CN1326998C - Gene encoding hemagglutinin protein of H5 avian influenza virus and its application - Google Patents

Abstract

The present invention relates to an artificial synthetic gene optiHA containing chicken bias codons. The reading frame of the gene optiHA contains 1707 bp nucleotide, and 568 amino acids are totally encoded. The gene has a nucleotide consanguinity rate of 70% and an amino acid consanguinity rate of 100% with an H5 subtype high virulence avian influenza virus A/Goose/GuangDong/1/96(H5N1)(GD/1/96(H5N1)) hemagglutinin (HA) gene, and the hemagglutinin (HA) protein of H5 subtype avian influenza virus GD/1/96(H5N1) is encoded by the gene. The present invention simultaneously relates to the application of the gene as the immunogen gene of H5 subtype flu DNA vaccine and other kinds of genetically engineered vaccine.

Description

The gene and the application thereof of coding H5 subtype avian influenza virus hemagglutinin

Technical field

The present invention relates to a kind of gene optiHA that contains the inclined to one side preferendum codon of chicken body of synthetic, the nucleotide homology rate of this gene and H5 hypotype highly pathogenic avian influenza virus A/Goose/GuangDong/1/96 (H5N1) [GD/1/96 (H5N1)] hemagglutinin (HA) gene is 70%, the amino acid homology rate is 100%, hemagglutinin (HA) albumen of coding and expression H5 subtype avian influenza virus GD/1/96 (H5N1).This gene can be used as the immunogen gene of H5 subtype influenza dna vaccination and other recombinant vaccine.

Background technology

Bird flu (Avian Influenza, AI) be by avian influenza virus (Avian Influenza Virus, AIV) bird that causes infects and/or disease syndrome, AIV belongs on taxonomy: viral boundary (Vira)----orthomyxoviridae family (Orthomyxoviridae)----Influenza Virus (Influenza VirusA and B)----avian influenza virus (Avian Influenza Virus).

Highly pathogenicity avian influenza (Highly Pathogenic Avian Influenza, HPAI) classified as category-A deadly infectious disease (Alexander by World Organization for Animal Health, D.J, et al.An outbreak of highlypathogenic avian influenza in turkeys in Great Britain in 1991.VeterinaryRecord, 1993,132,535-536.).Discovered in recent years, H5 and H7 hypotype highly pathogenic avian influenza virus (Highly Pathogenic Avian Influenza Virus, HPAIV) not only can bring about great losses to aviculture, and can infected person and causing death, anti-system to HPAI is to concern that aviculture develops in a healthy way and key subjects (the Tran TH of human life's safety, et al.Avian influenza A (H5N1) in 10 patients in Vietnam.N Engl J Med.2004,350 (12): 1179-88.).Dna vaccination is one of recombinant vaccine of the tool potentiality of anti-system highly pathogenicity avian influenza, its antigen is synthetic similar to the natural infection of cause of disease with the process of offering, antigen protein is the transporte to cells surface after endogenous is synthetic, give immunity system by the direct submission of MHC-I class MHC-II quasi-molecule, can induce body to produce specific CTL reaction (Robinson HL.Nucleic acid vaccines:an overview.Vaccine, 1997,15:785-787).

Hemagglutinin (HA) is the main immunogen protein of avian influenza virus, it can induce body to produce antibody-mediated specific humoral immune response, thereby the antibody of anti-HA can combining or the viral infection that neutralizes of the fusion process of virus envelope and endocytosis body film by viral interference and sialic acid acceptor.Studies have shown that attack (the Robinson HL that can effectively protect same HA subtype influenza virus based on the dna vaccination of influenza virus HA gene in a large number; et al.Protection against a lethal influenzavirus challenge by immunization with a haemagglutinin-expressing plasmidDNA.Vaccine 1993; 11 (9): 957-60.2.Kodihalli S; et al.DNA vaccine encodinghemagglutinin provides protective immunity against H5N1 influenza virusinfection in mice.Virol.1999 Mar; 73 (3): 2094-8.3.Kodihalli S; et al.Strategies for inducing protection against avian influenza A virus subtypes withDNA vaccines.Vaccine.2000 May 22,18 (23): 2592-9.3).A/Goose/GuangDong/1/96 (H5N1) [GD/1/96 (H5N1)] be China's isolating the earliest H5 hypotype highly pathogenic avian influenza virus (Tang Xiuying etc. the evaluation of Chinese bird flu epidemic strain. Chinese livestock and poultry transmissible disease, 1998,20 (1): 1-5.).Studies show that; the dna vaccination plasmid pCIHA that expresses GD/1/96 (H5N1) HA gene has not only shown good immunogenicity; and effective protectiveness HI antibody of inducing generation (H Chen that can continue to a year; et al.DNA immunization elicitshigh HI antibody and protects chicken from AIV challenge.ImmuntionalCongress Series 1219 (2001) 917-921. Jiang Yong duckweeds. the optimization of antigen gene codon and expression vector thereof strengthens the immune protective effect [doctorate paper] of H5 subtype avian influenza dna vaccination. Harbin; Harbin Veterinary Medicine Inst., China Academy of Agriculture; 2004.); but, compare economic feasibility with traditional inactivated avian influenza vaccine and lack competitiveness because the dependency of H5 subtype avian influenza dna vaccination high dosage causes use cost to improve.With the codon optimized codon of having a liking for use partially for the immunization animal of allogenic immunogen gene can significantly improve dna vaccination antigen presentation efficient, (the Garmory HS that reduces effective immunizing dose, et al.DNA vaccines:improving expression ofantigens.Genet Vaccines Ther.2003 Sep 16,1 (1): 2.), and might break through the restriction bottleneck that dna vaccination is further applied.

Summary of the invention

An object of the present invention is to provide a kind of codon optimized gene optiHA (SEQ ID NO:1) of synthetic, this gene contains the codon that the chicken body is had a liking for use partially, hemagglutinin (HA) albumen (SEQ ID NO:2) of coding and expression H5 subtype avian influenza virus A/Goose/GuangDong/1/96 (H5Nl) [GD/1/96 (H5N1)], this gene can be used as the immunogen gene of H5 subtype avian influenza dna vaccination and other recombinant vaccine.

Another object of the present invention provides a kind of optiHA of comprising expression carrier.

Another object of the present invention provides a kind of host cell that is used to express the optiHA gene.Described host cell can be eukaryotic cells such as human embryonic kidney cell, COS cell, chick embryo fibroblast.

The invention still further relates to the application as immunogen gene in preparation H5 subtype influenza virus DNA vaccine of optiHA gene, in recombinant vaccines such as subunit vaccine, recombinant fowlpox virus recombinant vaccine as the application of immunogen gene, and in Monoclonal Antibody as the application of immunogen gene.

The present invention about the theoretical foundation of the codon optimized strategy of H5 subtype avian influenza dna vaccination immunogen gene have following some:

1) avian influenza virus surface tissue albumen HA is its topmost immunogen protein.

2) chicken and the former HA Argine Monohydrochloride of A type influenza virus protective immunity codon usage frequency exist notable difference.The Rolling of coded amino acid codon has caused cell between different plant species to have the inclined to one side preferendum that codon uses in the protein translation process.Because the translation efficiency that weakens, particularly corresponding tRNA content lack change with initiator codon, will influence proteinic translation initiation greatly and extend efficient (Hamdan FF, et al.Codon optimization improves heterologousexpression of a Schistosoma mansoni cDNA in HEK293 cells.Parasitol Res.2002 Jun, 88 (6): 583-6.Epub 2002 Feb 16.).Chicken has the inclined to one side preferendum of identical codon with mammalian cell in the protein translation process; but exist notable difference with the former HA Argine Monohydrochloride of A type influenza virus protective immunity codon usage frequency; in 20 amino acid; have only 6 amino acid to use identical codon; all the other 14 amino acid whose codon service conditions completely different (Holm L.Codon usage and gene expression.Nucleic Acids Res.1986 Apr11,14 (7): 3075-87.).

3) the codon optimized codon of having a liking for use partially for the immunization animal with allogenic immunogen gene can significantly improve antigen presentation efficient.The codon optimized codon of having a liking for use partially for the immunization animal of allogenic immunogen gene can be significantly improved antigen presentation efficient, and this result has obtained sufficient confirmation in the dna vaccination research of human immunodeficiency (acquired immune deficiency syndrome (AIDS)).Inclined to one side preferendum in view of most of slow virus structural protein encoding gene codon usage frequency substantial deviation mammalian cell codons, Haas J (Haas J, et al.Codon usage limitation in theexpression of HIV-1 envelope glycoprotein.Curr Biol.1996 Mar1,6 (3): 315-24.) grade is utilized the terminal overlapping oligonucleotide of synthetic, adopt overlapping pcr codon optimized human immunodeficiency virus (HIV) the MN strain gp120 gene of Mammals that increased, improved the vivoexpression level greatly, be used for the constructed dna vaccine, significantly strengthened specific cell and humoral immune reaction level.Remove Env glycoprotein, codon optimized HIVGag, Gag-pol, Tat, Rev and Nef are used for specific cell and humoral immune reaction (the Gao F that dna vaccination or recombinant virus live vector vaccine have been obtained remarkable improvement equally, et al.Codon usage optimization ofHIV type 1 subtype C gag, pol, env, and nef genes:in vitro expression andimmune responses in DNA-vaccinated mice.AIDS Res Hum Retroviruses.2003 Sep, 19 (9): 817-23.).Nearly all HIV recombiant vaccine has all adopted codon optimized immunogen gene at present.Codon optimized immunogen gene is at people's papilloma virus (Cid-Arregui A, et al.A synthetic E7 gene of human papillomavirus type 16that yields enhanced expression of the protein in mammalian cells and is usefulfor DNA immunization studies.J Virol.2003 Apr; 77 (8): 4928-37), papilloma virus (the Moore RA of dog, et al.Intraepithelial DNA immunisation with a plasmidencoding a codon optimised COPV E1 gene sequence, but not the wild-typegene sequence completely protects against mucosal challenge with infectiousCOPV in beagles.Virology.2002 Dec 20; 45 1-9.) and sars coronavirus (Gao W, et al.Effects of a SARS-associated coronavirus vaccine in monkeys.Lancet.2003 Dec 6 304 (2):; 362 (9399): 1895-6.) be applied in succession in the dna vaccination.The mechanism of codon optimized immunogen gene enhancing immunity reaction not only relates to translation process codon translational speed and accelerates.The optimization of codon mammalian metapneumovirus preferendum often causes increasing substantially of CG content among the mRNA, thereby thoroughly changes the secondary structure of RNA.The stability that this might increase on the one hand mRNA, also might increase on the other hand mRNA transcribe the back from nucleus to cytoplasmic transport efficacy.In addition, the increase of CG content also might increase the frequency of occurrences of CpG, further bring into play effect (McCluskie MJ, the et al.The use of CpG DNAas a mucosal vaccine adjuvant.Curr Opin Investig Drugs.2001Jan of the immunological adjuvant of dna vaccination own; 2 (1): 35-9.).

4) overlapping extension PCR [Overlap Extension PCR (OE-PCR)] technology is immunogen gene the simplest codon optimized a, basic strategies.The ultimate principle of overlap extension pcr is that two fragments of mutual complementary eclipsed (oligonucleotide fragment of growing into about 100bp can close in general gene Synesis Company) are placed same PCR reaction system, the primer (first segmental upstream primer and second segmental downstream primer) that adds the fragment both sides after control PCR condition is extended its complementation is again proceeded the PCR reaction and is obtained containing two segmental big fragments (Mehta RK, et al.Bridge-overlap-extension PCR method for constructing chimeric genes.Biotechniques.1999 Jun, 26 (6): 1082-6.).Codon optimized for immunogen gene, Haas J (Haas J, et al. Codon usage limitation in the expression of HIV-1envelope glycoprotein.Curr Biol.1996 Mar 1,6 (3): 315-24.) grade is utilized eclipsed primer and special restriction enzyme site, adopt increased 8 long oligonucleotide fragments of gp120 of round pcr, then with these 8 fragments sequentially subclone go up and synthetic and made up the gp120 gene to carrier pCdm7, after this this technology is adopted by most researchers.Kim CH (KimCH, et al.Codon optimization for high-level expression of humanerythropoietin (EPO) in mammalian cells.Gene.1997 Oct15,199 (1-2): 293-301.) grade utilizes overlap extension pcr (OE-PCR) technology to synthesize the sophisticated erythropoietin gene of people (EPO).8 of synthetic are long be 80-90bp oligonucleotide fragment mutually complementary overlapping 15-20bp so that the PCR reaction.At first place same PCR reaction system to carry out PCR respectively preceding 4 oligonucleotide fragments of synthetic and back 4 oligonucleotide fragments, by first round PCR, amplification has obtained half fragment of N-terminal and half fragment of C-terminal of coding EPO gene respectively, the small segment that then two PCR reaction systems is obtained mixes, and to carry out 5 circulations with the same PCR reaction conditions in front, to contain 5 of restriction enzyme site and EPO gene then ' adds with the primer of 3 ' end acomplementary connector sequence, further increases 30 again and circulate and obtained the EPO gene of total length.

Based on above some, we are, overlapping extension PCR (OverlapExtension PCR synthetic with oligonucleotide, OE-PCR) technology, digestion with restriction enzyme and interconnection technique and sequencing technologies obtain a kind of new codon optimized gene optiHA, the nucleotide homology rate of this gene and A/Goose/GuangDong/1/96 (H5N1) [GD/1/96 (H5N1)] HA gene is 70%, the amino acid homology rate is 100%, the HA albumen of coding H5 subtype avian influenza virus GD/1/96 (H5N1).The HA gene of this gene and avian influenza virus A/Goose/GuangDong/1/96 (H5N1) [GD/1/96 (H5N1)] is inserted CMV promoter expression vector pCI respectively, H5 subtype avian influenza dna vaccination plasmid pCIoptiHA (containing gene optiHA) that makes up and pCIHA (containing GD/1/96 (H5N1) HA gene) be transfection 293T cell respectively, and indirect immunofluorescence and Western-blot detect the outer transient expression level of the HA proteoplast that confirms codon optimized HA gene optiHA and be significantly higher than wild-type HA gene.Thereupon with pCIoptiHA and pCIHA respectively with 100 μ g and 10 μ g dosage immunity SPF chicken in 3 age in week once, attack with HPAIV GD/1/96 (H5N1) nasal of 100LD50 after 4 weeks, behind result's immunity SPF chicken, 100 μ g pCIoptiHA can form 75% immunoprotection, and 100 μ gpCIHA can form 50% immunoprotection; 10 μ g pCIoptiHA can form the partial immunity protection to immune chicken 75%, and 10 μ g pCIHA then can not form immunoprotection substantially; PCIoptiHA inductive HI antibody horizontal is higher than pCIHA far away.The result shows that the optimization of HA gene codon can significantly improve HA gene vivoexpression level and H5 subtype avian influenza dna vaccination inductive protection antibody immune response level, improves immunogenicity, enhancing immunity protection effect.

Description of drawings

Fig. 1 is according to the nucleotide sequence of optiHA gene of the present invention and corresponding amino acid sequence.

Fig. 2 is the pcr amplification product electrophoresis picture of fragment optiHAF1-optiHAF11, and wherein swimming lane 1 is DNA MarkerDL2000 (D501A, precious biotechnology engineering (Dalian) company limited); Swimming lane 2 is the PCR product of fragment optiHAF1, and size is 88bp; Swimming lane 3 is the PCR product of fragment optiHAF2, and size is 162bp; Swimming lane 4 is the PCR product of fragment optiHAF3, and size is 204bp; Swimming lane 5 is the PCR product of fragment optiHAF4, and size is 162bp; Swimming lane 6 is the PCR product of fragment optiHAF5, and size is 164bp; Swimming lane 7 is the PCR product of fragment optiHAF6, and size is 201bp; Swimming lane 8 is the PCR product of fragment optiHAF7, and size is 201bp; Swimming lane 9 is the PCR product of fragment optiHAF8, and size is 155bp; Swimming lane 10 is the PCR product of fragment optiHAF9, and size is 157bp; Swimming lane 11 is the PCR product of fragment optiHAF10, and size is 168bp; Swimming lane 12 is the PCR product of fragment optiHAF11, and size is 182bp.

Fig. 3 is the connection construction strategy of gene optiHA, 11 fragment optiHAF1-optiiHAF11 of optiHA gene utilize overlapping extension PCR method amplification by the synthetic oligonucleotide fragment respectively and are cloned on the pBluscript carrier, and the restriction enzyme sites that 11 segmental cloned plasmids pBluscript-optiiHAF1-pBluscriptoptiHAF11 utilizations are selected link to each other sequentially and construct the optiHA gene afterwards.

Fig. 4 is that the PCR of gene optiHA identifies picture, and wherein swimming lane 1 is DNA MarkerDL2000; Swimming lane 2 is periodic H2O contrast for PCR reflects, and swimming lane 3 is the PCR product of the 1.8kb size of gene optiHA.

Fig. 5 cuts the evaluation picture for the enzyme of gene optiHA, and wherein swimming lane 1 is DNA 1KbMarker (CD002, Beijing hump star biotechnology Engineering Co., Ltd); 1.0Kb that swimming lane 2 obtains when cutting with the PvuII enzyme for the plasmid pCIoptiHAFull that contains gene optiHA and two bands of 4.8kb; 1.6kb that swimming lane 3 obtains when cutting with the XhoI enzyme for plasmid pCIoptiHAFull and the band of 4.2kb; 1.2kb that swimming lane 4 obtains when cutting with the NotI enzyme for plasmid pCIoptiHAFull and the band of 4.6kb; The fragment of the linearizing 5.8kb that swimming lane 5 obtains when cutting with the EcoRI enzyme for plasmid pCIoptiHAFull; 300bp that swimming lane 6 obtains when cutting with the BamHI enzyme for plasmid pCIoptiHAFull and the band of 5.5kb; Swimming lane 7 is DNA Marker DL15000.

Fig. 6 is the restriction analysis collection of illustrative plates of plasmid pCIoptiHA, and wherein swimming lane 1 is DNA 1KbMarker (CD002, Beijing hump star biotechnology Engineering Co., Ltd); The fragment of the linearizing 5.8kb that swimming lane 2 obtains when cutting with the EcoRI enzyme for pCIoptiHA; The band of 1.2Kb, 530bp, 300bp and 3.87kb that swimming lane 3 obtains when cutting with the PstI enzyme for pCIoptiHA, swimming lane 4 are cut the 1.1kb that obtains and the band of 4.7kb for pCIoptiHA with the BglII enzyme.

Fig. 7 for plasmid pCIHA (in contrast) the transfection 293T cell of the HA gene of expressing A/Goose/GuangDong/1/96 (H5N1) [GD/1/96 (H5N1)] after 24h in fluorescent microscope (200 *) observed indirect immunofluorescence detected result down, express the proteic cell of HA and mainly be rendered as bright green at its cytolemma, the cell among the figure shown in the arrow is for expressing the proteic cell of HA.

Fig. 8 for the plasmid pCIoptiHA transfection 293T cell of expressing the optiHA gene after 24h in fluorescent microscope (200 *) observed indirect immunofluorescence detected result down, express the proteic cell of HA and mainly be rendered as bright green at its cytolemma, the cell among the figure shown in the arrow is for expressing the proteic cell of HA.

Fig. 9 for plasmid pCIHA (in contrast) the transfection 293T cell of the HA gene of expressing A/Goose/GuangDong/1/96 (H5N1) [GD/1/96 (H5N1)] after 48h in fluorescent microscope (200 *) observed indirect immunofluorescence detected result down, express the proteic cell of HA and mainly be rendered as bright green at its cytolemma, the cell among the figure shown in the arrow is for expressing the proteic cell of HA.

Figure 10 for the plasmid pCIoptiHA transfection 293T cell of expressing the optiHA gene after 48h in fluorescent microscope (200 *) observed indirect immunofluorescence detected result down, express the proteic cell of HA and mainly be rendered as bright green at its cytolemma, the cell among the figure shown in the arrow is for expressing the proteic cell of HA.

Figure 11 for the 293T cell to impinging upon observed indirect immunofluorescence detected result under the fluorescent microscope (200 *), all cells is not all expressed HA albumen, cell does not present bright green under fluorescent microscope.

Figure 12 is the SDS-PAGE picture of pCIoptiHA and pCIHA, and wherein swimming lane 1 is the 293T cell of transfection plasmid pCIHA; Swimming lane 2 is the 293T cell of transfection plasmid pCIoptiHA; Swimming lane 3 is H5 subtype avian influenza virus A/Goose/GuangDong/1/96 (H5N1) [GD/1/96 (H5N1)]; Swimming lane 4 is the contrast of 293T cell; Swimming lane 5 is the molecular weight of albumen standard.

Figure 13 is the Western blot analytical results picture of pCIoptiHA and pCIHA, and wherein swimming lane 1 is the contrast of 293T cell; Swimming lane 2 is the HA albumen of 74KDa for the size of H5 subtype avian influenza virus A/Goose/GuangDong/1/96 (H5N1) [GD/1/96 (H5N1)]; The size that swimming lane 3 is expressed in the 293T cell for plasmid pCIoptiHA is the HA albumen of 74KDa; The size that swimming lane 4 is expressed in the 293T cell for plasmid pCIHA is the HA albumen of 74KDa.

Embodiment

Hereinafter describe reference example in detail the present invention, described embodiment only is intended as illustrative explanation the present invention, rather than intention limits the scope of the invention.Scope of the present invention is specifically limited by accompanying Claim.

The source of raw materials used and test reagent in the embodiment of the invention:

(1) H5 hypotype highly pathogenic avian influenza virus (HPAIV) A/Goose/Guangdong/1/96 (H5N1) [being abbreviated as GD/1/96 (H5N1)] is available from the Harbin veterinary institute.

(2) (the Genebank accession number: AF144305), derived by nucleotide sequence by its aminoacid sequence from Genebank for the HA gene nucleotide series of A/Goose/Guangdong/1/96 (H5N1) [GD/1/96 (H5N1)].

(3) the 293T cell is human embryonic kidney cell (CRL-11268), from ATCC.

(4) recipient bacterium E.coli JM109 (D9025) is precious biotechnology engineering (Dalian) company limited product.

(5) plasmid pBluscript (212207) is a Stratagene company product.

(6) expression vector pCI (E1731, Genebank accession number: U47119) be Promega company product.

(7) Platinum ^Pfx Taq archaeal dna polymerase (11708-013) is an Ivitrogen company product.

(8) T4DNA polysaccharase (M0203S), T4DNA ligase enzyme (M0202S) are New EnglandBliolabs company product.

(9) SapI (R0569S) is a New England Bliolabs company product, and BglII (D1021A), PstI (D1073A), PvuII (D1076A), EcoO109I (D1043A), NotI (D1166A), SphI (D1180A), KpnI (D1068A), XhoI (D1094A), EcoRI (D1040A) and XbaI restriction enzymes such as (D1093A) are precious biotechnology engineering (Dalian) company limited product.

(10) glue reclaims (in a small amount) test kit (W5212), plasmid (in a small amount) extraction agent box (W5002) is Shanghai China Shun biotechnology company limited product.

(11) CEQ ^TMDTCS-QUICK StarKit (608120) is a Beckman company product.

(12) Perfectprep  Plasmid Mini (0032005.500) is an EppendorfAG company product.

(13) Lipofectamine ^TM2000 (11668-027) are Invitrogen company product.

(14) DMEM dry powder (12100-046) is GIBCO company product, and the 1 * DMEM that is mixed with pH7.2 with deionized water (prepares the NaHCO that the 1000ml nutrient solution need add 3.7g ₃HEPES with 2.4g) 4 ℃ of preservations of solution, face the time spent add final concentration be 10% foetal calf serum (26149-095, Gibco), 100U/ml penicillin and 100 μ g/ml Streptomycin sulphates.

(15) OPTi-MEM  I (51985-034) is Invitrogen company product for not containing the nutrient solution that is used for transfection of serum.

(16) H5 subtype avian influenza polyclone positive serum (lot number: 040524) be Harbin veterinary institute product.

(17) protein electrophoresis molecular weight standard (SM0431) is a brilliant U.S. biotechnology company limited product.

(18) (F8888 FITC-IgG) is Sigma company product to the anti-chicken IgG of fluorescently-labeled two anti-rabbits.

(19) (A9046 HRPO-IgG) is Sigma company product to the anti-chicken IgG of two of horseradish peroxidase-labeled anti-rabbits.

(20) DAB colouring reagents box (AR1022) is Wuhan Boster Biological Technology Co., Ltd.'s product.

Instar chicken embryo was available from veterinary institute experimental animal center, Harbin on (21st) 9～11.

(22) the specific pathogen free bacterium (Specific-pathogen-free, white SPF) comes the Hangzhoupro chicken available from veterinary institute experimental animal center, Harbin.

(23) other chemical reagent is Shanghai China Shun biotechnology company limited product.

The rewriting and the sequential analysis of the inclined to one side preferendum codon of embodiment 1. H5 hypotype HA gene chicken bodies

Utilize the codon usage frequency table (to see attached list 1, CSDL, life science discipline information door, codon uses database, network address is http://www.kazusa.or.jp/codon/), the codon of H5 subtype avian influenza virus A/Goose/Guangdong/1/96 (H5N1) [GD/1/96 (H5N1)] HA gene all is transformed to the inclined to one side preferendum codon of chicken body, and the sequence of writing out the HA gene (called after optiHA) after codon optimized, long 1779bp (SEQ ID NO:1, referring to Fig. 1), and the optiHA gene order carried out sequence and restriction enzyme site analysis with DNASTAR software (DNASTAR.Inc.), according to the single endonuclease digestion site that can select on the optiHA gene to utilize, the optiHA gene is divided into 11 fragments that are about 200bp, 11 fragments are called after optiHAF1 (sheet segment length 88bp successively, position on gene optiHA is 1-88), optiHAF2 (sheet segment length 162bp, position on gene optiHA is 81-243), optiHAF3 (sheet segment length 204bp, position on gene optiHA is 237-441), optiHAF4 (sheet segment length 162bp, position on gene optiHA is 436-597), optiHAF5 (sheet segment length 164bp, position on gene optiHA is 587-751), optiHAF6 (sheet segment length 201bp, position on gene optiHA is 744-944), optiHAF7 (sheet segment length 201bp, position on gene optiHA is 939-1139), optiHAF8 (sheet segment length 155bp, position on gene optiHA is 1134-1288), optiHAF9 (sheet segment length 157bp, position on gene optiHA is 1285-1441), optiHAF10 (sheet segment length 168bp, position on gene optiHA is 1436-1603), optiHAF11 (sheet segment length 182bp, the position on gene optiHA is 1598-1779).These 11 fragments are in selected overlapped and each self-contained selected single endonuclease digestion site, single endonuclease digestion site, and promptly 3 of fragment optiHAF1 ' 5 ' of end and fragment optiHAF2 holds the overlapped BglII sites of containing; 3 ' the overlapped PstI sites of containing of 5 ' end of end and fragment optiHAF3 of fragment optiHAF2; 3 ' the overlapped PvuII sites of containing of 5 ' end of end and fragment optiHAF4 of fragment optiHAF3; 3 ' the overlapped EcoO109I sites of containing of 5 ' end of end and fragment optiHAF5 of fragment optiHAF4; 3 ' the overlapped NotI sites of containing of 5 ' end of end and fragment optiHAF6 of fragment optiHAF5; 3 ' the overlapped SphI sites of containing of 5 ' end of end and fragment optiHAF7 of fragment optiHAF6; 3 ' the overlapped KpnI sites of containing of 5 ' end of end and fragment optiHAF8 of fragment optiHAF7; Fragment optiHAF8 3 ' 5 ' end of end and fragment optiHAF9 since do not have to select the single endonuclease digestion site and respectively fragment optiHAF8 3 ' 5 ' of end and fragment optiHAF9 holds and added SapI site recognition sequence (restriction enzyme site of this adding is not included in the sequence of Fig. 1) in addition; 3 ' the overlapped PvuII sites of containing of 5 ' end of end and fragment optiHAF10 of fragment optiHAF9; 3 ' the overlapped XhoI that contain of 5 ' end of end and fragment optiHAF11 of fragment optiHAF10.In 11 fragments, fragment optiHAF1 design directly utilizes the amplification of OE-PCR method synthetic by the oligonucleotide fragment of one section forward (5 '-3 '), and fragment optiHAF2-optiHAF11 utilizes the amplification of OE-PCR method to synthesize by two positive and negative two to, about 20bp that overlaps each other, the oligonucleotide fragment that is about 100bp respectively.

Subordinate list 1 chicken and the most inclined to one side codon of having a liking for of influenza virus

Amino acid	Chicken	Influenza virus
			Arginine Arg (R) leucine Leu (L) serine Ser (S) threonine Thr (T) proline Pro (P) alanine Ala (A) glycine Gly (G) valine Val (V) lysine Lys (K) glutamine Gln (Q) asparagine Asn (N) histidine (H) glutamic acid Glu (E)	CGC CUG AGC ACC CCC GCC GGC GUG AAG CAG AAC CAC GAG	AGA CUG UCA ACA CCA GCA GGA GUG AAA CAA AAU CAU GAA

Aspartic acid Asp (D) tyrosine Tyr (Y) cysteine Cys (C) phenylalanine Phe (F) isoleucine I1e (I) methionine Met (M) tryptophan Trp (W)

GAC UAC UGC UUC AUC AUG UGG

GAU UAU UGC UUC AUA AUG UGG

Embodiment 2. is used for the oligonucleotide fragment of OE-PCR and synthesizing of primer

The oligonucleotide fragment optiHAF1-Forward (101) of fragment optiHAF1 directly send by Sigma company synthetic; Two oligonucleotide fragments of fragment optiHAF2 are optiHAF2-Forward (90) and optiHAF2-Reverse (101); Two oligonucleotide fragments of fragment optiHAF3 are optiHAF3-Forward (110) and optiHAF3-Reverse (110); Two oligonucleotide fragments of fragment optiHAF4 are optiHAF4-Forward (99) and optiHAF4-Reverse (100); Two oligonucleotide fragments of fragment optiHAF5 are optiHAF5-Forward (97) and optiHAF5-Reverse (99); Two oligonucleotide fragments of fragment optiHAF6 are optiHAF6-Forward (110) and optiHAF6-Reverse (110); Two oligonucleotide fragments of fragment optiHAF7 are optiHAF7-Forward (110) and optiHAF7-Reverse (110); Two oligonucleotide fragments of fragment optiHAF8 are optiHAF8-Forward (91) and optiHAF8-Reverse (103); Two oligonucleotide fragments of fragment optiHAF9 are optiHAF9-Forward (97) and optiHAF9-Reverse (99); Two oligonucleotide fragments of fragment optiHAF10 are optiHAF10-Forward (99) and optiHAF10-Reverse (101); Two oligonucleotide fragments of fragment optiHAF11 are optiHAF11-Forward (107) and optiHAF11-Reverse (101).These oligonucleotide fragments all send by Sigma company synthetic (seeing attached list 2).

Subordinate list 2 synthetic oligonucleotide fragments

Segment number	The oligonucleotide fragment sequence
		optiHAF1- Forward(101)	AGCGAAAGCAGGGGTCCAATCTGTCAAAATGGAGA AGATCGTGCTGCTGCTGGCCATCGTGAGCCTGGTGA

optiHAF2- Forward(90) optiHAF2- Reverse(101) optiHAF3- Forward(110) optiHAF3- Reverse(110) optiHAF4- Forward(99) optiHAF4- Reverse(100) optiHAF5- Forward(97) optiHAF5- Reverse(99)

AGAGCGACCAGATCTGCAT CGGCTACCACG (SEQ ID NO：3) CCAGATCTGCATCGGCTACCACGCCAACAACAGCAC CGAGCAGGTGGACACCATCATGGAGAAGAACGTGAC CGTGACCCACGCCCAGGA (SEQ ID NO：4) GCCACGCTGCAGTCGCGCAGGATCAGGGGCTTCACG CCGTTCAGGTCGCACAGCTTGCCGTTGTGGGTCTTCT CCAGGATGTCCTGGGCGTGGGTCACGGT (SEQ ID NO：5) TGCAGCGTGGCCGGCTGGCTGCTGGGCAACCCCATG TGCGACGAGTTCATCAACGTGCCCGAGTGGAGCTAC ATCGTGGAGAAGGCCAGCCCCGCCAACGACCTGTGC TA (SEQ ID NO：6) CTGCTCTTGGGGATGATCTGGATCTTCTCGAAGTGGT TGGTGCGGCTCAGCAGGTGCTTCAGCTCCTCGTAGTC GTTGAAGTCGCCGGGGTAGCACAGGTCGTTGGCGGG (SEQ ID NO：7) CAAGAGCAGCTGGAGCAACCACGACGCCAGCAGC GGCGTGAGCAGCGCCTGCCCCTACCACGGCCGCAGC AGCTTCTTCCGCAACGTGGTGTGGCTGA (SEQ ID NO：8) TGCCCCACAGCACCAGCAGGTCCTCCTGGTTGGTGT TGTTGTAGCTGCGCTTGATGGTGGGGTAGGCGCTGTT CTTCTTGATCAGCCACACCACGTTGCG (SEQ ID NO：9) AGGAGGACCTGCTGGTGCTGTGGGGCATCCACCACC CCAACGACGCCGCCGAGCAGACCAAGCTGTACCAGA ACCCCACCACCTACATCAGCGTGGG (SEQ ID NO：10) CTCCATGCGGCCGCTCTGCCCGTTCACCTTGGGGCGG GTGGCGATCTCGGGCACCAGGCGCTGGTTCAGGGTG

optiHAF6- Forward(110) optiHAF6- Reverse(110) optiHAF7- Forward(110) optiHAF7- Reverse(110) optiHAF8- Forward(91) optiHAF8- Reverse(103) optiHAF9- Forward(97) optiHAF9- Reverse(99)

CTGGTGCCCACGCTGATGTAGGTGGT(SEQ ID NO：11) GCGGCCGCATGGAGTTCTTCTGGACCATCCTGAAGC CCAACGACGCCATCAACTTCGAGAGCAACGGCAACT TCATCGCCCCCGAGTACGCCTACAAGATCGTGAAGA AG (SEQ ID NO：12) CATGCTGCTGTTGATGGCGCCCATGGGGGTCTGGCAC TTGGTGTTGCAGTTGCCGTACTCCAGCTCGCTCTTCA TGATGGCGCTGTCGCCCTTCTTCACGATCTTGTAGG (SEQ ID NO：13) GCATGCCCTTCCACAACATCCACCCCCTGACCATCGG CGAGTGCCCCAAGTACGTGAAGAGCAACCGCCTGGT GCTGGCCACCGGCCTGCGCAACACCCCCCAGCGCGA G (SEQ ID NO：14) GTACCCGTACCAGCCGTCCACCATGCCCTGCCAGCCG CCCTCGATGAAGCCGGCGATGGCGCCGAACAGGCCG CGCTTCTTGCGGCGGCGCTCGCGCTGGGGGGTGTTG C (SEQ ID NO：15) GGTACGGGTACCACCACAGCAACGAGCAGGGCAGC GGCTACGCCGCCGACAAGGAGAGCACCCAGAAGGC CATCGACGGCGTGACCAACAA (SEQ ID NO：16) GCGGCGGCTCTTCCTCCAGGTTGTTGAACTCGCGGC CCACGGCCTCGAACTGGGTGTTCATCTTGTCGATGAT GCTGTTCACCTTGTTGGTCACGCCGTCGAT (SEQ ID NO：17) CAACCTGCTCTTCGGAGCGCCGCATCGAGAACCTGA ACAAGCAGATGGAGGACGGCTTCCTGGACGTGTGGA CCTACAACGCCGAGCTGCTGGTGCT(SEQ ID NO：18) GCGCAGCTGCAGGCGCACCTTGTCGTACAGGTTCTT CACGTTGCTGTCGTGGAAGTCCAGGGTGCGCTCGTT CTCCATCAGCACCAGCAGCTCGGCGTT (SEQ

optiHAF10- Forward(99) optiHAF10- Reverse(101) optiHAF11- Forward(107) optiHAF11- Reverse(101)

ID NO：19) GTGCGCCTGCAGCTGCGCGACAACGCCAAGGAGCTG GGCAACGGCTGCTTCGAGTTCTACCACAAGTGCGAC AACGAGTGCATGGAGAGCGTGAAGAAC (SEQ ID NO：20) TGCTCTCGAGCTTCACGCCGCTGATCTCCTCGCGGTT CAGGCGGGCCTCCTCGCTGTACTGGGGGTAGTCGTA GGTGCCGTTCTTCACGCTCTCCATGC (SEQ ID NO：21) GTGAAGCTCGAGAGCATGGGCACCTACCAGATCCTG AGCATCTACAGCACCGTGGCCAGCAGCCTGGCCCTG GCCATCATGGTGGCCGGCCTGAGCCTGTGGATGTG (SEQ ID NO：22) AGTAGACACAAGGGTGTTTTTAACTACAATCTGAACT CACAAATTTAGATGCAGATGCGGCACTGCAGGCTGC CGTTGCTGCACATCCACAGGCTCAGGCC(SEQ ID NO：23)

In addition, according to 2 oligonucleotide fragment sequences of fragment optiHAF2-optiHAF11, with reference to the sequence of fragment optiHAF2-optiHAF11, use Oligo 6.0 software (Wojciech﹠amp simultaneously respectively; Piotr Rychlik Copyright, Version 6.67) being designed for the upstream and downstream primer that OE-PCR increases, two primers of fragment optiHAF2 are optiHAF2-Forward-5 ' and optiHAF2-Reverse-5 '; Two primers of fragment optiHAF3 are optiHAF3-Forward-5 ' and optiHAF3-Reverse-5 '; Two primers of fragment optiHAF4 are optiHAF4-Forward-5 ' and optiHAF4-Reverse-5 '; Two primers of fragment optiHAF5 are optiHAF5-Forward-5 ' and optiHAF5-Reverse-5 '; Two primers of fragment optiHAF6 are optiHAF6-Forward-5 ' and optiHAF6-Reverse-5 '; Two primers of fragment optiHAF7 are optiHAF7-Forward-5 ' and optiHAF7-Reverse-5 '; Two primers of fragment optiHAF8 are optiHAF8-Forward-5 ' and optiHAF8-Reverse-5 '; Two primers of fragment optiHAF9 are optiHAF9-Forward-5 ' and optiHAF9-Reverse-5 '; Two primers of fragment optiHAF10 are optiHAF10-Forward-5 ' and optiHAF10-Reverse-5 '; Two primers of fragment optiHAF11 are optiHAF11-Forward-5 ' and optiHAF11-Reverse-5 '.OptiHAF1-Forward (101) fragment is only designed its upstream primer optiHAF1-Forward-5 ', and all primers all send by Sigma company and directly synthesize (seeing attached list 3).

Subordinate list 3 is used for the primer of OE-PCR

The primer title	Primer sequence
		optiHAF1-Forward-5’	AGCGAAAGCAGGGGTCCAATCTGTCA (SEQ ID NO：24)
optiHAF2-Forward-5’	CCAGATCTGCATCGGCTACCACGCCA (SEQ ID NO：25)
		optiHAF2-Reverse-5’	GCCACGCTGCAGTCGCGCAGGATCA (SEQ ID NO：26)
optiHAF3-Forward-5’	GACTGCAGCGTGGCCGGCTGGCTGCTG (SEQ ID NO：27)
		optiHAF3-Reverse-5’	CCAGCTGCTCTTGGGGATGATCTGGATC (SEQ ID NO：28)
optiHAF4-Forward-5’	CAAGAGCAGCTGGAGCAACCACGA (SEQ ID NO：29)
		optiHAF4-Reverse-5’	TGCCCCACAGCACCAGCAGGTCCTC (SEQ ID NO：30)
optiHAF5-Forward-5’	AGGAGGACCTGCTGGTGCTGTGG (SEQ ID NO：31)
		optiHAF5-Reverse-5’	CTCCATGCGGCCGCTCTGCCCGTTC (SEQ ID NO：32)
optiHAF6-Forward-5’	GAGCGGCCGCATGGAGTTCTTCTGGAC(SEQ ID NO：33)
		optiHAF6-Reverse-5’	GGCATGCTGCTGTTGATGGCGCCCATG(SEQ ID NO：34)
optiHAF7-Forward-5’	CAGCATGCCCTTCCACAACATCCAC (SEQ

	ID NO：35)
		optiHAF7-Reverse-5’	GTGGTACCCGTACCAGCCGTCCACCA (SEQ ID NO：36)
optiHAF8-Forward-5’	GGTACGGGTACCACCACAGCAACGA (SEQ ID NO：37)
		optiHAF8-Reverse-5’	GCGGCGGCTCTTCCTCCAGGTTGT (SEQ ID NO：38)
optiHAF9-Forward-5’	CAACCTGCTCTTCGGAGCGCCGCAT (SEQ ID NO：39)
		optiHAF9-Reverse-5’	GCGCAGCTGCAGGCGCACCTTGTC (SEQ ID NO：40)
optiHAF10-Forward-5’	GTGCGCCTGCAGCTGCGCGACAAC (SEQ ID NO：41)
		optiHAF10-Reverse-5’	TGCTCTCGAGCTTCACGCCGCTG (SEQ ID NO：42)
optiHAF11-Forward-5’	GTGAAGCTCGAGAGCATGGGCAC(SEQ ID NO：43)
		optiHAF11-Reverse-5’	AGTAGACACAAGGGTGTTTTTAACTAC (SEQ ID NO：44)

OE-PCR amplification, clone and the order-checking of an embodiment 3.optiHA gene 11 fragment optiHAF1-optiHAF11 are identified

11 fragment optiHAF1-optiHAF11 use Platinum respectively ^The amplification of Pfx Taq archaeal dna polymerase.At first in the PCR pipe, add 10X Pfx Taq polymerase buffer 10ul successively, 2.5mmoldNTPs 4ul, Pfx Taq archaeal dna polymerase 1ul (1-2U) and corresponding each 10ul of forward and reverse oligonucleotide fragment (only adding the forward oligonucleotide fragment) for optiHAF1, after the sterilization deionized water is supplied 100ul, 95 ℃ of 5min, 48 ℃～55 ℃ annealing 1min, 72 ℃ of 5min add 20pmol again corresponding on each oligonucleotide fragment after 5 circulations, each 1ul of downstream primer (subordinate list 3) goes up amplification (only adding upstream primer for optiHAF1) at PTC-100 gene-amplificative instrament (M.J.Research.inc).The reaction conditions of OE-PCR is 48 ℃ of 1min, 72 ℃ of 1.5min, 30 circulations, last 72 ℃ of 5min extend, get 5ul PCR product electrophoretic examinations amplification on 1% sepharose, the size of fragment optiHAF1-optiHAF11 respectively is: 88bp, 162bp, 204bp, 162bp, 164bp, 201bp, 201bp, 155bp, 157bp, 168bp and 182bp (see figure 2).

11 segmental PCR products are reclaimed (in a small amount) test kit specification sheets operation steps according to glue to be reclaimed, clone SmaI site afterwards respectively in the pBluscript carrier, 4 clones of difference picked at random behind the transformation receptor bacterium E.coliJM109, extract plasmid according to plasmid (in a small amount) extraction agent box specification sheets, be dissolved in the sterilization deionized water of 50 μ L, use CEQ ^TMDTCS-QUICK Star Kit carries out the order-checking pre-treatment of plasmid DNA template, concrete steps are as follows: 11 segmental cloned plasmids and the 6 μ L sterilization deionized water with 1 μ L mixes respectively, 96 ℃ were heated 1-3 minute, naturally cold adds T3 primer (T3:ATTAACCCTCACTAAAGGGAA after room temperature, SEQ ID NO:45) 1 μ l (5pmol/ μ l) and DTCS Quick Start Master Mix 2 μ l, the PCR that checks order behind mixing reaction, the PCR response procedures is: 96 ℃ of 20sec, 50 ℃ of 20sec, 60 ℃ of 4min, 35 circulations remain on 4 ℃ at last.PCR has reacted reaction terminating liquid (the NaOAC 2ul of 3M PH5.2 that the back adds 2.5ul, the EDTA 2ul of 100mM PH8.0, the Glycogen 1ul of 20mg/ml, instant joining) termination reaction, add 30ul 95% ice ethanol sedimentation DNA then, mixing, 4 ℃, the centrifugal immediately 20min of 12000rpm.After carefully outwelling supernatant, with the residual salt of 100～200ul, 70% ice twice wash-out of ethanol, 4 ℃, the centrifugal 5min of 12000rpm.After vacuum is drained or room temperature dries DNA,, carefully add in the CEQ sample plate hole, add a dropstone wax oil at last in the sample plate hole with the abundant dissolving DNA precipitation of 30ul methane amide.Adopt dideoxy chain termination at BechmanCEQ8000 sequenator (Bechman immediately, America) upward clone's recombinant plasmid is checked order, utilize DNASTAR software (DNASTAR.Inc.) that the sequence that obtains is analyzed afterwards, as a result among segmental 4 clones of each of institute's picking, 1-2 positive clone arranged respectively, and positive colony is called after pBluscript-optiHAF1 to pBluscript-optiHAF11 successively.

The connection construction strategy of embodiment 4. gene optiHA

11 segmental positive plasmid pBluscript-optiHAF1 to pBluscript-optiHAF11 that sequence verification among the embodiment 3 is good according to single endonuclease digestion site selected among the embodiment 1 by the following method and the order, use routine techniques successively enzyme cut connection: (1) mends after with pBluscript-optiHAF 1 usefulness XbaI enzyme cutting flat with the klenow enzyme, the BglII enzyme is cut the back and is reclaimed the big or small fragment of 2700bp that is, it is the fragment of 160bp that pBluscript-optiHAF2 is reclaimed size after with BglII and EcoRV double digestion, then two fragments that reclaimed are linked to each other and be connected into the plasmid pBluseript-optiHAF1-2 that contains optiHAF1 and optiHAF2, connect into pBluscript-optiHAF1-2-3 after pBluscript-optiHAF1-2 and pBluscript-optiHAF3 cut with PstI and HindIII enzyme respectively, will cut with the SacI enzyme again, the T4 archaeal dna polymerase is mended the pBluscript-optiHAF1-2-3 after gentle EcoRI handles and is cut with the KpnI enzyme, the klenow enzyme is mended carrier pCI after gentle EcoRI handles and is connected and obtains pCI-optiHAF1-2-3; (2) after being cut with NotI and HindIII enzyme respectively, pBluscript-optiHAF5 and pBluscript-optiHAF6 connect into pBluscript-optiHAF5-6, connect into pBluscript-optiHAF5-6-7 after pBluscript-optiHAF5-6 and pBluscript-optiHAF7 cut with SphI and BamHI enzyme respectively, connect into pBluscript-optiHAF4-5-6-7 after again pBluscript-optiHAF5-6-7 and pBluscript-optiHAF4 being cut with EcoO109I and BamHI enzyme respectively; (3) earlier with pBluscript-optiHAF9 and carrier pCI respectively with connecting into pCIoptiHAF9 after XbaI and the EcoRI processing, connect into pCIoptiHAF8-9 after pCI-optiHAF9 and pBluscript-optiHAF8 cut with SapI and EcoRI enzyme respectively, connect into pBluscript-optiHAF10-11 after pBluscript-optiHAF10 and pBluscript-optiHAF11 cut with BamHI and EcoRI enzyme respectively, again with pCI-optiHAF8-9 and pBluscript-optiHAF10-11 respectively with connecting into pCI-optiHAF8-9-10-11 behind PstI and the XbaI enzyme cutting; (4) with pCI-optiHAF1-2-3 and pBluscript-optiHAF4-5-6-7 respectively with connecting into pCI-optiHA1-2-3-4-5-6-7 behind PvuII and the XbaI enzyme cutting, again with pCI-optiHAF8-9-10-11 and pCI-optiHAF1-2-3-4-5-6-7 respectively with the plasmid pCI-optiHAFull (connection strategy is seen Fig. 3) that connects into the optiHA gene that contains total length behind KpnI and the XbaI enzyme cutting.

The PCR of embodiment 5. gene optiHA identifies and restriction analysis

The plasmid pCIoptiHAFull that contains the optiHA gene is with the upstream primer on the pCI: pCI-up:5 '-ACTTAATACGACTCACTATA-3 ' (SEQ ID NO:46); The downstream primer of gene: 5 ' CCACTCTAGAGTGTTTTTAACTACAA-3 ' (SEQ ID NO:47) carry out PCR to be identified, the PCR condition is: 94 ℃ of 5min, 94 ℃ of 1min, 50 ℃ of 1min, 72 ℃ of 1.5min, 35 circulations, last 72 ℃ of 10min extend, and the PCR product carried out sepharose (1%) electrophoresis, the result has obtained being about the band of 1.7kb, with the consistent (see figure 4) of clip size of A/Goose/Guangdong/1/96 (H5N1) [GD/1/96 (H5N1)] HA gene.Specification sheets according to restriction enzyme, plasmid pCIoptiHAFull is carried out enzyme cut processing, and enzyme is cut product carry out sepharose (1%) electrophoresis, the result, two bands of 1.0Kb and 4.8kb have been obtained when cutting with the PvuII enzyme, cut the band that has obtained 1.6kb and 4.2kb with the XhoI enzyme, cut the band that has obtained 1.2kb and 4.6kb with the NotI enzyme, obtained the fragment of linearizing 5.8kb when cutting with the EcoRI enzyme, obtained the band of 300bp and 5.5kb when cutting with the BamHI enzyme, the gained result all with the consistent (see figure 5) of analytical results to the optiHA gene order (SEQ ID NO:1) of being write.

The sequence verification of embodiment 6. gene optiHA

The plasmid pCIoptiHAFull that will contain the optiHA gene extracts according to plasmid (in a small amount) extraction agent box specification sheets, uses CEQ ^TMDTCS-QUICK Star Kit carries out the order-checking pre-treatment of plasmid DNA template, concrete steps are as follows: respectively the plasmid pCIoptiHAFullDNA template of 1ul and 6ul sterilization deionized water are mixed in 5 PCR pipes, 96 ℃ were heated 1-3 minute, and cold adds pCI-up:5 '-ACTTAATACGACTCACTATA-3 ' (SEQ IDNO:48) respectively successively after room temperature naturally; Opt-wlp:5 '-GCACCAACCACTTCGAGA-3 ' (SEQ ID NO:49); Opt-wlf:5 '-GCTACCACGCCAACAACAGC-3 ' (SEQ ID NO:50); Opt-w2p:5 '-GAAGAGCGAGCTGGAGTAC-3 ' (SEQ ID NO:51); Opt-w3p:5 '-GCAGATGGAGGACGGCTTCCT-3 ' (SEQ ID NO:52); PCI-lower:5 '-TGCAGCTTATAATGGTTACA-3 ' (SEQ ID NO:53) 1 μ l (5pmol/ μ l) and DTCS Quick Start Master Mix 2 μ l, the PCR that checks order behind mixing reaction, the PCR response procedures is: 96 ℃ of 20sec, 50 ℃ of 20sec, 60 ℃ of 4min, 35 circulations remain on 4 ℃ at last.PCR has reacted reaction terminating liquid (the NaOAC 2ul of 3M PH5.2 that the back adds 2.5ul, the EDTA 2ul of 100mM PH8.0, the Glycogen 1ul of 20mg/ml, instant joining) termination reaction, add 30ul 95% ice ethanol sedimentation DNA then, mixing, 4 ℃, the centrifugal immediately 20min of 12000rpm.After carefully outwelling supernatant, with the residual salt of 100～200ul, 70% ice twice wash-out of ethanol, 4 ℃, the centrifugal 5min of 12000rpm.After vacuum was drained or room temperature dries DNA, with the abundant dissolving DNA precipitation of 30ul methane amide, the sample in each PCR pipe carefully joined respectively in the CEQ sample plate hole, adds a dropstone wax oil at last in the sample plate hole.Dideoxy chain termination carries out sequence verification to the gene optiHA that optimizes on the BechmanCEQ8000 sequenator, through order-checking, constructed optiHA gene is in full accord with the optiHA gene order of being write (SEQ ID NO:1), the gene length overall is 1779bp, reading frame contains Nucleotide 1707bp, 568 amino acid of encoding altogether (SEQ ID NO:2).

The structure of embodiment 7. gene optiHA expression plasmid pCIoptiHA

The optiHA gene that from plasmid pCIoptiHAFull, only contains open reading frame (ORF) with Auele Specific Primer (upstream: 5 ' TCAAAATGGAGAAGATCGTGCT-3 ' (SEQID NO:54), downstream: 5 ' CCACTCTAGAGTGTTITTAACTACAA-3 ' (SEQ IDNO:55)) with the amplification of Pfx Taq archaeal dna polymerase.In the PCR pipe, add 10X Pfx Taq polymerase buffer 10ul successively, 2.5mmol dNTP s4ul, Pfx Taq archaeal dna polymerase 1ul (1-2U), plasmid pCIoptiHAF1 ul and corresponding upstream and downstream primer 1ul, the sterilization deionized water is supplied 100ul, amplification condition is: 94 ℃ of 5min, 94 ℃ of 1min, 58 ℃ of 1min, 72 ℃ of 1.5min, 35 circulations, last 72 ℃ of 10min extend, the PCR product is cut the back directed cloning with the thorough enzyme of XbaI to be mended flat to cut the back with the KpnI enzyme with the klenow enzyme, again among the plasmid vector pCI with the XbaI enzyme cutting processing, obtain plasmid pCIoptiHA, the plasmid pCIoptiHA that builds is carried out enzyme cut evaluation, and enzyme is cut product carry out sepharose (1%) electrophoresis, the result, plasmid pCIoptiHA has obtained the fragment of linearizing 5.8kb when cutting with the EcoRI enzyme, obtained 1.2Kb when cutting with the PstI enzyme, 530bp, the band of 300bp and 3.87kb, cut the band that has obtained 1.1kb and 4.7kb with the BgIII enzyme, the gained result all with the consistent (see figure 6) of analytical results to constructed optiHA gene order (SEQ ID NO:1).

Embodiment 8. expression of gene optiHA in the 293T cell

Transfection with plasmid pCIoptiHA and pCIHA (in contrast, will contain avian influenza virus A/Goose/GuangDong/1/96 (H5N1) [GD/1/96 (H5N1)] HA gene cloned plasmids pBH5 (the ageing orchid, Yu Kangzhen, the step CHIGO.The analysis of one strain goose source highly pathogenic avian influenza virus strain isolated hemagglutinin gene.Scientia Agricultura Sinica, 1999,32 (2): 87-92.)) through the EcoRI enzyme cut, the klenow enzyme is mended flat and the SalI enzyme is cut the back and downcut the HA gene fragment, the CMV promoter expression vector pCI that insertion SalI and SmaI enzyme are cut and construct expression plasmid pCIHA) extract according to Perfectprep  Plasmid Mini operation steps.293T cell (human embryonic kidney cell) is incubated in the Tissue Culture Flask with the DMEM nutrient solution that contains 10% foetal calf serum earlier, passes in six orifice plates after 5 generations of continuous passage are above, places 37 ℃ of 5%CO ₂Cultivate in the incubator.Treat that the 293T cell grows to 60%～80% when being paved with, and presses Lipofectamine ^TM2000 test kit working instructions carry out transfection, detect the HA albumen of its expression after the transfection by indirect immunofluorescence and Western blot.

8.1 indirect immunofluorescence detects

When 24h, 48h, carry out indirect immunofluorescence and detect behind plasmid pCIoptiHA (pCIHA in contrast) the transfection 293T cell, establish the 293T cell negative control of untransfected plasmid simultaneously.With 70% ethanol fixedly behind the 20min-30min, seasoning.(0.01mol/L, pH7.4) after the washing, (0.01mol/L, pH7.4) 20 times of dilutions drip in the zone that 6 orifice plates central authorities select, 37 ℃ of effect 45min with PBS to get H5 subtype avian influenza polyclone positive serum with PBS.With PBS washing three times, each 5min washes the back and dashes once seasoning with deionized water again.The anti-chicken IgG of rabbit (FITC-IgG) that gets the FIFC mark uses the PBS that contains azovan blue (1/104), and (0.01mol/L, pH7.4) 100 times of dilutions drip in the zone that 6 orifice plates central authorities select, 37 ℃ of effect 45min.Use afterwards PBS (0.01mol/L, pH7.4) washing is three times, with after the deionized water desalination, seasoning.Drip alkaline glycerine (pH9.8), observe down in fluorescent microscope (Leica DMIRE2).The result, plasmid pCIoptiHA and pCIHA are behind transfection 293T cell, through indirect IF staining, the HA protein product of expression mainly is distributed on the cytolemma, and presents the special fluorescence (shown in arrow among Fig. 7,8,9 and 10) of bright green under fluorescent microscope.24h all can express H5 subtype HA protein (seeing Fig. 7 and Fig. 8) behind 2 kinds of plasmid transfection 293T cells, and 48h after transfection can express the proteic cell count of HA and obviously (see Fig. 9, Figure 10) than the many of 24h.24h and 48h after transfection, the expression level of the gene optiHA of optimization all (see Fig. 8, Figure 10) apparently higher than wild-type HA expression of gene level.The 293T cell contrast (seeing Figure 11) of untransfected plasmid does not see that special luciferase expression product is arranged.

8.2 Western blot detects

Carry out the SDS-PAGE electrophoresis with the sample for preparing after the 293T cell of 48h behind the plasmid transfection and H5 subtype avian influenza virus GD/1/96 (H5N1) cracking, transfer to afterwards and carry out Western blot with H5 subtype avian influenza polyclone positive serum on nitrocellulose (NC) film and detect 2 kinds of AIV HA albumen that plasmid is expressed.

8.2.1 SDS-PAGE electrophoresis

Specimen preparation

Results 293T cell behind plasmid pCIoptiHA (pCIHA in contrast) transfection 48h, give a baby a bath on the third day after its birth time with PBS (pH7.4), 2 * SDS electrophoretic buffer the lysing cell that adds the preheating of amassing with cell harvesting liquid isoploid, collect in the 1.5ml Eppendorf tube, place boiling water to boil 10min the abundant sex change of protein sample is got final product.H5 subtype avian influenza virus GD/1/96 (H5N1) is as positive control, and allantoic fluid is collected in the breeding back in SPF chicken embryo, and the preparation process of its SDS-PAGE electrophoresis sample is the same.

Gel casting and electrophoresis

Prepare 10% separation gel respectively, 5% concentrated glue by described the recording of " molecular cloning experiment guide " (second edition) (beautiful J. Sa nurse Brooker etc. is write, and Jin Dongyan etc. translate, 2002, Science Press), is recorded two clotting glue simultaneously.After treating its polymerization, add the sample and the 293T cell that prepare behind the 293T cell, H5 subtype avian influenza virus GD/1/96 (H5N1) cracking of 48h behind the 293T cell, plasmid pCIHA transfection of 48h after the 10ul plasmid pCIoptiHA transfection respectively with micropipet, add protein electrophoresis molecular weight standard (SM0431 simultaneously, the U.S. biotechnology of crystalline substance company limited) compares, first 80V electrophoresis on BIO-RAD vertical electrophoresis groove, treat that sample enters that to adjust voltage behind the separation gel be 120V, treats that dyestuff stops electrophoresis when moving to the gel bottom.Wherein a gel places 0.25% coomassie brilliant blue staining liquid (0.25%R250,40% methyl alcohol, 10% ethanol) 2 hours, with destainer (40% methyl alcohol, 10% acetate) decolouring, the band of the 293T cell of transfection plasmid is consistent with the band of 293T cell contrast as a result, and the different protein band high-visible (seeing Figure 12) of influenza virus contrast.Another gel places transfer device, is used for Western-blot and detects.

8.2.2 Western blot detects

Electrotransfer

Be cut into gel 6 Whatman filter paper and NC film onesize, at transfering buffering liquid (48mmol/L Tris, the 39mmol/L glycine, soak 5min 0.037%SDS), by 3 filter paper, the NC film, gel, the order of 3 filter paper will rise successively and be stacked together, place each layer and all will remove bubble between them, press NC film side by anode, the gel side puts it in the transfer groove by negative electrode, at TRANS-BLOT SD (Semi-dry Transfer Cell BIO-RAD) transfer device 22V electrotransfer 45min, take out the NC film, perform mark, be sandwiched in drying at room temperature 30min between the filter paper.The 22V electricity changes 45min (the cellulose membrane side is by anodal, and the glue side is by negative pole) then.Transfer printing finishes, and takes out the NC film and performs mark with pencil on film.Be sandwiched between the two layers of filter paper drying at room temperature 30min.

Immunodetection

The NC film is placed in the plate, adds confining liquid (0.02% sodium azide, 1% (w/v) BSA is dissolved in PBS), soaked film and get final product, 2-3h gently shakes under the room temperature.Wash 3 times with PBS then, adding H5 subtype avian influenza polyclone positive serum acts on 4-5h as 4 ℃ of one anti-(with PBS dilution in 1: 100) or spends the night, wash 3 times with PBS again, Buffer I (150mmol/L NaCl, 50mmol/L Tris.ClpH7.5) washes 10min, add 37 ℃ of effect 2h of the anti-chicken IgG of rabbit (HRPO-IgG) (doing the 1:1000 dilution) of horseradish peroxidase-labeled with the Buffer I that contains 1%BSA.Wash 3 times with Buffer I, Buffer II (10mmol/L Tris.Cl pH7.5,150mmol/L NaCl) wash once, the surplus liquid that exhausts was with DAB colouring reagents box (comprising DAB * 20 times concentrated solution, H2O2 * 20 times concentrated solution, TBS * 20 times concentrated damping fluid) colour developing 3 minutes.Colour developing finishes, and adds 0.5mM EDTA (pH8.0) color development stopping.

2 kinds of plasmids all can detect the albumen that molecular weight is about 74Kda as a result, and the gene optiHA of optimization is than wild-type HA expression of gene higher level (seeing Figure 13).

Embodiment 9. expresses the immunoprotection test of the plasmid pCIoptiHA of optiHA to the SPF chicken

9.1 immunoprotection test

With 3 the week age SPF chicken be divided into 5 groups at random, 4 or 5/group.Use pCIHA 100 μ g immunity, divide 2 intramuscular injection, 200 μ l the pCIHA of 0.5 μ g/ μ l for the 1st group through shank.The 2nd group is pCIHA10 μ g immune group, divides 2 intramuscular injection, 200 μ l the pCIHA of 0.05 μ g/ μ l through shank; The 3rd group is pCIoptiHA 100 μ g immunity, and immunization method is with the 1st group, and the 4th group is pCIoptiHA 10 μ g immunity, and immunization method is with the 2nd group.The 5th group is control group, injects 200 μ l PBS solution.Use HPAIVA/Goose/Guangdong/1/96 (H5N1) [GD/1/96 (H5N1)] the via intranasal application approach of 100LD50 to infect in dna vaccination plasmid 4 weeks behind single immunization respectively for two kinds, 0.1ml/ only, attack morbidity and the death condition of observed and recorded chicken in 2 weeks of poison back interior every day, and according to death toll statistics mortality ratio.To every group of chicken in gathering its wing venous blood weekly after the immunity He after attacking poison, separation of serum adopts hemagglutination-inhibition test (HI) (high pathogenic avian influenza diagnostic techniques (GB/T/18936-2003)), agar diffusion test (AGP) (high pathogenic avian influenza diagnostic techniques (GB/T/18936-2003)) to measure its corresponding HI antibody and AGP antibody titers respectively.Attacking the poison back the 3rd day, the 5th day and gathering cloaca swab and the larynx swab of every group of chicken on the 7th day, use PBS solution from 10 each swab ^-1To 10 ^-6Extent of dilution is done 10 times of serial dilutions, each extent of dilution is through 3 pieces of instar chicken embryos on the 9th～11 of allantoic cavity inoculation, 0.1ml/ piece, 48h collects allantoic fluid, Microhemagglutination method (high pathogenic avian influenza diagnostic techniques (GB/T/18936-2003)) detects virus, and according to its different dilution blood clotting result Reed; Muench method (work such as Yin Zhen, animal virology, second edition, 1997, Science Press, 329.) is calculated its viral isolating titre.

9.2 test-results

9.2.1 the HI antibody response behind immunity and the strong virus attack

PCIHA and pCIoptiHA are respectively with after 100 μ g and the 10 μ g dosage immunity once, and the antibody of immune chicken changes positive situation and antibody horizontal is obviously different.100 μ g pCIHA, 3 weeks after immunity have only 1 chicken can detect antibody, there were 2 chickens to detect antibody in 2 weeks after the 100 μ g pCIoptiHA immunity, the immunity back only had 1 chicken not have antibody in 4 weeks, do not detect antibody after the 10 μ g pCIHA immunity, and had 2 chickens to detect antibody after the 10 μ g pCIoptiHA immunity in 2 weeks; PCIoptiHA with 100 μ g and 10 μ g single immunizations after inductive HI antibody horizontal be higher than HI antibody horizontal (seeing Table 4) after the same dose pCIHA immunity far away.

The dynamic change of HI antibody (log2) after HI antibody changes positive situation and immunity and attacks poison behind table 4.pCIHA and the pCIoptiHA single immunization

Group	Immunogen	Dosage	Immunity back (week)								Attack poison back (week)
														1		2		3		4 *		1	2
1			pCIHA	100μg	0/4	0	0/4	0	1/4	0.6±1.3	1/4	1.0±2.0												2.3±1.5	5.8±1.1
	2	pCIHA											10μg	0/5	0	0/5	0	0/5	0	0/5	0	-	-
3			pCIoptiHA	100μg	0/4	0	2/4	2.0±2.8	3/4	3.1±2.9	3/4	3.5±3.5												4.0±2.0	7.0±1.7

4	pCIoptiHA	10μg	0/4	0	2/4	1.8±2.4	2/4	2.4±2.8	2/4	1.9±±2.6	3.0±3.0	5.0±2.6
													5	Contrast	-	0/5	0	0/5	0	0/5	0	0/5	0	-	-

Annotate: antibody changes positive method for expressing and changes positive chicken number/immune chicken sum for HI antibody ,-be illustrated in and attack all death of mould back chicken group.* attack poison around the immunity back the.

9.2.2 morbidity and death condition statistics and AGP antibody test

After GD/1/96 (H5N1) HPAIV attacked, all contrast chickens were all dead in 2 to 7 days after attacking poison.PCIoptiHA 100 μ g once have 1 chicken morbidity and dead after the immunity, and its dead protection ratio is 75%, and pCIHA 100 μ g singly exempt from group dead 2 chickens in 11 days after virus attack; The protection ratio of pCIoptiHA10 μ g is 75%, and it is dead 4 chickens that pCIHA 10 μ g singly exempt to organize within 7 days after the virus attack, and other 1 chicken is being attacked poison back death in the 11st day.The serum AGP antibody test of immunity back is all negative; Attacking the poison back during 2 weeks, pCIHA 100 μ g singly exempt from have 1 chicken AGP antibody positive in the group, the AGP antibody test all negative (seeing Table 5) of other all survival chickens.

Table 5.pCIHA and pCIoptiHA immunity chicken are attacked sequela and death condition and AGP antibody test result with HPAIV H5N1

Group	Immunogen	Dosage	Morbidity number/chicken sum	Death toll/chicken sum	Protection ratio (survival/sum)	Immunity back AGP antibody (week)				HPAIV attacks back AGP antibody (week)
												1	2	3	4 *	1	2
						1	pCIHA	100μg		2/4	2/4							2/4	-	-	-	-	0/2	1/2
2	pCIHA	10μg		5/5	5/5							0/5	-	-	-	-	×								×
						3	pCIoptiHA	100μg		1/4	1/4							3/4	-	-	-	-	0/3	0/3
4	pCIoptiHA	10μg		1/4	1/4							3/4	-	-	-	-	0/3								0/3
						5	Contrast	-	5/5	5/5	0/5							-	-	-	-	×	×

Annotate: ^*Attack poison around the immunity back the;-represent all experimental chicken AGP antibody tests negative; GD/1/96 (H5N1) HPAIV attacks back AGP antibody method for expressing: oblique line '/' top and below be respectively the AGP antibody positive chicken number and the chicken number of surviving at that time; * expression chicken is all dead after attacking a malicious week.

9.2.3 virus is separated titration results

Rushing down of gathering grown the chamber carry out with larynx swab inoculated into chick embryo that virus is separated and titration, the result, 100 μ g pCIoptiHA and pCIHA single immunization form incomplete immunoprotection; PCIoptiHA also forms incomplete immunoprotection with 10 μ g single immunizations; PCIHA almost can not form immunoprotection with 10 μ g single immunizations, 3 days, 5 days and 7 days all separable virus to different titers (seeing Table 6) after GD/1/96 (H5N1) HPAIV attacks.

Table 6.pCIHA attacks back virus with pCloptiHA single immunization chicken with H5N1 and separates and titration results

Group	Immunogen	Dosage	Swab	Attack poison back (my god)
										3		5		7
				Toxin expelling	Titre	Toxin expelling	Titre	Toxin expelling	Titre
										1	pCIHA	100μg	Larynx	l/3	0.97		1/3	0.9	0/3	＜0.9
Cloaca	2/3	1.58	0/3	＜0.9	0/3	＜0.9
							2	pCIHA	10μg				Larynx		2/5	1.7	0/3	＜0.9	1/1	0.9
Cloaca	3/5	1.1	1/3	0.9	0/1	＜0.9
										3	pCIoptiHA	100μg	Larynx		1/4	2.5	0/3	＜0.9	0/3	＜0.9
Cloaca	1/4	0.98	0/3	＜0.9	0/3	＜0.9
							4	pCIoptiHA	10μg				Larynx	0/3	＜0.9	0/3	＜0.9	0/3	＜0.9
Cloaca	0/3	＜0.9	0/3	＜0.9	0/3	＜0.9
										5	Control	-	Larynx	2/3	1.2	0/1	＜0.9	-	-
Cloaca	3/3	1.47	0/1	＜0.9	-	-

Annotate: oblique line '/' top and below be respectively viral and separate the positive chicken number and the chicken number of surviving at that time, when swab stoste was positive, the titration of virus result was defined as 0.9.

9.3 conclusion

Test-results shows, HA gene codon optimization and the optiHA gene that obtains can significantly improve H5 subtype avian influenza dna vaccination inductive protection antibody immune response level improves immunogenicity, enhancing immunity protection effect.

The I040426-sequence table

SEQUENCE LISTING

＜110〉Harbin Veterinary Medicine Inst., China Academy of Agriculture

＜120〉gene and the application thereof of coding H5 subtype avian influenza virus hemagglutinin

<130>I040426

<160>55

<170>PatentIn version 3.1

<210>1

<211>1779

<212>DNA

＜213〉synthetic

<220>

<221>CDS

<222>(29)..(1732)

<223>

<400>1

agcgaaagca ggggtccaat ctgtcaaa atg gag aag atc gtg ctg ctg ctg 52

Met Glu Lys Ile Val Leu Leu Leu

1 5

gcc atc gtg agc ctg gtg aag agc gac cag atc tgc atc ggc tac cac 100

Ala Ile Val Ser Leu Val Lys Ser Asp Gln Ile Cys Ile Gly Tyr His

10 15 20

gcc aac aac agc acc gag cag gtg gac acc atc atg gag aag aac gtg 148

Ala Asn Asn Ser Thr Glu Gln Val Asp Thr Ile Met Glu Lys Asn Val

25 30 35 40

acc gtg acc cac gcc cag gac atc ctg gag aag acc cac aac ggc aag 196

Thr Val Thr His Ala Gln Asp Ile Leu Glu Lys Thr His Asn Gly Lys

45 50 55

ctg tgc gac ctg aac ggc gtg aag ccc ctg atc ctg cgc gac tgc agc 244

Leu Cys Asp Leu Asn Gly Val Lys Pro Leu Ile Leu Arg Asp Cys Ser

60 65 70

gtg gcc ggc tgg ctg ctg ggc aac ccc atg tgc gac gag ttc atcaac 292

Val Ala Gly Trp Leu Leu Gly Asn Pro Met Cys Asp Glu Phe Ile Asn

75 80 85

gtg ccc gag tgg agc tac atc gtg gag aag gcc agc ccc gcc aac gac 340

Val Pro Glu Trp Ser Tyr Ile Val Glu Lys Ala Ser Pro Ala Asn Asp

90 95 100

ctg tgc tac ccc ggc gac ttc aac gac tac gag gag ctg aag cac ctg 388

Leu Cys Tyr Pro Gly Asp Phe Asn Asp Tyr Glu Glu Leu Lys His Leu

105 110 115 120

ctg agc cgc acc aac cac ttc gag aag atc cag atc atc ccc aag agc 436

Leu Ser Arg Thr Asn His Phe Glu Lys Ile Gln Ile Ile Pro Lys Ser

125 130 135

agc tgg agc aac cac gac gcc agc agc ggc gtg agc agc gcc tgc ccc 484

Ser Trp Ser Asn His Asp Ala Ser Ser Gly Val Ser Ser Ala Cys Pro

140 145 150

tac cac ggc cgc agc agc ttc ttc cgc aac gtg gtg tgg ctg atc aag 532

Tyr His Gly Arg Ser Ser Phe Phe Arg Asn Val Val Trp Leu Ile Lys

155 160 165

aag aac agc gcc tac ccc acc atc aag cgc agc tac aac aac acc aac 580

Lys Asn Ser Ala Tyr Pro Thr Ile Lys Arg Ser Tyr Asn Asn Thr Asn

170 175 180

cag gag gac ctg ctg gtg ctg tgg ggc atc cac cac ccc aac gac gcc 628

Gln Glu Asp Leu Leu Val Leu Trp Gly Ile His His Pro Asn Asp Ala

185 190 195 200

gcc gag cag acc aag ctg tac cag aac ccc acc acc tac atc agc gtg 676

Ala Glu Gln Thr Lys Leu Tyr Gln Asn Pro Thr Thr Tyr Ile Ser Val

205 210 215

ggc acc agc acc ctg aac cag cgc ctg gtg ccc gag atc gcc acc cgc 724

Gly Thr Ser Thr Leu Asn Gln Arg Leu Val Pro Glu Ile Ala Thr Arg

220 225 230

ccc aag gtg aac ggg cag agc ggc cgc atg gag ttc ttc tgg acc atc 772

Pro Lys Val Asn Gly Gln Ser Gly Arg Met Glu Phe Phe Trp Thr Ile

235 240 245

ctg aag ccc aac gac gcc atc aac ttc gag agc aac ggc aac ttc atc 820

Leu Lys Pro Asn Asp Ala Ile Asn Phe Glu Ser Asn Gly Asn Phe Ile

250 255 260

gcc ccc gag tac gcc tac aag atc gtg aag aag ggc gac agc gcc atc 868

Ala Pro Glu Tyr Ala Tyr Lys Ile Val Lys Lys Gly Asp Ser Ala Ile

265 270 275 280

atg aag agc gag ctg gag tac ggc aac tgc aac acc aag tgc cag acc 916

Met Lys Ser Glu Leu Glu Tyr Gly Asn Cys Asn Thr Lys Cys Gln Thr

285 290 295

ccc atg ggc gcc atc aac agc agc atg ccc ttc cac aac atc cac ccc 964

Pro Met Gly Ala Ile Asn Ser Ser Met Pro Phe His Asn Ile His Pro

300 305 310

ctg acc atc ggc gag tgc ccc aag tac gtg aag agc aac cgc ctg gtg 1012

Leu Thr Ile Gly Glu Cys Pro Lys Tyr Val Lys Ser Asn Arg Leu Val

315 320 325

ctg gcc acc ggc ctg cgc aac acc ccc cag cgc gag cgc cgc cgc aag 1060

Leu Ala Thr Gly Leu Arg Asn Thr Pro Gln Arg Glu Arg Arg Arg Lys

330 335 340

aag cgc ggc ctg ttc ggc gcc atc gcc ggc ttc atc gag ggc ggc tgg 1108

Lys Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp

345 350 355 360

cag ggc atg gtg gac ggc tgg tac ggg tac cac cac agc aac gag cag 1156

Gln Gly Met Val Asp Gly Trp Tyr Gly Tyr His His Ser Asn Glu Gln

365 370 375

ggc agc ggc tac gcc gcc gac aag gag agc acc cag aag gcc atc gac 1204

Gly Ser Gly Tyr Ala Ala Asp Lys Glu Ser Thr Gln Lys Ala Ile Asp

380 385 390

ggc gtg acc aac aag gtg aac agc atc atc gac aag atg aac acc cag 1252

Gly Val Thr Asn Lys Val Asn Ser Ile Ile Asp Lys Met Asn Thr Gln

395 400 405

ttc gag gcc gtg ggc cgc gag ttc aac aac ctg gag cgc cgc atc gag 1300

Phe Glu Ala Val Gly Arg Glu Phe Asn Asn Leu Glu Arg Arg Ile Glu

410 415 420

aac ctg aac aag cag atg gag gac ggc ttc ctg gac gtg tgg acc tac 1348

Asn Leu Asn Lys Gln Met Glu Asp Gly Phe Leu Asp Val Trp Thr Tyr

425 430 435 440

aac gcc gag ctg ctg gtg ctg atg gag aac gag cgc acc ctg gac ttc 1396

Asn Ala Glu Leu Leu Val Leu Met Glu Asn Glu Arg Thr Leu Asp Phe

445 450 455

cac gac agc aac gtg aag aac ctg tac gac aag gtg cgc ctg cag ctg 1444

His Asp Ser Asn Val Lys Asn Leu Tyr Asp Lys Val Arg Leu Gln Leu

460 465 470

cgc gac aac gcc aag gag ctg ggc aac ggc tgc ttc gag ttc tac cac 1492

Arg Asp Asn Ala Lys Glu Leu Gly Asn Gly Cys Phe Glu Phe Tyr His

475 480 485

aag tgc gac aac gag tgc atg gag agc gtg aag aac ggc acc tac gac 1540

Lys Cys Asp Asn Glu Cys Met Glu Ser Val Lys Asn Gly Thr Tyr Asp

490 495 500

tac ccc cag tac agc gag gag gcc cgc ctg aac cgc gag gag atc agc 1588

Tyr Pro Gln Tyr Ser Glu Glu Ala Arg Leu Asn Arg Glu Glu Ile Ser

505 510 515 520

ggc gtg aag ctc gag agc atg ggc acc tac cag atc ctg agc atc tac 1636

Gly Val Lys Leu Glu Ser Met Gly Thr Tyr Gln Ile Leu Ser Ile Tyr

525 530 535

agc acc gtg gcc agc agc ctg gcc ctg gcc atc atg gtg gcc ggc ctg 1684

Ser Thr Val Ala Ser Ser Leu Ala Leu Ala Ile Met Val Ala Gly Leu

540 545 550

agc ctg tgg atg tgc agc aac ggc agc ctg cag tgc cgc atc tgc atc 1732

Ser Leu Trp Met Cys Ser Asn Gly Ser Leu Gln Cys Arg Ile Cys Ile

555 560 565

taaatttgtg agttcagatt gtagttaaaa acacccttgt gtctact 1779

<210>2

<211>568

<212>PRT

＜213〉synthetic

<400>2

Met Glu Lys Ile Val Leu Leu Leu Ala Ile Val Ser Leu Val Lys Ser

1 5 10 15

Asp Gln Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gln Val

20 25 30

Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gln Asp Ile

35 40 45

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asn Gly Val Lys

50 55 60

Pro Leu Ile Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn

65 70 75 80

Pro Met Cys Asp Glu Phe Ile Asn Val Pro Glu Trp Ser Tyr Ile Val

85 90 95

Glu Lys Ala Ser Pro Ala Asn Asp Leu Cys Tyr Pro Gly Asp Phe Asn

100 105 110

Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Thr Asn His Phe Glu

115 120 125

Lys Ile Gln Ile Ile Pro Lys Ser Ser Trp Ser Asn His Asp Ala Ser

130 135 140

Ser Gly Val Ser Ser Ala Cys Pro Tyr His Gly Arg Ser Ser Phe Phe

145 150 155 160

Arg Asn Val Val Trp Leu Ile Lys Lys Asn Ser Ala Tyr Pro Thr Ile

165 170 175

Lys Arg Ser Tyr Asn Asn Thr Asn Gln Glu Asp Leu Leu Val Leu Trp

180 185 190

Gly Ile His His Pro Asn Asp Ala Ala Glu Gln Thr Lys Leu Tyr Gln

195 200 205

Asn Pro Thr Thr Tyr Ile Ser Val Gly Thr Ser Thr Leu Asn Gln Arg

210 215 220

Leu Val Pro Glu Ile Ala Thr Arg Pro Lys Val Asn Gly Gln Ser Gly

225 230 235 240

Arg Met Glu Phe Phe Trp Thr Ile Leu Lys Pro Asn Asp Ala Ile Asn

245 250 255

Phe Glu Ser Asn Gly Asn Phe Ile Ala Pro Glu Tyr Ala Tyr Lys Ile

260 265 270

Val Lys Lys Gly Asp Ser Ala Ile Met Lys Ser Glu Leu Glu Tyr Gly

275 280 285

Asn Cys Asn Thr Lys Cys Gln Thr Pro Met Gly Ala Ile Asn Ser Ser

290 295 300

Met Pro Phe His Asn Ile His Pro Leu Thr Ile Gly Glu Cys Pro Lys

305 310 315 320

Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Thr

325 330 335

Pro Gln Arg Glu Arg Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala Ile

340 345 350

Ala Gly Phe Ile Glu Gly Gly Trp Gln Gly Met Val Asp Gly Trp Tyr

355 360 365

Gly Tyr His His Ser Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Lys

Glu Ser Thr Gln Lys Ala Ile Asp Gly Val Thr Asn Lys Val Asn Ser

385 390 395 400

Ile Ile Asp Lys Met Asn Thr Gln Phe Glu Ala Val Gly Arg Glu Phe

405 4l0 415

Asn Asn Leu Glu Arg Arg Ile Glu Asn Leu Asn Lys Gln Met Glu Asp

420 425 430

Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met

435 440 445

Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu

450 455 460

Tyr Asp Lys Val Arg Leu Gln Leu Arg Asp Asn Ala Lys Glu Leu Gly

465 470 475 480

Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu

485 490 495

Ser Val Lys Asn Gly Thr Tyr Asp Tyr Pro Gln Tyr Ser Glu Glu Ala

500 505 510

Arg Leu Asn Arg Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Met Gly

515 520 525

Thr Tyr Gln Ile Leu Ser Ile Tyr Ser Thr Val Ala Ser Ser Leu Ala

530 535 540

Leu Ala Ile Met Val Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly

545 550 555 560

Ser Leu Gln Cys Arg Ile Cys Ile

565

<210>3

<211>101

<212>DNA

＜213〉synthetic

<400>3

agcgaaagca ggggtccaat ctgtcaaaat ggagaagatc gtgctgctgc tggccatcgt 60

gagcctggtg aagagcgacc agatctgcat cggctaccac g 101

<210>4

<211>90

<212>DNA

＜213〉synthetic

<400>4

ccagatctgc atcggctacc acgccaacaa cagcaccgag caggtggaca ccatcatgga 60

gaagaacgtg accgtgaccc acgcccagga 90

<210>5

<211>101

<212>DNA

＜213〉synthetic

<400>5

gccacgctgc agtcgcgcag gatcaggggc ttcacgccgt tcaggtcgca cagcttgccg 60

ttgtgggtct tctccaggat gtcctgggcg tgggtcacgg t 101

<210>6

<211>110

<212>DNA

＜213〉synthetic

<400>6

tgcagcgtgg ccggctggct gctgggcaac cccatgtgcg acgagttcat caacgtgccc 60

gagtggagct acatcgtgga gaaggccagc cccgccaacg acctgtgcta 110

<210>7

<211>110

<212>DNA

＜213〉synthetic

<400>7

ctgctcttgg ggatgatctg gatcttctcg aagtggttgg tgcggctcag caggtgcttc 60

agctcctcgt agtcgttgaa gtcgccgggg tagcacaggt cgttggcggg 110

<210>8

<211>98

<212>DNA

＜213〉synthetic

<400>8

caagagcagc tggagcaacc acgacgccag cagcggcgtg agcagcgcct gcccctacca 60

cggccgcagc agcttcttcc gcaacgtggt gtggctga 98

<210>9

<211>100

<212>DNA

＜213〉synthetic

<400>9

tgccccacag caccagcagg tcctcctggt tggtgttgtt gtagctgcgc ttgatggtgg 60

ggtaggcgct gttcttcttg atcagccaca ccacgttgcg 100

<210>10

<211>97

<212>DNA

＜213〉synthetic

<400>10

aggaggacct gctggtgctg tggggcatcc accaccccaa cgacgccgcc gagcagacca 60

agctgtacca gaaccccacc acctacatca gcgtggg 97

<210>11

<211>99

<212>DNA

＜213〉synthetic

<400>11

ctccatgcgg ccgctctgcc cgttcacctt ggggcgggtg gcgatctcgg gcaccaggcg 60

ctggttcagg gtgctggtgc ccacgctgat gtaggtggt 99

<210>12

<211>110

<212>DNA

＜213〉synthetic

<400>12

gcggccgcat ggagttcttc tggaccatcc tgaagcccaa cgacgccatc aacttcgaga 60

gcaacggcaa cttcatcgcc cccgagtacg cctacaagat cgtgaagaag 110

<210>13

<211>110

<212>DNA

＜213〉synthetic

<400>13

catgctgctg ttgatggcgc ccatgggggt ctggcacttg gtgttgcagt tgccgtactc 60

cagctcgctc ttcatgatgg cgctgtcgcc cttcttcacg atcttgtagg 110

<210>14

<211>110

<212>DNA

＜213〉synthetic

<400>14

gcatgccctt ccacaacatc caccccctga ccatcggcga gtgccccaag tacgtgaaga 60

gcaaccgcct ggtgctggcc accggcctgc gcaacacccc ccagcgcgag 110

<210>15

<211>110

<212>DNA

＜213〉synthetic

<400>15

gtacccgtac cagccgtcca ccatgccctg ccagccgccc tcgatgaagc cggcgatggc 60

gccgaacagg ccgcgcttct tgcggcggcg ctcgcgctgg ggggtgttgc 110

<210>16

<211>91

<212>DNA

＜213〉synthetic

<400>16

ggtacgggta ccaccacagc aacgagcagg gcagcggcta cgccgccgac aaggagagca 60

cccagaaggc catcgacggc gtgaccaaca a 91

<210>17

<211>103

<212>DNA

＜213〉synthetic

<400>17

gcggcggctc ttcctccagg ttgttgaact cgcggcccac ggcctcgaac tgggtgttca 60

tcttgtcgat gatgctgttc accttgttgg tcacgccgtc gat 103

<210>18

<211>97

<212>DNA

＜213〉synthetic

<400>18

caacctgctc ttcggagcgc cgcatcgaga acctgaacaa gcagatggag gacggcttcc 60

tggacgtgtg gacctacaac gccgagctgc tggtgct 97

<210>19

<211>99

<212>DNA

＜213〉synthetic

<400>19

gcgcagctgc aggcgcacct tgtcgtacag gttcttcacg ttgctgtcgt ggaagtccag 60

ggtgcgctcg ttctccatca gcaccagcag ctcggcgtt 99

<210>20

<211>99

<212>DNA

＜213〉synthetic

<400>20

gtgcgcctgc agctgcgcga caacgccaag gagctgggca acggctgctt cgagttctac 60

cacaagtgcg acaacgagtg catggagagc gtgaagaac 99

<210>21

<211>99

<212>DNA

＜213〉synthetic

<400>21

tgctctcgag cttcacgccg ctgatctcct cgcggttcag gcgggcctcc tcgctgtact 60

gggggtagtc gtaggtgccg ttcttcacgc tctccatgc 99

<210>22

<211>107

<212>DNA

＜213〉synthetic

<400>22

gtgaagctcg agagcatggg cacctaccag atcctgagca tctacagcac cgtggccagc 60

agcctggccc tggccatcat ggtggccggc ctgagcctgt ggatgtg 107

<210>23

<211>101

<212>DNA

＜213〉synthetic

<400> 23

agtagacaca agggtgtttt taactacaat ctgaactcac aaatttagat gcagatgcgg 60

cactgcaggc tgccgttgct gcacatccac aggctcaggc c 101

<210>24

<211>26

<212>DNA

＜213〉synthetic

<400>24

agcgaaagca ggggtccaat ctgtca 26

<210>25

<211>26

<212>DNA

＜213〉synthetic

<400>25

ccagatctgc atcggctacc acgcca 26

<210>26

<211>25

<212>DNA

＜213〉synthetic

<400>26

gccacgctgc agtcgcgcag gatca 25

<210> 27

<211>27

<212>DNA

＜213〉synthetic

<400>27

gactgcagcg tggccggctg gctgctg 27

<210>28

<211>28

<212>DNA

＜213〉synthetic

<400>28

ccagctgctc ttggggatga tctggatc 28

<210>29

<211>24

<212>DNA

＜213〉synthetic

<400>29

caagagcagc tggagcaacc acga 24

<210>30

<211>25

<212>DNA

＜213〉synthetic

<400>30

tgccccacag caccagcagg tcctc 25

<210>31

<211>23

<212>DNA

＜213〉synthetic

<400>31

aggaggacct gctggtgctg tgg 23

<210>32

<211>25

<212>DNA

＜213〉synthetic

<400>32

ctccatgcgg ccgctctgcc cgttc 25

<210>33

<211>27

<212>DNA

＜213〉synthetic

<400>33

gagcggccgc atggagttct tctggac 27

<210>34

<211>27

<212>DNA

＜213〉synthetic

<400>34

ggcatgctgc tgttgatggc gcccatg 27

<210>35

<211>25

<212>DNA

＜213〉synthetic

<400>35

cagcatgccc ttccacaaca tccac 25

<210>36

<211>26

<212>DNA

＜213〉synthetic

<400>36

gtggtacccg taccagccgt ccacca 26

<210>37

<211>25

<212>DNA

＜213〉synthetic

<400>37

ggtacgggta ccaccacagc aacga 25

<210>38

<211>24

<212>DNA

＜213〉synthetic

<400>38

gcggcggctc ttcctccagg ttgt 24

<210>39

<211>25

<212>DNA

＜213〉synthetic

<400>39

caacctgctc ttcggagcgc cgcat 25

<210>40

<211>24

<212>DNA

＜213〉synthetic

<400>40

gcgcagctgc aggcgcacct tgtc 24

<210>41

<211>24

<212>DNA

＜213〉synthetic

<400>41

gtgcgcctgc agctgcgcga caac 24

<210>42

<211>23

<212>DNA

＜213〉synthetic

<400>42

tgctctcgag cttcacgccg ctg 23

<210>43

<211>23

<212>DNA

＜213〉synthetic

<400>43

gtgaagctcg agagcatggg cac 23

<210>44

<211>27

<212>DNA

＜213〉synthetic

<400>44

agtagacaca agggtgtttt taactac 27

<210>45

<211>21

<212>DNA

＜213〉synthetic

<400>45

attaaccctc actaaaggga a 21

<210>46

<211>20

<212>DNA

＜213〉synthetic

<400>46

acttaatacg actcactata 20

<210>47

<211>26

<212>DNA

＜213〉synthetic

<400>47

ccactctaga gtgtttttaa ctacaa 26

<210>48

<211>20

<212>DNA

＜213〉synthetic

<400>48

acttaatacg actcactata 20

<210>49

<211>18

<212>DNA

＜213〉synthetic

<400>49

gcaccaacca cttcgaga 18

<210>50

<211>20

<212>DNA

＜213〉synthetic

<400>50

gctaccacgc caacaacagc 20

<210>51

<211>19

<212>DNA

＜213〉synthetic

<400>51

gaagagcgag ctggagtac 19

<210>52

<211>21

<212>DNA

＜213〉synthetic

<400>52

gcagatggag gacggcttcc t 21

<210>53

<211>20

<212> DNA

＜213〉synthetic

<400>53

tgcagcttat aatggttaca 20

<210>54

<211>22

<212>DNA

＜213〉synthetic

<400>54

tcaaaatgga gaagatcgtg ct 22

<210>55

<211>26

<212>DNA

＜213〉synthetic

<400>55

ccactctaga gtgtttttaa ctacaa 26

Claims (9)

1. an avian influenza virus hemagglutinin gene is characterized in that it being the nucleotide sequence shown in the SEQ ID NO:1.

2. an expression vector is characterized in that comprising the described gene of claim 1.

3. the described expression vector of claim 2, it is to obtain by expression vector pCI is gone in the described gene clone of claim 1.

4. a host cell is characterized in that comprising each described expression vector of claim 2-3.

5. the described host cell of claim 4, it is an eukaryotic cell.

6. the described host cell of claim 5, it is human embryonic kidney cell, COS cell or chick embryo fibroblast.

7. the application of the described gene of claim 1 in preparation H5 subtype influenza virus DNA vaccine.

8. the application of the described gene of claim 1 in preparation subunit vaccine or recombinant fowlpox virus recombinant vaccine.

9. the application of the described gene of claim 1 in the preparation monoclonal antibody.

Images