a bacterium, virus, fungus, or protozoan that causes a disease or medical condition in an animal which it has infected.
As used herein, "an adjuvant" is a substance that accentuates, increases, or enhances the immune response to an immunogen or antigen. As used herein, an increase, or accentuation or enhancement means a 2-fold or more, for example, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or 1000-fold or more increase in the amount of antibody produced, for example, in the response to an antigen administered in the presence of an adjuvant as compared to in the absence of an adjuvant. An increase, accentuation or enhancement also means at least 5% or more antibody production, for example, 5, 6, 10, 20, 30, 40, 50, 60 70, 80, 90 or 100% or more, for example, in response to an antigen administered in the presence versus the absence of an adjuvant. Adjuvants typically enhance both the humoral and cellular immune response but an increased response to either in the absence of the other qualifies to define an adjuvant. Moreover, adjuvants and their uses are well known to immunologists and are typically employed to enhance the immune response when doses of immunogen are limited or when the immunogen is poorly immunogenic or when the route of administration is sub-optimal. Thus the term 'adjuvanting amount' is that quantity of adjuvant capable of enhancing the immune response to a given immunogen or antigen. The mass that equals an adjuvanting amount will vary and is dependant on a variety of factors including but not limited to the characteristics of the immunogen, the quantity of immunogen administered, the host species, the route of administration, and the protocol for administering the immunogen. The adjuvanting amount can readily be quantified by routine experimentation given a particular set of circumstances. This is well within the ordinarily skilled artisan's purview and typically employs the use of routine dose response determinations to varying amounts of administered immunogen and adjuvant. Responses are measured by determining serum antibody titers raised in response to the immunogen using enzyme linked immunosorbant assays, radio immune assays, hemagglutination assays and the like.
As used herein, a "transgenic plant cell" refers to a plant cell which stably expresses a foreign gene, wherein the foreign gene is integrated into the plant cell chromosome and does not carry with it a viral vector sequence unique to a virus, where the foreign gene is passed onto the next cell generation and is capable of being expressed from the host plant cell chromosome. In addition, "transgenic plant material" refers to a "transgenic cell suspension" comprising one or a plurality of "transgenic plant cells" obtained by well-known cell culture techniques (Street, HE. 1973, Plant tissue and cell culture: botanical monographs. Vol II, University of California, Berkeley).
As used herein, a "trangenic plant" refers to a plant, the cells of which stably express a
"heterologous" foreign gene, wherein the foreign gene is integrated into the plant cell chromosome and does not carry with it a viral vector sequence unique to a virus, where the foreign gene is passed onto the next plant generation and is capable of being expressed from the host plant cell chromosome. A "transgenic plant" comprises a "plurality of transgenic plant cells". A "transgenic plant" refers to the whole plant, or a part thereof including, but not limited to roots, stems, leaves, stalks, seeds, fruit, tubers, flowers, pollen, and the like. Examples of heterologous foreign genes include, but are not limited to, Norwalk virus capsid protein (NVCP), Avian Influenza hemagglutination antigen (AIV-HA), Newcastle Disease Virus neuraminidase (NDV-HN), zona pellucida glycoprotein 3 (ZP3), and Hepatitis B surface Antigen (HBsAg).
Transgenic plant is herein defined as a plant cell culture, plant cell line, plant, or progeny thereof derived from a transformed plant cell or protoplast, wherein the genome of the transformed plant contains foreign DNA, introduced by laboratory techniques, not originally present in a native, non-transgenic plant cell of the same species. The terms "transgenic plant " and "transformed plant " have sometimes been used in the art as synonymous terms to define a plant whose DNA contains an exogenous DNA molecule. As used herein, an "edible plant" refers to a plant which may be consumed by an animal, has nutritional value and is not toxic. An "edible plant" may be a "food" which is a plant or a material obtained from a plant which is ingested by humans or other animals. The term "food" is intended to include plant material which may be fed to humans and other animals or a processed plant material which is fed to humans and other animals. Materials obtained from a plant are intended to include a component of a plant which is eventually ingested by a human or other animal. Examples of "edible plant" include, but are not limited to, tomato plants, rice plants, wheat plants, corn plants, carrot plants, potato plants, apple plants, soybean plants, alfalfa plants, medicago plants, vegetable plants, and fruit plants or any of the edible plants described herein.
In some cases an "edible plant" is "capable of being ingested for its nutritional value", which refers to a plant or portion thereof that provides a source of metabolizable energy, supplementary or necessary vitamins or co-factors, roughage or otherwise beneficial effect upon ingestion by an animal. Thus, where the animal to be treated by the methods of the present invention is an herbivore capable of bacterial-aided digestion of cellulose, such a food might be represented by a transgenic grass plant. Other edible plants include vegetables and fruits.
Similarly, although transgenic lettuce plants, for example, do not substantially contribute energy sources, building block molecules such as proteins, carbohydrates or fats, nor other necessary or supplemental vitamins or cofactors, a lettuce plant transgenic for the nucleic acid molecules described herein used as food for an animal would fall under the definition of a food as used herein if the ingestion of the lettuce contributed roughage to the benefit of the animal, even if the animal could not digest the cellulosic content of lettuce. An "edible plant" therefore excludes tobacco.
As used herein, "immune response" refers to a response made by the immune system of an organism to a substance, which includes but is not limited to foreign or self proteins. There are three general types of "immune response" including, but not limited to mucosal, humoral and cellular "immune responses." A "mucosal immune response" results from the production of secretory IgA (slgA) antibodies in secretions that bathe all mucosal surfaces of the respiratory tract, gastrointestinal tract and the genitourinary tract and in secretions from all secretory glands (McGhee, J. R. et al., 1983, Annals NY Acad. Sci. 409). These slgA antibodies act to prevent colonization of pathogens on a mucosal surface (Williams, R. C. et al., Science 111, 697 (1972); McNabb, P. C. et al., Ann. Rev. Microbiol. 35, 477 (1981)) and thus act as a first line of defense to prevent colonization or invasion through a mucosal surface. The production of slgA can be stimulated either by local immunization of the secretory gland or tissue or by presentation of an antigen to either the gut-associated lymphoid tissue (GALT or Peyer's patches) or the bronchial- associated lymphoid tissue (BALT; Cebra, J. J. et al., Cold Spring Harbor Symp. Quant. Biol. 41, 210 (1976); Bienenstock, J. M., Adv. Exp. Med. Biol. 107, 53 (1978); Weisz-Carrington, P. et al., J. Immunol 123, 1705 (1979); McCaughan, G. et al., Internal Rev. Physiol 28, 131 (1983)). Membranous microfold cells, otherwise known as M cells, cover the surface of the GALT and BALT and may be associated with other secretory mucosal surfaces. M cells act to sample antigens from the luminal space adjacent to the mucosal surface and transfer such antigens to antigen-presenting cells (dendritic cells and macrophages), which in turn present the antigen to a T lymphocyte (in the case of T-dependent antigens), which process the antigen for presentation to a committed B cell. B cells are then stimulated to proliferate, migrate and ultimately be transformed into an antibody-secreting plasma cell producing IgA against the presented antigen. When the antigen is taken up by M cells overlying the GALT and BALT, a generalized mucosal immunity results with slgA against the antigen being produced by all secretory tissues in the body (Cebra et al., supra; Bienenstock et al., supra; Weinz-Carrington et al., supra; McCaughan et al., supra). Oral immunization is therefore an important route to stimulate a generalized mucosal immune response and, in addition, leads to local stimulation of a secretory immune response in the oral cavity and in the gastrointestinal tract.
An "immune response" may be measured using techniques known to those of skill in the art. For example, serum, blood or other secretions may be obtained from an organism for which an "immune response" is suspected to be present, and assayed for the presence of the above mentioned immunoglobulins using an enzyme-linked immuno-absorbant assay (ELISA; U.S. Pat. No. 5,951,988; Ausubel et al., Short Protocols in Molecular Biology 3rd Ed. John Wiley & Sons, Inc. 1995). According to the present invention, a protein of the present invention can be said to stimulate an "immune response" if the quantitative measure of immunoglobulins in an animal treated with a protein of interest detected by ELISA is statistically different (for example, is increased or decreased by 2-fold or more, for example, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or 1000-fold or more increase or decrease in the amount of antibody produced. An increase or decrease also means at least 5% or more antibody production, for example, 5, 6, 10, 20, 30, 40, 50, 60 70, 80, 90 or 100% or more, or at least 5% or more of a decrease in antibody production) from the measure of immunoglobulins detected in an animal not treated with a protein of interest, wherein said immunoglobulins are specific for the protein of interest. A statistical test known in the art and useful to determining the difference in measured immunoglobulin levels includes, but is not limited to ANOVA, Student's T-test, and the like, wherein the P value is at least <0.1, <0.05, <0.01, <0.005, O.001, and even O.0001.
An "immune response" may be measured using other techniques such as immunohistochemistry using labeled antibodies which are specific for portions of the immunoglobulins raised during the "immune response". Tissue (e.g., ovarian tissue) from an animal to which a protein of interest has been administered according to the invention may be obtained and processed for immunohistochemistry using techniques well known in the art (Ausubel et al., Short Protocols in Molecular Biology 3rd Ed. John Wiley & Sons, Inc. 1995). Microscopic data obtained by immunohistochemistry may be quantitated by scanning the immunohistochemically stained tissue sample and quantitating the level of staining using a computer software program known to those of skill in the art including, but not limited to NIH Image (National Institutes of Health, Bethesda, MD). According to the present invention, a protein of the present invention can be said to stimulate an "immune response" if the quantitative measure of immunohistochemical staining in an animal treated with a protein of interest is statistically different (as defined by an increase or decrease discussed hereinabove) from the measure of immunohistochemical staining detected in an animal not treated with the protein of interest, wherein said histochemical staining requires binding specific for that protein. A statistical test known in the art may be used to determine the difference in measured immunohistochemical staining levels including, but not limited to ANOVA, Student's T-test, and the like, wherein the P value is at least <0.1, <0.05, <0.01, O.005, <0.001, and even <0.0001.
A "mucosal immune response" may be "detected" using any of the above referenced techniques. For example, an ELISA assay may be employed using anti-IgA antibodies to detect and measure the mucosal-specific immunoglobulins (Dickinson, B.L. & Clements, J.D. Dissociation of Escherichia coli heat-labile enterotoxin adjuvanticity from ADP- ribosyltransferase activity. Infect Immun 63, 1617-1623 (1995)).
A "humoral immune response" comprises the production of antibodies in response to an antigen or antigens. A cellular immune response includes responses such as a helper T-cell (CD4+) response and a cytotoxic T-cell lymphocyte (CD8+) response. A mucosal immune response (or secretory immune response) comprises the production of secretory (slgA) antibodies. An immune response can comprise one or a combination of these responses. As used herein, "animal" refers to an organism classified within the phylogenetic kingdom Animalia. As used herein, an "animal" also refers to a mammal. Animals, useful in the present invention, include, but are not limited to mammals, marsupials, mice, dogs, cats, cows, humans, deer, horses, sheep, livestock, poultry, chickens, turkeys, ostrich, fish, fin fish, shell fish, and the like.
As used herein, "monocotyledonous" refers to a type of plant whose embryos have one cotyledon or seed leaf. Examples of "monocots" include, but are not limited to lilies; grasses; corn; grains, including oats, wheat and barley; orchids; irises; onions and palms.
As used herein, "dicotyledonous" refers to a type of plant whose embryos have two seed halves or cotyledons. Examples of "dicots" include, but are not limited to tobacco; tomato; the legumes including alfalfa; oaks; maples; roses; mints; squashes; daisies; walnuts; cacti; violets and buttercups.
As used herein, "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded nucleic acid loop into which additional nucleic acid segments can be ligated. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant nucleic acid techniques are often in the form of plasmids. In the present specification, "plasmid" and "vector" can be used interchangeably as the plasmid is the most commonly used form of vector.
As used herein, "promoter" refers to a sequence of DNA, usually upstream (5') of the coding region of a structural gene, which controls the expression of the coding region by providing recognition and binding sites for RNA polymerase and other factors which may be required for initiation of transcription. The selection of the promoter will depend upon the nucleic acid sequence of interest. A "plant-functional promoter" refers to a "promoter" which is capable of supporting the initiation of transcription in plant cells. "Plant-functional promoters" useful in the present invention include, but are not limited to the 35 S promoter of the cauliflower mosaic virus (CaMV); promoters of seed storage protein genes such as ZmalOKz or Zmagl2, light inducible genes such as ribulose bisphosphate carboxylase small subunit (rbcS), stress induced genes such as alcohol dehydrogenase (Adhl), or "housekeeping genes" that express in all cells (such as Zmact, a maize actin gene); the tomato E8 promoter; ubiquitin; mannopine synthetase (mas); rice actin I; soybean seed protein glycinin (Gyl); soybean vegetative storage protein (vsp); and granule-bound starch synthase (gbss). Other "plant-functional promoters" include promoters for genes which are known to give high expression in edible plant parts, such as the patatin gene promoter from potato.
As used herein, "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences. A promoter sequence is "operably-linked" to a gene when it is in sufficient proximity to the transcription start site of a gene to regulate transcription of the gene.
As used herein, "administered" refers to the delivery of the transgenic plant material, cells, compositions, and pharmaceutical formulations of the present invention to an animal in such a manner so to guarantee that the "delivered" material contacts a mucosal surface of the animal to which it was administered. Routes of "delivery" useful in the present invention include, but are not limited to oral delivery, nasal delivery, intraperitoneal delivery, intramuscular, intravenous or subcutaneous delivery rectal or vaginal delivery (e.g., by suppository, or topical administration), or a route of delivery wherein the delivered material directly contacts a mucosal surface (i.e., "mucosal delivery"). As used herein, "pharmaceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredient(s). The characteristics of the carrier will depend on the route of administration.
As used herein, a "mucosal surface", "mucosal membrane", or "mucosa" refers to the well known medical definition of these structures, which is the surface or lining of a structure comprising an epithelium, lamina propria, and, in the digestive tract, a layer of smooth muscle. Examples of "mucosal surfaces" include, but are not limited to the inner coat of the bronchi, the mucous layer of the tympanic cavity, the inner mucous coat of the colon, the inner layer of the ductus deferens, the inner coat of the esophagus, the mucous coat of the small intestine, the mucous coat of the larynx, the mucous membrane of the tongue, the pituitary membrane, the mucous membrane of the oral cavity, the mucous membrane of the pharynx, the inner mucous layer of the trachea, the lining of the auditory tube, the mucous layer of the uterine tube, the inner layer of the ureter, the inner layer of the urethra, the endometrium, the mucous membrane of the vagina, the mucous layer of the stomach, the inner coat of the urinary bladder, and the mucous membrane of the seminal vesicle.
As used herein, a "carrier" refers to an inert and non-toxic material suitable for accomplishing or enhancing delivery of the vaccine of the present invention into an animal. Examples of a carrier include, but are not limited to water, phosphate buffered saline, or saline, and further may include an adjuvant. Adjuvants such as incomplete Freund's adjuvant, aluminum phosphate, aluminum hydroxide, or alum are materials well known in the art.
The present invention also provides pharmaceutical and veterinary compositions comprising an immunoprotective particle of the present invention in combination with one or more pharmaceutically acceptable adjuvants carriers, diluents, and excipients. Such pharmaceutical compositions may also be referred to as vaccines and are formulated in a manner well known in the pharmaceutical vaccine arts.
"Administering" or "administer" is defined as the introduction of a substance into the body of an animal and includes oral, nasal, rectal, vaginal and parenteral routes. The claimed compositions may be administered individually or in combination with other therapeutic agents via any route of administration, including but not limited to subcutaneous (SQ) intramuscular (IM), intravenous (IV), mucosal, nasal or oral. The compositions may be administered via the SQ or IM route. Especially preferred is the mucosal route, and most preferred is the oral route.
As used herein, "an effective amount or dosage of the vaccine" is an amount necessary to stimulate an innate immune response as defined herein and as detected by the assays described herein as in a human or animal sufficient for the human or animal to effectively resist a challenge mounted by a pathogen. For example, in one embodiment, "an effective amount or dosage of the vaccine" causes an increase in the amount of antibody that binds to the immunoprotective antigen of the vaccine. As used herein, an increase means a 2-fold or more, for example, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or 1000-fold or more increase in the amount of antibody produced by the vaccinated subject as compared to an unvaccinated subject. An increase also means at least 5% or more antibody production, for example, 5, 6, 10, 20, 30, 40, 50, 60 70, 80, 90 or 100% or more, by a vaccinated subject as compared to an unvaccinated subject. The dosages administered to such human or animal will be determined by a physician or veterinarian in light of the relevant circumstances including the particular immunoprotective particle or combination of particles, the condition of the human or animal, and the chosen route of administration. The dosage ranges presented herein are not intended to limit the scope of the invention in any way and are presented as general guidance for the skilled practitioner. The effective dosage can be estimated initially either in cell culture assays, or in animal models, usually mice, rabbits, dogs, or pigs. The animal model is also used to achieve a desirable concentration range and route of administration. Such information can then be used to determine useful dosages and routes for administration in humans.
The exact dosage is chosen by the individual physician in view of the patient to be treated. Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect. Additional factors which may be taken into account include the severity of the disease state; age, weight and gender of the subject; diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long acting pharmaceutical compositions might be administered every 3 to 4 days, every week, or once every two weeks depending on half-life and clearance rate of the particular formulation.
The particular dosages of an antigenic composition of the invention will depend on many factors including, but not limited to the species, age, and general condition of the human or animal to which the composition is administered, and the mode of administration of the composition. An effective amount of the composition of the invention can be readily determined using only routine experimentation. In vitro and in vivo models (for example poultry) can be employed to identify appropriate doses. Generally, 0.1, 1.0, 1.5, 2.0, 5, 10, or 100 mg/kg of an antigen will be administered to a large mammal, such as a baboon, chimpanzee, or human. If desired, co-stimulatory molecules or adjuvants can also be provided before, after, or together with the antigenic compositions. Preferably, the dosage of antigen is administered in the range of lng to 0.5 mg/kg bodyweight, more preferably, 1 mg to 50 mg/kg of body weight.
The efficacy of an edible vaccine according to the invention is determined by demonstrating that the administration of the vaccine prevents or ameliorates the symptoms of the disease being treated or caused by the pathogen of interest, by at least 5% , preferably 10-20% and more preferably, 25-100%. "Bird" is herein defined as any warm-blooded vertebrate member of the class Aves having forelimbs modified into wings, scaly legs, a beak, and bearing young in hard-shelled eggs. For purposes of this specification, preferred groups of birds are domesticated chickens, turkeys, ostriches, ducks, geese, and cornish game hens. A more preferred group is domesticated chickens and turkeys. The most preferred bird for purposes of this invention is the domesticated chicken, including broilers and layers.
The methods and compositions of the present invention are directed toward immunizing and protecting humans and animals, preferably domestic animals, such as birds (poultry), cows, sheep, goats, pigs, horses, cats, dogs and llamas, and most preferably birds. Certain of these animal species can have multiple stomachs and digestive enzymes specific for the decomposition of plant matter, and may otherwise readily inactivate other types of oral vaccines. While not meant to be a limitation of the invention, ingestion of transgenic plant cells, and compositions derived therefrom, can result in immunization of the animals at the site of the oral mucosa including the tonsils.
As used herein, "fruit" refers to the ovary of an angiosperm flower and the associated structures (e.g. the receptacle or parts of the floral tube) that enlarge and develop to form a mass of tissue surrounding the seeds. According to the invention, the particular tissues that are involved in fruit development vary with the species, but tissues involved in fruit development according to the invention, are always derived from the maternal parent of the progeny seeds.
As used herein, "ripe" refers to a stage of fruit development that is characterized by changes in pigmentation, the conversion of acids and starches to free sugars, and breakdown of cell walls that results in softening of the fruit.
As used herein, "fruit ripening conditions" refer to conditions under which the developmental processes involved in fruit ripening can occur, including cell division and expansion of maternal tissues that occurs after fertilization of ovaries. As used herein, for example, production of ethylene is a chemical signal that stimulates the genetic program for ripening in climacteric fruits such as tomato.
As used herein, "prior to the onset of fruit ripening" refers to a stage in fruit development wherein less than 10% (for example, 9.9, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.5%) of the fruit has undergone a change in pigmentation. "Prior to the onset of fruit ripening" also refers to a stage in fruit development wherein less than 10% (for example, 9.9, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.5%) of the acids and starches of a fruit are converted to sugar. "Prior to the onset of fruit ripening" also refers to a stage in fruit development wherein less than 10% (for example, 9.9, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.5%) of the cell wall material of a fruit is degraded.
As used herein, "incubating" includes growing a plant either in the field or in a controlled or uncontrolled laboratory or indoor setting. In one embodiment of the invention, an antigen is produced in a plant by "incubating", as defined herein, the plant under conditions wherein said plant expresses the antigen prior to the onset of fruit ripening.
DETAILED DESCRIPTION OF THE INVENTION
The invention relates to sequences encoding an antigen of interest, for example a plant optimized sequence encoding HN antigen of Newcastle Disease Virus or HA antigen of Avian Influenza Virus. The invention also relates to vectors, plant cells, transgenic plants and vaccines comprising the plant optimized sequences of the invention. The invention further relates to methods of protecting against viral infection, for example infection by Newcastle Disease Virus of Avian Influenza Virus. The invention also relates to methods of antigen production in transgenic plants.
IMMUNOPROTECTIVE ANTIGENS USEFUL ACCORDING TO THE INVENTION
The invention provides for plant cells and transgenic plants expressing a heterologous foreign gene. A heterologous foreign gene of the invention can be any gene of interest including but not limited to Norwalk virus capsid protein (NVCP) (Genbank Accession Number: M87661, GenBank #AF093797, Genome for Norwalk Virus, Genbank Accession Number AAB50466, for NV capsid protein), Avian Influenza hemagluttination antigen (AIV-HA) (Genbank Accession Number U67783 and AAC58999), Newcastle Disease Virus neuraminidase (NDV- HN)(Genbank Accession Numbers NM-204389, NP-989720, NP-009086, and NM-007155) (Genbank Accession Number: AY510092 and AAS10195), zona pellucida glycoprotein 3(ZP3), Hepatitis B surface Antigen (HBsAg) (Genbank Accession Numbers AF134148, AAD31865, X58569, GenBank #AF090842), shigatoxin B (StxB) (Genbank #AJ132761), staphylococcus enterotoxin B (SEB)(GenBank #M11118), E. coli labile toxin B (LT-B)(GenBank#AB011677), and E. coli labile toxin A subunit (LT-A) (GenBank #AB011677).
Newcastle's disease virus (NDV) is a member of the Paramyxovirus genus of the Paramyxoviridae. Viruses in this genus are enveloped negative-strand RNA viruses that also include parainfluenza viruses like Sendai, respiratory syncytial, mumps and measles viruses (Kingsbury et al., 1978, Intervirology, 10: 137-152). Virions are characterized by the presence of two surface glycoproteins including hemagglutinin neuraminidase (HN) a 74 kDA protein and a smaller fusion (F) protein. HN is involved in two important functions including cell attachment by recognition of sialic acid containing cell receptors, and neuraminidase activity cleaving sialic acid from progeny virus particles to prevent self-agglutination. The F protein mediates virus-to- cell and cell-to-cell fusion and hemolysis. See Scheid, A., and Choppin, P.W. (1973) J. Virology. 11, 263-271; Scheid, A, and Choppin, P.W. (1974) Virology 57, 470-490; Lamb, R.A., and Kolakofsky, D. (1996). Paramyxoviridae: the viruses and their replication, p.577-604. In B.N. Fields, D.M. Knipe, and P.M. Howley (ed.), Fields virology, 3rd ed. Lippincott-Raven Publishers, Philadelphia, Pa. Polyvalent sera prepared against either protein are capable of neutralizing the infectivity of the virus. See Mertz, D.C., Scheid, A., and Choppin, P.W. (1980) J. Exp. Med. 151, 275-288.
Avian influenza virus is described in Suarez et al., Virus Res. 1997, 51:115 and Socket., Can. Med. Assoc. J., 1998, 158:369, incorporated herein by reference in their entirety. The hemagglutinin gene of avian influenza virus is described in Barun et al., 1998, Nuc. Acids. Res., 16:4181, incorporated herein by reference in its entirety.
Preparation of the Constructs of the Invention
An expression cassette according to the invention comprises a DNA sequence encoding at least one immunoprotective antigen operably linked to transcriptional and translational control regions functional in a plant cell. Preferably the invention provides plant expression cassettes that are useful for expressing immunoprotective antigen transgenes in plants. These cassettes comprise the following elements that are operably linked from 5' to 3':
A) a plant gene promoter sequence that naturally expresses in plants;
B) a nucleic acid sequence encoding an immunoprotective antigen of interest; and
C) a 3'UTR.
Promoters useful in this embodiment are any known promoters that are functional in a plant. Many such promoters are well known to the ordinarily skilled artisan. Such promoters include promoters normally associated with other genes, and/or promoters isolated from any bacterial, viral, eukaryotic, or plant cell. It may be advantageous to employ a promoter that effectively directs the expression of the foreign coding sequence in the cell or tissue type chosen for expression. The use of promoter and cell type combinations for protein expression is generally known to those of skill in the art of molecular biology, for example, see Sambrook et al, In: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989. The promoters employed may be constitutive, or inducible, and can be used under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins or peptides. The term "constitutive" used in the context of a promoter means that the promoter is capable of directing transcription of an operably linked nucleic acid sequence in the absence of a stimulus (e.g., heat shock, chemicals, etc.). In contrast, an "inducible" promoter is one which is capable of directing a level of transcription of an operably linked nucleic acid sequence in the presence of a stimulus (e.g., heat shock, chemicals, etc.), wherein the level of the transcription is different from that in the absence of the stimulus. As used herein, "inducible" also refers to expressed in the presence of an exogenous or endogenous chemical (for example an alcohol, a hormone, or a growth factor), in the presence of light and/or in response to developmental changes. As used herein, "inducible" also refers to expressed in any tissue in the presence of a chemical inducer". As used herein, "chemical induction" according to the invention refers to the physical application of a exogenous or endogenous substance (including macromolecules e.g. proteins, or nucleic acids) to a plant or a plant organ (e.g. by spraying a liquid solution comprising a chemical inducer on leaves, application of a liquid solution to roots or exposing plants or plant organs to gas or vapor) which has the effect of causing the target promoter present in the cells of the plant or plant organ to increase the rate of transcription.
Some exemplary plant functional promoters, which can be used to express a structural gene of the present invention, are among the following: CaMV 35S and 19S promoters (US 5,352,605 and US 5,530,196); patatin promoter (US 5,436,393); a B33 promoter sequence of a patatin gene derived from Solanum tuberosum, and which leads to a tuber specific expression of sequences fused to the B33 promoter (US 5,436,393); tomato E8 promoter (WO 94/24298); tomato fruit promoters (US 5,556,653); -a plant ubiquitin promoter system (US 5,614,399 and 5,510,474); 5 cis-regulatory elements of abscisic acid-responsive gene expression (US 5,824,865); promoter from a badnavirus, rice tungro bacilliform virus (RTBV) (US 5,824,857); a chemically inducible promoter fragment from the 5' flanking region adjacent the coding region of a tobacco PR-la gene (US 5,789,214) ; a raspberry drul promoter (US 5,783,394); strawberry promoters and genes (WO 98/31812); promoter is the napin promoter, the phaseolin promoter, and the DC3 promoter (US 5,773,697); a LEA promoter (US 5,723,765); 5' transcriptional regulatory region for sink organ specific expression (US 5,723,757); G-box related sequence motifs, specifically Iwt and PA motifs, which function as cis-elements of promoters, to regulate the expression of heterologous genes in transgenic plants (US 5,723,751); PI 19 promoters and their use (US 5,633,440); Group 2 (Gp2) plant promoter sequences (US 5,608,144); nucleic acid promoter fragments derived from several genes from corn, petunia and tobacco (US 5,608,143); promoter sequences isolated from the nuclear gene for chloroplast GS2 glutamine synthetase and from two nuclear genes for cytosolic GS3 glutamine synthetase in the pea plant, Pisum sativum (US 5,391,725); full-length transcript promoter from figwort mosaic virus (FMV) (US 5,378,619); an isocitrate lyase promoter (US 5,689,040); a microspore-specific regulatory element (US 5,633,438); expression of heterologous genes in transgenic plants and plant cells using plant asparagine synthetase promoters (US 5,595,896); a promoter region that drives expression of a 1450 base TR transcript in octopine-type crown gall tumors (US 4,771,002); promoter sequences from the gene from the small subunit of ribulose-l,5-bisphosphate carboxylase (US 4,962,028); the Arabidopsis histone H4 promoter (US 5,491,288); a seed-specific plant promoter (US 5,767,363); a 21 bp promoter element which is capable of imparting root expression capability to a rbcS-3A promoter, normally a green tissue specific promoter (US 5,023,179); promoters of tissue-preferential transcription of associated DNA sequences in plants, particularly in the roots (US 5,792,925); Brassica sp. polygalacturonase promoter (US 5,689,053); a seed coat-specific cryptic promoter region (US 5,824,863); a chemically inducible nucleic acid promoter fragment isolated from the tobacco PR- la gene inducible by application of a benzo-l,2,3-thiadiazole, an isonicotinic acid compound, or a salicylic acid compound (US 5,689,044); promoter fragment isolated from a cucumber chitinase/lysozyme gene that is inducible by application of benzo- 1,2,3 -thiadiazole (US 5,654,414); a constitutive promoter from tobacco that directs expression in at least ovary, flower, immature embryo, mature embryo, seed, stem, leaf and root tissues (US 5,824,872); alteration of gene expression in plants (US 5,223,419); a recombinant promoter for gene expression in monocotyledenous plants (US 5,290,924); method for using TMV to overproduce peptides and proteins (WO 95/21248); nucleic acid comprising shoot meristem-specific promoter and regulated sequence (WO 98/05199); phaseolin promoter and structural gene (EP-B-0122791); plant promoters [sub domain of CaMV 35S] (US 5,097,025); use of tomato E8-derived promoters to express heterologous genes, e.g. 5-adenosylmethionine hydrolase in ripening fruit
(WO 94/24294); method of using transactivation proteins to control gene expression in transgenic plants (US 5,801,027); DNA molecules encoding inducible plant promoters and tomato Adh2 enzyme (US 5,821,398); synthetic plant core promoter and upstream regulatory element (WO 97/47756); monocot having dicot wound inducible promoter (US 5,684,239); selective gene expression in plants (US 5,110,732); CaMV 35S enhanced mannopine synthase promoter and method for using the same (US 5,106,739); seed specific transcription regulation (US 5,420,034); seed specific promoter region (US 5,623,067); DNA promoter fragments from wheat (US 5,139,954); chimeric regulatory regions and gene cassettes for use in plants (WO 95/14098); production of gene products to high levels (WO 90/13658); HMG promoter expression system and post harvest production of gene products in plants and plant cell cultures (US 5,670,349); gene expression system comprising the promoter region of the alpha amylase genes in plants (US 5,712,112).
A preferred group of promoters is the cassava vein mosaic virus promoters described in US Patent Application Serial Number 09/202,838, herein incorporated by reference in its entirety; the phaseolin promoters described in US Patent Number 5,591,605, herein incorporated by reference in its entirety; rice actin promoters described in US Patent Number 5,641,876, herein incorporated by reference in its entirety; the per 5 promoter described in WO 98/56921, herein incorporated by reference in its entirety; and the gamma zein promoters described in WO 00/12681.
A promoter DNA sequence is said to be "operably linked" to a coding DNA sequence if the two are situated such that the promoter DNA sequence influences the transcription of the coding DNA sequence. For example, if the coding DNA sequence codes for the production of a protein, the promoter DNA sequence would be operably linked to the coding DNA sequence if the promoter DNA sequence affects the expression of the protein product from the coding DNA sequence.
Construction of gene cassettes is readily accomplished utilizing well known methods, such as those disclosed in Sambrook et al. (1989); and Ausubel et al. (1987) Current Protocols in Molecular Biology. John Wiley and Sons, New York, NY. The present invention also includes DNA sequences having substantial sequence homology with the disclosed sequences encoding immunoprotective antigens such that they are able to have the disclosed effect on expression. As used in the present application, the term "substantial sequence homology" is used to indicate that a nucleotide sequence (in the case of DNA or RNA) or an amino acid sequence (in the case of a protein or polypeptide) exhibits substantial, functional or structural equivalence with another nucleotide or amino acid sequence. Any functional or structural differences between sequences having substantial sequence homology will be de minimis; that is they will not affect the ability of the sequence to function as indicated in the present application. Sequences that have substantial sequence homology with the sequences disclosed herein are usually variants of the disclosed sequence, such as mutations, but may also be synthetic sequences.
In most cases, sequences having 95% homology to the sequences specifically disclosed herein will function as equivalents, and in many cases considerably less homology, for example 75% or 80%, will be acceptable. Locating the parts of these sequences that are not critical may be time consuming, but is routine and well within the skill in the art. Exemplary techniques for modifying oligonucleotide sequences include using polynucleotide-mediated, site-directed mutagenesis. See Zoller et al. (1984); Higuchi et al. (1988); Ho et al. (1989); Horton et al.
(1989); and PCR Technology: Principles and Applications for DNA Amplification, (ed.) Erlich (1989).
The invention provides for a plant optimized sequence encoding an immunoprotective antigen of interest. A plant-optimized coding sequence is designed with hybrid codon preference reflecting tomato and potato codon usage (Ausubel F., et al., eds. (\994)Current Protocols in Molecular Biology, vol. 3 , p. A.1C.3 Haq TA, Mason HS, Clements JD, Arntzen CJ (1995).
A plant optimized sequence of the invention can be prepared as described in U.S. 5,380,831, incorporated by reference herein in its entirety. In general, the frequency of codon usage for a target plant of interest is used to adjust the codon usage frequency of a target gene of interest, for example, NDV HN.
The native sequence is scanned for sequence motifs that might result in interference with expression in the target plant, such as poly-A addition sites, Shaw/Kamen degradation sites, splice junction sites, and anything related to RNA termination or potential hairpin formation, etc. Runs of A/T sequences are often avoided. In one embodiment, it is preferable to keep strings of A/T to four or fewer in a row, if possible, since most regulatory sites tend to contain runs of A's and T's ( e.g. AATAAA consensus poly-A or ATTTA Shaw/Kamen). In general it is useful to scan for about 16 putative poly-A addition sequences based on identified sites from plants found in the literature. In certain embodiments, it is useful to search for C/G runs since they can stabilize hairpin stem formation. Since monocots tend to favor third position C's and G's somewhat more than dicots, the relevance of identification of C/G runs may depend on the host plant target for expression. In one embodiment wherein a gene is expressed in both dicots and monocots,an overall plant codon usage frequency is used as a basis for sequence optimization.
For the purposes of the present invention the term membrane anchor sequence contemplates that which the ordinarily skilled artisan understands about the term. Membrane anchor sequences include transmembrane protein sequences and are found in many naturally occurring proteins. Such membrane anchor sequences vary in size but always are comprised of a series of amino acids with lipophilic or aliphatic side chains that favor the hydrophobic environment within the membrane. During RNA translation and post translational processing, the anchor sequences integrate and become embedded in the cell membrane and function to anchor, or loosely attach the protein to a cellular membrane component allowing hydrophilic portions of the protein to be exposed to, and interact with, the aqueous milieu inside or outside of the cell.
In preparing the constructs of this invention, the various DNA fragments may be manipulated, so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Adapters or linkers may be employed for joining the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like.
In carrying out the various steps, cloning is employed, so as to amplify a vector containing the promoter/gene of interest for subsequent introduction into the desired host cells. A wide variety of cloning vectors are available, where the cloning vector includes a replication system functional in E. coli and a marker which allows for selection of the transformed cells. Illustrative vectors include pBR322, pUC series, pACYC184, Bluescript series (Stratagene) etc. Thus, the sequence may be inserted into the vector at an appropriate restriction site(s), the resulting plasmid used to transform the E. coli host (e.g., E. coli strains HB101, JM101 and DH5α), the E. coli grown in an appropriate nutrient medium and the cells harvested and lysed and the plasmid recovered. Analysis may involve sequence analysis, restriction analysis, electrophoresis, or the like. After each manipulation the DNA sequence to be used in the final construct may be restricted and joined to the next sequence, where each of the partial constructs may be cloned in the same or different plasmids.
Vectors are available or can be readily prepared for transformation of plant cells. In general, plasmid or viral vectors should contain all the DNA control sequences necessary for both maintenance and expression of a heterologous DNA sequence in a given host. Such control sequences generally include a leader sequence and a DNA sequence coding for translation start- signal codon, a translation terminator codon, and a DNA sequence coding for a 3' UTR signal controlling messenger RNA processing. Selection of appropriate elements to optimize expression in any particular species is a matter of ordinary skill in the art utilizing the teachings of this disclosure. Finally, the vectors should desirably have a marker gene that is capable of providing a phenotypical property which allows for identification of host cells containing the vector.
The activity of the foreign coding sequence inserted into plant cells is dependent upon the influence of endogenous plant DNA adjacent to the insert. Generally, the insertion of heterologous genes appears to be random using any transformation technique; however, technology currently exists for producing plants with site specific recombination of DNA into plant cells (see WO 91/09957). Any method or combination of methods resulting in the expression of the desired sequence or sequences under the control of the promoter is acceptable.
The present invention is not limited to any particular method for transforming plant cells.
Technology for introducing DNA into plant cells is well-known to those of skill in the art. Four basic methods for delivering foreign DNA into plant cells have been described. Chemical methods (Graham and van der Eb, Virology, 54(02):536-539, 1973; Zatloukal, Wagner, Cotten, Phillips, Plank, Steinlein, Curiel, Birnstiel, Ann. NY. Acad. Sci., 660:136-153, 1992); Physical methods including microinjection (Capecchi, Cell, 22(2):479-488, 1980), electroporation (Wong and Neumann, Biochim. Biophys. Res. Conmmun. 107(2):584-587, 1982; Fromm, Taylor, Walbot, Proc. Natl. Acad. Sci. USA, 82(17):5824-5828,1985; U.S. Pat. No. 5,384,253) and the gene gun (Johnston and Tang, Methods Cell. Biol, 43(A):353-365, 1994; Fynan, Webster, Fuller, Haynes, Santoro, Robinson, Proc. Natl. Acad. Sci. USA 90(24): 11478-11482, 1993); Viral methods (Clapp, Clin. Perinatol, 20(1): 155-168, 1993; Lu, Xiao, Clapp, Li, Broxmeyer, J. Exp. Med. 178(6):2089-2096, 1993; Eglitis and Anderson, Biotechniques, 6(7):608-614, 1988; Eglitis, Kantoff, Kohn, Karson, Moen, Lothrop, Blaese, Anderson, Avd. Exp. Med. Biol, 241:19- 27, 1988); and Receptor-mediated methods (Curiel, Agarwal, Wagner, Cotten, Proc. Natl. Acad. Sci. USA, 88(19):8850-8854, 1991; Curiel, Wagner, Cotten, Birnstiel, Agarwal, Li, Loechel, Hu, Hum. Gen. Ther., 3(2): 147-154, 1992; Wagner et al., Proc. Natl. Acad. Sci. USA, 89 (13):6099- 6103, 1992). The introduction of DNA into plant cells by means of electroporation is well-known to those of skill in the art. Plant cell wall-degrading enzymes, such as pectin-degrading enzymes, are used to render the recipient cells more susceptible to transformation by electroporation than untreated cells. To effect transformation by electroporation one may employ either friable tissues such as a suspension culture of cells, or embryogenic callus, or immature embryos or other organized tissues directly. It is generally necessary to partially degrade the cell walls of the target plant material to pectin-degrading enzymes or mechanically wounding in a controlled manner. Such treated plant material is ready to receive foreign DNA by electroporation.
Another method for delivering foreign transforming DNA to plant cells is by microprojectile bombardment. In this method, microparticles are coated with foreign DNA and delivered into cells by a propelling force. Such micro particles are typically made of tungsten, gold, platinum, and similar metals. An advantage of microprojectile bombardment is that neither the isolation of protoplasts (Cristou et al, 1988, Plant Physiol, 87:671-674,) nor the susceptibility to Agrobacterium infection is required. An illustrative embodiment of a method for delivering DNA into maize cells by acceleration is a Biolistics Particle Delivery System, which can be used to propel particles coated with DNA or cells through a screen onto a filter surface covered with corn cells cultured in suspension. The screen disperses the particles so that they are not delivered to the recipient cells in large aggregates. For the bombardment, cells in suspension are preferably concentrated on filters or solid culture medium. Alternatively, immature embryos or other target cells may be arranged on solid culture medium. The cells to be bombarded are positioned at an appropriate distance below the macroprojectile stopping plate. In bombardment transformation, one may optimize the prebombardment culturing conditions and the bombardment parameters to yield the maximum numbers of stable transformants. Both the physical and biological parameters for bombardment are important in this technology. Physical factors are those that involve manipulating the DNA/microprojectile precipitate or those that affect the flight and velocity of the microprojectiles. Biological factors include all steps involved in manipulation of cells before and immediately after bombardment, the osmotic adjustment of target cells to help alleviate the trauma associated with bombardment, and also the nature of the transforming DNA, such as linearized DNA or intact supercoiled plasmids.
Agrobacterium-mediated transfer is a widely applicable system for introducing foreign
DNA into plant cells because the DNA can be introduced into whole plant tissues, eliminating the need to regenerate an intact plant from a protoplast. The use of Agrobacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art. See, for example, the methods described in Fraley et al, 1985, Biotechnology, 3:629; Rogers et al, 1987, Meth. in Enzymol, 153:253-277. Further, the integration of the Ti-DNA is a relatively precise process resulting in few rearrangements. The region of DNA to be transferred is defined by the border sequences, and intervening DNA is usually inserted into the plant genome as described in Spielmann et al, 1986, Mol. Gen. Genet., 205:34; Jorgensen et al, 1987, Mol. Gen. Genet., 207:471.
Modern Agrobacterium transformation vectors are capable of replication in E. coli as well as Agrobacterium, allowing for convenient manipulations. Moreover, recent technological advances in vectors for Agrobacterium-mediated gene transfer have improved the arrangement of genes and restriction sites in the vectors to facilitate construction of vectors capable of expressing various proteins or polypeptides. Convenient multi-linker regions flanked by a promoter and a polyadenylation site for direct expression of inserted polypeptide coding genes are suitable for present purposes. In addition, Agrobacterium containing both armed and disarmed Ti genes can be used for the transformations.
Transformation of plant protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments (see, e.g., Potrykus et al, 1985, Mol. Gen. Genet., 199: 183; Marcotte et al, Nature, 335:454, 1988). Application of these systems to different plant species depends on the ability to regenerate the particular species from protoplasts.
Once the plant cells have been transformed, selected and checked for antigen expression, it is possible in some cases to regenerate whole fertile plants. This will greatly depend on the plant species chosen. Methods for regenerating numerous plant species have been reported in the literature and are well known to the skilled artisan. For practice of the present invention, it is preferable to transform plant cell lines that can be cultured and scaled-up rapidly by avoiding the generally lengthy regeneration step. In addition the use of plant cell cultures avoids open field production and greatly reduces the chances of gene escape and food contamination. Tobacco suspension cell cultures such as NT-1 and BY-2 (An, G., 1985 Plant Physiol 79, 568-570) are preferred because these lines are particularly susceptible to handling in culture, are readily transformed, produce stably integrated events and are amenable to cryopreservation. The tobacco suspension cell line, NT-1, is suitable for the practice of the present invention. NT-1 cells were originally developed from Nicotiana tabacum L.cv. bright yellow 2. The NT-1 cell line is widely used and readily available; though, any tobacco suspension cell line is consistent with the practice of the invention. It is worth noting that the origins of the NT-1 cell line are unclear. Moreover, the cell line appears variable and is prone to change in response to culture conditions. NT-1 cells suitable for use in the examples below are available from the American Type Culture Collection under accession number ATCC No. 74840. See also US Pat No 6,140,075, herein incorporated by reference.
Many plant cell culture techniques and systems ranging from laboratory-scale shaker flasks to multi-thousand liter bioreactor vessels have been described and are well know in the art of plant cell culture. See for example Fischer, R. et al, 1999 Biotechnol Appl Biochem. 30, 109- 112 and Doran, P., 2000 Current Opinions in Biotechnology 11, 199-204. After the transformed plant cells have been cultured to the mass desired, they are harvested, gently washed and placed in a suitable buffer for sonication. Many different buffers are compatible with the present invention. In general the buffer is an aqueous isotonic buffered salt solution at or near a neutral pH value that does not contain any detergent. Preferred buffers include Dulbeccos Phosphate Buffered Saline and PBS containing 1 mM EDTA.
For sonication, the washed cells are placed in buffer in a range of about 0.01 gm/ml to about 5.0 gm/ml, preferably in a range of about 0.1 gm/ml to about 0.5 gm/ml (washed wet weight cells per volume of buffer). Many commercially available sonication instruments are consistent with the invention and sonication times range from about 5 to about 20 seconds, preferably about 15 to about 20 seconds. The resulting particles are membrane vesicles that may range in size from a few microns to several hundred microns and expose the recombinant, immunoprotective, anchored proteins.
An immunoprotective agent or antigen of interest is expressed and isolated according to methods well known in the art and described in the examples herein below.
In one embodiment, a method of producing an antigen of interest comprises preparing a transgenic plant comprising a vector encoding the antigen. The plant is incubated under conditions wherein the plant expresses the antigen prior to the onset of ripening of the plant. According to this embodiment, the plant has a fruit that ripens (including but not limited to tomato, banana, citrus, melon, strawberry, pineapple, stonefruit, mango, pumpkin, squash etc..) The antigen produced according to this method can be isolated from the plant, or from the fruit of the plant prior to administration. Alternatively, the antigen is not isolated from the plant but is administed in a crude, food-processed or raw form.The details of this method are described in the Examples below.
Plants Useful According to the Invention
The present invention also provides for a transgenic plant transformed with the constructs of the invention. Plants that can be used for practice of the present invention include any dicotyledon and monocotyledon. These include, but are not limited to, tobacco, tomato, potato, eggplant, pepino, yam, soybean, pea, sugar beet, lettuce, bell pepper, celery, carrot, asparagus, onion, grapevine, muskmelon, strawberry, rice, sunflower, rapeseed/canola, wheat, oats, maize, cotton, walnut, spruce/conifer, poplar and apple, berries such as strawberries, raspberries, alfalfa and banana. Since many edible plants used by humans for food or as components of animal feed are dicotyledenous plants, dicotyledons are typically employed, although monocotyledon transformation is also applicable especially in the production of certain grains useful for animal feed. It is particularly advantageous in certain disease prevention for human infants to produce a vaccine in a juice for ease of administration to humans such as juice of tomato, soybean, and carrot, or milk. Cells and seeds derived from these plant vaccines are also useful according to the invention.
Representative plants that have been transformed with this system and representative references are listed in Table A. Other plants having edible parts, or which can be processed to afford isolated protein, can be transformed by the same methods or routine modifications thereof.
Table A
Plant Reference
Tobacco Barton, K. et al, (1983) Cell 32, 1033 Tomato Fillatti, J. et al, (1987) Bio/Technology 5, 726-730
Potato Hoekema, A. et al, (1989) Bio/Technology 1: 273-278
Eggplant Filipponee, E. et al, (1989) Plant Cell Rep. 8: 370-373
Pepino Atkinson, R. et al, (1991) Plant Cell Rep. 10: 208-212
Yam Shafer, W. et al, (1987) Nature. 327:529-532 Soybean Delzer, B., et al, (1990) Crop Sci. 30: 320-322
Pea Hobbs, S. et al, (1989) Plant Cell Rep. 8: 274-277
Sugar beet Kallerhoff, J. et al, (1990) Plant Cell Rep. 9: 224-228
Lettuce Michelmore, R, et al, (1987) Plant Cell Rep. 6: 439-442 Bell pepper Liu, W. et al, (1990) Plant Cell Rep. 9: 360-364
Celery Liu, C-N. et al, (1992) Plant Mol. Biol. 1071-1087
Carrot Liu, C-N. et al, (1992) Plant Mol Biol. 1071-1087
Asparagus Delbriel, B. et al, (1993) Plant Cell Rep. 12: 129-132
Onion Dommisse, E. et al; (1990) Plant Sci. 69:249-257 Grapevine Baribault, T., et al, (1989) Plant Cell Rep. 8: 137-140
Muskmelon Fang, G, et al, (1990) Plant Cell Rep. 9: 160-164
Strawberry Nehra, N. et al, (1990) Plant Cell Rep. 9: 10-13
Rice Raineri, D. et al, (1990) Bio/Technology. 8: 33-38
Sunflower Schrammeijer, B. et al, (1990) Plant Cell Rep. 9:55-60 Rapeseed/Canola Pua, E. et al, (1987) Bio/Technology 5. 815
Wheat Mooney, P. et al, (1991) Plant Cell Tiss. Organ Cult. 25:209-218
Oats Donson, J. et al, (1988) Virology. 162: 248-250
Maize Gould, J. et al, (1991) Plant Physiol 95: 426-434
Alfalfa Chabaud, M. et al, (1988) Plant Cell Rep. 1: 512-516 Cotton Umbeck, P. et al, (1987) Bio/Technology. 5:263-266
Walnut McGranahan, G. et al, (1990) Plant Cell Rep. 8:512-516
Spruce/Conifer Ellis, D. et al, (1989) Plant Cell Rep. 8:16-20
Poplar Python, F. et al, (1987) Bio/Technology 5:1323
Apple James, P. et al, (1989) Plant Cell Rep. 7:658-661 A transgenic plant transformed with a vector described hereinabove is another aspect of the present invention.
Potato varieties FL 1607 ("Frito Lay 1607") and Desiree, and tomato variety Tanksley TA234TM2R are particularly preferred varieties, which have been transformed with binary vectors using the methods described herein. Of these transformed varieties, Desiree is the only commercial variety; the other varieties can be obtained from Frito-Lay (Rhinelander, WI) and Steve Tanksley (Dept. of Plant Breeding, Cornell Univ.). Potato variety FL1607 allows rapid transformation but is not a good agronomic variety as it suffers from hollow heart.
Tomato is preferred as a model system for expression of foreign proteins because of its ease of genetic transformation, and because fruit-specific, ripening dependent promoters are available for regulated expression (Giovannoni et al, 1989).
The invention includes whole plants, plant cells, plant organs, plant tissues, plant seeds, protoplasts, callus, cell cultures, and any group of plant cells organized into structural and/or functional units capable of expressing at least a polynucleotide of the invention. Preferably, whole plants, plant cells, plant organs, plant tissues, plant seeds, protoplasts, callus, cell cultures, and any group of plant cells produce 0.001, 0.01, 1, 5, 10, 25, 50, 100, 500, or 1000 μg of polypeptide of the invention per gram of total soluble plant material.
Use, Dosage and Administration of a Vaccine According to the Invention
Food plant produced antigens provide a less expensive source of antigen, that does not require animal-sourced components, for the preparation of vaccines.
The vaccines according to the invention are useful for protection against a pathogen of interest and against viral infection.
1. Administration
The invention provides for methods of administering a vaccine according to the invention to a mammal to prevent viral infection.
In one embodiment, a vaccine is administered orally (either by feeding or by oral gavage) to ensure inducing a mucosal immune response as well as to take advantage of cost and convenience. Conveniently, an oral administration step entails consuming a transgenic plant or plant part according to the invention. An edible vaccine according to the invention can be in the form of a plant part, an extract, a juice, a liquid, a powder or a tablet.
An vaccine according to the invention may also be administered by via an intranasal route in the form of a nasal spray. Alternatively, a vaccine according to the invention may be administered orally, intraperitoneally, intramuscularly, intravenously, or subcutaneously.
The invention provides for compositions comprising an edible vaccine admixed with a physiologically compatible carrier. As used herein, "physiologically compatible carrier" refers to a physiologically acceptable diluent such as water, phosphate buffered saline, or saline, and further may include an adjuvant. Adjuvants such as incomplete Freund's adjuvant, aluminum phosphate, aluminum hydroxide, or alum are materials well known in the art.
The invention also provides for pharmaceutical compositions. In addition to the active ingredients, these pharmaceutical compositions may contain suitable pharmaceutically acceptable carrier preparations which can be used pharmaceutically.
Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for ingestion by the patient.
Pharmaceutical preparations for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are carbohydrate or protein fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethyl cellulose; and gums including arabic and tragacanth; and proteins such as gelatin and collagen. If desired, disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
Dragee cores are provided with suitable coatings such as concentrated sugar solutions, which may also contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating such as glycerol or sorbitol. Push-fit capsules can contain active ingredients mixed with a filler or binders such as lactose or starches, lubricants such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers.
Pharmaceutical formulations for parenteral administration include aqueous solutions of active compounds. For injection, the pharmaceutical compositions of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiologically buffered saline. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the active solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
For nasal administration, penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
2. Manufacture and Storage
The pharmaceutical compositions of the present invention may be manufactured in a manner known in the art, e.g. by means of conventional mixing, dissolving, granulating, dragee- making, levitating, emulsifying, encapsulating, entrapping or lyophilizing processes.
The pharmaceutical composition may be provided as a salt and can be formed with many acids, including but not limited to hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc... Salts tend to be more soluble in aqueous or other protonic solvents that are the corresponding free base forms. In other cases, the preferred preparation may be a lyophilized powder in lmM-50 mM histidine, 0.1%-2% sucrose, 2%-7% mannitol at a pH range of 4.5 to 5.5 that is combined with buffer prior to use. After pharmaceutical compositions comprising a compound of the invention formulated in an acceptable carrier have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition with information including amount, frequency and method of administration.
3. Therapeutically Effective Dose
Pharmaceutical compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in an effective amount to achieve the intended purpose. The determination of an effective dose is well within the capability of those skilled in the art.
For any compound, the therapeutically effective dose can be estimated initially either in cell culture assays, or in animal models, usually birds, mice, rabbits, dogs, or pigs. The animal model is also used to achieve a desirable concentration range and route of administration. Such information can then be use to determine useful doses and routes for administration in humans.
A therapeutically effective dose refers to that amount of protein or its antibodies, antagonists, or inhibitors which prevent or ameliorate the symptoms or conditions, for example caused by viral infection. Therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, eg, ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population). The dose ratio between therapeutic and toxic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED50. Pharmaceutical compositions which exhibit large therapeutic indices are preferred. The data obtained from cell culture assays and animals studies is used in formulating a range of dosage for human use. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage varies within this range depending upon the dosage from employed, sensitivity of the patient, and the route of administration.
The exact dosage is chosen by the individual physician or veterinarian in view of the patient to be treated. Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect. Additional factors which may be taken into account include the severity of the disease state; age, weight and gender of the subject; diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long acting pharmaceutical compositions might be administered every 3 to 4 days, every week, or once every two weeks depending on a half-life and clearance rate of the particular formulation.
In general, compositions contain from about 0.5% to about 50% of the compounds in total, depending on the desired doses and the type of composition to be used. The amount of the compounds, however, is best defined as the effective amount, that is, the amount of each compound which provides the desired dose to the subject in need of such treatment. The activity of the adjunctive combinations does not depend on the nature of the composition, so the composition is chosen and formulated solely for convenience and economy. Any of the combinations may be formulated in any desired form of composition.
Dosage amounts may vary from 0.1 to 100,000 micrograms of recombinant protein; transformed plant cell, or transformed transgenic plant per subject per day, for example, lug, lOug, lOOug, 500 ug, lmg, lOmg, and even up to a total dose of about lg per subject per day, depending upon the route of administration. In one embodiment, the dosage is in the range of 1 ng to ).5 mg per kilogram bodyweight. In another embodiment, the dosage is in the range of lμg to 50 μg per kilogram bodyweight. In another embodiment, the dosage is in the range of 1 to 25 μg per kilogram bodyweight. In another embodiment, the dosage is in the range of 2 to 25 μg per kg body weight. In another embodiment, the dosage is in the range of 2 to 15 μg per kg bodyweight. For example, in one embodiment HN antigen is administered subcutaneously in a range of 2.5 to 5 μg, and IN/ocularly in a range of .5 to 12 μg; HA antigen is administered subcutaneously at a dose of 1 to 5 mg, IN/ocuraly in a range of 24 to 26 μg; VP2 antigen is administered subcutaneously in a range of 8 to 17 μg, and LT antigen is administered orally in a range of 50 to 100 ng, subcutaneously in a range of 2-10μg and IN/ocularly in a range of 2 to 10 μg; Guidance as to particular dosages and methods of delivery is provided in the literature. See U.S. Patent Nos. 4,657,760; 5,206,344; or 5,225,212, hereby incorporated by reference. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotide or polypeptides will be specific to particular cells, conditions, locations, etc.
Testing the Efficacy of a Vaccine of the Invention
The efficacy of a vaccine according to the invention is determined by demonstrating that the administration of the vaccine prevents or ameliorates the symptoms of the viral infection being treated or prevented or the symptoms induced by the pathogen of interest, by at least 5% , preferably 10-20% and more preferably, 25-100%.
The efficacy of a vaccine according to the invention is determined by measuring antibody production in response to vaccination with a plant derived protein of interest, detection of the production of antibody in response to vaccination with a plant derived protein of interest, wherein the antibody inhibits hemagluttination, and assessing the mortality of a subject that has been inoculated and then challenged with a vaccine comprising an immunoprotective antigen of the invention (all as described hereinbelow).
Having now generally described the invention, the same will be more readily understood through reference to the following Examples which are provided by way of illustration, and are not intended to be limiting of the present invention, unless specified.
Example 1: Vectors
Gene Construction: The coding sequence of the HN gene of NDV strain "Lasota" (GenBank accession AF077761) was analyzed for codon use and the presence of undesired sequence motifs that could mediate spurious mRNA processing and instability, or methylation of genomic DNA. See Adang MJ, Brody MS, Cardineau G, Eagan N, Roush RT, Shewmaker CK, Jones A, Oakes JV, McBride KE (1993) The construction and expression of Bacillus thuringiensis crylllA gene in protoplasts and potato plants. Plant Mol Biol 21: 1131-1145. A plant-optimized coding sequence was designed with hybrid codon preference reflecting tomato and potato codon usage (Ausubel F., et al., eds. (1994)Current Protocols in Molecular Biology, vol. 3 , p. A.1C.3 Haq TA, Mason HS, Clements JD, Amtzen CJ (1995) Oral immunization with a recombinant bacterial antigen produced in transgenic plants. Science 268:714-716). The designed sequence is shown in Figure 1. The synthetic HN gene was assembled by a commercial supplier (Retrogen) and was received in two separate plasmids containing either the 5' (p4187-4203-l) or 3' (p42111-4235-lc-l) half of the gene cloned into pCR-Blunt.
Plasmid construction: Binary vectors for Agrobacterium-mediated plant transformations were constructed based on vector pBBV-PHAS-iaaH shown in Figure 2, which uses the plant selection marker phosphinothricin acetyl transferase (PAT), described in US Patent Nos:
5,879,903; 5,637,489; 5,276,268; and 5,273,894 herein incorporated by reference, driven by the constitutive cassava vein mosaic virus promoter (CsVMV) described in WO 97/48819. The
/ααHgene and the phaseolin promoter sequence were deleted by digestion of pBBV-PΗAS-iaaΗ with Pad and religated to form pCVMV-PAT; then the single Hindlll site was deleted by filling it with Klenow enzyme and religating to form pCP!H. The CsVMV promoter was end-tailored by PCR using primers CVM-Asc (5*-ATGGCGCGCCAGAAGGTAATTATCCAAG SEQ ID NO:5) and CVM-Xho (5*-ATCTCGAGCCATGGTTTGGATCCA SEQ ID NO:6) on template pCP!H, and the product was cloned in EcoRV-digested, T-tailed pBluescriptKS to make pKS- CVM7. A map of pCP!H is shown in Figure 3. The HN expression cassette pKS-CHN was constructed by ligating the vector pKS-CVM7/NcoI-EcoRI with 3 insert fragments: the HN 5' half on Ncol/Pstl, the HN 3' half on Pstl/Kpnl, and the soybean vspB 3' element on Kpnl-EcoRI (Haq 1995). The binary T-DNA vector pCHN was then assembled by ligation of the vector pCP!H/AscI-EcoRI and the AscI-EcoRI fragment of pKS-CHN. A map of pCHN is shown in Figure 4.
The granule bound starch synthase (GBSS) promoter, described in US Pat No. 5,824,798 herein incorporated by reference, was used to make other vectors. These constructs were made using a promoter fragment amplified from genomic DNA of Solanum tuberosum L. cv. "Desiree" using primers designed from the sequence in GenBank accession X83220 for the Chinese potato cultivar "Dongnong". A mutagenic primer "GSS-Nco" (5'- tgccatggtgatgtgtggtctacaa SEQ ID NO: 7) was used to create a Nco I site overlapping the translation initiation codon, along with forward primer "GSS-1.8F" (5'-gatctgacaagtcaagaaaattg SEQ ID NO:8) complimentary to the 5' region at -1800 bp; the 1825 bp PCR product was cloned in T-tailed pBluescriptKS to make pKS-GBN, and sequenced. A mutagenic primer "GSS-Xho" (5'-agctcGAGCTGTGTGAGTGAGTG SEQ ID NO:9) was used to create a Xhol site just 3' of the transcription start site along with primer "GSS-1.8F"; the 1550 bp PCR product was cloned in T-tailed pBluescriptKS to make pKS-GBX, and sequenced.
A GBSS promoter expression cassette containing the TEV 5 'UTR (untranslated region), described in US Pat No. 5,891,665 herein incorporated by reference, was assembled by ligation of vector pTH210 digested with Hindlll/Xhol with the Hindlll/Xhol fragment of pKS-GBX, which effected a substitution of the CaMV 35S promoter with the 811 bp GBSS promoter, to make pTH252A. See Haq TA, Mason HS, Clements JD, Arntzen CJ (1995) Oral immunization with a recombinant bacterial antigen produced in transgenic plants. Science 268:714-716. The HN gene was inserted into ρTH252A NcoI-KpnI by ligation with the HN 5' half on Ncol/Pstl and the HN 3' half on Pstl/Kpnl to make ρHN252A. The binary T-DNA vector pgHN was made by ligation of the vector pGLTB (shown in Figure 11) digested with Nsil and EcoRI with the fragments pHN252A/NsiI-KpnI and pTH210/KpnI-EcoRI. A map of pgHN is shown in Figure 5.
A GBSS promoter expression cassette containing the GBSS 5 'UTR, described in US Pat No. 5,824,798 herein incorporated by reference, with its intron, was assembled by ligation of vector pTH210 (Haq 1995) digested with Hindlll/Ncol with the Hindlll/Ncol fragment of pKS- GBN, which effected a substitution of the (cauliflower mosaic virus) CaMV 35 S promoter/TEV 5 'UTR with the 1084 bp GBSS promoter/5' -UTR, to make pTH251A. The binary T-DNA vector pgHN151 was made by ligation of the vector pCLT105 (shown in Figure 12) with fragments pTH251A/HindIII-NcoI and pHN252A/NcoI-KpnI. A map of pgHN151 is shown in Figure 6.
A GBSS promoter expression cassette containing the GBSS 5 'UTR with its intron and the bean phaseolin 3' element (described in US Patent Nos. 5,270,200; 6,184,437; 6,320,101, herein incorporated by reference) was constructed. First, pCP!H was digested at the unique Kpnl site, blunted with T4 DNA polymerase, and religated to make pCP!HK, which has the Kpnl site removed. pCPIHK was digested with Nsil, followed by blunting with T4 DNA polymerase, and then digestion with Pad. The resulting vector was ligated with a 2848 bp fragment from pgHN151 digested with Sad, followed by blunting with T4 DNA polymerase, and then digestion with Pad, to make pgHN 153. A map of pgHN 153 is shown in Figure 7.
A chimeric constitutive promoter (4OCSΔMAS US pat Nos: 5,001,060; 5,573,932 and 5,290,924 herein incorporated by reference) was used to construct another expression vector for HN. Plasmid, pAGM149, was digested with EcoRV and partial digestion with BamHI. This fragment was ligated with pCHN digested with Pmel/Pstl and the 5' half of the synthetic HN gene obtained by digestion of pKS-CHN with BamHI Pstl. The resulting pMHN is shown in Figure 8.
A plasmid containing the HA gene of AIV A/turkey/Wisconsin/68 (H5N9) was obtained from David Suarez (SEPRL, Athens, GA). It was end-tailored by PCR to add restriction sites Ncol at the 5' and Kpnl at the 3' end, and inserted into the vector pIBT210.1 (Haq et al., 1995), containing the 35S promoter, TEV 5'-UTR, and vspB 3' end. The expression cassette was transferred to the binary vector pGPTV-Kan (Becker et al., Plant Mol Biol 1992; 20: 1195-7) by digestion with Hindlll and EcoRI (partial), to make pIBT-HAO. The HA gene/vspB3' end fragment from pIBT-HAO was obtained by digestion with Ncol and EcoRI (partial), and inserted into pKS-CVM7 to make pKS-CHA. The cassette containing the CsVMV promoter, HA gene, and vspB3' end was obtained from pKS-CHA by digestion with Ascl and EcoRI (partial), and ligated with pCP!H to make pCHA, shown in Figure 9.
A dicot expression vector containing the plant-optimized nucleotide sequence of NDV- HN was constructed. The completed construct contained the gene cassette; Arabidopsis thaliana (At) Ubiquitin 3 (Ubi3) promoter v2/ Newcastle Disease Virus Hemagluttin Neuraminidase (NDV-HN)/ vspb 3 'UTR :: Cassava Vein Mosaic Virus (CsVMV) promoter/ PAT selectable marker/ Arabidopsis thaliana (At) ORF 25 3 'UTR in a binary expression vector.
The expression cassette was assembled by completing a 3-way ligation (Figure48). The binary vector pCGUS was modified by removing the CsVMV promoter and GUS gene. A restriction enzyme digest with the enzymes HinDIII and Kpnl (New England Biolabs) liberated a DNA fragment of 8310 bp. The NDV-HN gene was isolated from the plasmid pCHN as an Ncol/ Kpnl (New England Biolabs) restriction enzyme digestion DNA fragment of 1731 bp. Finally, the AtUbi3 promoter v2 was isolated from pDAB7121 as an Ncol / Hindlll (New England Biolabs) restriction enzyme digestion. The resulting reaction produced a DNA fragment of 1732 bp. The DNA of all three enzyme digestions was excised from agarose gel via the "QiaexII Gel Extraction Kit" (Qiagen). A 3-way ligation was completed using equimolar concentrations of all three DNA fragments. The ligation was catalyzed by the "T4 DNA Ligase" (New England Biolabs). The resulting ligation product was transformed into "One Shot Top 10 Chemically Competent E. coli. " (Invitrogen). Two colonies were isolated from this transformation. Initial screening via restriction enzyme digestion indicated that both clones produced the expected DNA banding pattern. The restriction enzyme reactions that were completed used the following enzymes; EcoRV, Fspl, HinDIII, Ncol, Sad, Seal (New England Biolabs) . Further confirmation of the correct construct involved a sequencing reaction over the AtUbi 3' promoter v2 / NDV-HN border. A sequencing reaction with the primer pUHN2 (tgg ttg gag cct agg gta ct) was completed using the "Beckman CEQ Quick Start Kit" (Beckman Coulter). The results of this sequencing reaction indicated that the AtUbi3 'promoter v2 DNA fragment did ligate with the NDV-HN DNA fragment at the intended Ncol restriction site. Sequencing across the NDV-HN / pCGUS border and pCGUS / AtUbi3' promoter v2 border required additional steps. A PCR reaction of both borders was completed. The NDV-HN / pCGUS border and pCGUS/ AtUbi3 'promoter v2 border were PCR amplified using the "FailSafe PCR Kit" (Epicenter). Two reactions for the NDV-HN / pCGUS border were completed using the FailSafe buffer's B and C with the PCR primers Kpnl 5' (act aat act taa tga taa ca) and Kpnl 3' (ata cac tac etc cac atg tt). The PCR reactions for the pCGUS / AtUbi3' promoter v2 border were completed using FailSafe buffer's B and C with the PCR primers HinDIII 5' (tgccggttttcaggtaac ata) and HinDIII 3' (agt tag gcc cga ata gtt tga a). All of the PCR reactions produced DNA fragments of the expected length (~600bp). The PCR amplifications of the border regions were cloned into the "TOPO TA cloning kit with pCR2.1-TOPO" (Invitrogen). Clones containing the amplified border region were identified via an EcoRI restriction enzyme digestion (New England Biolabs). To confirm that the intended ligation at these border junctions did occur, a sequencing reaction was completed using the "Beckman CEQ Quick Start Kit" (Beckman Coulter) with the Ml 3 reverse sequencing primer (aac age tat gac cat g). The results of these sequencing reactions indicated that the correct ligation reaction did occur at the pCGUS/ NDV-HN and the pCGUS/ At Ubi 3 promoter v2 borders.
Example 2: Preparation of Transgenic Nicotiana tabacum
Three to 4 days prior to transformation, a 1 week old NT-1 culture was sub-cultured to fresh medium by adding 2 ml of the NT-1 culture into 40 ml NT-1 media. The sub-culture was maintained in the dark at 25 + 1°C on a shaker at 100 rpm.
NT-1 Medium
Figure imgf000045_0001
Bl Inositol Stock flOOxXl liter)
Thiamine HCI (Vit Bl) - 0.1 g
MES (20x) f 1 liter
MES (2-N-morpholinoethanesulfonic acid) 10 g
Myoinositol - 10 g
Miller's I (1 liter)
KH2PO4 - 60 g Agrobacterium tumefaciens containing the expression vector of interest was streaked from a glycerol stock onto a plate of LB medium containing 50 mg/l spectinomycin. The bacterial culture was incubated in the dark at 30°C for 24 to 48 hours. One well-formed colony was selected, and transferred to 3 ml of YM medium containing 50 mg/L spectinomycin. The liquid culture was incubated in the dark at 30°C in an incubator shaker at 250 rpm until the OD600 was 0.5 - 0.6. This took approximately 24 hrs.
LB Medium
Reagent Per liter
Figure imgf000046_0001
YM Medium
Reagent Per liter
Figure imgf000046_0002
(Alternatively, YM in powder form can be purchased (Gibco BRL; catalog #10090-011). To make liquid culture medium, add 11.1 g to 1 liter water.)
On the day of transformation, 1 μl of 20 mM acetosyringone was added per ml of NT-1 culture. The acetosyringone stock was made in ethanol the day of the transformation. The NT-1 cells were wounded to increase the transformation efficiency. For wounding, the suspension culture was drawn up and down repeatedly (20 times) through a 10 ml wide-bore sterile pipette. Four milliliters of the suspension was transferred into each of 10, 60 x 15 mm Petri plates. One plate was set aside to be used as a non-transformed control. Approximately, 50 to 100 μl of Agrobacterium suspension was added to each of the remaining 9 plates. The plates were wrapped with parafilm then incubated in the dark on a shaker at 100 rpm at 25 + 1°C for 3 days.
Cells were transferred to a sterile, 50 ml conical centrifuge tube, and brought up to a final volume of 45 ml with NTC medium (NT-1 medium containing 500 mg/L carbenicillin, added after autoclaving). They were mixed, then centrifuged at 1000 rpm for 10 min in a centrifuge equipped with a swinging bucket rotor. The supernatant was removed, and the resultant pellet was resuspended in 45 ml of NTC. The wash was repeated. The suspension was centrifuged, the supernatant was discarded, and the pellet was resuspended in 40 ml NTC. Aliquots of 5 ml were plated onto each Petri plate (150 x 15 mm) containing NTCB10 medium (NTC medium solidified with 8g/l Agar/Agar; supplemented with 10 mg/l bialaphos, added after autoclaving). Plates were wrapped with parafilm then maintained in the dark at 25° + 1°C. Before transferring to the culture room, plates were left open in the laminar flow hood to allow excess liquid to evaporate. After 6 to 8 weeks, putative transformants appeared. They were selected and transferred to fresh NTCB5 (NTC medium solidified with 8g/l Agar/Agar; supplemented with 5 mg/l bialaphos, added after autoclaving). The plates were wrapped with parafilm and cultured in the dark at 25° ± l°C.
Putative transformants appeared as small clusters of callus on a background of dead, non- transformed cells. These calli were transferred to NTCB5 medium and allowed to grow for several weeks. Portions of each putative transformant were selected for ELISA analysis. After at least 2 series of analysis by ELISA, lines with the highest antigen levels were selected. The amount of callus material for each of the elite lines was then multiplied in plate cultures and occasionally in liquid cultures. The resulting transformed NT-1 cell lines expressed and accumulated the HN protein from Newcastle Disease Virus (Lasota strain), or transformed cell line CHA expressed the HA protein from Avian Influenza Virus. These lines contain an undetermined number of copies of the T-DNA region of the plasmids stably integrated into the nuclear chromosomal DNA. The transgenic CHN NT-1 cells accumulate HN at levels up to 1% of total soluble protein as determined by HN-specific ELISA.
[0002] Transgenic NTl cell and potato lines selected for Bialaphos® resistance were propagated and evaluated for HN expression by ELISA. High-expressing NTl cell lines were established in liquid suspension culture. Potato lines containing a constitutive promoter construct (pCHN, pMHN) were screened for expression in leaf tissue, and selected lines were transferred to soil and cultured in a greenhouse to obtain tubers for evaluation. Potato lines containing a tuber- specific GBSS promoter construct (pGHN, pGHN151, pGHN153) were screened for expression using microtubers developed in vitro.
HN expression in pCHN-transformed NTl lines using the CsVMV promoter.
Expression of HN in NTl cell lines assayed from callus growing on solid media is shown in Figure 19. The highest expressing lines were CHN-5 (8.5 ng/μg TSP) and CHN-18 (6.2 ng/μg TSP). Lines CHN-1 and CHN-5 were established in liquid suspension culture. The expression of HN per unit cell mass in these cultures is shown in Figure 20. Line CHN-5 showed expression of HN at 6.7 μg per g cell mass. The same cell lines shown in Figure 20 were evaluated multiple times, and some new lines assayed at the last time point, stability of expression of HN in the NTl lines (Figure 21). Western blotting of extracts from lines CHN-5 and CHN-7 showed a single reactive band co-migrating with the reference standard when probed with monoclonal antibody, and showed an additional smaller band when probed with a polyclonal antiserum (Figure 22).
Effects of freeze-drying of fresh cells and of storage of extracts at 4°C. In order to examine the effect of drying on antigen stability, freeze-dried NTl cells were extracted and assayed by ELISA. Extracts of freeze-dried cells showed no loss or apparent increase in HN content per fresh cell mass (Figure 23). Furthermore, extracts of fresh cells stored at 4°C for one week showed an increase in HN content assayed by ELISA (Figure 23). We have observed a similar effect with another membrane-bound viral protein, the hepatitis B surface antigen. It may result from oxidation of cysteine residues to form correct disulfide bonds, which results in display of the appropriate antigenic epitopes.
Particle behavior of plant-expressed HN antigen. In order to evaluate assembly of NTl cell-expressed antigen to form particulate structures, sucrose gradient sedimentation was performed on crude cell extracts. The profiles shown in Figure 24 indicate that the NTl cell- derived HN showed 2 peaks of ELISA reactive material. One peak co-sedimented with inactivated virus particles, while the other peak sedimented more slowly but still showed particulate character. These data provide evidence that the HN protein is correctly inserted into the ER membrane.
HN expression in pMHN-transformed NTl lines using the (4ocs)ΔMAS promoter. HN expression in several NTl cell lines transformed with pMHN, compared to pCHN- transformed NTl cell lines, is shown in Figure 25. Expression in pMHN-transformed lines was at least as high as in pCHN-transformed lines, with the highest accumulation of HN observed at approximately 30 μg per gram cell mass. Maximal HN expression in pCHN- transformed NTl cells was less than 20 μg per gram cell mass. Bialaphos® resistant NTl cell lines were also generated and assayed for HA expression by ELISA as described previously. In the first set of assays, only one pCHA-transformed line accumulated HA to a similar extent as the pGPTV- HAO line #12 that was previously generated (Figure 13). In this experiment, the expression range was up to 2.5 ng/μg TSP. In repeated experiments with these and new pCHA-transformed lines, accumulation of HA ranged up to 18 ng/μg TSP in line CHA-13 (Figure 14). Selected lines from this group were analyzed by Western blot. In all pCHA- lines tested, a reactive band at the expected size of ~68 kDa was observed (Figure 15). These data show that the HA protein was correctly processed to remove the signal peptide, and accumulated in a stable form. Previous studies on pGPTV-HAO-transformed NTl cells by non-denaturing Western blot (unpublished studies), showed that the HA assembled oligomeric structures, probably the native trimer that occurs on the surface of the AIV virion.
Example 3: Crvopreservation
Cell Culture: NT-1 tobacco suspension cultures (non-trans genie and transgenic lines) were maintained in 250 ml Erlenmeyer flasks. Initially, the cells were cultured in a modified liquid Linsmaier and Skoog medium (LS) (1965). The medium, designated LSg, contained LS salts and vitamins, 30 g l"1 glucose, and 0.05 mg l"1 2,4-dichlorophenoxyacetic acid (2,4-D). The pH of the medium was adjusted to 5.8. The cultures were transferred to fresh medium weekly by transferring 6 ml of 7-day-old cultures into 50 ml of LSg medium.
Based on poor growth of the cells in LSg medium, two additional media were investigated which were designated KCMS and NT-1. KCMS contained Murashige and Skoog (MS) (1962) salts, 1.3 mg l"1 thiamine, 200 mg l"1 KH2PO4, 30 g l"1 sucrose, 0.2 mg f1 and 0.1 mg l*1 kinetin. NT-1 medium contained MS salts, 180 mg l"1 KH2PO4 , 0.5 mg l"1 2-N- morpholinoethanesulfonic acid, 1 mg l'1 thiamine, 100 mg l"1 myoinositol, 30 g l"1 sucrose, and 2.21 mg l"1 2,4-D. The pH of both media was adjusted to 5.7. For transfers to fresh medium, 2 ml of a 7-day-old culture were transferred into 48 ml of either KCMS or NT-1. All suspension cultures were maintained in the dark at 25°C on an orbital shaker at 100 rpm
Preculture: Three days after subculture (late exponential growth period), the cells were precultured in their respective medium (LSg, KCMS, or NT-1) by replacing one third of the medium with IM mannitol (for final concentration of 0.3 M), for 24 to 72 h.
Heat Shock Treatment: After preculture, cultures were placed on an orbital shaker at 100 rpm at 37°C for 2 h. They were transferred back to the shaker at 25°C for 4 h before vitrification.
Vitrification: The vitrification solution designated PVS2/100% contained 30% glycerol, 15% ethylene glycol, and 15% DMSO in a 0.4 M sucrose solution. A PVS2/20% solution was made by diluting PVS2/100%. Both solutions were adjusted to a pH of 5.8, autoclaved, then stored at 4°C.
To start the vitrification process, 4 ml of ice cold PVS2/20% was added to a 1 ml settled cell volume of cells. The preparation was incubated on ice for 5 min, then 1 ml of cold PVS2/100% was added at 1 -minute intervals until a total volume of 9 ml was achieved. The preparations were centrifuged for 1 min at 7500 - 8000 rpm. The supernatant was discarded, then 0.5ml of PVS2/100% was added at 2, 1-min intervals while the cells remained on ice. Then 1 ml of PVS2/100% was added 3 times at 1-min intervals. Haif a milliliter of this mixture was then transferred into each of 6 cryogenic straws (Continental Plastic Corporation, Delavan, WI). The straws were heat sealed at each end with hot forceps, and immersed immediately into liquid nitrogen. The remaining 2 ml were not frozen and served as controls.
Recovery: After 1 h in liquid nitrogen, the vitrified cells were thawed in a 40°C water bath for 3 - 5 sec, then immediately diluted with 7 ml of cold 1.2 M sucrose. The cells were kept on wet ice for 20 min, then centrifuged for 3 min at 7500 - 8000 rpm. Cells were transferred to 2 layers of filter paper (42.5 mm Whatman) on LSg or NT-1 solidified medium containing
0.75% agarose (Invitrogen Life Technologies, Carlsbad, CA) in 60 x 15 mm tissue culture plates. The cultures were maintained at 25°C in the dark. Two days after plating, the cells were transferred to fresh NT-1 solidified medium. Transgenic lines were initially plated on medium without a selection agent until cell growth was well established and covered a small plate. They were then transferred to medium containing the appropriate selection.
Thereafter, the cells were transferred to fresh medium approximately every 2 wk. When cell growth nearly covered the surface of the medium in the plate, the cells were removed from the filter paper and transferred to larger plates (100 x 15 mm). When the callus again covered the plate, the cells were transferred to NT-1 medium solidified with 8 g l"1 Agar (Sigma, St. Louis, MO) for maintenance.
Example 4: Antigen preparation
Whole wet NT-1 cells expressing either HN, HA or null control were harvested directly from cell culture and filtered to remove excess media by placing a Spectramesh 30 filter in a Buchner funnel and pouring cells and media through the filter using a slight vacuum. 0.5 grams of cells were placed in 2 mis of buffer (Dulbeccos Phosphate Buffered Saline and ImM EDTA), and then sonicated for 15 to 20 seconds on ice. Sonication was performed using a Branson 450 sonifier with a replaceable microtip at output control of 8, duty cycle 60 for varying amounts of time. Sonicates were then placed on ice until use.
Example 5: Antigen Extraction
To examine whether non-detergent treatments could release ELISA signal from transformed NT-1 cells and allow retention of biological activity, a series of treatments were set up that involved comparison of treatments without detergent and various levels of sonication. The results were striking in that periods of sonication greater than 20 seconds in extraction buffer completely destroyed hemagglutination activity of HN from a pCHN bearing NT-1 cell line, but not ELISA signal. In contrast, sonication for only 20 seconds in DPBS not only released antigen detectable by ELISA signal, but the soluble protein extracts demonstrated excellent hemagglutination activity (see Table 1).
Table 1
Comparison of extraction methods on hemagglutination activity of plant-derived HN
Figure imgf000051_0001
'Native NDV was sonicated for 2 minutes. Ext. buffer - 50 mM sodium ascorbate, ImM EDTA, ImM PMSF, and 0.1% Triton X-100 pH 7.2; DPBS - Dulbeccos phosphate buffered saline; sonic. - sonication; F/T - freeze-thaw; nd-not done for this experiment.
Plant-derived HN extracted without detergent was used as the antigen in hemagglutination inhibition assays to determine if polyclonal antibody produced to native virus could recognize and inhibit agglutination of RBC's by the plant-derived HN. The results indicate that native antibody will recognize the hemagglutination epitope of the plant-derived HN in a similar manner as native virus (Table 2). The data from Table 2 also demonstrates that control NT-1 cells or NT-1 cells expressing a non-hemagglutinating protein do not agglutinate red blood cells nor are affected by NDV specific serum. In this experiment, extracts of plant- derived protein were diluted to 4 HA units, and then treated with NDV specific polyclonal antisera. Four HA units is the standard amount of virus used for titration of serum. Table 2
Comparison of hemagglutination inhibition (HAI) activity of plant-derived HN and native virus
Figure imgf000052_0001
* Stock virus is diluted such that 4HA units, a 1 :4 dilution of the stock will generate a positive HA but a dilution of 1 :8 will not hemagglutinate. This is the concentration of virus used to titer antibody, the endpoint dilution of antibody that will interfere with 4 HA units of virus is considered to be the HAI titer of the antibody preparation.
The above data demonstrates that using an extraction method that does not utilize detergent and reduces the amount of cell disruption produces an extracellular fraction that retains hemagglutination activity for transformed NT-1 cell lines expressing HN or HA. To determine if HN protein from non-detergent extracted NT-1 cells had additional biological activity that may be relevant to vaccine efficacy, the HN extracts were examined for ability to bind to chicken cell receptors. Immuno-fluorescence staining indicated that CEF cells treated with native virus or pCHN-18 extracts were indistinguishable. Thus, plant-derived HN retains virus-like ability to bind to receptors on target cell surfaces.
The combined data from Tables 1 and 2, together with the hemagglutination and immunofluorescence assays discussed above, suggest that the HN protein derived transgenic NT- 1 cells will retain both immunological and biological features if processed and formulated correctly. Most significant of the data provided above is that antisera to native virus will recognize plant-derived HN in HAI tests. Chickens that contain at least 4 fold higher titer of HAI activity above background are almost always certain of protection against challenge from virulent virus. To test whether the plant derived protein extracted in non-detergent as described above would generate antibody in target animals species both HA and HN protein were prepared and inoculated into chickens and rabbits. Example 6: Quantitative ELISA
HN
Quantitative ELISA for HN is performed by coating plates on the day prior to running the assay. 50 μl per well of Capture Antibody (Rabbit anti-HN in 50% glycerol, diluted (1 :500) in 0.0 IM Borate Buffer) is added to each well of each flat bottom 96-well microtiter plate. The plate is covered and incubated at 2°C - 7°C overnight, (12-18 hours). The coated ELISA plate(s) are allowed to equilibrate to room temperature (approximately 20-30 minutes) and then washed three times with 200-300 μl per well per wash with PBS-T. The entire plate is blocked to prevent non-specific reactions by adding 200 μl per well of 3% Skim Milk Blocking Solution. The plate(s) is(are) then incubated for 2 hours (+ 10 minutes) at 37°C±2°C (covered with a plate cover or equivalent). HN Reference antigen (Ag) in 1% Skim Milk Blocker is added to a concentration of 250 ng HN/ml; experimental antigens are diluted in 1% Blocker. The HN ELISA plate(s) are washed one time with PBS-T and 100 μl per well of diluted HN Reference Antigen and HN Test Samples are added to Row B. 50 μl per well of 1% Blocker is added to all remaining wells. The samples are serially diluted down the plate by transferring 50 μl per well from row B to row G, mixing 4-5 times with the pipette before each transfer. The plate(s) are covered and incubated 1 hour (+10 minutes) at 37°C±2°C; and the ELISA plate(s) are washed three times with PBS-T. Fifty μl of NDV HN 4A Ascites Fluid in 50% glycerol (1 :2000) in 3% Blocker is added to each well and the plates are covered and incubated 1 hour (+10 minutes) at 37°C±2°C. The ELISA plate(s) are washed three times with PBS-T and 50 μl of rabbit anti- Mouse IgG in 50% glycerol (1 :3000) in 3% Blocker is added to each well. The plates are covered and incubated 1 hour (+ 10 minutes) at 37°C±2°C. ELISA plate(s) are washed three times with PBS-T and 50 μl of ABTS Peroxidase Substrate Solution (equilibrated at RT (room temperature) for at least 30 minutes) is added to each well. The plates are covered and incubated at RT in the dark for 15-20 minutes. The Optical Density (OD) of the wells are read at a wavelength of 405 nm (with a 492nm Reference Filter). The initial dilution of the HN Reference Antigen should be within 0.7 - 1.0 OD, this serves as the positive control for the ELISA.
HA
For quantitative ELISA of HA, the plates are coated on the day prior to running the assay. Fifty μl per well of Capture Antibody (goat anti-Hav5 in 50% glycerol, diluted (1 :1000) in 0.0 IM Borate Buffer) is added to each well of flat bottom 96-well microtiter plate(s)). The plate(s) are covered and incubate at 2°C - 7°C overnight, (12-18 hours). The coated ELISA plate(s) is(are) allowed to equilibrate to room temperature (approximately 20-30 minutes) and is(are) then washed three times with 200-300 μl per well per wash with PBS-T. The entire plate is blocked to prevent non-specific reactions by adding 200 μl per well of 3% Skim Milk Blocking Solution. The plate(s) is(are) then incubated for 2 hours (+ 10 minutes) at 37°C±2°C (covered with a plate cover or equivalent). AIV-HA (allanotoic fluid) reference Antigen is added in 1% Skim Milk Blocker to a concentration of 1000 ng HA/ml and experimental antigens are diluted in 1% Blocker. The HA ELISA plate(s) are washed one time with PBS-T and 100 μl per well of diluted HA reference antigen and HA Test Samples are added to Row B. 50 μl per well of 1% Blocker is added to all remaining wells. The samples are serially diluted down the plate by transferring 50 μl per well from row B to row G, mixing 4-5 times with the pipette before each transfer. The plate(s) are covered and incubated 1 hour (+10 minutes) at 37°C±2°C. The ELISA plate(s) are washed three times with PBS-T. Fifty μl of chicken anti-AIV polyclonal antisera in 50% glycerol (1 :2000) in 3% Blocker is added to each well and the plates are covered and incubated 1 hour (+10 minutes) at 37°C±2°C. The ELISA plate(s) are washed three times with PBS-T and then 50 μl of goat anti-chicken IgG in 50% glycerol (1 :3000) in 3% Blocker is added to each well. The plates are covered and incubated 1 hour (+ 10 minutes) at 37°C±2°C. The ELISA plate(s) are washed three times with PBS-T and 50 μl of ABTS Peroxidase Substrate Solution (equilibrated at RT for at least 30 minutes) is added to each well. The plate(s) are covered and incubated at RT in the dark for 15-20 minutes. The Optical Density (OD) of the wells read at a wavelength of 405 nm (with a 492nm Reference Filter). The initial dilution of the HA Reference Antigen should be within 0.7 - 1.0 OD, this serves as the positive control for the ELISA.
Example 7: Serum ELISA
NDV-HN
Plates are coated with rabbit α-NDV pooled antiserum (Mixed 1 :2 with 50% glycerol in water) diluted (1 :2000) in 0.01 M borate buffer (100 μl/well). Plates are incubated overnight at 2- 7°C, covered and then equilibrated for approximately 20-30 minutes at room temperature. Plates are washed 3X with PBS-T (IX PBS + 0.05% Tween-20) at 300 μl/well with the Titertek M96 plate washer or equivalent. Plates are blocked with 5% skim milk in PBS-T (Blocking Buffer) (200μl/well) and incubated for 2 hours at 37°C. Plates are washed IX with PBS-T at 300μl/well with the Titertek M96 plate washer or equivalent. NDV allantoic fluid is diluted 1 :200 in Blocking Buffer. lOOμl/well of the diluted antigen is added to the plate, and plates are incubated for 1 hour at 37 °C. Plates are washed 3X with PBS-T at 300μl/well with the Titertek M96 plate washer or equivalent. Test chicken serum samples are diluted (1:50). Negative control serum is diluted (1:50) (Neg. Control 27NOV00). Positive control serum is diluted (1 :10,000 or 1 :20,000) (SPAFAS Chicken α-NDV serum). All serum samples are diluted in Blocking Buffer. lOOμl/well of Negative Control Serum is added to Column 1 Rows B-G; 200μl/well of Positive Control Serum is added to Columns 2-3 Row A; 200μl/well of Test Serum Samples is added to Rows A appropriate columns. This allows 4 samples per plate with 8 dilutions per sample. 1 OOμl/well of Blocking Buffer is added to all remaining wells The Positive Control Serum and the Test Serum Samples are serially two-fold diluted down the plate. The samples are diluted down the plate from Row A to Row H, discarding the remaining 1 OOμl/well. Plates are incubated for 1 hour at 37 °C and then washed 3X with PBS-T at 300μl/well with the Titertek M96 plate washer or equivalent. The Goat α-Chicken IgG (H&L)-HRP is diluted (1:3000) in Blocking Buffer. 100 μl/well of the diluted conjugate is added to each plate. Once the conjugate is added to the plates, the ABTS substrate is equilibrated at RT in the dark. Plates are incubated for 1 hour at 37 °C and then washed 3X with PBS-T at 300μl/well using the Titertek M96 plate washer or equivalent. 1 OOμl/well of pre- warmed ABTS substrate is added to each plate, waiting 2-3 minutes between plates. Plates are read at dual wavelength 405/490 nm on the Tecan Sunrise plate reader or equivalent when the first dilution of the positive control reaches an absorbance of between 0.7 and 1.0.
AIV-HA
Plates are coated with Rabbit α-HA pooled antiserum diluted (1:1000) in 0.01 M borate buffer and incubated overnight at 2-7°C, covered. Plates are equilibrated for approximately 20- 30 minutes at room temperature and then washed 3X with PBS-T (PBS Stock + 0.05% Tween- 20) at 300 μl/well using the Titertek M96 plate washer or equivalent. The plates are blocked with 5% skim milk in PBS-T (Blocking Buffer) (200μl/well) and incubated for 1 hour at 37 °C. The plates are washed IX with PBS-T at 300μl/well using the Titertek M96 plate washer or equivalent. Inactivated T/W/68 AIV Allantoic Fluid is diluted (1 : 100) in Blocking Buffer and 1 OOμl/well of the diluted antigen is added to the plate. Plates are incubated for 1 hour at 37°C. The plates are washed 3X with PBS-T at 3 OOμl/well using the Titertek M96 plate washer or equivalent. Test chicken serum samples are diluted (1:50). Negative control serum is diluted (1 :50). Positive control serum is diluted (1 :25600) (USDA/SEPRL Chicken α-AIV (T/W/68 antiserum) All serum is diluted in Blocking Buffer. 1 OOμl/well of Negative Control Serum is added to Column 1 Rows B-G; 200μl/well of Positive Control Serum is added to Columns 2-3 Row A; 200μl/well of Test Serum Samples is added to Row A in appropriate columns; 1 OOμl/well of Blocking Buffer is added to all remaining wells. The Positive Control Serum and the Test Serum Samples are serially diluted two-fold down the plate, discarding the remaining 1 OOμl/well. The plates are incubated for 1 hour at 37°C. The plates are washed 3X with PBS-T (300μl/well) using the Titertek M96 plate washer or equivalent. Goat α-Chicken IgG (H&L)- HRP is diluted (1 :3000) in Blocking Buffer and 100 μl/well of the diluted conjugate is added to each plate. Once the conjugate is added to the plates, the ABTS substrate is equilibrated at RT in the dark. The plates are incubated for 1 hour at 37°C and then washed 3X with PBS-T at
300μl/well using the Titertek M96 plate washer or equivalent. 1 OOμl/well of equilibrated ABTS substrate is added to each plate, leaving 2-3 minutes between plates. Plates are read at dual wavelength 405/490 nm on the Tecan Sunrise plate reader or equivalent when the first dilution of the positive control reaches an absorbance of between 0.7 and 1.0.
Example 8: Antigenicity in Rabbits
To test whether the plant derived protein extracted in non-detergent as described above would generate antibody in target animals species both HA and HN protein were prepared and inoculated into rabbits. New Zealand White rabbits 3 months of age were inoculated with HA- AIV or HN-NDV according to the dose schedule provided in Table 3. For the primary inoculation the antigen was mixed with Complete Freund's Adjuvant (CFA) and Incomplete Freund's Adjuvant was used for all booster inoculations. The antibody titers induced by both proteins are provided in Table 4. The results indicate that after two inoculations HAI antibody titers were induced by both proteins. However, the titers of the AIV-HA inoculated rabbits were higher than those induced by the NDV-HN protein. This may be significant since the AIV/HA protein had lower overall biological activity (hemagglutination) per unit of AIV-HA protein than NDV-HN (Table 3 column 4). This may indicate that the AIV-HA protein derived from plants is more potent per unit of protein than the NDV-HN protein considering that the quantitation methods from both proteins are accurate. It also suggests that the AIV-HA protein formulated in this manner would be immunogenic in chickens. Table 3 Dose levels for inoculation into rabbits
Figure imgf000057_0001
Chemical BCA protein assay kit; TSP - total soluble protein.
Table 4
Serology Results from NT-1 derived AIV-HA and NDV-HN inoculated rabbits
Figure imgf000057_0002
To examine the efficacy of the plant derived antigens in chickens the HN protein was inoculated into chickens that were 2 days of age and 10 days of age. The dose concentrations used for these studies are provided in Table 5. All vaccine inoculum were formulated with the soluble fraction of NT-1 cells grown 15-20 days in shaker flasks at 25°C. Adjuvant used in both trials was MPL-TDM from Corixa, Inc. Intranasal groups were given MPL alone as the adjuvant. Example 9: Challenge in Poultry
Two-day old SPF chicks were inoculated by various routes using biologically active (hemagglutination positive) NDV-HN protein derived from NT-1 with the amount of HN protein per inoculation shown in Table 5. The serological and challenge results of this trial are provided in Table 6. All control groups responded as expected in that birds not receiving NDV-HN antigen in the inoculum had 100% mortality, whereas, control birds receiving 20 ug of native NDV by SQ had 100% survival. In the experimental treatment groups there was 75% protection in group #3 (SQ inoculation without adjuvant) and 80% protection in group #4 (SQ inoculation with adjuvant). The remaining treatment groups, which were inoculated by IN and oral routes, had 100% mortality. However, in group 6 two birds had a delay in mortality, indicating that these birds may have been sensitized to vaccination (see Table 9)
Figure imgf000058_0001
*Dose based on wet weight expression per mass cells mixed with feed; IN-intranasal; SQ-subcutaneous; OG-oral gavage; OF-on feed mixtures.
Table 6 Serology and challenge results from poultry trial
Figure imgf000058_0002
Figure imgf000059_0001
had a delayed onset to mortality see Table 9.
In a subsequent trial, eighteen 10-day old SPF birds were inoculated according to the schedule and dose amounts described in Table 7. Results of this trial are shown in Table 8. One control group (#3), a non-vaccinated non-challenged treatment was used to show that the housing and facility had no adverse affects on general health of the chickens. Control groups in this trial also responded as expected. Since birds from both trials were challenged at the same facility, treatment group # 2 served as a positive control for both poultry trials. In the remaining groups, all of which were inoculated SQ with HN derived from NT-1 cells, there was 100% survival in group #7, 80% survival in each of groups 5 and 6, and 60% survival in group 4 (see Table 8).
Table 7 Dose levels of antigen used per inoculation
Figure imgf000059_0002
Figure imgf000060_0001
Conclusions: Using a procedure that provides recovery of hemagglutination of HA and HN protein, preparations for these plant-derived proteins were inoculated into two separate animal species by subcutaneous (SQ) route to determine if antibody could be induced that will inhibit hemagglutination (HAI antibody). In one trial, HN protein was formulated to have high hemagglutination activity to total soluble protein ratios. These materials were then inoculated by SQ, intranasal (IN) and by oral routes. The results indicate that both HA-AIV and HN-NDV protein derived from NT-1 cells will induce hemagglutination inhibition (HAI) antibody in rabbits when formulated in this manner. In addition, HN-NDV derived from NT-1 inoculated by SQ route in chickens will induce (HAI) antibodies and protect against virulent NDV challenge.
The results from these trials indicate that the HN-NDV protein derived from NT-1 cells is immunogenic in birds when inoculated by SQ. In most cases birds protected from challenge had a detectable HAI titer post challenge, however, there were exceptions to this observation. Two birds (bird #1093 and #1047, respectively) did not have a detectable HAI or ELISA titer after challenge but survived challenge (Tables 6 and 8).
Figure imgf000060_0002
Figure imgf000061_0001
All birds received IO EID50 Texas GB strain of NDV, except group 1, which received 10 EID50 Texas GB strain of NDV and group 3, which was the non-challenge control. Birds were challenged 31 days post last vaccination. Bird numbers bolded had a delayed onset to mortality see Table 9. n/c - nonchallenged.
Typically, a high titer response after challenge is indicative of a good sensitizing immunization, yet, it is not unprecedented with native or recombinant derived NDV antigen that birds will be protected without a detectable HAI or ELISA antibody titer (Winterfield, R. W., Dhillon, A. S., and L.J. Alby, 1979. Vaccination of Chickens against Newcastle Disease with Live and Inactivated Newcastle Disease Virus. Poultry. Sci. 59: 240-246). It is proposed that either a cellular immune response or a local immune response is involved with providing immune protection in a vaccinated bird where no humoral antibody response can be detected
(Agrawal, P.K. and D. L. Reynolds. 1991. Evaluation of the cell mediated immune response of chickens vaccinated with Newcastle disease virus as determined by the under-agarose leukocyte- migration inhibition technique. Avian Dis. 35: 360-364).
In some cases, although there was a detectable titer at the end of the vaccination schedule at day 28, there was no protection to challenge. However, in all cases when this situation occurred there was no detectable antibody titer before (on the day of challenge) or after challenge indicating that these birds were not sensitized effectively (compare Tables 4 and 6). Differences observed between the two poultry trials may be attributed to the fact that antigen used in the first trial had a much higher biological activity per microgram of HN. Antigen used in this trial had at least a 2 fold higher level of hemagglutination activity per microgram of protein than antigen in the latter trial (compare Tables 5 and 7). This may be one reason why birds treated with non-adjuvanted antigen (group #3, Table 6) developed detectable ELISA and HAI titers by day 28, whereas, birds treated with non-adjuvanted antigen (group #4, Table 8) did not show ELISA titers by day 28. Another difference which may have contributed to the results is the age of the birds. Birds in the first trial were vaccinated at day 2 of age, whereas, birds in the second trial were vaccinated at day 10 of age.
Table 9 Death on days after challenge
Figure imgf000062_0001
Adjuvant also seems to be an important feature in formulating the antigen in these trials. Although the adjuvant effect was not evident when using higher doses of NT-1 derived NDV- HN (compare groups 3 and 4, Table 6 with groups 6 and 7, Table 8), there was a clear adjuvant effect when using a low dose of NDV-HN (compare groups 4 and 5, Table 8). In addition, although there was 100% mortality in groups inoculated by intranasal route, the group that received adjuvant had 2 birds (#923 and #1088) that did not die until day 8, which was 3 days after all negative control birds had succumbed to challenge (Table 9). The significance of the delay to mortality in the intranasal group receiving adjuvanted antigen is not significant, however, it is interesting that birds #923 and #1088 were two birds with detectable HAI antibody titers at day 21 of the trial and were treated with less antigen per dose than the other treatment groups (see Table 5).
It is clear from the data provided here that HN-NDV derived from transformed NT-1 cells is efficacious against virulent challenge to NDV. The immune response to the plant derived antigen has several similarities to immune response to native antigen. 1) Although the antibody titers are higher for native antigen pre-challenge, a 20 ug dose inoculated SQ will provide protection against challenge for both native and plant derived antigen. 2) Antibody titers must have similar duration of response in that in both studies challenge was performed 24 days and 31 days post vaccination. 3) All birds producing a positive HAI antibody response (above background) at the end of the vaccination schedule and post challenge were protected from NDV associated pathology.
No birds were protected from challenge when inoculated by oral or intranasal route. In the case of the oral administered birds, inoculums of 100 to 300 ug of HN-NDV soluble protein from NT-1 cells along with 700 to 2400 ug of HN-NDV feed as whole wet cells per inoculation did not elicit a detectable antibody titer after three doses nor were birds protected from challenge. Because the HN-NDV from NT-1 has definite binding capability to red blood cells and to (CEF) chick embryo fibroblasts, the ability to bind to native receptors did not supplement binding or delivery to antigen sampling sites on the bird mucosal surface in this study.
The data provided here show that HN-NDV antigen derived from transgenic NT-1 cell culture will protect against virulent challenge when administered SQ. Furthermore, despite feeding several milligrams of antigen in the oral treatment groups, no HAI antibody was induced in the systemic compartment and no protection against challenge was observed. Thus, as previous data have shown, antigens that do not have a natural affinity or invasiveness for the antigen presenting sites on the mucosal surface need to be targeted to those sites with the aid of a protein that does sensitize the mucosal surface.
Example 10: Preparation and Analysis of Transgenic Potato
Binary vectors pCHN, pgHN, pMHN and pCHA were used to transform potato (cv. Desiree) and transgenic tubers analysed for expression of the recombinant HN antigen from NDV, or the recombinant HA antigen from Avian Influenza Virus. Plant material. In vitro plants of Solanum tuberosum cv Desiree were provided by Dr. Steven Slack, Department of Plant Pathology, Cornell University. For propagation, nodal segments were transferred to a shoot propagation medium designated CM which contained MS salts (Murashige and Skoog, 1962), 100 mg/l myoinositol, 0.4 mg/l thiamine, 20 g/l sucrose, and 8g/l Agar/Agar (Sigma Chemical Co., St. Louis, MO; catalog # A-1296). The pH of the medium was adjusted to pH 5.7 before the addition of the Agar/Agar. One nodal explant was placed in each test tube and maintained at 24° + 1°C under a photoperiod of 16h (light)/8 h (dark) at 74 μE m'V. The source of light for these cultures and those described throughout this report was from a mixture of cool and warm fluorescent bulbs (F40CW and F40WW) (Philips Lighting Co., www.lighting.philips.com/index.htm). Nodal explants were harvested and transferred to fresh medium every 6 weeks.
Agrobacterium preparation. Agrobacterium tumefaciens containing the gene construct of interest was streaked from a glycerol stock maintained at -80°C onto Petri plates of LB medium which contained 10 g/l bacto tryptone, 5 g/l yeast extract, lOg/l NaCl, 50 mg/l spectinomycin, and 15g/l Difco Bacto Agar (Difco Laboratories, Detroit, MI; catalog #DF 0140-01). Four well- formed colonies were picked with a sterile pipet tip, then added to 50 ml of YM medium (Gibco BRL cat.# 10090-011) containing 50 mg/l spectinomycin. Cultures were grown in a shaking incubator at 28°C and 100 m for 24 hrs, or until the culture reached an OD600 of 0.5 - 0.7. It takes approximately 24 hrs to reach this OD. When the desired OD was reached, the cells were centrifuged at 8000 φm for 10 min at 20°C. The pellet was resuspended in MS liquid medium (MS salts, 2 mg/l glycine, 0.5 mg/l nicotinic acid, 0.5 mg/l pyridoxine, 0.4 mg/l thiamine, 0.25 mg/l folic acid, 0.05 mg/l d-biotin, 100 mg/l myoinositol, 30 g/l sucrose, pH 5.6) at the same original volume as the YM selective medium.
Infection. Stem internode segments 0.5 - 1 cm in length were excised from six-week-old in vitro plants and inoculated the same day. Approximately 100 internode explants were incubated per 50 ml of inoculum for 10 min, agitating occasionally. After the incubation, they were blotted onto sterile filter paper, then transferred to medium designated CIM which contained MS salts, 2 mg/l glycine, 0.5 mg/l nicotinic acid, 0.5 mg/l pyridoxine, 0.4 mg/l thiamine, 0.25 mg/l folic acid, 0.05 mg/l D-biotin, 100 mg/l myoinositol, 30 g/l sucrose (grade II; PhytoTechnology Laboratories, Shawnee Mission, KS), 1 mg/l benzyladenine (BA), 2 mg/l naphthaleneacetic acid (NAA) (added after autoclaving), and 6 g/l Agar/Agar (PhytoTechnology Laboratories, Shawnee Mission, KS). The pH of the medium was adjusted to 5.6 before the addition of the Agar/Agar. One hundred explants were cultured per 100 x 20 mm Petri plates. All cultures were maintained at 24° + 1°C under a photoperiod of 16h (light)/8 h (dark) at 74 μE m-V1.
Plant regeneration. After 48 hrs of cocultivation, the explants were transferred to 3C5ZR bialaphos selective medium which contained MS salts, 0.1 mg/l thiamine, 0.5 mg/l nicotinic acid, 0.5 mg/l pyridoxine, 100 mg/l myoinositol, 30 g/l sucrose, 0.5 mg/l indole-3- acetic acid (IAA) (added after autoclaving), 3 mg/l zeatin riboside (added after autoclaving), 500 mg/l carbenicillin (added after autoclaving) (Agri-Bio, Miami, FL), 5 mg/l bialaphos (added after autoclaving) (Duchefa, http://www.duchefa.com/), and 8g/l Agar/Agar. The pH of the medium was adjusted to 5.9 before the addition of the Agar/Agar. Twenty-five internode segments were cultured per 100 x 20 mm Petri plate and the plates were sealed with Nesco film (Karlan Research Products, Santa Rosa, CA). Explants were transferred weekly for 1 month, then every 10 - 14 days. All cultures were maintained at 24° + 1°C under a photoperiod of 16h (light)/8 h (dark) at 74 μE m'V.
When regenerants were approximately 0.5 - 1 cm in length, they were excised and transferred to bialaphos selective rooting medium which contained the same components as CM with the addition of 500 mg/l carbenicillin (added after autoclaving) and 5 mg/l bialaphos (added after autoclaving). Five regenerants were cultured per GA7 Magenta box. Once the shoots rooted, the shoot tip from each plant was transferred to CM in test tubes for maintenance.
Microtubers. Microtubers were induced on plant material for an early indication of expression in tubers. This was especially applicable for transgenic lines containing genes driven by the tuber-specific promoter, GBSS. Nodal segments were placed on microtuber medium which contained 1/2 strength MS salts, 5 mg/l kinetin, 80 g/l sucrose, 0.25 mM ancymidol (added after autoclaving), 9g/l Agar/Agar. The pH of the medium was adjusted to 5.85 prior to the addition of the Agar/Agar. The cultures were maintained in the dark at 18°C. The microtubers were analyzed by ELISA for antigen expression levels.
PCR analysis. Genomic DNA was isolated from leaves from 3 - 4-week-old putative transformants. Leaf samples were homogenized at room temperature in 500 μl of an extraction buffer containing 200 mM Tris HCI (pH 7.5), 250 mM NaCl, 25 mM EDTA, and 0.5% SDS. They were allowed to remain at room temperature for 1 hr, then centrifuged at 12,000 φm for 5 min. The supernatant was removed to a new tube, 500 μl of isopropanol was added, then the samples either remained at room temperature for 5 - 10 min, or were placed at -20°C overnight. They were then centrifuged at 13,000 φm for 5 min, and the supernatant was discarded. The resultant pellet was washed with 70% ethanol, dried, then resuspended in 100 μl of TE buffer.
The primer set was designed such that the forward primer was in the CVMV promoter and the reverse primer (PAT R2) was in the PAT gene which resulted in a product size of approximately 500 bp. Amplified DNA fragments were run on a 1% agarose gel, stained with ethidium bromide, and visualized under a UV light.
ELISA analysis of leaves. Leaf material was harvested into tubes then placed on ice. Lines with the highest antigen levels were selected for propagation, then transferred to the greenhouse.
Greenhouse acclimation. Plants with well-formed root systems were transferred to Jiffy 7 pots. The pots were placed in trays and covered with plastic domes. After approximately 2 weeks, the domes were removed. The plants were transferred to 3 gallon pots containing Cornell soil mix when the roots systems had grown through the mesh on the Jiffy 7 pots.
HN expression in pCHN-transformed potato plants. Potato (Solanum tuberosum L. cv. Desiree) plants were transformed with pCHN, and regenerated Bialaphos® resistant plants were screened for expression of HN in leaves by ELISA. Several lines were selected based on leaf expression (Figure 26), propagated, and transplanted to soil for greenhouse culture. At maturity, tubers were harvested, extracted, and assayed for HN content by ELISA (Figure 26). HN accumulation varied among individual tubers from the same line, but in general expression was correlated with the HN content of leaves within each line (Figure 26). The best expression was observed in tubers of lines 6, 21, 27, and 34, with the highest accumulation observed at ~11 μg HN per g fresh tuber mass.
Particle behavior of potato tuber-expressed HN antigen. In order to evaluate assembly of NTl cell-expressed antigen to form particulate structures, sucrose gradient sedimentation was performed on pCHN-transformed potato tuber extracts. The profiles shown in Figure 27 indicate that the tuber-derived HN showed 2 peaks of ELISA reactive material, similar to the NTl cell- derived HN shown in Figure 24.
HN expression in potato plants transformed with pGHN and pGHN151. Potato (Solanum tuberosum L. cv. Desiree) plants were transformed with pGHN or pGHNl 51 , and regenerated Bialaphos® resistant plants were screened for expression of HN in microtubers by ELISA. Several pGHN-transformed lines were selected based on microtuber expression (Figure 28), propagated, and transplanted to soil for greenhouse culture. Transformation with pGHN151 was relatively inefficient, resulting in only one line that showed expression in microtubers (GHN151-6), which was transplanted to soil for greenhouse culture. At maturity, tubers were harvested, extracted, and assayed for HN content by ELISA (Figure 28). HN accumulation varied among individual tubers from the same line, but in general expression was correlated with the HN content of microtubers within each line (Figure 29). The best expression was observed in tubers of lines GHN-1, 30, 47, and 54, with the highest accumulation observed at ~40 μg HN per g fresh tuber mass. Expression in tubers of line GHN151-6 varied between 6 and 12 μg HN per g fresh tuber mass. It is possible that the intron-containing GBSS promoter construct pGHN151 was unstable in transgenic plants or in Agrobacterium, resulting in poor expression with this construct.
ELISA analysis of tubers. Approximately 3 - 4 months after plants were transferred to soil, assorted tissue were harvested for analysis. Figure 16 shows expression of HA in microtubers of pCHA transformed microtubers, which ranged up to 700 ng/g fresh weight. This is similar to the accumulation observed in pGPTV-HAO-transformed tubers (HA gene driven by CaMV 35S promoter), which was maximal at 1 ug/g fresh weight. Selected lines were transplanted to soil and grown in the greenhouse. Leaves of soil-grown plants were sampled and assayed by ELISA (Figure 17). Expression of HA in leaves was very poor (<0.025 ng/μg TSP), which is consistent with the earlier assays with leaves of tissue culture plants. Tubers of mature plants were harvested, extracted, and evaluated for HA expression by ELISA. Accumulation of HA in tubers was maximally 500 ng/g fresh weight (Figure 18). The expression observed in microtubers produced in vitro was well correlated with the expression in soil-grown tubers (Figures 16 and 18), thus the microtuber is a good model for expression of HA with pCHA.
Example 11 : Preparation and Analysis of Transgenic Tomato
Binary vectors pCHN, pMHN, and pUHN were used to transform tomato (variety TA234) and transgenic fruit and leaves analysed for expression of the recombinant HN protein from Newcastle Disease Virus.
Plant material. Seeds from a tomato line designated TA234 were used for transformations. TA234, originally known as Momor, is a verticillium and tobacco mosaic virus resistant line derived from the variety Moneymaker. Seeds were surface sterilized in 20% Clorox, for 20 min, rinsed 3 times with sterile distilled water, then cultured on 1/2 MSO medium (See below) in Magenta boxes. They were maintained at 24° + 1°C, under a photoperiod of 16h (light)/8 h (dark) at 74 μE m'V. The source of light for these cultures and those described throughout this report was a mixture of cool and warm fluorescent bulbs (F40CW and F40WW) (Philips Lighting Co., www.lighting.philips.com/index.htm). The seed cultures were maintained for 6 - 8 days depending upon the stage of cotyledon growth. Cotyledons were excised before the first true leaves emerged. If cotyledon sections were longer than 1 cm, they were cut into two 0.5 cm segments. Cotyledon sections were placed on feeder layer plates which were prepared one day prior to transformation. The feeder layer consisted of NTl suspension cultured cells plated on KCMS medium (See below) which had been subculrured (2 mis of cells :48 ml of liquid KCMS) 7 days prior to plating. The plated suspension culture was covered with a sterile 7 cm Whatman filter paper. Cotyledon sections were placed on top of the filter paper.
Agrobacterium preparation. Agrobacterium tumefaciens containing the gene construct of interest was streaked from glycerol stocks maintained at -80°C onto fresh plates of LB medium (See Appendix) containing the appropriate antibiotic. For DAS constructs, 50 mg/l spectinomycin was added to the LB medium. The cultures were incubated for 24 - 48 hrs at 28°C. The duration of the incubation time was dependent upon colony size. If pin-point colonies developed after 24 hrs, the cultures were incubated for an additional day.
When the colonies were of a well-formed size, liquid cultures were prepared. Four colonies were picked with a sterile pipet tip, then added to 50 ml of YM selective medium containing 50 mg/l spectinomycin for DAS constructs (See below). Cultures were grown in a shaking incubator at 28°C and 100 φm for 24 hrs, or until the culture reached an OD60o of 0.5 - 0.6. It takes approximately 24 hrs to reach this OD. When the desired OD was reached, the cells were centrifuged at 8000 φm for 10 min at 20°C. The pellet was resuspended in MS liquid medium at the same original volume as the YM selective medium.
Infection. Cotyledon explants were cultured on the feeder layer plates 1 day prior to infection with Agrobacterium. For infection, they were incubated in the Agrobacterium suspension for 10 min, then the suspension was removed. The explants were blotted on sterile paper towels, then placed with the adaxial sides down on the original feeder plate cultures. They were maintained at 19°C in the dark for 48 hrs of cocultivation. Plant regeneration: After cocultivation, cotyledon explants were cultured with the adaxial sides up on selective 2Z medium containing 3 mg/l bialaphos. The cultures were maintained at 24 + 2°C under a 16-hr photoperiod of cool white fluorescent lights. Three weeks later, the cultures were transferred to 1Z medium containing 3 mg/l bialaphos (See below), then to fresh medium at 3 week intervals. When shoots began to regenerate, the cultures were transferred to the same 1Z medium with bialaphos in Magenta boxes. When shoots were 2 cm tall, they were transferred to selective rooting medium containing 2 mg/l bialaphos (See below) in Magenta boxes. Plants were maintained at 24 + 1°C under a 16-hr photoperiod of cool white fluorescent lights. After approximately 3 weeks, cuttings from these plants were transferred again to selective rooting medium containing bialaphos, however, timentin was not included to determine if there was Agrobacterium contamination present.
Analysis. Plants that rooted on selective rooting medium were selected for ELISA analysis. Leaf material was harvested, transferred to 2 ml conical screw cap tubes, and placed on ice. ELISA was performed at least twice before selecting the lines containing the highest antigen level. The elite lines were propagated and transferred to the greenhouse.
Greenhouse acclimation. Plants were transferred to the greenhouse when they had a well-developed root system. The agar medium was washed off the roots before transferring the plants to 6-inch pots containing Cornell mix. They were covered with plastic domes. During the next week, the domes were gradually lifted to acclimate the plants. After approximately 5 weeks, the plants are transferred to 3-gallon pots containing Cornell mix.
Media Ingredients
1/2 MSO
Per liter
Figure imgf000069_0001
KCMS
Per liter
[MS salts 4.3 g
Figure imgf000070_0001
LB
Per liter
Figure imgf000070_0002
YM
Per liter
Figure imgf000070_0003
Alternatively, YM in powder form can be purchased (Gibco BRL; catalog #10090-011). To make liquid culture medium, add 11.1 g to 1 liter water.
MS Liquid Medium
Per liter
Figure imgf000070_0004
Selective Rooting Medium
Per liter
Figure imgf000071_0001
Add the following filter-sterilized components per liter after autoclaving: Bialaphos: 2 ml of a 1 mg/ml stock solution Timentin: 3 ml of a 100 mg/ml stock solution
Nitsch Vitamins Stock (lOOOx)
Per 50 ml
Figure imgf000071_0002
Adjust pH to 7.0 to clear solution.
Example 12: Tomato as a Production System of Edible Vaccines
Assembly of a Synthetic HN Gene. A HN expression cassette that includes the promoter of the Casava vein mosaic virus (CsVMV) and terminated by the 3' element of the Soybean
Vegetative Storage Protein (VSP) was assembled and inserted into binary vectors by the Mason Laboratory (The Boyce Thompson Institute for Plant Research (BTI)) for Agrobacterium- mediated plant transformations. The vector carries the gene encoding the plant selection marker phosphinothricin acetyl transferase (PAT, described in US Patent Nos: 5,879,903; 5,637,489; 5,276,268; and 5,273,894) (Figure 30).
Tomato Transformation and Regeneration. Agrobacterium-mediated transformation of tomato cotyledons (variety Tanksley TA234TM2R) was performed according to Frary and Earle [12] by the Van Eck Laboratory (BTI). Regenerating explants were transferred to fresh medium every 3 weeks. Green shoots were transferred to GA-7 boxes (Magenta Coφoration, Chicago, IL) containing rooting media (MS salts 4.3 g, 1 ml/1 Nitsch vitamins 1000X, 30 g/l sucrose, 8 g/l difco bacto agar, pH 6.0, supplemented with 50 mg/l kanamycin, 300 mg/l timentin and 4 mg/l IBA) when they were approximately 1 cm tall. Rooted plantlets were transferred to soil and maintained at 28°C under a 12 hours photoperiod.
Protein Extraction and Elisa Analysis. Crude protein extracts were made by homogenizing 1 mg of fresh leaf, fruit or NTl cell material per 5 μL of PBS or 1 mg of dried leaf, fruit or NTl cell material per 10 μL of PBS in a QBiogene (Carlsbad, CA, USA) Fast Prep machine. Insoluble material was removed by centrifugation at 14,000 φm in an Eppendorf 5415C microcentrifuge at 4°C for 5 minutes. The resulting sample supernatants were kept on ice during analysis and subsequently stored at -80°C.
Ninety-six well, microtiter plates (Costar 3590, Fisher Scientific, PA, USA check) were coated with 100 μl per well of a 1 in 1,000 dilution of SPAFAS chicken anti-NDV polyclonal antibody (Benchmark Biolabs, NE) in 0.01 M borate buffer. The plates were covered and incubated overnight at 4°C. The plates were equilibrated to room temperature for 30 minutes then washed three times with 300 μl per well phosphate buffered saline with 0.05% Tween-20 (PBST). The plates were blocked with 200 μl per well, 3% skim milk in PBST at 37°C for two hours then washed three times with PBST before 50 μl per well of protein extracts were added. ELISAs were performed on two replicates on a series of two-fold dilutions of the crude extracts in 5% skim milk + PBS + 0.05% Tween-20. The plates were incubated for one hour at 37°C before washing three times with PBST. One hundred microliters of the primary antibody, HN Mab 4A (Benchmark Biolabs), diluted 1 in 250 in 1 % skim milk in PBST, was added to each well and incubated for one hour at 37°C. The plates were then washed three times with PBST before 100 μl per well of goat, anti-mouse IgG horse radish peroxidase (HRP) conjugate (Sigma, St Louis, MO, USA) diluted 1 in 3,000 in 1 % skim milk in PBST was added and left to incubate at 37°C for one hour. The plates were washed four times with PBST before 50 μl per well of TMB Peroxidase EIA Substrate kit (BioRad) was added and incubated for five minutes at room temperature. Absorbance at 450 nm was measured in a ThermoMax Micropla reader. ELISA data obtained by anti-HN ELISA was converted to microgram per gram of fresh weight by reference to a standard curve constructed using purified HN (Benchmark Biolabs).
The top four lines based on HN expression in the leaves were used for fruit analysis.
Nucleic Acid Extraction. Ten milliliters of extraction buffer (4% p-amino salicylic acid,
1% 1,5 naphthalenedisulfonic acid, disodium salt hydrate), 3 ml CTAB buffer, and 10 ml buffer- saturated phenol (pH 4.3) were added to a 50 ml falcon tube and heated at 70°C in a water bath for 10 minutes. About 3.5 g of individual tomato fruit were ground in liquid nitrogen then added to the heated tube and vortexed vigorously for 30 seconds. Ten milliliters of chloroform:isoamylalcohol (24: 1) was added. The resulting slurry was vortexed for 30 seconds before centrifuging for 20 minutes at 10,000 φm at 4°C. The aqueous phase was transferred to a 50mL falcon tube, mixed with 2 volumes of ethanol, and precipitated for 15 minutes at room temperature. The extract was then centrifuged for 15 minutes at 10,000 φm at 4°C before the supernatant was discarded. The resulting nucleic acid pellet was resuspended in 2 ml DEPC treated water, mixed with an equal volume of 4 M LiCl, and precipitated at -20°C overnight. The extract was centrifuged at 10,000 φm at 4°C for 20 minutes. The supernatant containing genomic DNA was removed to a different tube, precipitated with 2 volumes of ethanol and stored at -20°C overnight. Meanwhile, the RNA pellet was resuspended in DEPC treated water and stored at -20°C. The following day, the DNA pellet was centrifuged down at 10,000 φm at 4°C for 20 minutes and resuspended in water containing 1 μg/ml Rnase A.
Southern Analysis. Fifteen micrograms of tomato genomic or 330 ng of pCHN plasmid
DNA were digested with 5 units of restriction enzyme EcoRI per μg DNA at 37°C for 20 to 24 hours. Uncut and digested samples were run overnight in a 1.0% TAΕ agarose gel. The gel was prepared for transfer by one 20 minute depurination wash (0.25 HC1), two 30 minute denaturation washes (1.5 M NaCl, 0.5 NaOH) and two 30 minute neutralization washes (0.5 M TrisHCl, pH 7, 3 NaCl). DNA was then transferred to a nylon membrane (Zeta-Probe blotting membranes, Bio-Rad, Hercules, CA, USA) by capillary transfer and fixed by UV cross-linkage using a Bio-Rad GS Gene Linker. A PCR labeled probe was made by using the primer set HNa (CCG AGC AGT TTC ACA AGT GG, SΕQ ID NO: 10) and HNb (CCT GAT CTT GCT TCA CGT ACA, SΕQ ID NO:l 1) on a pCHN template. DIG labeled dCTP was incoφorated into the 1734 bp amplicon using the Roche Molecular Biochemical DIG PCR Probe Synthesis kit according to manufacturer's instructions. The amplification was performed over 37 cycles using an iCycler Gradient Thermo Cycler (BioRad, Hercules, CA, USA). The template was initially melted at 94°C for 5 minutes followed by 35 cycles of 94°C for 30 seconds, 56°C for 30 seconds, and 72°C for 90 seconds. A final extension step was performed at 72°C for 5 minutes before soaking at 4°C. Hybridization bottles and 10 ml DIG Easy Hyb (Roche Scientific, Mannheim, Germany) per membrane were pre-warmed to 45°C in a hybridization oven. Membranes were prehybridized for 60 minutes at 45°C and hybridized overnight at 45°C with a probe concentration of 5 μl/ml DIG Easy Hyb.
Post hybridization washes and detection were performed as per manufacturer's instructions (Roche - DIG wash and block buffer set and DIG Luminescent Detection Kit). Labeled membranes were visualized after exposure to film. Northern Analysis. Thirty micrograms of total RNA from tomato transformants and wild type plants and 1.25 μg of ladder (high range RNA ladder, MBI Fermentas, Hanover, MD) were denatured with formaldehyde/formamide and run for two hours in a 1% agarose 3-(N- moφholino) propanesulfonic acid (MOPS) formaldehyde gel at 80V. The RNA was transferred to zeta probe membrane (BioRad, Hercules, CA, USA) by upward capillary action and fixed by UV cross-linkage. The membrane was then stained with 0.04% methylene blue in 0.5M sodium acetate to determine if RNA transfer was successful and to confirm that RNA concentrations in all samples were similar. A PCR labeled, DNA probe was made using the primer set HNa and HNb on a pCHN template. DIG labeled dCTP was incoφorated into the 1734 bp amplicon as per manufacturer's instructions (PCR DIG Probe Synthesis kit, Roche Scientific, Mannheim,
Germany). The amplifications were performed as described for Southern analysis. Hybridization bottles and 10 ml DIG Easy Hyb (Roche) per membrane were pre- warmed to 45°C in a hybridization oven. Membranes were pre-hybridized for at least 90 minutes at 45°C and hybridized overnight with a probe concentration of 7.5 μl/ml DIG Easy Hyb. Post hybridization washes and detection were performed as per manufacturer's instructions (Roche - DIG wash and block buffer set and DIG Luminescent Detection Kit). Labeled membranes were visualized after exposure to film.
Western Analysis. Purified HN supplied by Benchmark Biolabs and NTl cell line 119 transformed with pCHN (supplied by BTI) were used as positive controls. Twenty microliters of protein extracts were added to 4 μl 6X SDS gel loading buffer (300mM Tris-HCl, pH 6.8, 600 m DTT, 12 % SDS, 0.6% bromophenol blue, 60% glycerol), boiled for 10 minutes and loaded into a 15 % sodium dodecyl sulfate polyacrylamide gel. The gel was run in tris-glycine buffer (25 m Tris, 250 mM Glycine, pH 8.3, 0.1% SDS) at 30 milliamps per gel until the dye front ran about 5 mm from the gel bottom. The separated proteins were transferred from the gel to a PVDF membrane using a BioRad Trans Blot Cell (50 V for 2 hours or overnight at 7 V). All membrane washes were performed in PBST (PBS + 0.1% Tween-20) at room temperature unless otherwise stated. The membrane was blocked with 5% skim milk + PBS + 0.1% Tween-20 overnight at 4°C or for two hours at room temperature using slow rotation in a hybridization incubator (Fisher Scientific, Tustin, CA, USA). The membrane was washed twice briefly before incubating for one hour at 37°C with a 1 in 50,000 dilution of the primary antibody, mouse anti-HN Mabl4F antiserum (Benchmark Biolabs) in 1 % skim milk + PBS + 0.1% Tween-20. The membrane was briefly rinsed in PBST before a 15 minute wash and three 5 minute washes then incubated in a 1 in 30,000 dilution of an anti-rabbit IgG horseradish peroxidase (HRP) conjugate (Sigma) for an hour at 37°C with slow rotation. The membrane was rinsed, then subjected to a 15 minute wash and three 5 minute washes. Detection was performed using the Amersham ECL + kit as per manufacturer's instructions.
Haemagglutination Activity. To make a 1 % chicken red blood cell (cRBC) standardized solution, cRBCs in Alsevers solution (Colorado Serum, Co) were transferred into a 15 ml conical tube and centrifuged at 250 g for 10 minutes. The supernatant was aspirated and the pellet resuspended in 10 ml Dulbecco's phosphate-buffered saline without calcium and magnesium (DPBS) (Cellgro, Mediatech, Inc, Kansas City, MO). The suspension was centrifuged at 250 g for 10 minutes. The washes and resuspensions were repeated until the supernatant was clear. Once this was achieved the cells were pelleted and the supernatant aspirated to leave the packed RBC pellet. The pellet was then diluted in 1 % DPBS- (volume to volume). Four hundred microliters of the 1% RBC solution was transferred to a small tube, 1.6 ml of deionized water was added before being vortexed at high speed for 20 seconds to lyse the cells. A cRBC solution was not used unless the absorbance at 540 nm of the lysed cells was 0.4 - 0.5. A 96-well, U bottom plate (Falcon) was sprayed with antistatic spray before 50 μl per well of DPBS was added. Fifty microliters of the samples, including the positive control of NDV HN and negative control of DPBS, was added to the first row, mixed through repeated pipetting then serially diluted by transferring 50 μl to the next row. Fifty microliters of the standardized cRBC was added to each well before the dilutions were incubated on a plate shaker at 600 φm for 20 - 30 seconds. The plates were then incubated at 5°C for an hour before the control NDV HN wells were checked for haemagglutination. Once this was achieved the final read was made. The HA titer was taken as the reciprocal of the highest dilution that was positive for agglutination.
Analysis. Fruit ripening is a developmentally and genetically regulated process that is characterized by many biochemical and physiological changes, including increases in the rate of ethylene biosynthesis and respiration, chlorophyll degradation, pigment accumulation, textural modifications such as fruit softening, changes in the levels of sugars and organic acids, and production of volatile aromatic compounds (Brady CJ. Annu Rev. Plant Physiol 1987; 38: 155- 178). There is a distinct relationship between fruit pH and solids content (mainly sugars, Benton Jones J. Tomato plant culture: in the field, greenhouse, and home garden. New York: CRC Press, 1999). The degree of ripeness is also a factor that affects pH. Ripening of wild type
TA234 caused the fruit pH to decrease significantly (α = 0.05) (Figure 31) and the total soluble protein to generally decrease (Figure 32). Although the extent of decrease varies, this has been found in other studies (Benton Jones J. Tomato plant culture: in the field, greenhouse, and home garden. New York: CRC Press, 1999).
The four lines expressing the highest level of HN in leaf tissue had varying phenotypes. The phenotypes of lines CHN-1, CHN- 12 and CHN-32 were indistinguishable from control plants while line CHN- 10 showed traits indicative of polyploidy such as thick, wrinkly leaves and late flower set and fruit development. Comparing the intensity of signals between the plasmid controls and the genomic samples in Southern analysis, the lines had between 1 and 4 copies of the transgene (Figure 33) with CHN-1 having two copies, CHN- 10 four copies, CHN- 12 having one copy, and CHN-32 having 2 copies. Since CHN- 10 is likely a polyploid line, it will not be used in further studies or for production of vaccine batches.
Methylene blue staining of the northern membrane before the pre-hybridization and hybridization steps revealed the transfer of RNA from the gel to the membrane was successful and that there were similar concentrations of RNA in each of the samples (Figure 34a). Northern analysis of total RNA specific for the HN gene demonstrated no band in the wild type negative control however a band of about 5000 nucleotides was seen in the transgenic tomato lines
(Figure 34b). Since the HN gene expression cassette with promoter and terminator is 2,832 bp and the expression cassettes within the T-DNA combined are 4323 bp, the transcript is larger than expected and was thought due to read through of the VSP 3' termination signal during transcription of the HN gene. Transcript prevalence varied at different stages of fruit ripening within a line and between lines. Line CHN- 10 displayed a distinct decrease in HN-specific mRNA content as the fruit ripened (Figure 34b). However since only one fruit was sampled for northern analysis no pattern could be discerned between RNA prevalence and stage of ripening in the other CHN tomato lines.
Anti-HN ELISA of transgenic lines revealed a trend of decreasing concentration as the fruit ripened (Figure 35). Stages 4 and 5 had significantly less HN per gram fresh weight than stage 1 fruit in lines CHN-1 (Figure 35a) and CHN-10 (Figure 35b) and stage 2 fruit in CHN-32
(Figure 35c) (α = 0.05). FIN concentration was not significantly different at the same stage between different varieties (α = 0.05). HN concentration varied between 71.1 and 3.5 μg/g fresh weight with the highest concentration in each line being 67.2 μg/g fresh weight in stage 1 fruit of CHN-1, 63.3 μg/g fresh weight in stage 1 fruit of CHN-10, 65.4 μg/g fresh weight in stage 1 fruit of CHN- 12 and 71.1 μg/g fresh weight in stage 2 fruit of CHN-32. The best stage to harvest a
HN tomato crop would therefore be at the green or early breaker stage. Western analysis of the Lasota NDV HN positive control while overloaded, revealed bands around 49, 74, 78, 90,120, 200, 250 and larger than 250 kDa (Figure 36). The 78 kDa band was designated HN monomers, the smaller bands degradation products. The 90 kDa band was thought a different glycosylation form and the 120 kDa and larger bands as HN polymers. Western analysis of transgenic fruit at different stages was difficult due to the low expression of HN, however two bands around 78 and 70 kDa were visible. These bands were also present in the leaves of transgenic tomato plants and in the NTl cell line 119 but were not present in the tomato or NTl cell line negative controls. It was thought the 78 and 70 kDa bands represented different glycosylation forms of the HN antigen or the 70 kDa band a truncated version of the HN monomer. Additional bands thought to be degradation products were visible around 20 and 48 kDa in leaf samples of transgenic tomatoes and 48 kDa in the NTl 119 line.
NF, represents tomato fruit negative control - wild type fruit; NL tomato leaf negative control - wild type leaf; NNT NTl cell negative control - non-transformed cell lines; 119, transgenic NTl cell line 119; L10, leaf from transgenic tomato line 10; L32, leaf from tomato line 32; HN, animal derived Lasota NDV virus; M, Bio-Rad's precision plus protein all blue standard; 1-1, fruit from line CHN-1, stage 1 of ripening; 1-3, fruit from line CHN-1, stage 3 of ripening; 1-6, fruit from line CHN-1, stage 6 of ripening; 32-1, fruit from line CHN-32, stage 1 of ripening; 32-3, fruit from line CHN-32, stage 3 of ripening; 32-6, fruit from line CHN-32, stage 6 of ripening; 10-1, fruit from CHN-10, stage 1 of ripening. Protein size is give in kDa.
Haemagglutination assays of the freeze-dried green fruit and leaves of the transgenic tomato revealed haemagglutination activity in all lines (Figure 37). Activity was highest in the leaves in lines CHN-1, CHN- 12 and CHN-32 with CHN-10 being the only line to have higher activity in the fruit. Line CHN-32 displayed the highest haemagglutination activities of 512 and 2,048 in the fruit and leaves (Figure 37a) as well as the highest haemagglutination activity of 10,928 units per microgram HN (Figure 37b). The CHN-1 line had the second highest haemagglutination activities of 128 and 256 in the fruit and leaves as well as the second highest activity of 3,994 units per μg HN (Figure 37a and b). Despite being mis-processed during transcription, the synthetic HN gene was translated into a functional protein.
Although CHN-10 had higher HN activity in the fruit, the target organ for animal trials and vaccine delivery, the probable polyploid status of this line in addition to its slowness to flower and fruit made it an unlikely candidate for future studies. Taking into account HN expression levels and HN activity in the four lines, the CHN-1 and CHN-32 lines were chosen for future analysis.
Western analysis, ELISA and haemagglutinin activity assays show that tomato is capable of expressing a HN protein of the correct size (78 kDa) that is antigenic in ELISAs and retains haemagglutination activity. The optimal time to harvest tomato fruit expressing HN under the control of the CsVMV promoter was the early stage of fruit ripening. This decreased the time to harvest by 2 weeks and increased HN expression approximately 15-fold. Despite the protein being correctly processed, northern analysis reveals that the gene is not processed correctly at the DNA level. The 5,000 nucleotide transcript is likely due to read through of the HN gene terminator. Lines CHN-1 and CHN-32 were deemed the best lines for progression to additional studies.
Example 13 HN expression during Maturation of Tomato Fruit
HN levels in maturing tomato fruit to determine if immature fruit are capable of expressing higher levels of HN than stage one tomatoes.
The fruit of red-fleshy tomato varieties is said to be mature when it has completed growth but is still completely green. This stage of ripeness is known as "green" or "stage one". Tomatoes are usually picked at this stage then ripened with ethylene. The stages following include "breakers" or "stage two" when there is a definite break in color from green to tannish- yellow or pink (vine ripened tomatoes are picked at this stage); "turning" or "stage three" when more than 10% but less than 30% (for example, 11, 12, 13, 14, 15, 20, 25, 29%) of the surface of the tomato shows a definite change in color from green to tannish-yellow, pink or red; "pink" or "stage four" when more than 30% but less than 60% (for example, 31, 32, 33, 34, 35, 40, 45, 50, 55, 59%) of the surface of the fruit is pink or red in color; "light red" or "stage five" when more than 60% but less than 90% (for example, 61, 62, 63, 64, 65, 70. 75, 80, 85, 89%) of the surface of the fruit is pinkish-red or red; "red" or "stage six" when more than 90% (for example, 91, 92, 93, 94, 95, 99, 100%) of the surface of the fruit is red.
Expression of the synthetic, plant optimized, gene for the Newcastle disease virus haemagglutinin neuraminidase (HN) protein driven by the Casava Vein Mosaic Virus promoter (CsVMV), decreased as the tomato fruit ripened. It was determined that in stage one green tomato fruit, HN expression was approximately 12μg/g fresh weight (FW) and that this steadily decreased as the tomato ripened to stage six red tomato fruit to an approximate value of 2.5 μg/g FW.
One Ti plant from each of the elite lines in the T0 CHN generation (CHN-1, CHN-32) was germinated and allowed to grow. When flowering began, cross-pollination was prevented by each flower being self-pollinated by hand and enclosed in a paper towel. The individual flower was dated and allowed to fruit. Three fruit from each plant line were harvested at one week post-pollination, two weeks post-pollination, four weeks post-pollination, six weeks post- pollination, and finally at stage one green fruit (about eight weeks post pollination). Fruit diameter (mm) and fresh mass (g) were recorded before ELISA analysis of the HN content and lyophilization. To measure the diameter of the tomato fruit, a vernier caliper was applied to the widest part of the tomato fruit peφendicular to the stem and the measurement in millimeters recorded. Mass was determined using a gram balance.
HN ELISA. SPAFAS chicken α-NDV polyclonal antibody diluted 1:1500 in 0.01M borate buffer was used to coat a 96 well ELISA plate. One hundred microliters of the dilution was pipetted into each well before the plate was covered, and left overnight at 4°C. The next morning the plate was allowed to equilibrate for 30 minutes at 24°C, before being washed three times with PBST (0.05% tween). A solution of 3% skim milk was made and 200μl added to each well. The plate was placed at 37°C and allowed to block for two hours.
To collect a sample, a coring tool (size 1) was pushed through the center of the tomato along the horizontal axis. Any gelatinous material or seeds were excluded from the sample.
Using a scalpel, approximately 1 cm of the tomato was collected and placed into the sample tube that was then placed on ice. The actual sample weight was calculated by subtracting the individual tube weight from the total mass then 20 x tomato extraction buffer (4M Nacl (final concentration lOOmM), 0.5M EDTA (final concentration ImM), 20% Triton-x 100 (final concentration 10%), Leupeptin (final concentration lOug/ml), 0.5M NaPi, pH 7.0 (final concentration 50mM), brought to volume with milliQ water) (mass by volume) was added to the tube. A ceramic bead was added to the sample tube and the sample homogenized using a fast prep machine at speed 4.0 for 30 seconds. The homogenized samples were centrifuged and then set aside on ice while the standard curve was prepared.
After the plate had blocked for two hours it was washed three times with PBST (PBS plus
0.05 % tween). For the NDV HN standard curve, lOOμl of 232ng/ml NDV purified stock (1:80) was pipetted into the second well of the second row. Fifty microliters of 1% skim milk was pipetted into the remaining wells of the second row and each of the wells in rows 3-8 of the microtiter plate. Fifty microliters of each plant sample was then added to the 1% skim milk in wells 3-11 of the second row. The purified NDV as well as the plant samples were then serially diluted down the plate by pipetting 50μl out of row two and into row three and so on down the plate. The samples were mixed in the wells by pipetting up and down after each dilution step. The initial concentration of the samples was a 40-fold dilution. The plate was placed back into the 37°C incubator for 1 hour.
After incubating for one hour the plate was washed three times with PBST and the primary antibody added. The primary antibody NDV HN Mab 4 A was diluted to a concentration of 1 :250 in 1% skim milk and lOOμl added to each well. This was allowed to incubate for one hour at 37°C. Next the plate was washed three times with PBST and the secondary antibody goat anti-mouse IgG, was added to each well at a concentration of 1:3000 in 1% skim milk. This was allowed to incubate for one hour at 37°C.
The plate was washed four times with PBST and 50μl TMB substrate was added to each well. After five minutes had elapsed the TMB was neutralized with IN H2SO4. The plate was then read on a spectrophotometer at a wavelength of 450nm.
The percent water loss was determine by removing the seeds from each tomato fruit, measuring the mass, freezing at -20°C, lyophilizing, then reweighing the tomato fruit.
To take into account the increase in fruit size in addition to HN concentration, the HN content of a tomato fruit at each of the maturation stages selected was calculated by multiplying the fruit HN concentration by the fruit mass. In addition, the data generated from this study was used to calculate the possible number of doses produced from the CHN elite lines if fruit were harvested at stage one or at four weeks post pollination. In this model it was assumed that the same number of fruit would be produced from a plant harvested when fruit were at stage three and a plant harvested when fruit were four weeks post pollination and that one dose would be 50μg of antigen. Results
Fruit Physiology
As expected, fruit size, mass and percent water loss increased with time (Figures 38, 39, and 40). Only small variations were observed between repetitions of measurements taken at the same maturation stage within the same plant line. No significant difference was seen between line 1 and 32 at the same stage in maturation (α = 0.05).
HN Content of Maturing Fruit
Concentration of HN in maturing fruit peaked at two weeks post pollination then decreased as the fruit matured (Figure 41). There was no significant difference between the two tomato lines at the same stage of maturation nor between the HN content in the first four weeks after pollination (α = 0.05). There was significantly more HN in fruit two weeks post pollination than in fruit six weeks after pollination and when mature and in the stage 1 of ripening (α = 0.05).
To take into account the increase in fruit size in addition to HN content, the amount of HN of a tomato fruit at each of the maturation stages selected was calculated. The HN content within a fruit peaked at four weeks post pollination (723 μg for line CHN-1 and 630.9 μg for line CHN-32) before decreasing with further fruit maturation (Figure 42). There was no significant difference between lines at the same stage of maturation (α = 0.05).
Calculations were made for the number of doses produced by the HN elite lines if fruit were harvested at stage 1 or four weeks post pollination (Table 10). It was assumed the same number of fruit would be produced from each harvest and that one dose would be 50μg of antigen. These data indicate that if 33 fruit are harvested at stage one, 126 doses would be produced; and if fruit were harvested four weeks post pollination, 486 doses would be produced. Thus harvest time is reduced by four weeks and there is a 286% increase in doses yielded.
Table 10. Effect of harvest time on number of HN doses produced.
Figure imgf000081_0001
Figure imgf000082_0001
Although HN concentration peaked at 38.8 - 42 μg/g fresh weight in tomato fruit two weeks post pollination, no significant difference was found in HN concentration in the first four weeks after pollination (α = 0.05). When mass was taken into account however, tomato fruit that were four weeks post pollination averaged between 631 - 723μg HN, which was a significantly higher amount of HN than the other maturation stages tested fø = 0.05). Since percentage of water loss between fruit at stage one of ripening and two and four weeks post pollination did not varying greatly (total difference of 2.6%) the significantly higher antigen content at four weeks pollination was not a factor of varying water content or dilution of antigen. These data suggest that the best time to harvest tomato fruit expressing HN under the control of the CsVMV promoter is four weeks post pollination.
To identify easily when fruit are four weeks post pollination, fruit mass and diameter were recorded throughout their maturation. Fruit four weeks post pollination averaged a mass of 40g and a diameter between 42 and 45mm. Fruit size is affected by genetics, temperature, day length and plant age. The small standard errors of our means indicated that genetics is not presently an issue with regards to plant-by-plant variation in fruit size. However the effect of stress (due to change in temperature, day length and plant age) means that fruit size may not always prove an accurate indication of time post pollination. Large temperature fluctuations, day length and plant age should therefore be kept in mind, when approximating time of pollination using fruit size.
To calculate the benefit of harvesting earlier in the maturation of tomato fruit we constructed a conservative model that assumed 33 fruit are harvested from one plant over an average production period, and one dose of HN would be 50μg. The model was deemed conservative since one dose is likely to be less than 50μg and plants that have fruit harvested four weeks post pollination would have reduced metabolic burden and would likely produce more fruit than plants that have fruit harvested at a later stage. These data suggest that by harvesting the fruit at four weeks post pollination, the time required for fruit to be ready for harvest is reduced by four weeks and there is a 286% increase in doses yielded.
Tomato therefore is capable of expressing large quantities of HN when harvested at an optimal time in fruit maturation.
Example 14 Preparation of CHN-18 Master Seed
Master Seed Passage: Master Seed passage 2 was used for DNA extraction.
DNA Extraction and PCR Amplification: DNA extraction was performed as described herein. PCR amplification for the HN and PAT gene expression cassettes were conducted separately. There was a 24 bp overlap between the PCR products of HN and PAT expression cassettes.
For HN gene cassette amplification, 50 μL PCR reaction contained 2.5 units of Takara Ex Tag DNA polymerase (Takara Shuzo Co, Shiga, Japan, catalog # RR001 A), 0.2 μM of each primers (CHN01 /CHN03), 5 μL of 1 OX reaction buffer containing MgCl2, 0.2 mM of each dNTP, and 200 ng of genomic DNA. The PCR was performed with a Gen Amp PCR 9700 system, manufactured by Applied Biosystem (Foster City, CA) at the following condition: 94 °C for 5 min for 1 cycle, 94 °C for 30 sec, 60 °C 30 sec and 72 °C for 3 min 30 sec for 40 cycles, 72 °C for 7 min.
For PAT gene cassette amplification, a 50 μL PCR reaction contained 2.5 units of Takara
Ex Tag DNA polymerase (Takara Shuzo Co, Shiga, Japan, catalog # RR001 A), 0.2 μM of each primers (CHN02/CHN04), 5 μL of 10X reaction buffer containing MgCl2, 0.2 mM of each dNTP, and 200 ng of genomic DNA were used. The PCR was performed with a Gen Amp PCR 9700 system, manufactured by Applied Biosystem (Foster City, CA) at the following condition: 94 °C for 5 min for 1 cycle, 94 °C for 30 sec, 56 °C 30 sec and 72 °C for 2 min 30 sec fro 40 cycles, 72 °C for 7 min.
Cloning of PCR Products: After agarose gel electrophoresis and visual observation, PCR products were purified using MiniElute PCR Purification Kit (Qiagen, Valencia, CA. Catalog # 28004) according to the manufacturer's protocol. Purified PCR products were cloned into pCR® II-TOPO vector using TOPO TA Cloning® kit (Invitrogen, Carlsbad, CA, Catalog # 051302) according to the manufacturer's protocol.
Plasmid DNA Extraction Plasmid DNA was extracted using Qiaprep Spin Minprep kit (Qiagen, Valencia, CA, catalog # 27106) according to the manufacturer's protocol.
DNA Sequencing and Analysis: Plasmid DNAs containing cloned PCR products were sent to Lark Technologies Inc (Houston, TX) for sequencing using ABI PRISM® BigDye™ Primer Cycle Sequencing Kits (Applied Biosystem, Foster City, CA). DNA sequences were analyzed using Vector NTl program (InforMax, Frederick, MD).
Results
DNA sequences from the HN and PAT cassettes were assembled and compared with the sequences from a virtual plasmid map of pCHN. DNA sequences of all the genetic elements including the CsVMV promoter, HN and PAT coding sequences, vspB 3' UTR, and MAS 3' UTR were identical to the ones in the virtual plasmid map pCHN. Based on the virtual plasmid map pCHN, the PCR product including the whole gene insert in CHN-18 Master Seed using primer CHN01/CHN02 was 4757 bp. However, the actual cloned and sequenced PCR product including the whole gene insert in CHN-18 Master Seed was 4768 bp. By sequence comparison, 7 additional DNA bases were located in the junction region (poly cloning site) between the PAT coding sequences and MAS 3' UTR, another additional 4 DNA bases were located outside of the 3' end of MAS3' UTR (Figure 43). The inconsistenct DNA base number between the virtual plasmid map and the actual sequencing data most likely occurred during the virtual creation of plasmid map pCHN. Open reading frame analysis of the entire insert sequence indicated there were only the expected HN and PAT open reading frames, and the 11 DNA bases did not result in any changes in the existing HN and PAT open reading frame and did not create any new opening reading frames.
Conclusions
By comparison with the virtual sequence from plasmid map pCHN, the actual DNA sequence of the whole gene insert in CHN-18 Master Seed was identical to what was expected except for extra 11 DNA bases outside all the genetic elements in the gene insert. These 11 DNA bases do not have any effect on the existing HN and PAT open reading frames. The principles, preferred embodiments and modes of operation of the present invention have been described in the foregoing specification and examples. The invention that is intended to be protected herein, however, is not to be construed as limited to the particular forms specifically disclosed, since they are to be regarded as illustrative rather than restrictive. Variations and changes may be made by those skilled in the art without departing from the spirit and scope of the invention.
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, cell biology, microbiology and recombinant DNA techniques, which are within the skill of the art. Such techniques are explained fully in the literature. See, e.g.. Sambrook, Fritsch & Maniatis. 1989. Molecular Cloning: A Laboratory Manual. Second Edition ; Oligonucleotide Synthesis (M.J. Gait, ed., 1984); Nucleic Acid Hybridization (B.D. Harnes & SJ. Higgins, eds., 1984); A Practical Guide to Molecular Cloning (B. Perbal, 1984); (Harlow, E. and Lane, D.) Using Antibodies: A Laboratory Manual (1999) Cold Spring Harbor Laboratory Press; and a series, Methods in Enzymology (Academic Press, Inc.); Short Protocols In Molecular Biology. (Ausubel et al., ed., 1995).
All patents, patent applications, and published references cited herein are hereby incoφorated by reference in their entirety. While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.

Claims

We claim:
1. An isolated plant optimized nucleotide sequence encoding the HN antigen of Newcastle Disease Virus comprising the sequence of SEQ ID NO: 1.
2. A recombinant expression vector comprising SEQ ID NO: 1.
3. The vector of claim 2, selected from the group consisting of pCHN, pGHN, pGHN 151, pGHN153, pMHN, pUHN.
4. The vector of claim 2, wherein a plant-functional promoter is operably linked to SEQ ID NO:l.
5. A recombinant expression vector for expressing an immunoprotective antigen in a plant cell comprising a DNA sequence encoding the HA antigen of Avian Influenza Virus, wherein the vector is pCHA
6. A transgenic plant cell for expression of an immunogenic antigen comprising a vector of claim 2, 3 or 5.
7. The plant cell of claim 6, wherein said plant cell is a potato plant cell, a tomato plant cell or a tobacco plant cell.
8. A transgenic plant comprising a vector of claim 2, 3 or 5.
9. A vaccine comprising a recombinant viral antigenic protein and a pharmaceutically acceptable carrier, wherein the viral antigenic protein is the HN antigen of Newcastle Disease virus produced by a vector of claim 2 or 3, and wherein said vaccine is capable of eliciting an immune response upon administration to an animal.
10. The vaccine of claim 9, wherein said HN protein comprises SEQ ID NO:2.
11. The vaccine of claim 9, wherein said HN protein is produced in a plant cell.
12. A method for protecting an animal against NewCastle Disease Virus comprising administering an effective amount of the vaccine of claim 9 to an animal.
13. A vaccine comprising a recombinant viral antigenic protein and a pharmaceutically acceptable carrier, wherein the viral antigenic protein is the HA antigen of Avian Influenza Virus produced by a vector of claim 5, and wherein said vaccine is capable of eliciting an immune response upon administration to an animal.
14. The vaccine of claim 13, wherein said HA antigen is produced in a plant cell.
15. A method for protecting an animal against Avian Influenza Virus comprising administering an effective amount of the vaccine of claim 13 to an animal.
16. The method of claim 12 or 15, wherein the vaccine is administered orally, intranasaly, intraperitonealy, intramuscularly, intravenously or subcutaneously.
17. The method of claim 12 or 15, wherein the effective amount is at a range of 1 μg to 50 μg per kilogram of bodyweight.
18. A method of producing an antigen in a transgenic plant comprising the steps of:
a) producing a transgenic plant comprising a vector encoding said antigen;
b) incubating said plant under conditions wherein said plant expresses said antigen; and
wherein said plant is incubated prior to the onset of ripening.
19. The method of claim 18, wherein said plant comprises a fruit that ripens.
20. The method of claim 18, wherein said plant is a tomato plant.
21. The method of claim 19, wherein the fruit of said plant is harvested prior to the onset of ripening.
22. The method of claim 21, wherein said antigen is isolated from said harvested fruit.
23. The method of claim 18, wherein said antigen is selected from the group consisting of HN antigen of Newcastle Disease Virus, HA antigen of Avian Influenza Virus, LTB, NVCP, zona pellucida glycoprotein and HBsAg.
PCT/US2004/014182 2003-05-05 2004-05-04 Vectors and cells for preparing immunoprotective compositions derived from transgenic plants WO2004098533A2 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
AU2004235813A AU2004235813B2 (en) 2003-05-05 2004-05-04 Vectors and cells for preparing immunoprotective compositions derived from transgenic plants
AT04751538T ATE473271T1 (en) 2003-05-05 2004-05-04 VECTORS AND CELLS FOR PRODUCING IMMUNOPROTECTIVE COMPOSITIONS OBTAINED FROM TRANSGENIC PLANTS
NZ543348A NZ543348A (en) 2003-05-05 2004-05-04 Vectors and cells for preparing immunoprotective compositions derived from transgenic plants
CA002524293A CA2524293A1 (en) 2003-05-05 2004-05-04 Vectors and cells for preparing immunoprotective compositions derived from transgenic plants
DE602004028004T DE602004028004D1 (en) 2003-05-05 2004-05-04 VECTORS AND CELLS FOR THE MANUFACTURE OF IMMUNOPROTEKTIVE COMPOSITIONS DERIVED FROM TRANSGENIC PLANTS
EP04751538A EP1620550B1 (en) 2003-05-05 2004-05-04 Vectors and cells for preparing immunoprotective compositions derived from transgenic plants
BRPI0410340-8A BRPI0410340A (en) 2003-05-05 2004-05-04 vectors and cells for preparing transgenic plant-derived immunoprotective compositions

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US46799803P 2003-05-05 2003-05-05
US60/467,998 2003-05-05

Publications (2)

Publication Number Publication Date
WO2004098533A2 true WO2004098533A2 (en) 2004-11-18
WO2004098533A3 WO2004098533A3 (en) 2005-08-04

Family

ID=33435152

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/014182 WO2004098533A2 (en) 2003-05-05 2004-05-04 Vectors and cells for preparing immunoprotective compositions derived from transgenic plants

Country Status (13)

Country Link
US (3) US7132291B2 (en)
EP (1) EP1620550B1 (en)
KR (1) KR20060035596A (en)
CN (1) CN100393870C (en)
AR (1) AR044246A1 (en)
AT (1) ATE473271T1 (en)
AU (1) AU2004235813B2 (en)
BR (1) BRPI0410340A (en)
CA (1) CA2524293A1 (en)
DE (1) DE602004028004D1 (en)
NZ (1) NZ543348A (en)
WO (1) WO2004098533A2 (en)
ZA (1) ZA200508930B (en)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1326998C (en) * 2004-11-25 2007-07-18 中国农业科学院哈尔滨兽医研究所 Gene encoding hemagglutinin protein of H5 avian influenza virus and its application
WO2007128169A1 (en) * 2006-05-09 2007-11-15 Zhigao Bu RECOMBINANT NEWCASTLE DISEASE LaSota LOW VIRULENT VACCINE STRAIN EXPRESSING AVIAN INFLUENZA VIRUS H5 SUBTYPE HA PROTEIN
EP1942931A2 (en) * 2005-11-04 2008-07-16 Dow AgroSciences LLC Preparation of vaccine master cell lines using recombinant plant suspension cultures
EP2010210A2 (en) * 2006-04-21 2009-01-07 Dow AgroSciences LLC Vaccine for avian influenza and methods of use
EP2029167A2 (en) * 2006-06-16 2009-03-04 Dow AgroSciences LLC Novel dna sequences, vectors and proteins of avian influenza hemagglutinin
WO2010003225A1 (en) * 2008-07-11 2010-01-14 Medicago, Inc. Influenza virus-like particles (vlps) comprising hemagglutinin
EP2173886A1 (en) * 2007-07-13 2010-04-14 Medicago Inc. Influenza virus-like particles (vlps) comprising hemagglutinin produced within a plant
EP2238253A1 (en) * 2007-11-27 2010-10-13 Medicago Inc. Recombinant influenza virus-like particles (vlps) produced in transgenic plants expressing hemagglutinin
WO2011035422A1 (en) * 2009-09-22 2011-03-31 Medicago Inc. Method of preparing plant-derived vlps
WO2011090708A2 (en) 2009-12-28 2011-07-28 Merial Limited Recombinant ndv antigen and uses thereof
WO2012055986A1 (en) 2010-10-27 2012-05-03 Philip Morris Products S.A. Methods for capturing virus like particles from plants using expanded chromatography
US8771703B2 (en) 2008-07-08 2014-07-08 Medicago Inc. Soluble recombinant influenza antigens
US9012197B2 (en) 2009-12-28 2015-04-21 Merial, Inc. Production of hemagglutinin-neuraminidase protein in microalgae
US9546375B2 (en) 2008-07-18 2017-01-17 Medicago Inc. Influenza virus immunizing epitope
US9815873B2 (en) 2011-03-23 2017-11-14 Medicago Inc. Method for recovering plant-derived proteins
US10272148B2 (en) 2009-06-24 2019-04-30 Medicago Inc. Chimeric influenza virus-like particles comprising hemagglutinin
US11441150B2 (en) 2014-01-10 2022-09-13 Medicago Inc. CPMV enhancer elements
WO2023237726A1 (en) * 2022-06-10 2023-12-14 Pantarhei Oncology B.V. An intracellular tumor-specific variant of human zona pellucida glycoprotein 3 and nucleic acids coding therefor for use in the treatment of cancer

Families Citing this family (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2427641T3 (en) 2003-05-22 2013-10-31 Ibio, Inc. Recombinant vehicle molecule for expression, delivery and purification of target polypeptides
CA2616859C (en) 2005-08-03 2015-04-14 Fraunhofer Usa, Inc. Compositions and methods for production of immunoglobulins
EP1984405A4 (en) * 2006-02-13 2010-06-30 Fraunhofer Usa Inc Influenza antigens, vaccine compositions, and related methods
WO2008048344A2 (en) * 2006-02-13 2008-04-24 Fraunhofer Usa, Inc. Bacillus anthracis antigens, vaccine compositions, and related methods
CA2642056A1 (en) * 2006-02-13 2007-08-23 Fraunhofer Usa, Inc. Hpv antigens, vaccine compositions, and related methods
KR100766775B1 (en) * 2006-04-24 2007-11-01 대한민국 Toxoid vaccine preventing the infectious disease of Enterohamorrhagic Escherichia coli
US20080241188A1 (en) * 2007-03-30 2008-10-02 Zeon Corporation Turkey herpesvirus vectored recombinant containing avian influenza genes
BRPI0810865A2 (en) * 2007-04-28 2017-05-09 Fraunhofer Usa Inc trypanosome antigens, vaccine compositions, and related methods
HUE031698T2 (en) * 2007-06-15 2017-07-28 Medicago Inc Modifying glycoprotein production in plants
KR100964462B1 (en) * 2007-07-10 2010-06-16 성균관대학교산학협력단 An avian influenza virus vaccine and a method for preparing same
CA2692933C (en) * 2007-07-11 2016-10-18 Fraunhofer Usa, Inc. Yersinia pestis antigens, vaccine compositions, and related methods
CA2696764A1 (en) * 2007-08-20 2009-02-26 Fraunhofer Usa, Inc. Prophylactic and therapeutic influenza vaccines, antigens, compositions, and methods
US8734803B2 (en) 2008-09-28 2014-05-27 Ibio Inc. Humanized neuraminidase antibody and methods of use thereof
US9233148B2 (en) * 2009-01-09 2016-01-12 Samuel Bogoch Replikin-based compounds for prevention and treatment of influenza and methods of differentiating infectivity and lethality in influenza
JP2012521786A (en) 2009-03-30 2012-09-20 モウント シナイ スクール オフ メディシネ Influenza virus vaccine and use thereof
CA2776144C (en) 2009-09-29 2020-10-27 Fraunhofer Usa, Inc. Influenza hemagglutinin antibodies, compositions, and related methods
BR112012020839A2 (en) 2010-02-18 2017-11-21 Sinai School Medicine vaccines for use in the prophylaxis and treatment of influenza virus disease
CN102939103A (en) 2010-03-30 2013-02-20 西奈山医学院 Influenza virus vaccines and uses thereof
CA2849434A1 (en) 2011-09-20 2013-03-28 Mount Sinai School Of Medicine Influenza virus vaccines and uses thereof
ES2951259T3 (en) * 2011-09-30 2023-10-19 Medicago Inc Increased yield of virus-like particles in plants
US11390878B2 (en) 2011-09-30 2022-07-19 Medicago Inc. Increasing protein yield in plants
US9968670B2 (en) 2012-12-18 2018-05-15 Icahn School Of Medicine At Mount Sinai Influenza virus vaccines and uses thereof
US9908930B2 (en) 2013-03-14 2018-03-06 Icahn School Of Medicine At Mount Sinai Antibodies against influenza virus hemagglutinin and uses thereof
IL241692B2 (en) 2013-03-28 2023-12-01 Medicago Inc Influenza virus-like particle production in plants
EP3247389A4 (en) 2015-01-23 2019-10-30 Icahn School of Medicine at Mount Sinai Influenza virus vaccination regimens
CN109641041A (en) 2016-06-15 2019-04-16 西奈山伊坎医学院 Influenza virus haemagglutinin albumen and application thereof
US11254733B2 (en) 2017-04-07 2022-02-22 Icahn School Of Medicine At Mount Sinai Anti-influenza B virus neuraminidase antibodies and uses thereof
EP4392565A1 (en) * 2021-08-24 2024-07-03 Futuragene Israel Ltd. Sequences and promoters for use in plant cells and methods of making and using such sequences

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0433372B1 (en) * 1988-09-06 2002-06-12 Washington University Oral immunization by transgenic plants
US20010053367A1 (en) * 1991-08-26 2001-12-20 Prodigene, Inc. Vaccines expressed in plants
US6034298A (en) * 1991-08-26 2000-03-07 Prodigene, Inc. Vaccines expressed in plants
US5612487A (en) 1991-08-26 1997-03-18 Edible Vaccines, Inc. Anti-viral vaccines expressed in plants
US5426108A (en) * 1993-11-10 1995-06-20 American Cyanamid Company Antibiotic 31F508 ALPHA1, ALPHA2, BETA1 and BETA2
DE69533964T2 (en) * 1994-10-24 2006-03-30 The Texas A & M University System, College Station ORAL IMMUNIZATION THROUGH THE USE OF TRANSGENIC PLANTS
ES2219679T3 (en) * 1995-10-18 2004-12-01 Akzo Nobel N.V. COMBINATION VACCINE AGAINST NEWCASTLE DISEASE.
US6395964B1 (en) * 1995-10-24 2002-05-28 The Texas A&M University System Oral immunization with transgenic plants
EP0974660A1 (en) * 1998-06-19 2000-01-26 Stichting Instituut voor Dierhouderij en Diergezondheid (ID-DLO) Newcastle disease virus infectious clones, vaccines and diagnostic assays
AU2001270164A1 (en) * 2000-06-26 2002-01-08 The United States Of America As Represented By The Secretary Of Agriculture Production of vaccines using transgenic plants
WO2002083072A2 (en) * 2001-04-13 2002-10-24 Boyce Thompson Institute For Plant Research Methods and compositions for stable transgenic plant pharmaceuticals and their use as contraceptives

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BIENENSTOCK, J. M., ADV. EXP. MED. BIOL., vol. 107, 1978, pages 53
CEBRA, J. J. ET AL., COLD SPRING HARBOR SYMP. QUANT. BIOL., vol. 41, 1976, pages 210
DICKINSON, B.L.; CLEMENTS, J.D.: "Dissociation of Escherichia coli heat-labile enterotoxin adjuvanticity from ADP- ribosyltransferase activity", INFECT IMMUN, vol. 63, 1995, pages 1617 - 1623, XP002928605
MCCAUGHAN, G. ET AL., INTERNAL REV. PHYSIOL, vol. 28, 1983, pages 131
WEISZ-CARRINGTON, P. ET AL., J. IMMUNOL, vol. 123, 1979, pages 1705

Cited By (55)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1326998C (en) * 2004-11-25 2007-07-18 中国农业科学院哈尔滨兽医研究所 Gene encoding hemagglutinin protein of H5 avian influenza virus and its application
EP1942931A2 (en) * 2005-11-04 2008-07-16 Dow AgroSciences LLC Preparation of vaccine master cell lines using recombinant plant suspension cultures
US7964403B2 (en) 2005-11-04 2011-06-21 Dow Agrosciences Llc Preparation of vaccine master cell lines using recombinant plant suspension cultures
EP1942931A4 (en) * 2005-11-04 2009-04-29 Dow Agrosciences Llc Preparation of vaccine master cell lines using recombinant plant suspension cultures
US7993655B2 (en) * 2006-04-21 2011-08-09 Dow Agrosciences Llc Vaccine for avian influenza and methods of use
EP2010210A2 (en) * 2006-04-21 2009-01-07 Dow AgroSciences LLC Vaccine for avian influenza and methods of use
JP2009535306A (en) * 2006-04-21 2009-10-01 ダウ・アグロサイエンス・エル・エル・シー Vaccines against bird flu and methods of use
EP2010210A4 (en) * 2006-04-21 2010-07-21 Dow Agrosciences Llc Vaccine for avian influenza and methods of use
WO2007128169A1 (en) * 2006-05-09 2007-11-15 Zhigao Bu RECOMBINANT NEWCASTLE DISEASE LaSota LOW VIRULENT VACCINE STRAIN EXPRESSING AVIAN INFLUENZA VIRUS H5 SUBTYPE HA PROTEIN
EP2029167A4 (en) * 2006-06-16 2010-06-16 Dow Agrosciences Llc Novel dna sequences, vectors and proteins of avian influenza hemagglutinin
JP2009540801A (en) * 2006-06-16 2009-11-26 ダウ・アグロサイエンス・エル・エル・シー Novel DNA sequences, vectors and proteins of avian influenza hemagglutinin
US8163876B2 (en) 2006-06-16 2012-04-24 Dow Agrosciences Llc DNA sequences, vectors and proteins of avian influenza hemagglutinin
EP2029167A2 (en) * 2006-06-16 2009-03-04 Dow AgroSciences LLC Novel dna sequences, vectors and proteins of avian influenza hemagglutinin
EP2173886A1 (en) * 2007-07-13 2010-04-14 Medicago Inc. Influenza virus-like particles (vlps) comprising hemagglutinin produced within a plant
US9452210B2 (en) 2007-07-13 2016-09-27 Medicago Inc. Influenza virus-like particles (VLPS) comprising hemagglutinin produced within a plant
EP2173886A4 (en) * 2007-07-13 2010-10-13 Medicago Inc Influenza virus-like particles (vlps) comprising hemagglutinin produced within a plant
JP2010533001A (en) * 2007-07-13 2010-10-21 メディカゴ インコーポレイテッド Influenza virus-like particles (VLPs) containing hemagglutinin produced in plants
KR101541330B1 (en) * 2007-07-13 2015-08-05 메디카고 인코포레이티드 INFLUENZA VIRUS-LIKE PARTICLES(VLPs) COMPRISING HEMAGGLUTININ PRODUCED WITHIN A PLANT
AU2009202819B2 (en) * 2007-07-13 2014-08-28 Aramis Biotechnologies Inc. Recombinant influenza virus-like particles (VLPs) produced in transgenic plants expressing hemagglutinin
AU2008278222B2 (en) * 2007-07-13 2014-03-06 Aramis Biotechnologies Inc. Influenza virus-like particles (VLPs) comprising hemagglutinin produced within a plant
JP2016052331A (en) * 2007-11-27 2016-04-14 メディカゴ インコーポレイテッド Influenza virus-like particles (vlps) comprising hemagglutinin
JP2011509661A (en) * 2007-11-27 2011-03-31 メディカゴ インコーポレイテッド Recombinant influenza virus-like particles (VLP) produced in transgenic plants expressing hemagglutinin
US11434497B2 (en) 2007-11-27 2022-09-06 Medicago Inc. Recombinant influenza virus-like particles (VLPS) produced in transgenic plants
US10190132B2 (en) 2007-11-27 2019-01-29 Medicago Inc. Recombinant influenza virus-like particles (VLPs) produced in transgenic plants expressing hemagglutinin
US9458470B2 (en) 2007-11-27 2016-10-04 Medicago Inc. Recombinant influenza virus-like particles (VLPs) produced in transgenic plants expressing hemagglutinin
EP2238253A1 (en) * 2007-11-27 2010-10-13 Medicago Inc. Recombinant influenza virus-like particles (vlps) produced in transgenic plants expressing hemagglutinin
JP2014097076A (en) * 2007-11-27 2014-05-29 Medicago Inc Recombinant influenza virus-like particle (vlp) produced in transgenic plant that expresses hemagglutinin
EP2238253A4 (en) * 2007-11-27 2011-04-06 Medicago Inc Recombinant influenza virus-like particles (vlps) produced in transgenic plants expressing hemagglutinin
EP2610345A1 (en) 2007-11-27 2013-07-03 Medicago Inc. Recombinant influenza virus-like particles (VLPS) produced in transgenic plants expressing hemagglutinin
CN103122354A (en) * 2007-11-27 2013-05-29 麦迪卡格公司 Influenza virus-like particles (vlps) comprising hemagglutinin produced within a plant
US8771703B2 (en) 2008-07-08 2014-07-08 Medicago Inc. Soluble recombinant influenza antigens
EP2307549A1 (en) * 2008-07-11 2011-04-13 Medicago Inc. Influenza virus-like particles (vlps) comprising hemagglutinin
EP2570484A1 (en) 2008-07-11 2013-03-20 Medicago Inc. Influenza virus-like particles (VLPS) comprising hemagglutinin
EP2307549A4 (en) * 2008-07-11 2011-09-07 Medicago Inc Influenza virus-like particles (vlps) comprising hemagglutinin
WO2010003225A1 (en) * 2008-07-11 2010-01-14 Medicago, Inc. Influenza virus-like particles (vlps) comprising hemagglutinin
JP2011527180A (en) * 2008-07-11 2011-10-27 メディカゴ インコーポレイテッド Influenza virus-like particles (VLPS) containing hemagglutinin
US9546375B2 (en) 2008-07-18 2017-01-17 Medicago Inc. Influenza virus immunizing epitope
US10272148B2 (en) 2009-06-24 2019-04-30 Medicago Inc. Chimeric influenza virus-like particles comprising hemagglutinin
US11833200B2 (en) 2009-09-22 2023-12-05 Medicago Inc. Method of preparing plant-derived proteins
WO2011035422A1 (en) * 2009-09-22 2011-03-31 Medicago Inc. Method of preparing plant-derived vlps
AU2010300033B2 (en) * 2009-09-22 2015-01-22 Aramis Biotechnologies Inc. Method of preparing plant-derived VLPS
US11826419B2 (en) 2009-09-22 2023-11-28 Medicago Inc. Method of preparing plant-derived VLPs
RU2579903C2 (en) * 2009-09-22 2016-04-10 Медикаго Инк. Method of production of virus-like particles of plants
KR101773431B1 (en) 2009-09-22 2017-09-12 메디카고 인코포레이티드 Method of preparing plant-derived vlps
US9012197B2 (en) 2009-12-28 2015-04-21 Merial, Inc. Production of hemagglutinin-neuraminidase protein in microalgae
EP3213766A1 (en) 2009-12-28 2017-09-06 Merial Ltd. Recombinant ndv antigen and uses thereof
WO2011090708A3 (en) * 2009-12-28 2011-12-15 Merial Limited Recombinant ndv antigen and uses thereof
US10633667B2 (en) 2009-12-28 2020-04-28 Boehringer Ingelheim Animal Health USA Inc. Recombinant NDV antigen and uses thereof
WO2011090708A2 (en) 2009-12-28 2011-07-28 Merial Limited Recombinant ndv antigen and uses thereof
JP2013515747A (en) * 2009-12-28 2013-05-09 メリアル リミテッド Recombinant NDV antigen and uses thereof
WO2012055986A1 (en) 2010-10-27 2012-05-03 Philip Morris Products S.A. Methods for capturing virus like particles from plants using expanded chromatography
US9815873B2 (en) 2011-03-23 2017-11-14 Medicago Inc. Method for recovering plant-derived proteins
US11441150B2 (en) 2014-01-10 2022-09-13 Medicago Inc. CPMV enhancer elements
US11884929B2 (en) 2014-01-10 2024-01-30 Medicago Inc. CPMV enhancer elements
WO2023237726A1 (en) * 2022-06-10 2023-12-14 Pantarhei Oncology B.V. An intracellular tumor-specific variant of human zona pellucida glycoprotein 3 and nucleic acids coding therefor for use in the treatment of cancer

Also Published As

Publication number Publication date
US7407802B2 (en) 2008-08-05
ZA200508930B (en) 2007-03-28
EP1620550A2 (en) 2006-02-01
US20090017065A1 (en) 2009-01-15
BRPI0410340A (en) 2006-05-30
CN1788077A (en) 2006-06-14
KR20060035596A (en) 2006-04-26
WO2004098533A3 (en) 2005-08-04
CN100393870C (en) 2008-06-11
US20080076177A1 (en) 2008-03-27
AU2004235813A1 (en) 2004-11-18
EP1620550A4 (en) 2006-06-14
US20050048074A1 (en) 2005-03-03
CA2524293A1 (en) 2004-11-18
NZ543348A (en) 2008-08-29
ATE473271T1 (en) 2010-07-15
AU2004235813B2 (en) 2010-07-29
AR044246A1 (en) 2005-09-07
US7132291B2 (en) 2006-11-07
DE602004028004D1 (en) 2010-08-19
EP1620550B1 (en) 2010-07-07

Similar Documents

Publication Publication Date Title
US7407802B2 (en) Vectors and cells for preparing immunoprotective compositions derived from transgenic plants
Yang et al. Expression of the fusion glycoprotein of newcasstle disease virus in transgenic rice and its immunogenicity in mice
US20040268442A1 (en) Stable immunoprophylactic and therapeutic compositions derived from transgenic plant cells and methods for production
US7964403B2 (en) Preparation of vaccine master cell lines using recombinant plant suspension cultures
EP0793717A1 (en) Oral immunization with transgenic plants
US20050166290A1 (en) Expression cassettes and methods for delivery of animal vaccines
Shahid et al. Early stage development of a Newcastle disease vaccine candidate in corn
Rosales-Mendoza et al. Transgenic carrot tap roots expressing an immunogenic F1–V fusion protein from Yersinia pestis are immunogenic in mice
Joensuu et al. Transgenic plants for animal health: plant-made vaccine antigens for animal infectious disease control
AU2002256205B2 (en) Methods and compositions for stable transgenic plant pharmaceuticals and their use as contraceptives
AU2002256205A1 (en) Methods and compositions for stable transgenic plant pharmaceuticals and their use as contraceptives
JP2005539039A (en) Use of Escherichia coli heat labile toxin as an adjuvant in birds and poultry
US20040175440A1 (en) Methods and compositions for stable transgenic plant pharmaceuticals and their use as contraceptives
Tian The use of transgenic tobacco as a production and delivery system for a vaccine against hemorrhagic enteritis virus of turkeys

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2004235813

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2524293

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 543348

Country of ref document: NZ

Ref document number: 1020057020819

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 200508930

Country of ref document: ZA

WWE Wipo information: entry into national phase

Ref document number: 2004751538

Country of ref document: EP

Ref document number: 20048120987

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 2004235813

Country of ref document: AU

Date of ref document: 20040504

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2004235813

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2004751538

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1020057020819

Country of ref document: KR

ENP Entry into the national phase

Ref document number: PI0410340

Country of ref document: BR