WO2004098377A2 - Methods and compositions for diagnosis and therapy of parkin-associated disorders - Google Patents

Methods and compositions for diagnosis and therapy of parkin-associated disorders Download PDF

Info

Publication number
WO2004098377A2
WO2004098377A2 PCT/US2003/034268 US0334268W WO2004098377A2 WO 2004098377 A2 WO2004098377 A2 WO 2004098377A2 US 0334268 W US0334268 W US 0334268W WO 2004098377 A2 WO2004098377 A2 WO 2004098377A2
Authority
WO
WIPO (PCT)
Prior art keywords
parkin
nucleic acid
associated disorder
subject
protein
Prior art date
Application number
PCT/US2003/034268
Other languages
French (fr)
Other versions
WO2004098377A3 (en
Inventor
Carlo M. Croce
Original Assignee
Thomas Jefferson University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Thomas Jefferson University filed Critical Thomas Jefferson University
Priority to AU2003286741A priority Critical patent/AU2003286741A1/en
Publication of WO2004098377A2 publication Critical patent/WO2004098377A2/en
Publication of WO2004098377A3 publication Critical patent/WO2004098377A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/53—Ligases (6)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/9015—Ligases (6)

Definitions

  • the invention relates to treatment and diagnosis of cancers and other diseases associated with defects in the Parkin gene or with aberrant regulation of Parkin expression. More specifically, the invention relates to the role of Parkin as a tumor suppressor gene, and methods to correct loss of Parkin expression or to correct aberrant Parkin expression. The invention further relates to methods of diagnosing Parkin-associated disorders, as well as identifying cells or subjects who are predisposed to developing a Parkin-associated disorder.
  • Tumorigenesis is the result of a multi-step process resulting in genetic alterations that drive the progressive transformation of normal cells into malignant derivatives (Hanahan, D. et al., 2000 Cell 100:57-70).
  • Tumor suppressor genes are defined as genetic elements whose loss or mutational inactivation allows or causes cells to acquire a neoplastic phenotype (Hinds, P. W. et al., 1994 Curr. Opin. Genet. Dev. 4:135-41). Frequent loss of heterozygosity ( OH) within genetically-defined chromosomal regions can indicate the presence of a putative
  • biallelic inactivation Another mechanism for inactivation of tumor suppressor genes is biallelic inactivation.
  • Biallelic inactivation of a TSG can occur by several mechanisms, including chromosomal deletion of both alleles.
  • homozygous deletion HD
  • HDs usually span relatively short genomic regions and have been instrumental in the identification of several TSGs, such as FHIT, RBI, and WT1 (Ohta, M., et al. 1996 Cell 84:587-97, Benedict, W. F., et al, 1983 Science 219:973- 975, Gessler, M., et al, 1990 Nature 343:774-8).
  • the Parkin gene was initially identified in four Japanese families affected by autosomal recessive juvenile Parkinsonism (AR-JP) (Kitada, T., et al, 1998 Nature
  • Parkin gene is inactivated by point mutations, or more frequently, by exon deletions or alteration (Mizuno, Y., et al., 2001, Curr. Opin. Neural. 14:477-82; Kitada, T., et al, 1998, Nature 392:605- 608).
  • Functional analysis has shown that the Parkin protein is an E3 ubiquitin ligase, and its involvement in protein degradation is under study (Hyun et al., 2002, J. Biol.
  • the Parkin gene maps to the long arm of chromosome 6 (6q25.2-q27) (Kitada, T., et al., 1998 Nature 392:605-608). To date, eight genes have been mapped to the 6q25.2-q27 chromosomal region, a region involved in loss of heterozygosity in cancer: mannose-6-phosphate/insulin-like grow factor 2 receptor (M6P/IGFF2R) (De Souza, A. T., et al, 1995 Oncogene 10:1725-9), apolipoprotein-A (LPA) (McLean, J.
  • M6P/IGFF2R mannose-6-phosphate/insulin-like grow factor 2 receptor
  • LPA apolipoprotein-A
  • the Parkin gene spans approximately 43% of the 6q25.2-q27 segment and has been shown to contain several characterized familial deletions (Mizuno, Y., et al., 2001 Curr. Opin. Neurol. 14:477-82).
  • the Parkin gene consists of 12 exons and large introns, with an overall average size of 125 kb (Asakawa, S., et al., 2001 Biochem. Biophys. Res. Commun. 286:863-868).
  • the Parkin protein has been classified as a RING fmger E3 ligase containing 465 amino acids, which ubiquitinates itself (Imai, Y., et al., 2000 J. Biol. Chem. 275:35661-4) and is involved in the degradation of the synaptic vesicle-associated protein CDCrel-1 (Zhang, Y., et al, 2000 Proc. Natl. Acad. Sci. USA 97:13354- 13359) and the membrane protein Pael-R (Imai, Y., et al, 2001 Cell. 105:891-902).
  • chromosome 6 Deletion in the long arm of chromosome 6 is associated with the occurrence of several solid tumors, including carcinomas of the ovary (Saito, S., et al, 1996 Cancer Res. 56:5586-5589, Tibiletti, M. G., et al, 1996 Cancer Res. 56:4493-4498), breast (Orphanos, V., et al, 1995 Br. J. Cancer 1:290-3), kidney (Morita, R., et al, 1991 Cancer Res. 51 :5817-20), and lung (Kong, F. M., et al, 2000 Oncogene
  • melanoma (Millikin, D., et al, 1991 Cancer Res. 51:5449-53); and of hematological cancers such as acute lymphoblastic leukemia (Hayashi, Y., et al, 1990 Blood 76:1626-30), Burkitt's lymphoma (Parsa, N. Z., et al, 1994 Genes Chromosomes Cancer 9:13-18) and Non-Hodgkin's B-cell lymphoma (Gaidano, G., et al, 1992 Blood 80:1781-1787).
  • microcell-mediated transfer of human chromosome 6 suppresses tumorigenicity in two breast cancer cell lines (Negrini, M., et al, 1994 Cancer Res. 54:1331-6) and reduces the tumorigenicity of several melanoma cell lines (Trent, J. M., et al, 1990 Science 247:568-71).
  • introduction of an intact human chromosome 6 into the breast cancer cell line MCF- 7 (Negrini, M., et al, 1994 Cancer Res.
  • Loss of heterozygosity (LOH) analysis of the long arm of chromosome 6 has identified several regions of loss: 6q21-q23 (Sheng, Z. M. 5 et al, 1996 Br. J. Cancer 73:144-147), 6q25.1-q25.2 (Colitti, C, et al, 1998 Oncogene 16:555-559) and 6q25- q27 (Tibiletti, M. G., et al, 1996 Cancer Res. 56:4493-4498, Cooke, I. E., et al, 1996 Genes Chromosomes Cancer 15:223-33). Moreover, deletions at 6q27 are present in benign ovarian tumors (Tibiletti, M.
  • Chromosomal region 6q25-q27 is frequently deleted in a wide spectrum of human neoplasms, such as melanoma, ovarian cancer, breast cancer, non-Hodgkin's B-cell lymphoma and several others (Kong, F. M., et al, 2000 Oncogene 19:1572-1578,
  • Chromosomal region 6q25-q27 also contains one of the most active chromosomal fragile sites of the human genome, FRA6E (Smith, D. I., et al, 1998
  • FRA3B and FRA16D have been shown to co-localize with the tumor suppressor genes FHIT and WWOX, respectively (Ohta, M., et al. 1996 Cell 84:587-97; Paige, A. J., et al, 2001 Proc. Natl Acad. Sci. USA 98:11417-11422).
  • FHIT and WWOX genetic loci each cover a large genomic region; FHIT is approximately 1.8 Mb (Inoue, H., et al,
  • the invention is based on the surprising discovery that the Parkin gene, which is known to be involved in Parkinson's Disease, is a tumor suppressor gene.
  • the Parkin protein can be used to restore normal growth characteristics to tumor cells, and reduction or absence of the Parkin protein in a cell, or the presence of an abnormal
  • Parkin protein in a cell is indicative of a Parkin-associated disorder, as hereinafter defined.
  • the invention thus provides a method of treating a Parkin-associated disorder in a subject in need of such treatment, comprising administering an effective amount of a composition comprising a Parkin protein, or a biologically active fragment derivative or homolog thereof, or at least one isolated nucleic acid comprising a nucleic acid sequence encoding a Parkin protein, or a biologically active fragment, derivative, or homolog thereof.
  • the invention further provides a method of treating a Parkin-associated disorder in a subject in need of such treatment, comprising the steps of isolating cells associated with a Parkin-associated disorder from the subject, transfecting the cells with an isolated nucleic acid comprising a nucleic acid sequence encoding a Parkin protein, or a biologically active fragment or homolog thereof, and reimplanting the transfected cells into the subject, such that proliferation of cells associated with a Parkin-associated disorder is inhibited.
  • Expression of the isolated nucleic acid or stable integration of the isolated nucleic acid into the genome of the transfected cell can be confirmed prior to reimplantation of the transfected cells into the subject.
  • the invention also provides a pharmaceutical composition for treating a Parkin-associated disorder, comprising a Parkin protein, or a biologically active fragment derivative or homolog thereof, or at least one isolated nucleic acid comprising a nucleic acid sequence encoding a Parkin protein, or a biologically active fragment or homolog thereof, and a pharmaceutically acceptable carrier.
  • the invention provides a method of diagnosing a Parkin- associated disorder or screening for a predisposition for developing a Parkin- associated disorder in a subject.
  • the method comprises measuring the dosage or copy number of the Parkin gene, or determining the level of Parkin nucleic acid, in a sample derived from the subject.
  • a Parkin gene dosage of one or zero indicates the presence of a Parkin-associated disorder or a predisposition for developing a Parkin- associated disorder.
  • a lower level of Parkin nucleic acid in the sample indicates the presence of a lower level of Parkin nucleic acid in the sample, relative to the level of Parkin nucleic acid in an analogous sample from a control subject not having the Parkin-associated disorder, indicates the presence of a
  • Parkin-associated disorder or a predisposition for developing a Parkin-associated disorder.
  • the invention further provides a method for diagnosing a Parkin-associated disorder comprising analyzing Parkin gene sequences from cells derived from a subject for a mutation in the Parkin gene sequences. Detection of one or more mutations in a Parkin nucleic acid sequence in the sample indicates the presence of a Parkin-associated disorder or a predisposition for developing a Parkin-associated disorder.
  • the invention further provides a method of diagnosing a Parkin-associated disorder or screening for a predisposition for developing a Parkin-associated disorder in a subject, comprising measuring the level of Parkin protein or Parkin protein activity in a sample derived from a subject. A lower level of Parkin protein or activity in the sample, relative to the level of Parkin protein or activity in a control sample, indicates that the subject has a Parkin-associated disorder or a predisposition for developing a Parkin-associated disorder.
  • the Parkin protein activity is ubiquitin ligase activity.
  • AR-JP means autosomal recessive juvenile parkinsonism.
  • HD means homozygous deletion
  • HSC hemopoietic stem cell
  • IBR in-between ring
  • LH loss of heterozygosity.
  • PBL peripheral blood leukocyte.
  • PCR means polymerase chain reaction.
  • PTD means protein transduction domain.
  • RT-PCR means reverse transcriptase polymerase chain reaction.
  • TSG tumor suppressor gene
  • each "amino acid” is represented by the full name thereof, by the three letter code corresponding thereto, or by the one-letter code corresponding thereto, as indicated in the following table:
  • amino acid as used herein is meant to include both natural and synthetic amino acids, and both D and L amino acids.
  • Standard amino acid means any of the twenty L-amino acids commonly found in naturally occurring peptides.
  • Nonstandard amino acid residues means any amino acid, other than the standard amino acids, regardless of whether it is prepared synthetically or derived from a natural source.
  • synthetic amino acid also encompasses chemically modified amino acids, including but not limited to salts, amino acid derivatives (such as amides), and substitutions.
  • Amino acids contained within the peptides of the present invention, and particularly at the carboxy- or amino-terminus, can be modified by methylation, amidation, acetylation or substitution with other chemical groups which can change a peptide's circulating half life without adversely affecting activity of the peptide. Additionally, a disulfide linkage may be present or absent in the peptides of the invention.
  • amino acid is used interchangeably with “amino acid residue,” and may refer to a free amino acid and to an amino acid residue of a peptide. It will be apparent from the context in which the term is used whether it refers to a free amino acid or a residue of a peptide.
  • Amino acids have the following general structure:
  • Amino acids are classified into seven groups on the basis of the side chain R:
  • An “analog” of Parkin includes any non-peptide molecule comprising a structure that mimics the physico-chemical and spatial characteristics of Parkin, and which has Parkin biological activity.
  • Antibody as used herein includes polyclonal and monoclonal antibodies, chimeric, single chain, and humanized antibodies, as well as Fab fragments, including the products of an Fab or other immunoglobulin expression library.
  • between markers refers to a segment of nucleic acid between two named microsatellite markers, which can include the microsatellite markers.
  • the segment defined by the named microsatellite markers is also referred to herein to as a "genetic interval"
  • Bioly active as used herein with respect to Parkin peptides, fragments, derivatives, homologs, and analogs means that the peptides, fragments, derivatives, homologs, or analogs have the ability to function as a ubiquitin ligase, an inhibitor of cell proliferation, or an inhibitor of tumorigenesis, as described herein.
  • a "cell associated with a Parkin-associated disorder” means a cell isolated from a subject who has, or is suspected of having, a Parkin-associated disorder, which cell has a reduction or absence of Parkin protein or Parkin mRNA or has a mutation or deletion in at least one Parkin gene. Techniques for measuring levels of Parkin protein in a cell, or for detecting deletions or mutations in the Parkin gene, are within the skill in the art and are described in detail below.
  • a "cell associated with a Parkin-associated disorder” also means a cell isolated from a subject who has, or is suspected of having, a Parkin-associated disorder, which cell has a cancerous or neoplastic phenotype.
  • cancerous or neoplastic phenotypes are insensitive to contact-induced growth inhibition in culture, and will form foci when cultured for extended periods.
  • Cancerous or neoplastic cells also exhibit characteristic morphological changes, disorganized patterns of colony growth and acquisition of anchorage-independent growth.
  • Cancerous or neoplastic cells also have the ability to form invasive tumors in susceptible animals, which can be evaluated by injecting the cells, for example, into athymic mice using techniques within the skill in the art.
  • a “compound of the invention,” as used herein, includes Parkin nucleic acids and derivatives, analogs, fragments, and homologs thereof, as well as Parkin proteins, and derivatives, analogs, fragments, and homologs thereof.
  • “Derivative” includes any purposefully generated peptide which in its entirety, or in part, comprises a substantially similar amino acid sequence to Parkin and has Parkin biological activity. Derivatives of Parkin may be characterized by single or multiple amino acid substitutions, deletions, additions, or replacements. These derivatives may include (a) derivatives in which one or more amino acid residues of SEQ ID NO:2 (GenBank accession no.
  • BAA25751 are substituted with conservative or non-conservative amino acids; (b) derivatives in which one or more amino acids are added to SEQ ID NO:2; (c) derivatives in which one or more of the amino acids of SEQ ID NO:2 includes a substituent group; (d) derivatives in which SEQ ID NO:2 or a portion thereof is fused to another peptide (e.g., serum albumin or protein transduction domain); (e) derivatives in which one or more nonstandard amino acid residues (i.e., those other than the 20 standard L-amino acids found in naturally occurring proteins) are incorporated or substituted into SEQ ID NO:2; and (f) derivatives in which one or more nonamino acid linking groups are incorporated into or replace a portion of SEQ ID NO:2.
  • Parkin peptide, fragment, derivative, homolog, and analog or nucleic acid encoding a Parkin peptide, fragment, derivative, or homolog is an amount sufficient to inhibit progression of a Parkin-associated disorder or to inhibit proliferation of cells associated with a Parkin-associated disorder.
  • expression refers to transcription of the Parkin gene, resulting in synthesis of Parkin mRNA.
  • Expression refers to translation of Parkin mRNA, resulting in synthesis of Parkin protein.
  • fragment refers to a subsequence of a larger nucleic acid.
  • a “fragment” of a nucleic acid can be at least about 20 nucleotides in length; for example, at least about 50 nucleotides to about 100 nucleotides; preferably at least about 100 to about 500 nucleotides, more preferably at least about 500 to about 1000 nucleotides, even more preferably at least about 1000 nucleotides to about 1500 nucleotides; particularly, preferably at least about 1500 nucleotides to about 2500 nucleotides; most preferably at least about 2500 nucleotides.
  • fragment refers to a subsequence of a larger protein or peptide.
  • a “fragment” of a protein or peptide can be at least about 20 amino acids in length; for example at least about 50 amino acids in length; more preferably at least about 100 amino acids in length, even more preferably at least about 200 amino acids in length, particularly preferably at least about 300 amino acids in length, and most preferably at least about 400 amino acids in length.
  • a "homolog" of Parkin protein includes any nonpurposely generated peptide which, in its entirety or in part, comprises a substantially similar amino acid sequence to SEQ ID NO:2 and has Parkin biological activity. Homologs can include paralogs, orthologs, and naturally occurring alleles or variants of Parkin.
  • Homologous refers to the subunit sequence similarity between two polymeric molecules, e.g.; between to nucleic acid molecules, such as, two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit; e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position.
  • the homology between two sequences is a direct function of the number of matching or homologous positions; e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 of 10), are matched or homologous, the two sequences are 90% homologous.
  • the DNA sequences 3 ⁇ TTGCC5' and 3'TATGGC are 50% homologous.
  • a "subunit" of a nucleic acid molecule is a nucleotide, and a “subunit” of a polypeptide is an amino acid.
  • “homology” is used synonymously with “identity.”
  • inhibitor means to suppress or block an activity or function by at least ten percent relative to a control value. Preferably, the activity is suppressed or blocked by 50% compared to a control value, more preferably by 15%, and even more preferably by 95%.
  • isolated means altered or removed from the natural state through the actions of a human being. For example, a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.”
  • An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
  • loss of proliferation control means the loss of or reduced ability of a cell to control normal growth processes such as the rate of cell proliferation, cell contact mediated regulation of proliferation, the ability to senesce, or the ability to differentiate.
  • a “mutation,” as used herein, refers to a change in nucleic acid or polypeptide sequence relative to a reference sequence (which is preferably a naturally-occurring normal or “wild-type” sequence), and includes translocations, deletions, insertions, and substitutions/point mutations.
  • a “mutant” as used herein, refers to either a nucleic acid or protein comprising a mutation.
  • a “nucleic acid” refers to a polynucleotide and includes poly-ribonucleotides and poly-deoxyribonucleotides.
  • oligonucleotide typically refers to short polynucleotides of about 50 nucleotides or less in length. It will be understood that when a nucleotide sequence is represented herein by a DNA sequence (i.e., A, T, G, and C), this also includes the corresponding RNA sequence (i.e., a, u, g, c) in which "u” replaces "T”.
  • Parkin activity refers to the functions or properties of Parkin such as the ability of Parkin to function as a ubiquitin ligase, as an inhibitor of cell proliferation, or as an inhibitor of tumorigenesis.
  • Parkin associated-disorder refers to a disorder in which there is an association between a mutated or defective Parkin gene or protein in cells of a subject and loss of proliferation control of the cells.
  • Parkin-associated disorder thus, for example, refers to any cancer or proliferative disorder in which the expression of the Parkin gene is reduced or absent in at least a portion of cells associated with the Parkin-associated disorder.
  • Parkin-associated disorders include cancers, non-cancerous hyperproliferative disorders, and other non-cancerous cell proliferative disorders, including disorders in which cells exhibit diminished ability or lack of ability to differentiate or senesce.
  • a "non-cancerous" Parkin-associated disorder is characterized by abnormally- proliferating cells (i.e., cells which have escaped normal growth control mechanisms) which are not able to invade and metastasize.
  • Abnormally proliferating cells in non- cancerous Parkin-associated disorders typically form fibroid growths or benign tumors.
  • Examples of non-cancerous Parkin-associated disorders include any benign skin lesion or condition involving the uncontrolled growth of the various cell types of the skin or subcutaneous tissue such as psoriasis, keloids, and scars.
  • Non- cancerous Parkin-associated disorders can include hemangiomatosis, myelodegenerative disease, neurofibromatosis, ganglioneuromatosis, Paget's disease of the bone, fibrocystic disease, Peyronie's disease, Dupuytren's contracture, cirrhosis, atherosclerosis, and vascular restenosis.
  • Parkin-associated disorders which are cancerous or tumorigenic can be characterized by primary or metastatic tumors or neoplastic cells from cancers of at least the following histologic subtypes: sarcoma (cancers of the connective and other tissue of mesodermal origin); melanoma (cancers deriving from pigmented melanocytes); carcinoma (cancers of epithelial origin); adenocarcinoma (cancers of glandular epithelial origin); cancers of neural origin (glioma/glioblastoma and astrocytoma); and hematological neoplasias, such as leukemias and lymphomas (e.g., acute lymphoblastic leukemia and chronic myelocytic leukemia).
  • sarcoma cancers of the connective and other tissue of mesodermal origin
  • melanoma cancers deriving from pigmented melanocytes
  • carcinoma cancers of epithelial origin
  • Parkin-associated disorders which are cancerous or tumorigenic also include cancers having their origin in at least the following organs or tissues, regardless of histologic subtype: breast; tissues of the male and female urogenital system (e.g. ureter, bladder, prostate, testis, ovary, cervix, uterus, vagina); lung; tissues of the gastrointestinal system (e.g., stomach, large and small intestine, colon, rectum); exocrine glands such as the pancreas and adrenals; tissues of the mouth and esophagus; brain and spinal cord; kidney (renal); pancreas; hepatobiliary system (e.g., liver, gall bladder); lymphatic system; smooth and striated muscle; bone and bone marrow; skin; and tissues of the eye.
  • urogenital system e.g. ureter, bladder, prostate, testis, ovary, cervix, uterus, vagina
  • lung tissues of the gastrointestinal system (e.g.,
  • Parkin-associated disorders which are cancerous or tumorigenic include tumors in any prognostic stage of development, for example as measured by the Overall Stage Groupings (also called Roman Numeral) or the Tumor, Nodes, and Metastases (TNM) staging systems.
  • Appropriate prognostic staging systems and stage descriptions for a given cancer are known in the art, for example as described in the National Cancer Institute's "CancerNet” Internet website.
  • Parkin-associated disorders which are cancerous or tumorigenic include cancer cells which are hormone-dependent and cancer cells which are not hormone- dependent.
  • peptide As used herein, the terms "peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds.
  • a protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids which can comprise a protein's or peptide 's sequence.
  • “Pharmaceutically acceptable” means physiologically tolerable, for either human or veterinary applications.
  • compositions include formulations for human and veterinary use.
  • a “polynucleotide” means a single strand or parallel or anti-parallel strands of a nucleic acid.
  • a polynucleotide can be either a single-stranded or a double- stranded nucleic acid.
  • a “prophylactic” or “preventive” treatment is a treatment administered to a subject who does not exhibit signs, or exhibits only early signs, of a Parkin-associated disorder.
  • a prophylactic or preventative treatment is administered for the purpose of decreasing the risk of developing pathology associated with the Parkin-associated disorder.
  • protecting group refers to a terminal amino group of the peptide which is coupled to any of various amino-terminal protecting groups traditionally employed in peptide synthesis.
  • protecting groups include, for example, acyl protecting groups such as formyl, acetyl, benzoyl, trifluoroacetyl, succinyl, and methoxysuccinyl; aromatic urethane protecting groups such as benzyloxycarbonyl; and aliphatic urethane protecting groups, for example, tert-butoxycarbonyl or adamantyloxycarbonyl See Gross and
  • protecting group refers to a terminal carboxyl group of the peptide which is coupled to any of various carboxyl-terminal protecting groups.
  • protecting groups include, for example, tert-butyl, benzyl or other acceptable groups linked to the terminal carboxyl group through an ester or ether bond.
  • sample refers to a biological sample from a subject, including normal tissue samples, tumor tissue samples, blood, urine, or any other source of material obtained from a subject which contains a compound or cells of interest.
  • a "subject,” as used herein, can be a human or non-human animal
  • Non-human animals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals, as well as reptiles, birds and fish.
  • the subject is a human.
  • a "substantially similar amino acid sequence” refers to a peptide or a portion of a peptide which has an amino acid sequence identity or similarity to a reference peptide of at least about 70%.
  • sequence identity is at least about 75%, more preferably at least about 80%>, more preferably at least about 85%, particularly preferably at least about 90%), and more particularly preferably at least about 95%, and most preferably at least about 98%.
  • Amino acid sequence similarity or identity can be computed by using the BLASTP and TBLASTN programs which employ the BLAST (basic local alignment search tool) 2.0.14 algorithm. The default settings used for these programs are suitable for identifying substantially similar amino acid sequences for purposes of the present invention.
  • substantially similar nucleic acid sequence means a nucleic acid sequence corresponding to a reference nucleic acid sequence wherein the corresponding sequence encodes a peptide having substantially the same structure and function as the peptide encoded by the reference nucleic acid sequence; e.g., where only changes in amino acids not significantly affecting the peptide function occur.
  • the substantially similar nucleic acid sequence encodes the peptide encoded by the reference nucleic acid sequence.
  • the percentage of identity between the substantially similar nucleic acid sequence and the reference nucleic acid sequence is at least 10%.
  • the sequence identity is at least about 75%), more preferably at least about
  • Substantial similarity of nucleic acid sequences can be determined by comparing the sequence identity of two sequences, for example by physical/chemical methods (i.e., hybridization) or by sequence alignment via computer algorithm.
  • Suitable nucleic acid hybridization conditions to determine if a nucleotide sequence is substantially similar to a reference nucleotide sequence are: 7% sodium dodecyl sulfate SDS, 0.5 M NaPO 4 , 1 mM EDTA at 50°C with washing in 2X standard saline citrate (SSC), 0.1% SDS at 50°C; preferably in 7% (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50°C with washing in IX SSC, 0.1% SDS at 50°C; preferably 7% SDS, 0.5
  • Suitable computer algorithms to determine substantial similarity between two nucleic acid sequences include, GCS program package (Devereux et al. (1984), Nucl Acids Res. 12:387), and the BLASTN or FASTA programs (Altschul et al. (1990), supra). The default settings provided with these programs are suitable for determining substantial similarity of nucleic acid sequences for purposes of the present invention.
  • substantially purified refers to a peptide or nucleic acid sequence which is substantially homogenous in character due to the removal of other compounds (e.g., other peptides, nucleic acids, carbohydrates, lipids) or other cells originally present.
  • “Substantially purified” is not meant to exclude artificial or synthetic mixtures with other compounds, or the presence of impurities which do not interfere with biological activity, and which may be present, for example, due 1 to incomplete purification, addition of stabilizers, or formulation into a pharmaceutically acceptable preparation.
  • “Synthetic mutant” includes any purposefully generated mutant or variant protein or nucleic acid derived from Parkin, in particular from the amino acid sequence of SEQ ID NO:2. Such mutants can be generated by, for example, chemical mutagenesis, polymerase chain reaction (PCR) based approaches, or primer-based mutagenesis strategies well known to those skilled in the art.
  • treat refers to administering an agent or compound to reduce the frequency with which symptoms of a Parkin- associated disorder are experienced, to reduce the severity of symptoms, or to prevent symptoms from occurring. Treatment can restore the effect of Parkin function or activity which has been lost or diminished in a Parkin-associated disorder.
  • Variant as the term is used herein, is a nucleic acid sequence or a peptide sequence that differs in sequence from a reference nucleic acid sequence or peptide sequence respectively, but retains essential properties of the reference molecule.
  • Changes in the sequence of a nucleic acid variant may not alter the amino acid sequence of a peptide encoded by the reference nucleic acid, or may result in amino acid substitutions, additions, deletions, fusions and truncations. Changes in the sequence of peptide variants are typically limited or conservative, so that the sequences of the reference peptide and the variant are closely similar overall and, in many regions, identical. A variant and reference peptide can differ in amino acid sequence by one or more substitutions, additions, deletions in any combination.
  • a variant of a nucleic acid or peptide can be a naturally occurring such as an allelic variant, or can be a variant that is not known to occur naturally. Non-naturally occurring variants of nucleic acids and peptides may be made by mutagenesis techniques or by direct synthesis.
  • FIGURE 1 A is a physical map of the D6S 1581 -D6S 1008 genomic interval of
  • FIGURE IB represents a Loss of Heterozygosity (LOH) analysis of 6q25-q27 in breast and ovarian cancer, summarizing allelic loss in 6 breast and 4 ovarian malignant tumors with partial deletions at 6q25-q27.
  • LOH Loss of Heterozygosity
  • Each vertical line represents a single case.
  • Black, grey and white circles represent LOH, retention of heterozygosity and non-informative results, respectively.
  • the shared minimal region of loss among informative cases is indicated on the right side between markers D6S1599 and D6S305.
  • FIGURE 2A is a Northern blot analysis of Parkin expression in normal human tissues.
  • FIGURE 2B is a Northern blot analysis of Parkin expression in tumor-derived cell lines.
  • FIGURE 2C is a Western blot analysis of Parkin expression in tumor-derived cell lines and normal breast, ovary, and lung tissue.
  • FIGURE 2D is an electrophoretic analysis of Parkin expression in malignant ovarian and breast tumors by semi-quantitative RT-PCR. Representative results are shown for each sample.
  • FIGURE 3 A demonstrates an electrophoretic analysis of tumor specific Parkin transcripts following PCR amplification of tumor and normal ovarian cDNA. Both wild-type and aberrant transcripts are visible in UPN 66 and UPN 223, while UPN 323 and normal ovary possess only wild-type Parkin.
  • FIGURE 3B is a schematic representation of a normal full length Parkin mRNA and a normal full length 465 amino acid residue Parkin protein.
  • FIGURE 3C is a schematic representation and sequence analysis of the aberrant Parkin transcript "Short Parkin mRNA Variant I” and its predicted truncated protein. Also indicated is the location of primer pairs.
  • FIGURE 3D is a schematic representation and sequence analysis of the aberrant Parkin transcript "Short Parkin mRNA Variant II” and its predicted truncated protein. Also indicated is the location of primer pairs.
  • FIGURE 4A is a PCR analysis of exons 1 through 3 in Calu-3, H-1573, and H-460 lung cancer cell lines and in normal human genomic DNA from peripheral blood lymphocytes (PBLs).
  • PBLs peripheral blood lymphocytes
  • FIGURE 4B is a Southern blot analysis of an EcoRI-Bglll digest of the Parkin gene in tumor cell lines and human PBLs. Blots were hybridized with either a Parkin exon 2 specific probe (top) or the full length Parkin cDNA (bottom). Arrows indicate the absence of the expected 15.3 and 6.5 kb EcoRI and Bglll fragments, respectively.
  • FIGURE 4C is a schematic representation of exon 2 deletions in the lung adenocarcinoma cell lines, Calu-3, and H-1573.
  • FIGURE 5 is a graph comparing the tumorigenicity in nude mice of H-460 lung adenocarcinoma cells which have been transduced with (Parkin- closed diamond) or without (WT- closed square) the Parkin cDNA.
  • the ordinate represents tumor volume and the abscissa represents time (days).
  • FIGURES 6A-6C are schematics summarizing allelic loss in the Parkin/FRA6E locus in various histologic subtypes of lung cancer (see Table 3).
  • FIG. 6 A shows the various regions of human chromosome 6, including the 6q25-q27 region in the distal end of the q arm.
  • FIG. 6B vertical lines labeled with tumor case numbers represent informative cases analyzed for loss or retention of heterozygosity at 5 markers in the 6q25-q27 region. Black, cross-hatched, and white circles represent LOH, retention of heterozygosity, and noninformative results, respectively.
  • the relative positions of the intragenic markers D6S305 and D6S1599 are indicated in FIG. 6C.
  • FIGURE 7 is an electrophoretic analysis of Parkin expression in lung tumors and in normal heart and lung tissue by semi-quantitative RT-PCR. LOH data and the
  • T /NL are shown for each case. NI- Not Informative; HZ- heterozygous; ND- not done.
  • FIGURE 8 A is a graph comparing cell proliferation in vitro of wild type H460 lung tumor cells ("H460 WT”) with cell proliferation in vitro of H460 cells transfected with a lentiviral vector comprising the Parkin gene (“H460 Parkin”) or
  • EGFP H460 EGFP
  • the ordinate represents MTS absorbance units and the abscissa represents time (hours).
  • FIGURE 8B is a graph comparing tumor growth in nude mice implanted with wild type H460 lung tumor cells (“WT”) with tumor growth of H460 cells transfected with a lentiviral vector comprising the Parkin gene (“Parkin”) or EGFP (“EGFP").
  • WT wild type H460 lung tumor cells
  • Parkin Parkin gene
  • EGFP EGFP
  • the ordinate represents tumor volume (minimum of 3 mice/group) and the abscissa represents time (days)
  • the present invention thus provides methods for the diagnosis and treatment of Parkin-associated disorders.
  • All nucleic acid sequences herein are given in the 5' to 3' direction.
  • all deoxyribonucleotides in a nucleic acid sequence are represented by capital letters (e.g., deoxythymidine is "T"), and ribonucleotides in a nucleic acid sequence are represented by lower case letters (e.g., uridine is "u").
  • a Parkin-associated disorder is treated by administering to a subject an isolated Parkin protein, either alone or in combination with other compounds.
  • the Parkin protein completely or partially corrects the loss of proliferation control exhibited by cells associated with a Parkin-associated disorder.
  • loss of proliferation control in cancer cells can be completely or partially corrected by administering an isolated Parkin protein, either alone or in combination with other compounds.
  • loss of proliferation control is prevented in premalignant cancer cells or cells associated with a Parkin-associated disorder that do not exhibit a tumorigenic or neoplastic phenotype, by administering an isolated nucleic acid encoding the Parkin gene or Parkin protein, either alone or in combination with other therapeutic compounds.
  • Biologically active fragments of Parkin can also be used in the present methods.
  • Biologically active Parkin fragments according to the invention can be obtained, for example, by chemical or enzymatic fragmentation of larger natural or synthetic Parkin peptides, or by biological or chemical syntheses as described below.
  • Parkin derivatives of Parkin can also be used in the present methods.
  • the techniques for obtaining Parkin derivatives are within the skill in the art and include, for example, standard recombinant nucleic acid techniques, solid phase peptide synthesis techniques and chemical synthetic techniques as described below.
  • Parkin derivatives can also be obtained by using linking groups to join Parkin (especially SEQ ID NO: 2) or Parkin fragments to other peptides.
  • Linking groups suitable for use in the present invention include, for example, cyclic compounds capable of connecting an amino-terminal portion and a carboxyl terminal portion of SEQ ID NO: 2. Techniques for generating derivatives are also described in U.S.
  • derivatives include, for example, synthetic variants of Parkin.
  • Parkin derivatives also include fusion peptides in which a portion of the fusion peptide has a substantially similar amino acid sequence to SEQ ID NO: 2.
  • Such fusion peptides can be generated by techniques well-known in the art, for example by subcloning nucleic acid sequences encoding SEQ ID NO: 2 and a heterologous peptide sequence into the same expression vector, such that the SEQ ID NO: 2 and the heterologous sequence are expressed together in the same protein.
  • the heterologous sequence can also comprise a peptide leader sequence that directs entry of the expressed protein into a cell.
  • leader sequences include "protein transduction domains" or "PTDs,” which are discussed in more detail below.
  • Biologically active homologs and analogs of Parkin protein can also be used in the present methods.
  • Parkin analogs preferably comprise a structure, called a pharmacophore, that mimics the physico-chemical and spatial characteristics of Parkin, especially of SEQ ID NO: 2.
  • Parkin analogs can be identified by screening a library of pro-analogs designed by the retrosynthetic, target oriented, or diversity- oriented synthesis strategies described by Schreiber (2000 Science 287:1964-1969), the entire disclosure of which is herein incorporated by reference.
  • Retrosynthetic strategies require the identification of key structural elements in a molecule. These elements are then incorporated into the structure of otherwise distinct pro-analogs generated by organic syntheses.
  • U.S. Patent 6,030,942 in particular Example 4 therein, describes retrosynthetic methods for the design and selection of analogs based on key structural elements of a protein.
  • Parkin key structural elements of Parkin can be identified, for example, by evaluating the various portions of Parkin for the ability to mimic or inhibit E3 ubiquitin ligase or to inhibit proliferation of cells (see Examples 1-5 below).
  • Parkin key structural elements can be determined using nuclear magnetic resonance (NMR), crystallographic, and/or computational methods which permit the electron density, electrostatic charges or molecular structure of certain portions of Parkin or fragments thereof to be mapped.
  • Parkin key structural elements comprise the primary, secondary and tertiary structure of the amino acid sequence of SEQ ID NO: 2.
  • pro-analog libraries can be screened for analogs; i.e., compounds exhibiting the ability to mimic or inhibit E3 ubiquitin ligase or to inhibit proliferation of cells (see Examples 1-5 below).
  • analogs i.e., compounds exhibiting the ability to mimic or inhibit E3 ubiquitin ligase or to inhibit proliferation of cells (see Examples 1-5 below).
  • Parkin, and biologically active fragments, derivatives, homologs, and analogs of Parkin protein can be modified to enhance their entry into cells associated with a Parkin-associated disorder.
  • the compounds of the invention can be encapsulated in a liposome prior to being administered.
  • the encapsulated compounds are delivered directly into the abnormally proliferating cells by fusion of the liposome to the cell membrane.
  • Reagents and techniques for encapsulating the present compounds in liposomes are well known in the art, and include, for example, the ProVectinTM Protein Delivery Reagent from Imgenex.
  • the peptide compounds of the invention are modified by associating the compounds with a peptide leader sequence known as a
  • protein transduction domain or "PTD.” These sequences direct entry of the compound into abnormally proliferating cells by a process known as “protein transduction” (Schwarze et al, 1999, Science 285:1569-1572.
  • PTDs are well-known in the art, and can comprise any of the known PTD sequences including, for example, arginine-rich sequences such as a peptide of nine to eleven arginine residues optionally in combination with one to two lysines or glutamines as described in Guis et al. (1999, Cancer Res. 59:2577-2580, the disclosure of which is herein incorporated by reference).
  • Preferred are sequences of eleven arginine residues or the NH 2 -terminal 11 -amino acid protein transduction domain from the human immunodeficiency virus TAT protein.
  • leader sequences include, but are not limited to, other arginine-rich sequences; e.g., 9 to 10 arginines, or six or more arginines in combination with one or more lysines or glutamines.
  • Such leader sequences are known in the art; see, e.g., Guis et al. (1999), supra.
  • the PTD is designed so that it is cleaved from the compound upon entry into the cell.
  • a PTD may be located anywhere on the compound that does not disrupt the compound's biological activity.
  • the PTD is preferably located at the N-terminal end.
  • Kits and methods for constructing fusion proteins comprising a protein of interest (e.g., Parkin) and a PTD are known in the art; for example the Trans VectorTM system (Q-BIOgene), which employs a 16 amino acid peptide called "PenetratinTM” corresponding to the Drosophila antennapedia DNA-binding domain; and the Voyager system (Invitrogen Life Technologies), which uses the 38 kDa VP22 protein from Herpes Simplex Virus- 1.
  • the compounds of the invention which comprise peptides can be synthesized de novo using conventional solid phase synthesis methods.
  • the peptide chain is prepared by a series of coupling reactions in which the constituent amino acids are added to the growing peptide chain in the desired sequence.
  • N-protecting groups e.g., the carbobenzyloxy group or the t- butyloxycarbonyl group
  • various coupling reagents e.g., dicyclohexylcarbodiimide or carbonyldiimidazole
  • various active esters e.g., esters of N-hydroxyphthalimide or N- hydroxy-succinimide
  • various cleavage reagents e.g., trifluoroactetic acid (TFA), HC1 in dioxane, boron tris-(trifluoracetate) and cyanogen bromide
  • reaction in solution with isolation and purification of intermediates are methods well- known to those of ordinary skill in the art.
  • a preferred peptide synthesis method follows conventional Merrifield solid phase procedures well known to those skilled in the art. Additional information about solid phase synthesis procedures can be had by reference to Steward and Young, Solid Phase Peptide Synthesis, W.H. Freeman & Co., San Francisco, 1969; the review chapter by Merrifield in Advances in Enzymology 32:221-296, F.F. Nold, Ed., Interscience Publishers, New York, 1969; and Erickson and Merrifield, The Proteins 2:61-64 (1990), the entire disclosures of which are incorporated herein by reference. Crude peptide preparations resulting from solid phase syntheses may be purified by methods well known in the art, such as preparative HPLC. The amino-terminus may be protected according to the methods described for example by Yang et al, (1990 FEBS Lett. 272:61-64), the entire disclosure of which is herein incorporated by reference.
  • the compounds of the invention which comprise peptides can also be produced by biological synthesis.
  • Biological synthesis of peptides is well known in the art, and includes the transcription and translation of a synthetic nucleic acid encoding a Parkin protein, or a biologically active fragment, derivative, or homolog thereof.
  • Biological syntheses of Parkin, or biologically active fragments, derivatives and homologs thereof can be based on the Parkin nucleic acid sequence (GenBank accession no. AB009973; SEQ ID NO:l) or amino acid sequence (GenBank accession no. BAA25751; SEQ ID NO:2) (Kitada et al, 1998, Nature 392:605-608).
  • the techniques of recombinant DNA teclmology are within the skill in the art. General methods for the cloning and expression of recombinant molecules are described in
  • Parkin and fragments, derivatives, and homologs thereof can be prepared utilizing recombinant DNA techniques, which can comprise combining a nucleic acid encoding the peptide in a suitable vector, inserting the resulting vector into a suitable host cell, recovering the peptide produced by the resulting host cell, and purifying the polypeptide recovered.
  • the nucleic acids encoding Parkin peptides may be operatively linked to one or more regulatory regions. Regulatory regions include promoters, polyadenylation signals, translation initiation signals (Kozak regions), termination codons, peptide cleavage sites, and enhancers.
  • the regulatory sequences used must be functional within the cells into which they are transfected. Selection of the appropriate regulatory region or regions is a routine matter, within the level of ordinary skill in the art.
  • Suitable promoters include both constitutive promoters and regulated (inducible) promoters, and can be prokaryotic or eukaryotic, depending on the host.
  • prokaryotic (including bacteriophage) promoters useful for practice of this invention are: lac, T3, T7, lambda Pr' PI' and tip promoters.
  • eukaryotic (including viral) promoters useful for practice of this invention are: ubiquitous promoters (e.g. HPRT, vimentin, actin, tubulin), intermediate filament promoters (e.g. desmin, neurofilaments, keratin, GFAP), therapeutic gene promoters (e.g.
  • tissue-specific promoters e.g. actin promoter in smooth muscle cells
  • promoters which respond to a stimulus e.g. steroid hormone receptor, retinoic acid receptor
  • tetracycline-regulated transcriptional modulators cytomegalovirus immediate-early, retroviral LTR, metallothionein, SV-40, El a, and MLP promoters.
  • Tetracycline-regulated transcriptional modulators and CMV promoters are described in WO 96/01313, US 5,168,062 and US 5,385,839, the entire disclosures of which are incorporated herein by reference.
  • Suitable polyadenylation signals that can be used in the present invention include SV40 polyadenylation signals and LTR polyadenylation signals.
  • the compounds of the invention can be modified with other substances prior to use in the present methods, using techniques known in the art.
  • a modifying substance can be joined, for example, to the compound of the invention by chemical means (e.g., by covalent bond, electrostatic interaction, Van der Waals forces, hydrogen bond, ionic bond, chelation, and the like) or by physical entrapment.
  • the compounds of the invention can be modified with a label (e.g., substances which are magnetic resonance active; radiodense; fluorescent; radioactive; detectable by ultrasound; detectable by visible, infrared or ultraviolet light).
  • Suitable labels include, for example, fluorescein isothiocyanate, peptide chromophores such as phycoerythrin or phycocyanin and the like; bioluminescent peptides such as the luciferases originating from Photinus pyrali; or fluorescent proteins originating from Renilla reniformi.
  • Compounds of the invention may also be modified with polymeric and macromolecular structures (e.g., liposomes, zeolites, dendrimers, magnetic particles, and metallic beads) or targeting groups (e.g., signal peptide sequences, ligands, lectins, or antibodies).
  • Peptides or peptide fragments can be further modified with end protecting groups at the carboxyl or amino-terminal ends, amino-acid side chain modifying groups, and the like.
  • Modification of the peptides of the invention may alter their activity, for example by altering characteristics such as in vivo tissue partitioning, peptide degradation rate, or ligase activity.
  • the modifications may also confer additional characteristics to the compound, such as the ability to be detected, manipulated, or targeted.
  • functional groups which can be covalently linked to the compounds of the invention comprising peptides include amines, alcohols, or ethers.
  • Functional groups covalently linked to the compounds of the invention which comprise peptides, and which can increase the in vivo half-life of the compounds include polyethylene glycols, small carbohydrates such as sucrose, or polypeptides.
  • the half-life in the blood stream of the compounds of the invention is enhanced by the addition of adducts such as sucrose or polyethylene glycol, production of peptide-IgG chimeras.
  • adducts such as sucrose or polyethylene glycol
  • the compounds of the invention which comprise peptides can also be cyclized via cysteine-cysteine linkages, which is known to enhance the biological activities of a variety of peptides.
  • a polyethylene glycol adduct is (2-aminoethyl)- O'-(N-diglycolyl-2-aminoethyl)-hexaethyleneglycol
  • a polyethylene glycol adduct is added in the form of GK[(2-aminoethyl)- O'-(N-diglycolyl-2-aminoethyl)-hexaethyleneglycol]GG, wherein the dipeptide GK increases peptide solubility and the dipeptide GG is used as a spacer between the solid support and peptide chain to improve the ease of peptide synthesis.
  • the compounds of the invention can be derivatized with functional groups or linked to other molecules to facilitate their delivery to specific sites of action or to potentiate their activity.
  • the compounds of the invention can also be covalently or non-covalently linked to other pharmaceuticals, bioactive agents, or other molecules. Such derivatizations should not significantly interfere with the ubiquitin ligase or other biological properties of the compounds.
  • Carriers and derivatizations of the compounds of the invention should also be designed or chosen so as not to exert toxic or undesirable activities on animals or humans treated with these formulations.
  • Parkin protein is used to inhibit the aberrant growth of cells associated with a Parkin-associated disorder, such as cancer and other proliferative disorders.
  • the invention provides a method of treating a Parkin-associated disorder in a subject in need of such treatment.
  • the method comprises administering an effective amount of a Parkin protein, or biologically active fragment, derivative, homolog or analog thereof to the subject, such that proliferation of cells associated with a Parkin-associated disorder is inhibited.
  • Parkin protein activity is increased.
  • activity is increased by increasing the amount of Parkin protein, or a biologically active fragment, derivative, homolog or analog thereof.
  • to "inhibit the proliferation" of a cell associated with a Parkin- associated disorder means to kill the cell, or permanently or temporarily arrest or impede the growth of the cell
  • Inhibition of cell proliferation can be inferred if the number of cells associated with a Parkin-associated disorder in the subject remains constant or decreases after administration of a compound of the invention.
  • An inhibition of proliferation of cells associated with a Parkin-associated disorder can also be inferred if the absolute number of such cells increases, but the rate of tumor growth decreases.
  • the effect of treatment can be monitored using many cellular, molecular, and clinical techniques, which are known to those of ordinary skill in the art.
  • assays are known in the art which can be used to measure cell proliferation and tumorigenicity in vitro and in vivo. Other methods useful for measuring cell proliferation and tumorigenicity are known to those of skill in the art.
  • the number of cells associated with a Parkin-associated disorder in a subject's body can be determined by direct measurement, or by estimation from the size of primary or metastatic tumor masses.
  • the number of cells associated with a Parkin-associated disorder in a subject can be readily determined by immunohistological methods, flow cytometry, or other techniques designed to detect the characteristic surface markers of a given cell type.
  • the size of a tumor mass can be ascertained by direct visual observation, or by diagnostic imaging methods such as X-ray, magnetic resonance imaging, ultrasound, and scintigraphy. Diagnostic imaging methods used to ascertain size of the tumor mass can be employed with or without contrast agents, as is known in the art.
  • the size of a tumor mass can also be ascertained by physical means, such as palpation of the tissue mass or measurement of the tissue mass with a measuring instrument such as a caliper.
  • a preferred physical means for determining the size of a tumor mass is the digital rectal exam.
  • One skilled in the art can readily determine an effective amount of the Parkin protein, or fragments, derivatives, homologs, or analogs thereof, to be administered to a given subject, by taking into account factors such as the size and weight of the subject; the extent of disease penetration; the age, health and sex of the subject; the route of administration; and whether the administration is regional or systemic.
  • an effective amount of the compounds of the invention can be based on the approximate weight of a tumor mass to be treated.
  • the approximate weight of a tumor mass can be determined by calculating the approximate volume of the mass, wherein one cubic centimeter of volume is roughly equivalent to one gram.
  • An effective amount of the compounds of the invention based on the weight of a tumor mass can be at least about 10 micrograms/gram of tumor mass. More preferably, the effective amount is at least about 100 micrograms/gram of tumor mass. Particularly preferably, the effective amount is at least about 500 micrograms/gram of tumor mass. It is preferred that an effective amount based on the weight of the tumor mass be injected directly into the tumor.
  • an effective amount of the compounds of the invention can also be based on the approximate or estimated body weight of a subject to be treated. Preferably, such effective amounts are administered parenterally or enterally, as described below.
  • an effective amount of the compounds of the invention administered to a subject can range from about 5-500 micrograms/kg of body weight, or between about 500-1000 micrograms/kg of body weight, or is greater than about 1000 micrograms/kg of body weight.
  • an effective amount of a Parkin protein, or fragments, derivatives, homologs, or analogs thereof can be administered to the subject once (e.g., as a single injection or deposition).
  • the compounds of the invention can be administered once or twice daily to a subject for a period of from about three to about twenty-eight days, more preferably from about seven to about ten days.
  • the compounds of the invention are administered once a day for seven days.
  • a dosage regimen comprises multiple administrations
  • the effective amount of a Parkin protein, or fragments, derivatives, homologs, or analogs thereof can comprise the total amount of compound administered over the entire dosage regimen.
  • the compounds of the invention can be administered to a subject by any means suitable for delivering the compounds to cells of the subject, for example by any suitable enteral or parenteral administration route.
  • Suitable enteral administration routes for the present methods include oral, rectal, or intranasal delivery.
  • Suitable parenteral administration routes include intravascular administration (e.g.
  • intravenous bolus injection intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature
  • peri- and intra-tissue injection e.g., peri-tumoral and intra-tumoral injection, intra-retinal injection, or subretinal injection
  • subcutaneous injection or deposition including subcutaneous infusion (such as by osmotic pumps)
  • direct application to the tissue of interest for example by injection, a catheter, or other placement device (e.g., a retinal pellet or a suppository or an implant comprising a porous, non-porous, or gelatinous material); and inhalation.
  • the compounds of the invention are administered by injection or infusion.
  • the compounds are administered locally to the site of the disorder.
  • the Parkin protein, or a fragment, derivative, analog, or homolog thereof is preferably administered by direct injection into the tumor.
  • an effective amount of the Parkin protein, or fragment, derivative or homolog thereof is administered to a subject by delivering an isolated nucleic acid comprising sequences encoding the Parkin protein, or fragment, derivative or homolog thereof to a cell associated with a Parkin-associated disorder.
  • Transfection methods for eukaryotic cells include direct injection of the nucleic acid into the nucleus or pronucleus of a cell; electroporation; liposome transfer or transfer mediated by lipophilic materials; receptor mediated nucleic acid delivery, bioballistic or particle acceleration; calcium phosphate precipitation, and transfection mediated by viral vectors.
  • cells can be transfected with a liposomal transfer compound, e.g., DOTAP (N-[l -(2,3 -dioleoyloxy)propyl]-N,N,N-trimethyl -ammonium methylsulfate, Boehringer-Mannheim) or an equivalent, such as LIPOFECTIN.
  • DOTAP N-[l -(2,3 -dioleoyloxy)propyl]-N,N,N-trimethyl -ammonium methylsulfate, Boehringer-Mannheim
  • nucleic acid used is not critical to the practice of the invention; acceptable results can be achieved with 0.1-100 micrograms of nucleic acid/10 5 cells. For example, a ratio of about 0.5 micrograms of plasmid vector in 3 micrograms of
  • DOTAP per 10 5 cells can be used.
  • a nucleic acid comprising sequences encoding Parkin, or a biologically active fragment, derivative, or homolog thereof, can be obtained using a number of standard techniques. Such nucleic acids can, for example, be chemically synthesized or recombinantly produced using methods known in the art as described above.
  • the nucleic acid sequence of the Parkin gene is provided in GenBank record accession no. AB009973 (SEQ ID NO:l), the entire disclosure of which is herein incorporated by reference.
  • Nucleic acid sequences comprising sequences encoding Parkin protein, or biologically active fragments, derivatives, or homologs thereof can be expressed from recombinant circular or linear DNA plasmids using any suitable promoter.
  • suitable promoters for expressing nucleic acid sequences from a plasmid include the U6 or HI RNA pol III promoter sequences, or the cytomegalovirus promoters. Selection of other suitable promoters is within the skill in the art.
  • the recombinant plasmids suitable for use in the present invention can also comprise inducible or regulatable promoters for expression of nucleic acids in cells associated with a Parkin-associated disorder.
  • plasmids suitable for expressing the Parkin gene are within the skill in the art. See, for example Zeng, Y. et al. 2002, Molecular Cell 9:1327-1333; Brummelkamp, T.R. et al 2002, Science 296:550-553; Miyagishi, M. et al. 2002, Nat. Biotechnol. 20:497-500; Paddison, P.J. et al. 2002, Genes Dev. 16:948-958; Lee, N.S. et al. 2002, Nat. Biotechnol. 20:500- 505; and Paul C.P. et al. 2002, Nat. Biotechnol. 20:505-508, the entire disclosures of which are herein incorporated by reference.
  • a plasmid according to the invention comprises a sequence encoding the Parkin mRNA under the control of the CMV intermediate- early promoter.
  • "under the control" of a promoter means that the nucleic acid sequences encoding Parkin are located 3' of the promoter, so that the promoter can initiate transcription of the Parkin product coding sequences.
  • a nucleic acid comprising sequences encoding Parkin protein, or biologically active fragments, derivatives, or homologs thereof can also be expressed from recombinant viral vectors.
  • the nucleic acids expressed from the recombinant viral vectors can either be isolated from cultured cell expression systems by standard techniques, or can be expressed directly in cells associated with a Parkin-associated disorder. The use of recombinant viral vectors to deliver the Parkin gene to cancer cells is discussed in more detail below.
  • the recombinant viral vectors of the invention can comprise any suitable promoter for expressing the nucleic acid sequences in cells associated with a Parkin associated disorder.
  • suitable promoters include, for example, the U6 or HI RNA pol III promoter sequences, or the cytomegalovirus promoters. Selection of other suitable promoters is within the skill in the art.
  • the recombinant viral vectors suitable for use in the present invention can also comprise inducible or regulatable promoters for expression of Parkin in a cell.
  • Any viral vector capable of accepting and expressing nucleic acid sequences can be used; for example, vectors derived from adenovirus (AV); adeno-associated virus (AAV); retroviruses (e.g., lentiviruses (LV), Rhabdoviruses, murine leukemia virus); herpes virus, and the like.
  • the tropism of the viral vectors can also be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses.
  • an AAV vector of the invention can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like.
  • recombinant viral vectors suitable for use in the invention methods for inserting and expressing nucleic acid sequences, methods of delivering the viral vector to cells associated with a Parkin-associated disorder, and recovery of the expressed sequences are within the skill in the art. For example, see Dornburg, R., 1995, Gene Therap. 2:301-310; Eglitis, M.A. 1988, Biotechniques 6:608-614; Miller, A.D. 1990, Hum Gene Therap. 1:5-14; and Anderson, W.F., 1998, Nature 392:25-30, the entire disclosures of which are herein incorporated by reference.
  • Preferred viral vectors are those derived from AV and AAV.
  • a suitable AV vector, a method for constructing the recombinant AV vector, and a method for delivering the vector into target cells are described in Xia H et al (2002), Nat. Biotech. 20:1006-1010, the entire disclosure of which is herein incorporated by reference.
  • Suitable AAV vectors, methods for constructing the recombinant AV vector, and methods for delivering the vectors into target cells are described in
  • an isolated nucleic acid comprising sequences encoding Parkin protein, or a biologically active fragment, derivative, or homolog thereof can be administered to the subject in conjunction with a delivery reagent.
  • Suitable delivery reagents for administration include the Mirus Transit TKO lipophilic reagent; lipofectin; lipofectamine; cellfectin; or polycations (e.g., polylysine), or liposomes.
  • liposomes are used to deliver isolated nucleic acids comprising sequences encoding Parkin protein, or a biologically active fragment, derivative, or homolog thereof, to a subject. Liposomes can also increase the blood half-life of the nucleic acids.
  • the compounds of the invention, or nucleic acids comprising sequences encoding a Parkin protein or biologically active fragment, derivative, or homolog thereof are encapsulated in liposomes prior to administration to the subject.
  • Liposomes suitable for use in the invention can be formed from standard vesicle-forming lipids, which generally include neutral or negatively charged phospholipids and a sterol such as cholesterol The selection of lipids is generally guided by consideration of factors such as the desired liposome size and half-life of the liposomes in the blood stream. A variety of methods are known for preparing liposomes.
  • the liposomes encapsulating nucleic acids comprising sequences encoding Parkin can comprise a ligand molecule that targets the liposome to a cell associated with a Parkin-associated disorder, such as a breast, ovary, or lung cancer cell.
  • a Parkin-associated disorder such as a breast, ovary, or lung cancer cell.
  • Ligands which bind to receptors prevalent in such cells such as monoclonal antibodies that bind to tumor cell antigens are preferred.
  • the liposomes encapsulating isolated nucleic acids comprising sequences encoding Parkin or a fragment, derivative, or homolog thereof, can also be modified so as to avoid clearance by the mononuclear macrophage system ("MMS") and reticuloendothelial system ("RES").
  • MMS mononuclear macrophage system
  • RES reticuloendothelial system
  • modified liposomes have opsonization- inhibition moieties on the surface or incorporated into the liposome structure.
  • a liposome of the invention can comprise both opsonization-inhibition moieties and a ligand.
  • Opsonization-inhibiting moieties for use in preparing the liposomes of the invention are typically large hydrophilic polymers that are bound to the liposome membrane.
  • an opsonization inhibiting moiety is "bound" to a liposome membrane when it is chemically or physically attached to the membrane, e.g., by the intercalation of a lipid-soluble anchor into the membrane itself, or by binding directly to active groups of membrane lipids.
  • These opsonization-inhibiting hydrophilic polymers form a protective surface layer which significantly decreases the uptake of the liposomes by the MMS and RES; e.g., as described in U.S. Pat. No. 4,920,016, the entire disclosure of which is herein incorporated by reference.
  • Opsonization-inhibiting moieties suitable for modifying liposomes are preferably water-soluble polymers with a number-average molecular weight from about 500 to about 40,000 daltons, and more preferably from about 2,000 to about 20,000 daltons.
  • Such polymers include polyethylene glycol (PEG) or polypropylene glycol (PPG) derivatives; e.g., methoxy PEG or PPG, and PEG or PPG stearate; synthetic polymers such as polyacrylamide or poly N-vinyl pyrrolidone; linear, branched, or dendrimeric polyamidoamines; polyacrylic acids; polyalcohols, e.g., polyvinylalcohol and polyxylitol to which carboxylic or amino groups are chemically linked, as well as gangliosides, such as ganglioside GMi.
  • PEG polyethylene glycol
  • PPG polypropylene glycol
  • synthetic polymers such as polyacrylamide or poly N
  • Copolymers of PEG, methoxy PEG, or methoxy PPG, or derivatives thereof, are also suitable.
  • the opsonization inhibiting polymer can be a block copolymer of PEG and either a polyamino acid, polysaccharide, polyamidoamine, polyethyleneamine, or polynucleotide.
  • the opsonization inhibiting polymers can also be natural polysaccharides containing amino acids or carboxylic acids, e.g., galacturonic acid, glucuronic acid, mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid, alginic acid, carrageenan; aminated polysaccharides or oligosaccharides (linear or branched); or carboxylated polysaccharides or oligosaccharides, e.g., reacted with derivatives of carbonic acids with resultant linking of carboxylic groups.
  • the opsonization-inhibiting moiety is a PEG, PPG, or derivatives thereof. Liposomes modified with PEG or PEG-derivatives are sometimes called "PEGylated liposomes.”
  • the opsonization-inhibiting moiety can be bound to the liposome membrane by any one of numerous well-known techniques.
  • an N- hydroxysuccinimide ester of PEG can be bound to a phosphatidyl-ethanolamine lipid- soluble anchor, and then bound to a membrane.
  • a dextran polymer can be derivatized with a stearylamine lipid-soluble anchor via reductive amination using Na(CN)BH 3 and a solvent mixture such as tetrahydrofuran and water in a 30:12 ratio at 60°C. Liposomes modified with opsonization-inhibiting moieties remain in the circulation much longer than unmodified liposomes.
  • Stealth liposomes are sometimes called “stealth” liposomes.
  • Stealth liposomes are known to accumulate in tissues fed by porous or "leaky” microvasculature. Thus, tissue characterized by such microvasculature defects, for example solid tumors, will efficiently accumulate these liposomes; see Gabizon, et al (1988), Proc. Natl Acad. Sci., USA, 18:6949-53.
  • the reduced uptake by the RES lowers the toxicity of stealth liposomes by preventing significant accumulation of the liposomes in the liver and spleen.
  • liposomes that are modified with opsonization-inhibition moieties are particularly suited to deliver nucleic acids comprising sequences encoding a Parkin protein, or fragment, derivative, or homolog thereof to cells associated with a Parkin-associated disorder.
  • the cells from a subject are transfected with a nucleic acid comprising sequences which encode Parkin or fragments, derivatives, or homologs thereof, and a plasmid expression vector that stably integrates into the cell genome to provide long-term expression of a compound of the invention.
  • Stable integration and expression of transfected nucleic acids can be confirmed by techniques known in the art, such as a Southern blot of genomic DNA using Parkin cDNA (or fragments thereof) as a probe. Stable expression of Parkin mRNA can also be detected by standard Northern blot techniques.
  • the cells of the subject are transfected by administering an isolated nucleic acid comprising sequences which encode Parkin or fragments, derivatives, or homologs thereof, and a plasmid expression vector to the subject.
  • the cells being transfected have been isolated from the subject.
  • the isolated cells can be a mixture of cells, including normal cells, tumor cells, or cells which are predisposed to developing a Parkin-associated disorder.
  • the cells are separated prior to reimplantation by selecting only cells which have incorporated the isolated nucleic acid comprising sequences which encode Parkin or fragments, derivatives, or homologs thereof, and a plasmid expression vector.
  • the cells are reimplanted to purge or displace remaining Parkin- associated disorder cells or to purge cells predisposed to developing a Parkin- associated disorder.
  • the cells are reimplanted because there are only a limited number of cells in the tissue from which they were derived, and there is a need to replace the cells which were removed.
  • the transfected and reimplanted cells are hematopoietic stem cells from a subject who has been diagnosed with a leukemia or lymphoma.
  • cells associated with a Parkin-associated disorder such as breast, ovary or lung cancer cells, are isolated from a subject, transfected with a nucleic acid comprising sequences encoding a Parkin protein, or fragment, derivative, or homolog thereof, and reintroduced into the subject.
  • the invention also provides for the transfection and reimplantation of leukemia or lymphoma cells.
  • the cells associated with a Parkin-associated disorder are melanoma, non-Hodgkin's B-lymphoma, Burkitt's lymphoma, and kidney cancer cells.
  • Techniques for isolating, identifying, separating, and culturing cells associated with a Parkin-associated disorder, such as the tumor and cancer cells discussed above, are within the skill in the art.
  • the isolated cells can be transfected by any suitable technique, as discussed above. After transfection, a portion of the cells can optionally be examined to confirm the presence of appropriate expression levels of the gene products. Once appropriate expression of Parkin has been confirmed, the remaining transfected cells can then be reintroduced into the subject. Transfected cells can be reintroduced into the subject by parenteral methods, including intravenous infusion. Transfected cells can also be reintroduced into the subject by direct injection into a tissue such as bone marrow, or direct injection into a tumor. The transfected cells are preferably reintroduced into the subject in a saline solution or other pharmaceutically acceptable carrier.
  • a suitable number of transfected cells for reintroduction is from about 10 5 to about 10 8 cells per kilogram of subject body weight.
  • the number of transfected cells available for reintroduction can be increased by expanding the cells in culture prior to transfection.
  • the compounds comprising an isolated nucleic acid comprising sequences encoding the Parkin protein, or fragment, derivative or homolog of the Parkin sequence can be administered to a subject by any means suitable for delivering the compounds to cells of the subject, for example by any suitable enteral or parenteral administration route.
  • Suitable enteral administration routes for the present methods include oral, rectal, or intranasal delivery.
  • Suitable parenteral administration routes include intravascular administration (e.g.
  • intravenous bolus injection intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature
  • peri- and intra-tissue injection e.g., peri-tumoral and intra- tumoral injection, intra-retinal injection, or subretinal injection
  • subcutaneous injection or deposition including subcutaneous infusion (such as by osmotic pumps); direct application to the tissue of interest, for example by a catheter or other placement device (e.g., a retinal pellet or a suppository or an implant comprising a porous, non-porous, or gelatinous material); and inhalation.
  • the compounds of the invention are administered by injection or infusion.
  • compounds of the invention are delivered locally to the site of the disorder.
  • the isolated nucleic acid comprising sequences encoding the Parkin protein, or fragment, derivative or homolog of the Parkin sequence is preferably administered by direct injection into the tumor.
  • an effective amount of an isolated nucleic acid comprising a sequence encoding a Parkin protein, or fragments, derivatives, homologs, or analogs thereof, to be administered to a given subject by taking into account factors such as the size and weight of the subject; the extent of disease penetration; the age, health and sex of the subject; the route of administration; and whether the administration is regional or systemic.
  • a preferred method of delivering the isolated nucleic acid to the cells associated with a Parkin-associated disorder is by transfection.
  • Isolated nucleic acids comprising sequences encoding Parkin protein or a biologically active fragment, derivative, or homolog thereof, are preferably formulated as pharmaceutical compositions prior to administering to a subject, according to techniques known in the art.
  • Pharmaceutical compositions of the present invention are characterized as being at least sterile and pyrogen-free.
  • pharmaceutical formulations include formulations for human and veterinary use. Methods for preparing pharmaceutical compositions of the invention are within the skill in the art, for example as described in Remington's Pharmaceutical Science, 17th ed., Mack Publishing Company, Easton, Pa. (1985), the entire disclosure of which is herein incorporated by reference.
  • the present pharmaceutical formulations comprise at least one compound of the invention or at least one isolated nucleic acid comprising sequences encoding Parkin or a fragment, derivative, or homolog thereof (e.g., 0.1 to 90% by weight), or physiologically acceptable salts thereof, mixed with a pharmaceutically-acceptable carrier.
  • the pharmaceutical formulations of the invention can also comprise isolated nucleic acids comprising sequences encoding Parkin protein or a biologically active fragment, derivative, or homolog thereof, which are encapsulated by liposomes and a pharmaceutically-acceptable carrier.
  • Preferred pharmaceutically-acceptable carriers are water, buffered water, normal saline, 0.4% saline, 0,3%) glycine, hyaluronic acid and the like.
  • compositions of the invention can also comprise conventional pharmaceutical excipients and/or additives.
  • Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents.
  • Suitable additives include physiologically biocompatible buffers (e.g., tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (as for example calcium DTP A, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate).
  • Pharmaceutical compositions of the invention can be packaged for use in liquid form, or can be lyophilized.
  • solid pharmaceutically-acceptable carriers can be used; for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and'the like.
  • a solid pharmaceutical composition for oral administration can comprise any of the carriers and excipients listed above and 10-95%, preferably 25%- 75%, of a compound of the invention.
  • a pharmaceutical composition for aerosol (inhalational) administration can comprise 0.01-20%) by weight, preferably 1%-10% by weight, of the compound of the invention encapsulated in a liposome as described above, and a propellant.
  • a carrier can also be included as desired; e.g., lecithin for intranasal delivery.
  • the compounds of the present invention can comprise a pharmaceutically acceptable salt.
  • Suitable acids which are capable of forming such salts with the compounds of the present invention include inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, phosphoric acid and the like; and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, anthranilic acid, cinnamic acid, naphthalene sulfonic acid, sulfanilic acid and the like.
  • Pharmaceutically acceptable carriers include physiologically tolerable or acceptable diluents, excipients, solvents, or adjuvants.
  • compositions are preferably sterile and nonpyrogenic.
  • suitable carriers include, but are not limited to, water, normal saline, dextrose, mannitol, lactose or other sugars, lecithin, albumin, sodium glutamate, cysteine hydrochloride, ethanol, polyols (propylene glycol, polyethylene glycol, glycerol, and the like), vegetable oils (such as olive oil), injectable organic esters such as ethyl oleate, ethoxylated isosteraryl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum methahydroxide, bentonite, kaolin, agar-agar and tragacanth, or mixtures of these substances, and the like.
  • compositions may also contain minor amounts of nontoxic auxiliary pharmaceutical substances or excipients and/or additives, such as wetting agents, emulsifying agents, pH buffering agents, antibacterial and antifungal agents (such as parabens, chlorobutanol, phenol, sorbic acid, and the like).
  • Suitable additives include, but are not limited to, physiologically biocompatible buffers (e.g., tromethamine hydrochloride), additions (e.g., 0.01 to 10 mole percent) of chelants
  • compositions can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions.
  • Pharmaceutical compositions according to the present invention can be prepared in a manner fully within the skill of the art.
  • the invention provides for diagnosing a Parkin-associated disorder, and for screening a subject for a predisposition to develop a Parkin-associated disorder.
  • Detection of a mutated Parkin gene or protein or aberrant expression of a Parkin gene or protein is an indication that a subject has a Parkin-associated disorder or is predisposed to developing a Parkin-associated disorder.
  • Methods for detecting levels of Parkin gene expression in cells are within the skill in the art. For example, the absence of a gene, or the presence of inactivating mutations in a gene, can reduce or eliminate expression of that gene.
  • a deletion or mutation in the Parkin gene can be detected by determining the structure or sequence of the gene in tissue from a subject suspected of having a Parkin-associated disorder, and comparing this with the structure or sequence of the Parkin gene in a sample of unaffected tissue from the subject, or in a sample of tissue from a normal control subject. Such a comparison can be made by any suitable technique known in the art.
  • Parkin gene deletions or mutations can be detected by standard molecular biology techniques, such as Southern blot hybridization of the genomic DNA from a subject using probes for Parkin genes.
  • Other methods for detecting deletions or mutations in Parkin include PCR and single-stranded conformation polymorphism (SSCP) studies.
  • Deletion of the Parkin gene can also be inferred from a loss in heterozygosity of chromosomal markers located at 6q25-q27 which are closely linked to Parkin.
  • a loss in heterozygosity in the D6S2067 and D6S1008 microsatellite markers indicates a loss of the Parkin gene.
  • Methods for determining loss of heterozygosity of chromosomal markers are known to those of ordinary skill in the art.
  • Probes for detecting loss of the entire Parkin gene or fragments of the Parkin gene are derived based on the nucleic acid sequence of the Parkin gene (SEQ ID NO:l; NCBI Accession No. AB009973). Probes can be prepared for the entire sequence or for various parts of the sequence, such as probes corresponding to regions encoding parts of one or more of the twelve exons of the Parkin gene. Probes can also be prepared corresponding to the microsatellite markers D6S411, D6S305, and
  • D6S1599 which are markers for regions within the Parkin gene. Markers D6S411 and D6S305 are located between exons 7 and 8 of the Parkin gene, and marker
  • D6S1599 is located between exons 2 and 3 of the Parkin gene.
  • a mutation is located in at least one of exons 1 to 12. In one aspect, a mutation is between the 3' end of exon 1 and the 5' end of exon 12. In another aspect, a mutation is between the 3' end of exon 2 and the 5' end of exon 10. In yet another aspect, the mutation is a partial deletion of exon 3, a deletion of exons 4 through 9, and a partial deletion in the 5' end of exon 10.
  • the mutation is a deletion of exons 2 through 7.
  • a mutation in the Parkin gene can be a homozygous deletion.
  • the mutation is a hemizygous deletion.
  • a mutation is located in a 5' regulatory region of the gene such as in the promoter.
  • the Parkin gene is mutation between microsatellite markers D6S411 and D6S1599.
  • a mutation can also comprise the satellite markers.
  • the mutation is between microsatellite markers D6S411 and D6S305.
  • the mutation is between microsatellite markers D6S305 and D6S1599.
  • Parkin gene expression can also be determined directly, for example by reverse transcriptase PCR (RT-PCR) of Parkin mRNA, or by detection of the mRNA by Northern blot analysis. RT-PCR and Northern blotting techniques are within the skill in the art.
  • RT-PCR and Northern blotting techniques are within the skill in the art.
  • Various assays also exist for measuring or detecting Parkin protein levels and Parkin protein activity. Assays for determining protein levels are known in the art and include electrophoretic separation and identification, Western blot analysis, peptide digestion, and sequence analysis.
  • Various immunoassays known in the art can be used to measure Parkin protein, fragments, derivatives, or homologs.
  • assays include competitive and non-competitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich” immunoassays, gel diffusion precipitin reactions, Western blots, precipitation assays, in situ immunoassays, complement fixation assays, immunofluorescence assays, and immunoelectrophoretic assays.
  • Parkin protein, its fragments, derivatives, or homologs thereof can be used as an immunogen to generate antibodies which recognize such an immunogen.
  • Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, Fab fragments, and an Fab expression library.
  • Techniques for preparing various kinds of antibodies are known in the art.
  • the antibodies of the invention are useful in assessing the levels of Parkin protein, its fragments, derivatives, or homologs thereof.
  • the antibodies can be used in methods known in the art relating to localization and activity of the protein sequences of the normal or mutated Parkin protein, for imaging these proteins, and for measuring levels thereof in samples derived from a test subject or from a control sample or subject.
  • a primary antibody is detected by detecting a label on a primary antibody which has bound to the desired immunogen.
  • a secondary antibody which has bound to a primary antibody, is detected by detecting a label on the secondary antibody.
  • Many assays are known in the art for labeling and detecting primary and secondary antibodies.
  • assays can be performed to determine the amount of biologically active Parkin protein which is present in a cell or sample.
  • Parkin is a ubiquitin ligase and its activity can be measured using assays known in the art.
  • Parkin ubiquitin-protein ligase activity can be assessed by measuring formation of ubiquitinated protein.
  • a cell or tissue of interest can be lysed in 0.5% Nonidet P-40 and then incubated in 50 mM potassium phosphate buffer (pH 7.4) containing Enzyme El (Affmiti Research Products, Starbucks, UK), UbcH7 protein (3 ⁇ g, Affmiti Research Products), and free ubiquitin (1 ⁇ g, Sigma) (Hyun et al, 2002, J. Biol. Chem. 277:28572-28577). The reaction mixtures are then incubated at
  • ubiquitinated protein 37°C for one hour.
  • the level of ubiquitinated protein is assessed by dot blotting with alkaline phosphatase-conjugated anti-ubiquitin antibody (Santa Cruz Biotechnology), which recognizes free ubiquitin and mono-ubiquitinated proteins.
  • alkaline phosphatase-conjugated anti-ubiquitin antibody Santa Cruz Biotechnology
  • lysates are filtered to remove free ubiquitin. Conjugation is measured using the periodate method and ubiquitination is analyzed by densitometry (Hyun et al, 2002, J.
  • a subject in need of treatment for a Parkin-associated disorder can be identified by obtaining a sample of cells or tissue associated with a Parkin-associated disorder, such as tumor or neoplastic cells (or cells suspected of being tumor or neoplastic) from the subject, and determining whether the expression of Parkin is reduced or absent in at least a portion of the cells, as compared to cells from normal tissue obtained from the subject.
  • Parkin expression in cells or tissue obtained from a subject can be compared to average expression levels of these genes in cells obtained from a population of normal subjects.
  • a subject in need of treatment for breast, ovarian, lung, or other cancers can be readily identified by a physician using standard diagnostic techniques.
  • the invention provides for monitoring the progression of a Parkin-associated disorder in a subject.
  • Progression of a Parkin-associated disorder refers to an advance in the course of the disorder.
  • Subjects who can be monitored include subjects being treated for a Parkin-associated disorder and subjects who have been diagnosed with a predisposition for developing a Parkin-associated disorder.
  • progression of a Parkin-associated disorder in a subject can be monitored by measuring the level of Parkin nucleic acid, Parkin protein, or Parkin protein activity in a sample derived from the subject. A decrease in the level of Parkin nucleic acid, Parkin protein, or Parkin protein activity in the sample, relative to the level present in a sample derived from the subject at an earlier time, indicates that there has been progression the Parkin-associated disorder.
  • progression of a Parkin-associated disorder in a subject can be monitored by measuring the level of mutant Parkin nucleic acid, mutant Parkin protein, or activity of a mutant Parkin protein in the subject.
  • the method comprises measuring the level of mutant Parkin nucleic acid, mutant Parkin protein, or activity of mutant Parkin protein in a sample derived from the subject.
  • the invention should not be construed to be limited solely to the assays and methods described herein, but should be construed to include other methods and assays as well.
  • One of skill in the art will know that other assays and methods are available to perform the procedures described herein.
  • Tumor samples and matching peripheral blood and/or normal adjacent tissue specimens were obtained from patients undergoing cancer surgery, according to Institutional Review Board-approved protocols. Tumor and normal tissue specimens were snap frozen while blood was separated and DNA isolated from lymphocytes. A portion of the tissue specimens was assessed for tumor content by histology, and only tissue with >60% tumor cells were used. All cell lines were purchased from the American Type Culture Collection
  • LOH Loss of Heterozygosity
  • LOH was defined for those samples that had XL OH values less than 0.7 or allele loss of approximately 40%. Allelic loss was scored by two independent observers and confirmed at least twice for each marker. Mapping of chromosome 6q25-q27 region.
  • Sequences from BAC/PAC clones mapping to chromosome 6q25-q27 were obtained by searching the National Center for Biotechnology Information (NCBI) database at its website.
  • NCBI National Center for Biotechnology Information
  • a 3.5 Mb sequence "contig" was assembled which encompassed a genomic interval defined by 8 microsatellite markers (FIG. 1A and Table 1). The contig encompassed the D6S1581 and D6S1008 interval at 6q25-q27
  • FIG. 1 A No gaps were found to be present within the contig and the localization of each microsatellite marker was verified by sequence alignment.
  • Basic Local Alignment Search Tool (BLAST ® ) analysis of the assembled contig identified the position of both known and predicted genes relative to the location of each microsatellite marker. Sequence analysis led to the identification of 8 genes aligning to the consensus of this contig, including the previously identified E3 ubiquitin ligase, Parkin. Markers D61599, D6S305, and D6S411 were found to localize within Parkin introns 2 and 7, respectively (FIG. 1 A).
  • Ovarian tumors UPN 79 and UPN 272 defined the centromeric and telomeric boundaries of the deleted region, respectively, and case UPN 323 allowed identification of an even smaller common region of LOH around microsatellite marker D6S1599.
  • Results from the LOH analysis of the breast tumors showed a commonly deleted region between markers D6S305 and D6S1599 defined by tumors UPN 425 (centromeric end) and UPN 411 (telomeric end). This region of loss was more precisely defined by sample UPN 395, which demonstrated LOH at marker D6S305 while retaining heterozygosity at the D6S1579 and D6S1599 loci.
  • Northern Blot Analysis Multiple Tissue Northern blots and normal tissue poly(A)+ RNA were purchased from Clontech. The tissues included spleen, thymus, prostate, testis, ovary, small intestine, colon, peripheral blood lymphocytes (PBL), heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas. Poly(A)+ RNA from cultured cell lines was extracted using the MACS mRNA Isolation Kit (Miltenyi Biotec), according to the manufacturer's instructions. Four ⁇ g of each poly(A)+ RNA sample was electrophoretically resolved on 0.8% denaturing agarose gels and transferred to a nylon membrane in 20X SSC. Blots were hybridized with a
  • the membranes were blocked overnight in 5% nonfat dried milk in Tris-buffered saline with Tween (TBST) and incubated with a polyclonal Parkin antibody (Cell Signaling) for 1 to 3 hours in blocking solution. Expression was detected using the ECL Western Blotting
  • RNA obtained from frozen tumor biopsies was reverse transcribed into cDNA as described above.
  • Five ⁇ l of cDNA were amplified in a 25 ⁇ l reaction mixture containing 0.04 U of Taq DNA polymerase (Roche), 0.4 mM dNTPs, IX buffer containing 1.5 mM MgCl 2 (Roche), 0.18 ⁇ M of each primer specific for Parkin (Park Fw/Park659Rw) and 0.03 ⁇ M of primers specific for ⁇ -actin (Applied Biosystems).
  • PCR amplifications were performed for 25 cycles (94°C for 30", 58°C for 30", and 72°C for 30") followed by one extension cycle of T at 72°C.
  • Primers (ParkFw/Park659Rw) were designed to specifically amplify transcripts of the human Parkin gene.
  • a set of primers specific for the ⁇ -actin gene (Applied Biosystems) was included in each reaction as an internal control.
  • PCR products were separated on 2.0%) agarose gels and transferred by blotting to nylon membranes using standard conditions (Zhang, Y., et al, 2000 Proc. Natl Acad. Sci. USA 97:13354- 13359).
  • Membranes were hybridized with a fragment corresponding to the full length Parkin cDNA labeled with [ - 32 P]dCTP by random priming using the Prime It II Labeling Kit (Stratagene).
  • blots were re-hybridized with a ⁇ -actin specific probe.
  • Parkin and ⁇ -actin RT-PCR products were quantified with the Personal Densitometer SI (Molecular Dynamics) and Image Quant Software (Version
  • Parkin Expression Analysis The relative values of Parkin expression were determined by calculating the ratio of normalized expression levels with that of the corresponding normal tissue. Criteria for overexpression or reduced expression were a ratio of above 1.5 or below 0.5, respectively. Parkin Expression Analysis.
  • Parkin mRNA Expression levels of Parkin mRNA were analyzed in 24 tumor-derived cell lines and a panel of normal tissues (FIGS. 2A and 2B). Results A major transcript of 4.5 kb was detected in all human tissues examined with the exceptions of thymus and peripheral blood lymphocytes. In addition, two smaller transcripts of 2.0 kb and 4.0 kb were identified in testis and kidney, respectively. mRNA from tumor-derived cell lines exhibited varying levels of Parkin expression, from no detectable expression in 18 out of 24 (75%) cases, to almost normal levels in MDA-MB-468, SK-OV-3, and H-211, relative to each normal tissue. One exception was the lung adenocarcinoma cell line, H-460, where an elevated amount of the Parkin transcript was observed.
  • Parkin expression was analyzed in a series of ovarian and breast tumors by semi-quantitative RT-PCR (FIG. 2D). Twenty-seven out of 38 (71%) tumor tissues showed decreased or no expression of Parkin transcript relative to normal ovary or breast tissue. Nine out of 38 samples (24%) showed nearly identical levels of expression while 2 out of 38 (5%) cases demonstrated an increased level of expression (Table 2).
  • the common region of loss identified in the LOH analysis defined by the microsatellite markers D6S305 and D6S1599 involves Parkin exons 2 through 10, indicating that the tumor-specific aberrant transcripts shown in FIG. 3B are the result of genomic deletions. Translation of each of these altered transcripts, if it occurs, would likely result in a prematurely terminated protein encoding for a Parkin protein that does not contain the RING and IBR functional domains (Shimura, H., et al, 2000 Nat. Genet 25:302-305, Imai, Y., et al, 2000 J. Biol Chem. 275:35661-4).
  • PCR Polymerase chain reactions
  • Primer pairs are as follows: Park Fw/Park659Rw (5'- AACATCATCCCAGCAAGATG-3') (SEQ ID NO:5), Park508Fw (5'- GTCCAGCAGGTAGATCAATC-3') (SEQ ID NO:6)/Parkl046Rw (5'- GTACCGGTTGTACTGCTCTT-3') (SEQ ID NO:7) and Park929Fw (5'- GTTTGTTCACGACCCTCAAC-3') (SEQ ID NO:8)/ParkORFRw.
  • DNA sequencing was carried out as described (Ohta et al, 1996 Cell 84:587-597; Inoue et al, 1997 Proc. Natl Acad. Sci.
  • RT-PCR followed by direct sequencing of the full-length Parkin cDNA was performed in all of the tumor-derived cell lines and each of the invasive breast tumors and ovarian adenocarcinomas available for analysis. Results Aberrant RT-PCR products (truncated deletions) were identified in 3 out of
  • FIG. 3 A A schematic of normal (wild-type) Parkin full length mRNA and protein is provided in FIG. 3B. Sequence analysis of the aberrant transcripts revealed the absence of sequences between exons
  • Genomic DNA was extracted from cell or tissue samples according to standard procedures (Joseph Sambrook, D. W. R. 2001 Molecular
  • exon 2 specific probe was generated by PCR of normal genomic DNA using the primers Ex2Fw (5'-ATGTTGCTATCACCATTTAAGGG-3') (SEQ ID NO:9) and Ex2Rw (5*-AGATTGGCAGCGCAGGCGGCATG-3') (SEQ ID NO: 10). PCR fragments were gel purified and labeled with [ ⁇ - P]dCTP as described above. Membranes were pre-hybridized and hybridized in the PerfectHyb-Plus solution (SIGMA), washed, and exposed overnight to X-Omat autoradiographic film (Kodak) at -80°C.
  • SIGMA PerfectHyb-Plus solution
  • the LOH studies described herein indicate homozygous deletions play a role in both the inactivation of Parkin gene expression, as well as in the expression of several aberrant transcripts observed in the malignant ovarian and breast tumors analyzed.
  • homozygous deletions of Parkin exon 2 have been identified in the Calu-3 and H- 1573 lung adenocarcinomas cell lines (FIGs. 4A and 4B). Parkin expression was absent in these two lung adenocarcinoma tumor-derived cell lines (FIG. 2B).
  • loss of expression may either depend on unidentified alterations of the genomic structure or alternative epigenetic mechanisms (Jones, P. A.
  • H-460 lung adenocarcinoma cells were transfected with or without a Parkin full-length cDNA using lentiviral provirus and packaging constructs. Polyclonal populations of H-460 cells which had been transduced with or without (WT) the
  • Parkin cDNA were tested for their ability to form tumors in nude mice.
  • LOH Loss of Heterozygosity
  • PCR cycles included one cycle of 95°C for 10 minutes followed by 35 cycles of 94°C for 30 seconds, 57°C for 30 seconds, 72°C for 30 seconds, and a final extension step of 72°C for 10 minutes in a Perkin-Elmer Gene Amp PCR system 9600.
  • ⁇ -actin amplification served as a control for cDNA quality. PCR products were separated on a 1.0%) agarose gel. Parkin and ⁇ -actin RT-PCR products were quantified with the Personal Densitometer SI (Molecular Dynamics) and
  • IMAGEQUANT software Version 5 (Molecular Dynamics).
  • the relative values of Parkin expression were determined by calculating the ratio of normalized expression levels with that of the corresponding normal tissue. The criteria for overexpression or reduced expression was a ratio of >1.5 or ⁇ 0.5, respectively.
  • Three out of nine tumor tissue samples (33%) showed either decreased expression or no expression of Parkin transcripts, relative to normal lung tissue.
  • Five out of nine tumor tissue samples (55%>) showed nearly identical levels of Parkin expression relative to normal tissue.
  • One of the tumor tissue samples (11%) demonstrated an increased level of Parkin expression (FIG. 7).
  • Sample 66T which retained heterozygosity of the Parkin locus
  • sample 86T which lost heterozygosity of the Parkin locus, both showed a reduction in Parkin gene expression.
  • PCR amplification was carried out in 25 ⁇ l reactions, containing 30 ng of DNA, 2 units of AmpliTaq Gold (PE Applied Biosystems), 1.5 mM dNTPs mix, IX PCR Buffer, 2.5 mM MgCl 2 (PE Applied Biosystems) and 0.5 ⁇ M each primer. PCR cycles included one cycle of 95°C for 10 minutes, followed by 35 cycles of 94°C for
  • PCR products were resolved on TBE-2%> agarose and gel purified by using the Qiagen gel extraction kit (Qiagen, Valencia, CA) for direct sequencing. Primer pairs were as follows: ParkFw (CCAGTGACCATGATAGTGTT; SEQ ID NO:3)/ParkORFRw
  • a 541-bp region including the first Parkin exon, was amplified.
  • Bisulfite sequencing was performed on the amplified product and PCR products were purified and directly sequenced by standard techniques in order to determine average methylation levels. No differences in the methylation pattern between the normal and tumor
  • RT-PCR followed by direct sequencing of the full-length Parkin was performed in lung tumor samples. No point mutations or truncations were found in any of the cases tested.
  • Transient transfections of pNaldini.CMV.IRES.EGFP or pNaldini.CMV.PARKINHA.IRES.EGFP and packaging vectors into 293FT cells was performed by the calcium phosphate precipitation method using the ProFection Mammalian Transfection System (Promega) according to the manufacturer's instructions.
  • Viruses were pseudotyped with the vesicular stomatitis virus glycoprotein (VSVG) using the pVSV-G vector (Clontech). Viral supernatants were collected after 48 hours and 72 hours, filtered, and snap-frozen in liquid nitrogen.
  • Titers were determined by infecting 293FT cells with serial dilutions of virus supplemented with polybrene (Sigma) at a final concentration of 8.0 ⁇ g/ml. Infectivity was determined by GFP expression of target cells by flow cytometry
  • Transduction units were expressed as a percentage of GFP positive cells relative to the total number of cells analyzed.
  • conditioned media collected from transfections performed in T-175 flasks (Becton Dickinson) seeded with 5 x 10 6 293FT cells yielded approximately 1-10 x 10 7 TU/ml Subsequently, infections of target cells were performed in order to achieve between 90 and 100% GFP positive cells.
  • H460 wild type cells or H460 cells transfected with the Parkin expression vector or EGFP expression vector were harvested 24 and 48 hours post-transduction, washed in PBS and fixed in ethanol Following RNAse treatment (Roche), cells were stained with 50 ⁇ g/ml of propidium iodide (Molecular Probes). All samples were analyzed by flow cytometry (FACSCalibur, Becton Dickinson Immunocytometery Systems) and the FlowJo Version 3.4 Software Package (Tree Star, Inc., San Carlos, CA). Cell proliferation was measured using the Cell Titer 96 Aqueous One Solution Cell Proliferation Assay (MTS) according to the manufacturer's directions (Promega). Infection efficiencies of greater than 90% were observed in H460 cells using recombinant lentiviruses containing Parkin or EGFP alone. Typically, Parkin and
  • EGFP gene expression levels stabilized 48 hours post infection and continued for several weeks (>12 weeks). No cytotoxic effects or changes in growth characteristics and cell cycle were observed in transfected H460 cells (FIG. 8A).
  • Tumor cells transduced with virus particles containing Parkin or EGFP alone showed no significant differences in their ability to proliferate in vitro over the course of 96 hours (FIGS. 8A). High levels of ectopic Parkin gene expression were maintained in nearly 100%) of the cells examined by flow cytometry and Western analysis prior to injection.
  • the data show a decreased rate of tumor growth in the animals receiving H460 cells infected with the Parkin-expressing virus.
  • Tumor volume of H460 cells infected with the Parkin-expressing virus is reduced three-four fold relative to the tumor volume of animals injected wild type H460 cells or to H460 cells infected with the
  • FIG. 8B EGFP expressing virus

Abstract

Methods and compositions are provided for the diagnosis and treatment of Parkin-associated disorders such as certain cancers and non-cancerous proliferative diseases. Compounds comprising Parkin protein and biologically active fragments, derivatives, or homologs thereof, as well as nucleotide sequences encoding these compounds, can be used in the diagnosis and treatment of Parkin-associated disorders. Also provided are methods and compositions for the diagnosis of a predisposition for developing a Parkin-associated disorder.

Description

METHODS AND COMPOSITIONS FOR DIAGNOSIS AND THERAPY OF PARKIN-ASSOCIATED DISORDERS
Reference to Government Grant
This invention was supported in part by grant number P30 CA06927 from the National Cancer Institute. The U.S. Government has certain rights in this invention.
Field of the Invention The invention relates to treatment and diagnosis of cancers and other diseases associated with defects in the Parkin gene or with aberrant regulation of Parkin expression. More specifically, the invention relates to the role of Parkin as a tumor suppressor gene, and methods to correct loss of Parkin expression or to correct aberrant Parkin expression. The invention further relates to methods of diagnosing Parkin-associated disorders, as well as identifying cells or subjects who are predisposed to developing a Parkin-associated disorder.
Background of the invention
Tumorigenesis is the result of a multi-step process resulting in genetic alterations that drive the progressive transformation of normal cells into malignant derivatives (Hanahan, D. et al., 2000 Cell 100:57-70). Tumor suppressor genes (TSG) are defined as genetic elements whose loss or mutational inactivation allows or causes cells to acquire a neoplastic phenotype (Hinds, P. W. et al., 1994 Curr. Opin. Genet. Dev. 4:135-41). Frequent loss of heterozygosity ( OH) within genetically-defined chromosomal regions can indicate the presence of a putative
TSG (Lin, J. C, et al, 1996 Oncogene 13:2001-2008, Knudson, A. G. 1993 Proc. Natl. Acad. Sci. USA 90:10914-10921).
Another mechanism for inactivation of tumor suppressor genes is biallelic inactivation. Biallelic inactivation of a TSG can occur by several mechanisms, including chromosomal deletion of both alleles. Although uncommon, homozygous deletion (HD) is occasionally observed in primary tumors and cell lines from different cancers. HDs usually span relatively short genomic regions and have been instrumental in the identification of several TSGs, such as FHIT, RBI, and WT1 (Ohta, M., et al. 1996 Cell 84:587-97, Benedict, W. F., et al, 1983 Science 219:973- 975, Gessler, M., et al, 1990 Nature 343:774-8).
The Parkin gene was initially identified in four Japanese families affected by autosomal recessive juvenile Parkinsonism (AR-JP) (Kitada, T., et al, 1998 Nature
392:605-608). In individuals affected with AR-JP, the Parkin gene is inactivated by point mutations, or more frequently, by exon deletions or alteration (Mizuno, Y., et al., 2001, Curr. Opin. Neural. 14:477-82; Kitada, T., et al, 1998, Nature 392:605- 608). Functional analysis has shown that the Parkin protein is an E3 ubiquitin ligase, and its involvement in protein degradation is under study (Hyun et al., 2002, J. Biol.
Chem., 277:28572-28577; Zhang, Y., et al., 2000, Proc. Natl. Acad. Sci. USA 97:13354-13359).
The Parkin gene maps to the long arm of chromosome 6 (6q25.2-q27) (Kitada, T., et al., 1998 Nature 392:605-608). To date, eight genes have been mapped to the 6q25.2-q27 chromosomal region, a region involved in loss of heterozygosity in cancer: mannose-6-phosphate/insulin-like grow factor 2 receptor (M6P/IGFF2R) (De Souza, A. T., et al, 1995 Oncogene 10:1725-9), apolipoprotein-A (LPA) (McLean, J. W., et al, 1987 Nature 330:132-7), plasminogen (PLG) (Forsgren, M., et al, 1987 FEBS Lett. 213:254-60), mitogen-activated protein kinase 4 (MAP3K4) (Mita et al., 2002 Mol. Cell. Biol. 22:4544-4555), Parkin (Kitada, T., et al., 1998 Nature 392:605-
608) and solute carrier 22 members 1, 2, and 3 (SLC22A1, SLC22A2 and SLC22A3, respectively) (Koehler, M. R., et al, 1997 Cytogenet. Cell Genet. 79:198-200).
The Parkin gene spans approximately 43% of the 6q25.2-q27 segment and has been shown to contain several characterized familial deletions (Mizuno, Y., et al., 2001 Curr. Opin. Neurol. 14:477-82). The Parkin gene consists of 12 exons and large introns, with an overall average size of 125 kb (Asakawa, S., et al., 2001 Biochem. Biophys. Res. Commun. 286:863-868).
The Parkin protein has been classified as a RING fmger E3 ligase containing 465 amino acids, which ubiquitinates itself (Imai, Y., et al., 2000 J. Biol. Chem. 275:35661-4) and is involved in the degradation of the synaptic vesicle-associated protein CDCrel-1 (Zhang, Y., et al, 2000 Proc. Natl. Acad. Sci. USA 97:13354- 13359) and the membrane protein Pael-R (Imai, Y., et al, 2001 Cell. 105:891-902). More recently, a physical and functional interaction between Parkin and CHIP, a protein which has multi-ubiquitin chain assembling enzyme E4-like activity, has been reported (Imai, Y., et al, 2002 Mol. Cell. 10:55-67). Moreover, other E3 RING ligases such as MdM2 (Geyer, R. K., et al, 2000 Nat. Cell Biol. 2:569-73) and Pare
(which has strong structural similarity to Parkin; Nikolaev, A. Y., et al., 2003 Cell 112:29-40) have been implicated in the regulation of p53 function by controlling p53 nuclear export and ubiquitination (Geyer, R. K., et al., 2000 Nat. Cell Biol. 2:569-73, Boyd, S. D., et al, 2000 Nat. Cell Biol. 2:563-8) and sub-cellular localization (Nikolaev, A. Y., et al, 2003 Cell 112:29-40).
Deletion in the long arm of chromosome 6 is associated with the occurrence of several solid tumors, including carcinomas of the ovary (Saito, S., et al, 1996 Cancer Res. 56:5586-5589, Tibiletti, M. G., et al, 1996 Cancer Res. 56:4493-4498), breast (Orphanos, V., et al, 1995 Br. J. Cancer 1:290-3), kidney (Morita, R., et al, 1991 Cancer Res. 51 :5817-20), and lung (Kong, F. M., et al, 2000 Oncogene
19:1572-1578); melanoma (Millikin, D., et al, 1991 Cancer Res. 51:5449-53); and of hematological cancers such as acute lymphoblastic leukemia (Hayashi, Y., et al, 1990 Blood 76:1626-30), Burkitt's lymphoma (Parsa, N. Z., et al, 1994 Genes Chromosomes Cancer 9:13-18) and Non-Hodgkin's B-cell lymphoma (Gaidano, G., et al, 1992 Blood 80:1781-1787). In addition, microcell-mediated transfer of human chromosome 6 suppresses tumorigenicity in two breast cancer cell lines (Negrini, M., et al, 1994 Cancer Res. 54:1331-6) and reduces the tumorigenicity of several melanoma cell lines (Trent, J. M., et al, 1990 Science 247:568-71). Similarly, introduction of an intact human chromosome 6 into the breast cancer cell line MCF- 7 (Negrini, M., et al, 1994 Cancer Res. 54 1331-1336) and into the mouse BK virus-transformed cell line pRPcTlssl restores ability of these cells to senesce (Gualandi, F., et al, 1994 Genes Chromosomes Cancer 10:77-84).
Loss of heterozygosity (LOH) analysis of the long arm of chromosome 6 has identified several regions of loss: 6q21-q23 (Sheng, Z. M.5 et al, 1996 Br. J. Cancer 73:144-147), 6q25.1-q25.2 (Colitti, C, et al, 1998 Oncogene 16:555-559) and 6q25- q27 (Tibiletti, M. G., et al, 1996 Cancer Res. 56:4493-4498, Cooke, I. E., et al, 1996 Genes Chromosomes Cancer 15:223-33). Moreover, deletions at 6q27 are present in benign ovarian tumors (Tibiletti, M. G., et al, 1998 Oncogene 16:1639-1642). Chromosomal region 6q25-q27 is frequently deleted in a wide spectrum of human neoplasms, such as melanoma, ovarian cancer, breast cancer, non-Hodgkin's B-cell lymphoma and several others (Kong, F. M., et al, 2000 Oncogene 19:1572-1578,
Millikin, D., et al, 1991 Cancer Res. 51 :5449-53, Gaidano, G., et al, 1992 Blood 80:1781-7. 14, Sheng, Z. M., et al, 1996 Br. J. Cancer 73:144-147, Cooke, I. E., et al, 1996 Genes Chromosomes Cancer 15:223-33).
Chromosomal region 6q25-q27 also contains one of the most active chromosomal fragile sites of the human genome, FRA6E (Smith, D. I., et al, 1998
Int. J. Oncol 12:187-196). Other active fragile sites such as FRA3B and FRA16D have been shown to co-localize with the tumor suppressor genes FHIT and WWOX, respectively (Ohta, M., et al. 1996 Cell 84:587-97; Paige, A. J., et al, 2001 Proc. Natl Acad. Sci. USA 98:11417-11422). In addition, the FHIT and WWOX genetic loci each cover a large genomic region; FHIT is approximately 1.8 Mb (Inoue, H., et al,
1997 Proc. Natl Acad. Sci. USA 94:14584-9, Mimori, K., et al, 1999 Proc. Natl Acad. Sci. USA 96:7456-6) while WWOX is larger than 1.0 Mb (Bednarek, A. K., et al, 2000 Cancer Res. 60:2140-2145). Chromosomal fragile sites may therefore harbor large tumor suppressor genes. Although the studies described above indicate that the 6q25-27 chromosomal region harbors a tumor suppressor gene, a role for the Parkin gene in cancer has not been suggested.
There is a need for methods of diagnosing and treating cancers and other disorders which are associated with defects or deletions in the chromosomal region 6q25-27, in particular the Parkin gene. The present invention satisfies those needs.
There is also a need for methods of diagnosing and treating disorders involving aberrant expression of the Parkin gene, or the expression of an inactive Parkin protein. Summary of the Invention
The invention is based on the surprising discovery that the Parkin gene, which is known to be involved in Parkinson's Disease, is a tumor suppressor gene. The Parkin protein can be used to restore normal growth characteristics to tumor cells, and reduction or absence of the Parkin protein in a cell, or the presence of an abnormal
Parkin protein in a cell, is indicative of a Parkin-associated disorder, as hereinafter defined.
The invention thus provides a method of treating a Parkin-associated disorder in a subject in need of such treatment, comprising administering an effective amount of a composition comprising a Parkin protein, or a biologically active fragment derivative or homolog thereof, or at least one isolated nucleic acid comprising a nucleic acid sequence encoding a Parkin protein, or a biologically active fragment, derivative, or homolog thereof.
The invention further provides a method of treating a Parkin-associated disorder in a subject in need of such treatment, comprising the steps of isolating cells associated with a Parkin-associated disorder from the subject, transfecting the cells with an isolated nucleic acid comprising a nucleic acid sequence encoding a Parkin protein, or a biologically active fragment or homolog thereof, and reimplanting the transfected cells into the subject, such that proliferation of cells associated with a Parkin-associated disorder is inhibited. Expression of the isolated nucleic acid or stable integration of the isolated nucleic acid into the genome of the transfected cell can be confirmed prior to reimplantation of the transfected cells into the subject.
The invention also provides a pharmaceutical composition for treating a Parkin-associated disorder, comprising a Parkin protein, or a biologically active fragment derivative or homolog thereof, or at least one isolated nucleic acid comprising a nucleic acid sequence encoding a Parkin protein, or a biologically active fragment or homolog thereof, and a pharmaceutically acceptable carrier.
In one embodiment, the invention provides a method of diagnosing a Parkin- associated disorder or screening for a predisposition for developing a Parkin- associated disorder in a subject. The method comprises measuring the dosage or copy number of the Parkin gene, or determining the level of Parkin nucleic acid, in a sample derived from the subject. A Parkin gene dosage of one or zero indicates the presence of a Parkin-associated disorder or a predisposition for developing a Parkin- associated disorder. In another aspect, a lower level of Parkin nucleic acid in the sample, relative to the level of Parkin nucleic acid in an analogous sample from a control subject not having the Parkin-associated disorder, indicates the presence of a
Parkin-associated disorder or a predisposition for developing a Parkin-associated disorder.
The invention further provides a method for diagnosing a Parkin-associated disorder comprising analyzing Parkin gene sequences from cells derived from a subject for a mutation in the Parkin gene sequences. Detection of one or more mutations in a Parkin nucleic acid sequence in the sample indicates the presence of a Parkin-associated disorder or a predisposition for developing a Parkin-associated disorder.
The invention further provides a method of diagnosing a Parkin-associated disorder or screening for a predisposition for developing a Parkin-associated disorder in a subject, comprising measuring the level of Parkin protein or Parkin protein activity in a sample derived from a subject. A lower level of Parkin protein or activity in the sample, relative to the level of Parkin protein or activity in a control sample, indicates that the subject has a Parkin-associated disorder or a predisposition for developing a Parkin-associated disorder. In one aspect of the invention, the Parkin protein activity is ubiquitin ligase activity.
Abbreviations and Short Forms
The following abbreviations and short forms are used in this specification. "AR-JP" means autosomal recessive juvenile parkinsonism.
"HD" means homozygous deletion.
"HSC" means hemopoietic stem cell.
"IBR" means in-between ring.
"LOH" means loss of heterozygosity. "PBL" means peripheral blood leukocyte.
"PCR" means polymerase chain reaction. "PTD" means protein transduction domain.
"RT-PCR" means reverse transcriptase polymerase chain reaction.
"TSG" means tumor suppressor gene.
Definitions
The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element. As used herein, each "amino acid" is represented by the full name thereof, by the three letter code corresponding thereto, or by the one-letter code corresponding thereto, as indicated in the following table:
Full Name Three-Letter Code One-Letter Code
Aspartic Acid Asp D
Glutamic Acid Glu E
Lysine Lys K
Arginine Arg R
Histidine His H
Tyrosine Tyr Y
Cysteine Cys C
Asparagine Asn N
Glutamine Gin Q
Serine Ser s
Threonine Thr T
Glycine Gly G
Alanine Ala A
Valine Val V
Leucine Leu L
Isoleucine lie I
Methionine Met M Proline Pro P
Phenylalanine Phe F
Tryptophan Trp W
The expression "amino acid" as used herein is meant to include both natural and synthetic amino acids, and both D and L amino acids. "Standard amino acid" means any of the twenty L-amino acids commonly found in naturally occurring peptides. "Nonstandard amino acid residues" means any amino acid, other than the standard amino acids, regardless of whether it is prepared synthetically or derived from a natural source. As used herein, "synthetic amino acid" also encompasses chemically modified amino acids, including but not limited to salts, amino acid derivatives (such as amides), and substitutions. Amino acids contained within the peptides of the present invention, and particularly at the carboxy- or amino-terminus, can be modified by methylation, amidation, acetylation or substitution with other chemical groups which can change a peptide's circulating half life without adversely affecting activity of the peptide. Additionally, a disulfide linkage may be present or absent in the peptides of the invention.
The term "amino acid" is used interchangeably with "amino acid residue," and may refer to a free amino acid and to an amino acid residue of a peptide. It will be apparent from the context in which the term is used whether it refers to a free amino acid or a residue of a peptide.
Amino acids have the following general structure:
Figure imgf000010_0001
Amino acids are classified into seven groups on the basis of the side chain R:
(1) aliphatic side chains, (2) side chains containing a hydroxylic (OH) group, (3) side chains containing sulfur atoms, (4) side chains containing an acidic or amide group, (5) side chains containing a basic group, (6) side chains containing an aromatic ring, and (7) proline, an imino acid in which the side chain is fused to the amino group. The nomenclature used to describe the peptide compounds of the present invention follows the conventional practice wherein the amino group is presented to the left and the carboxy group to the right of each amino acid residue. In the formulae representing selected specific embodiments of the present invention, the amino-and carboxy-terminal groups, although not specifically shown, will be understood to be in the form they would assume at physiologic pH values, unless otherwise specified.
An "analog" of Parkin includes any non-peptide molecule comprising a structure that mimics the physico-chemical and spatial characteristics of Parkin, and which has Parkin biological activity. "Antibody" as used herein includes polyclonal and monoclonal antibodies, chimeric, single chain, and humanized antibodies, as well as Fab fragments, including the products of an Fab or other immunoglobulin expression library.
As used herein, the term "between markers" refers to a segment of nucleic acid between two named microsatellite markers, which can include the microsatellite markers. The segment defined by the named microsatellite markers is also referred to herein to as a "genetic interval"
"Biologically active," as used herein with respect to Parkin peptides, fragments, derivatives, homologs, and analogs means that the peptides, fragments, derivatives, homologs, or analogs have the ability to function as a ubiquitin ligase, an inhibitor of cell proliferation, or an inhibitor of tumorigenesis, as described herein.
As used herein, a "cell associated with a Parkin-associated disorder" means a cell isolated from a subject who has, or is suspected of having, a Parkin-associated disorder, which cell has a reduction or absence of Parkin protein or Parkin mRNA or has a mutation or deletion in at least one Parkin gene. Techniques for measuring levels of Parkin protein in a cell, or for detecting deletions or mutations in the Parkin gene, are within the skill in the art and are described in detail below. As used herein, a "cell associated with a Parkin-associated disorder" also means a cell isolated from a subject who has, or is suspected of having, a Parkin-associated disorder, which cell has a cancerous or neoplastic phenotype. One skilled in the art can readily identify cells with a cancerous or neoplastic phenotype. For example, such cells are insensitive to contact-induced growth inhibition in culture, and will form foci when cultured for extended periods. Cancerous or neoplastic cells also exhibit characteristic morphological changes, disorganized patterns of colony growth and acquisition of anchorage-independent growth. Cancerous or neoplastic cells also have the ability to form invasive tumors in susceptible animals, which can be evaluated by injecting the cells, for example, into athymic mice using techniques within the skill in the art.
A "compound of the invention," as used herein, includes Parkin nucleic acids and derivatives, analogs, fragments, and homologs thereof, as well as Parkin proteins, and derivatives, analogs, fragments, and homologs thereof. "Derivative" includes any purposefully generated peptide which in its entirety, or in part, comprises a substantially similar amino acid sequence to Parkin and has Parkin biological activity. Derivatives of Parkin may be characterized by single or multiple amino acid substitutions, deletions, additions, or replacements. These derivatives may include (a) derivatives in which one or more amino acid residues of SEQ ID NO:2 (GenBank accession no. BAA25751) are substituted with conservative or non-conservative amino acids; (b) derivatives in which one or more amino acids are added to SEQ ID NO:2; (c) derivatives in which one or more of the amino acids of SEQ ID NO:2 includes a substituent group; (d) derivatives in which SEQ ID NO:2 or a portion thereof is fused to another peptide (e.g., serum albumin or protein transduction domain); (e) derivatives in which one or more nonstandard amino acid residues (i.e., those other than the 20 standard L-amino acids found in naturally occurring proteins) are incorporated or substituted into SEQ ID NO:2; and (f) derivatives in which one or more nonamino acid linking groups are incorporated into or replace a portion of SEQ ID NO:2. As used herein, "effective amount" or "therapeutically effective amount" of a
Parkin peptide, fragment, derivative, homolog, and analog or nucleic acid encoding a Parkin peptide, fragment, derivative, or homolog, is an amount sufficient to inhibit progression of a Parkin-associated disorder or to inhibit proliferation of cells associated with a Parkin-associated disorder. The term "expression," as used with respect to Parkin mRNA, refers to transcription of the Parkin gene, resulting in synthesis of Parkin mRNA. "Expression," as used with respect to Parkin protein, refers to translation of Parkin mRNA, resulting in synthesis of Parkin protein.
As used herein, the term "fragment," as applied to a nucleic acid, refers to a subsequence of a larger nucleic acid. A "fragment" of a nucleic acid can be at least about 20 nucleotides in length; for example, at least about 50 nucleotides to about 100 nucleotides; preferably at least about 100 to about 500 nucleotides, more preferably at least about 500 to about 1000 nucleotides, even more preferably at least about 1000 nucleotides to about 1500 nucleotides; particularly, preferably at least about 1500 nucleotides to about 2500 nucleotides; most preferably at least about 2500 nucleotides.
As used herein, the term "fragment," as applied to a protein or peptide, refers to a subsequence of a larger protein or peptide. A "fragment" of a protein or peptide can be at least about 20 amino acids in length; for example at least about 50 amino acids in length; more preferably at least about 100 amino acids in length, even more preferably at least about 200 amino acids in length, particularly preferably at least about 300 amino acids in length, and most preferably at least about 400 amino acids in length.
A "homolog" of Parkin protein includes any nonpurposely generated peptide which, in its entirety or in part, comprises a substantially similar amino acid sequence to SEQ ID NO:2 and has Parkin biological activity. Homologs can include paralogs, orthologs, and naturally occurring alleles or variants of Parkin.
"Homologous" as used herein, refers to the subunit sequence similarity between two polymeric molecules, e.g.; between to nucleic acid molecules, such as, two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit; e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position. The homology between two sequences is a direct function of the number of matching or homologous positions; e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 of 10), are matched or homologous, the two sequences are 90% homologous. By way of example, the DNA sequences 3ΑTTGCC5' and 3'TATGGC are 50% homologous.
As used herein, a "subunit" of a nucleic acid molecule is a nucleotide, and a "subunit" of a polypeptide is an amino acid. As used herein, "homology" is used synonymously with "identity."
The term "inhibit," as used herein, means to suppress or block an activity or function by at least ten percent relative to a control value. Preferably, the activity is suppressed or blocked by 50% compared to a control value, more preferably by 15%, and even more preferably by 95%. "Isolated" means altered or removed from the natural state through the actions of a human being. For example, a nucleic acid or a peptide naturally present in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
The phrase "loss of proliferation control," as used herein, means the loss of or reduced ability of a cell to control normal growth processes such as the rate of cell proliferation, cell contact mediated regulation of proliferation, the ability to senesce, or the ability to differentiate. A "mutation," as used herein, refers to a change in nucleic acid or polypeptide sequence relative to a reference sequence (which is preferably a naturally-occurring normal or "wild-type" sequence), and includes translocations, deletions, insertions, and substitutions/point mutations. A "mutant" as used herein, refers to either a nucleic acid or protein comprising a mutation. A "nucleic acid" refers to a polynucleotide and includes poly-ribonucleotides and poly-deoxyribonucleotides.
The term "oligonucleotide" typically refers to short polynucleotides of about 50 nucleotides or less in length. It will be understood that when a nucleotide sequence is represented herein by a DNA sequence (i.e., A, T, G, and C), this also includes the corresponding RNA sequence (i.e., a, u, g, c) in which "u" replaces "T". The phrase "Parkin activity" refers to the functions or properties of Parkin such as the ability of Parkin to function as a ubiquitin ligase, as an inhibitor of cell proliferation, or as an inhibitor of tumorigenesis.
A "Parkin associated-disorder," as used herein, refers to a disorder in which there is an association between a mutated or defective Parkin gene or protein in cells of a subject and loss of proliferation control of the cells. "Parkin-associated disorder" thus, for example, refers to any cancer or proliferative disorder in which the expression of the Parkin gene is reduced or absent in at least a portion of cells associated with the Parkin-associated disorder. Parkin-associated disorders include cancers, non-cancerous hyperproliferative disorders, and other non-cancerous cell proliferative disorders, including disorders in which cells exhibit diminished ability or lack of ability to differentiate or senesce. A "non-cancerous" Parkin-associated disorder is characterized by abnormally- proliferating cells (i.e., cells which have escaped normal growth control mechanisms) which are not able to invade and metastasize. Abnormally proliferating cells in non- cancerous Parkin-associated disorders typically form fibroid growths or benign tumors. Examples of non-cancerous Parkin-associated disorders include any benign skin lesion or condition involving the uncontrolled growth of the various cell types of the skin or subcutaneous tissue such as psoriasis, keloids, and scars. Other non- cancerous Parkin-associated disorders can include hemangiomatosis, myelodegenerative disease, neurofibromatosis, ganglioneuromatosis, Paget's disease of the bone, fibrocystic disease, Peyronie's disease, Dupuytren's contracture, cirrhosis, atherosclerosis, and vascular restenosis.
Parkin-associated disorders which are cancerous or tumorigenic can be characterized by primary or metastatic tumors or neoplastic cells from cancers of at least the following histologic subtypes: sarcoma (cancers of the connective and other tissue of mesodermal origin); melanoma (cancers deriving from pigmented melanocytes); carcinoma (cancers of epithelial origin); adenocarcinoma (cancers of glandular epithelial origin); cancers of neural origin (glioma/glioblastoma and astrocytoma); and hematological neoplasias, such as leukemias and lymphomas (e.g., acute lymphoblastic leukemia and chronic myelocytic leukemia). Parkin-associated disorders which are cancerous or tumorigenic also include cancers having their origin in at least the following organs or tissues, regardless of histologic subtype: breast; tissues of the male and female urogenital system (e.g. ureter, bladder, prostate, testis, ovary, cervix, uterus, vagina); lung; tissues of the gastrointestinal system (e.g., stomach, large and small intestine, colon, rectum); exocrine glands such as the pancreas and adrenals; tissues of the mouth and esophagus; brain and spinal cord; kidney (renal); pancreas; hepatobiliary system (e.g., liver, gall bladder); lymphatic system; smooth and striated muscle; bone and bone marrow; skin; and tissues of the eye. Parkin-associated disorders which are cancerous or tumorigenic include tumors in any prognostic stage of development, for example as measured by the Overall Stage Groupings (also called Roman Numeral) or the Tumor, Nodes, and Metastases (TNM) staging systems. Appropriate prognostic staging systems and stage descriptions for a given cancer are known in the art, for example as described in the National Cancer Institute's "CancerNet" Internet website.
Parkin-associated disorders which are cancerous or tumorigenic include cancer cells which are hormone-dependent and cancer cells which are not hormone- dependent.
As used herein, the terms "peptide," "polypeptide," and "protein" are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids which can comprise a protein's or peptide 's sequence.
"Pharmaceutically acceptable" means physiologically tolerable, for either human or veterinary applications.
As used herein, "pharmaceutical compositions" include formulations for human and veterinary use.
A "polynucleotide" means a single strand or parallel or anti-parallel strands of a nucleic acid. Thus, a polynucleotide can be either a single-stranded or a double- stranded nucleic acid. A subject who has a "predisposition to a Parkin-associated disorder," as used herein, refers to a subject having at least one cell associated with a Parkin-associated disorder.
A "prophylactic" or "preventive" treatment is a treatment administered to a subject who does not exhibit signs, or exhibits only early signs, of a Parkin-associated disorder. A prophylactic or preventative treatment is administered for the purpose of decreasing the risk of developing pathology associated with the Parkin-associated disorder.
As used herein, "protecting group," with respect to a terminal amino group of a peptide, refers to a terminal amino group of the peptide which is coupled to any of various amino-terminal protecting groups traditionally employed in peptide synthesis. Such protecting groups include, for example, acyl protecting groups such as formyl, acetyl, benzoyl, trifluoroacetyl, succinyl, and methoxysuccinyl; aromatic urethane protecting groups such as benzyloxycarbonyl; and aliphatic urethane protecting groups, for example, tert-butoxycarbonyl or adamantyloxycarbonyl See Gross and
Mienhofer, eds., The Peptides, vol. 3, pp. 3-88 (Academic Press, New York, 1981) for suitable protecting groups.
As used herein, "protecting group," with respect to a terminal carboxy group of a peptide, refers to a terminal carboxyl group of the peptide which is coupled to any of various carboxyl-terminal protecting groups. Such protecting groups include, for example, tert-butyl, benzyl or other acceptable groups linked to the terminal carboxyl group through an ester or ether bond.
A "sample," as used herein, refers to a biological sample from a subject, including normal tissue samples, tumor tissue samples, blood, urine, or any other source of material obtained from a subject which contains a compound or cells of interest.
A "subject," as used herein, can be a human or non-human animal Non- human animals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals, as well as reptiles, birds and fish. Preferably, the subject is a human. As used herein, a "substantially similar amino acid sequence" refers to a peptide or a portion of a peptide which has an amino acid sequence identity or similarity to a reference peptide of at least about 70%. Preferably, the sequence identity is at least about 75%, more preferably at least about 80%>, more preferably at least about 85%, particularly preferably at least about 90%), and more particularly preferably at least about 95%, and most preferably at least about 98%. Amino acid sequence similarity or identity can be computed by using the BLASTP and TBLASTN programs which employ the BLAST (basic local alignment search tool) 2.0.14 algorithm. The default settings used for these programs are suitable for identifying substantially similar amino acid sequences for purposes of the present invention.
"Substantially similar nucleic acid sequence" means a nucleic acid sequence corresponding to a reference nucleic acid sequence wherein the corresponding sequence encodes a peptide having substantially the same structure and function as the peptide encoded by the reference nucleic acid sequence; e.g., where only changes in amino acids not significantly affecting the peptide function occur. Preferably, the substantially similar nucleic acid sequence encodes the peptide encoded by the reference nucleic acid sequence. The percentage of identity between the substantially similar nucleic acid sequence and the reference nucleic acid sequence is at least 10%. Preferably, the sequence identity is at least about 75%), more preferably at least about
80%), more preferably at least about 85%, particularly preferably at least about 90%, and more particularly preferably at least about 95%), and most preferably at least about 98%). Substantial similarity of nucleic acid sequences can be determined by comparing the sequence identity of two sequences, for example by physical/chemical methods (i.e., hybridization) or by sequence alignment via computer algorithm.
Suitable nucleic acid hybridization conditions to determine if a nucleotide sequence is substantially similar to a reference nucleotide sequence are: 7% sodium dodecyl sulfate SDS, 0.5 M NaPO4, 1 mM EDTA at 50°C with washing in 2X standard saline citrate (SSC), 0.1% SDS at 50°C; preferably in 7% (SDS), 0.5 M NaPO4, 1 mM EDTA at 50°C with washing in IX SSC, 0.1% SDS at 50°C; preferably 7% SDS, 0.5
M NaPO4, 1 mM EDTA at 50°C with washing in 0.5X SSC, 0.1% SDS at 50°C; and more preferably in 7% SDS, 0.5 M NaPO4, 1 mM EDTA at 50°C with washing in 0.1X SSC, 0.1% SDS at 65°C. Suitable computer algorithms to determine substantial similarity between two nucleic acid sequences include, GCS program package (Devereux et al. (1984), Nucl Acids Res. 12:387), and the BLASTN or FASTA programs (Altschul et al. (1990), supra). The default settings provided with these programs are suitable for determining substantial similarity of nucleic acid sequences for purposes of the present invention.
"Substantially purified" refers to a peptide or nucleic acid sequence which is substantially homogenous in character due to the removal of other compounds (e.g., other peptides, nucleic acids, carbohydrates, lipids) or other cells originally present.
"Substantially purified" is not meant to exclude artificial or synthetic mixtures with other compounds, or the presence of impurities which do not interfere with biological activity, and which may be present, for example, due1 to incomplete purification, addition of stabilizers, or formulation into a pharmaceutically acceptable preparation. "Synthetic mutant" includes any purposefully generated mutant or variant protein or nucleic acid derived from Parkin, in particular from the amino acid sequence of SEQ ID NO:2. Such mutants can be generated by, for example, chemical mutagenesis, polymerase chain reaction (PCR) based approaches, or primer-based mutagenesis strategies well known to those skilled in the art. The terms to "treat" or "treatment," as used herein, refer to administering an agent or compound to reduce the frequency with which symptoms of a Parkin- associated disorder are experienced, to reduce the severity of symptoms, or to prevent symptoms from occurring. Treatment can restore the effect of Parkin function or activity which has been lost or diminished in a Parkin-associated disorder. "Variant" as the term is used herein, is a nucleic acid sequence or a peptide sequence that differs in sequence from a reference nucleic acid sequence or peptide sequence respectively, but retains essential properties of the reference molecule. Changes in the sequence of a nucleic acid variant may not alter the amino acid sequence of a peptide encoded by the reference nucleic acid, or may result in amino acid substitutions, additions, deletions, fusions and truncations. Changes in the sequence of peptide variants are typically limited or conservative, so that the sequences of the reference peptide and the variant are closely similar overall and, in many regions, identical. A variant and reference peptide can differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. A variant of a nucleic acid or peptide can be a naturally occurring such as an allelic variant, or can be a variant that is not known to occur naturally. Non-naturally occurring variants of nucleic acids and peptides may be made by mutagenesis techniques or by direct synthesis.
Brief Description of the Figures FIGURE 1 A is a physical map of the D6S 1581 -D6S 1008 genomic interval of
6q25-q27. All microsatellite markers and BAC/PAC clone sequences were obtained from the NCBI database. Positions and alignment of known genes identified in this region and the markers used for loss of heterozygosity (LOH) analyses are indicated. The Parkin genomic structure according to Asakawa et al. (Biochem. Biophys. Res. Comm., 2001, 286:863-868) is also shown.
FIGURE IB represents a Loss of Heterozygosity (LOH) analysis of 6q25-q27 in breast and ovarian cancer, summarizing allelic loss in 6 breast and 4 ovarian malignant tumors with partial deletions at 6q25-q27. Each vertical line represents a single case. Black, grey and white circles represent LOH, retention of heterozygosity and non-informative results, respectively. The shared minimal region of loss among informative cases is indicated on the right side between markers D6S1599 and D6S305.
FIGURE 2A is a Northern blot analysis of Parkin expression in normal human tissues. FIGURE 2B is a Northern blot analysis of Parkin expression in tumor-derived cell lines.
FIGURE 2C is a Western blot analysis of Parkin expression in tumor-derived cell lines and normal breast, ovary, and lung tissue.
FIGURE 2D is an electrophoretic analysis of Parkin expression in malignant ovarian and breast tumors by semi-quantitative RT-PCR. Representative results are shown for each sample. FIGURE 3 A demonstrates an electrophoretic analysis of tumor specific Parkin transcripts following PCR amplification of tumor and normal ovarian cDNA. Both wild-type and aberrant transcripts are visible in UPN 66 and UPN 223, while UPN 323 and normal ovary possess only wild-type Parkin. FIGURE 3B is a schematic representation of a normal full length Parkin mRNA and a normal full length 465 amino acid residue Parkin protein.
FIGURE 3C is a schematic representation and sequence analysis of the aberrant Parkin transcript "Short Parkin mRNA Variant I" and its predicted truncated protein. Also indicated is the location of primer pairs. FIGURE 3D is a schematic representation and sequence analysis of the aberrant Parkin transcript "Short Parkin mRNA Variant II" and its predicted truncated protein. Also indicated is the location of primer pairs.
FIGURE 4A is a PCR analysis of exons 1 through 3 in Calu-3, H-1573, and H-460 lung cancer cell lines and in normal human genomic DNA from peripheral blood lymphocytes (PBLs).
FIGURE 4B is a Southern blot analysis of an EcoRI-Bglll digest of the Parkin gene in tumor cell lines and human PBLs. Blots were hybridized with either a Parkin exon 2 specific probe (top) or the full length Parkin cDNA (bottom). Arrows indicate the absence of the expected 15.3 and 6.5 kb EcoRI and Bglll fragments, respectively. FIGURE 4C is a schematic representation of exon 2 deletions in the lung adenocarcinoma cell lines, Calu-3, and H-1573.
FIGURE 5 is a graph comparing the tumorigenicity in nude mice of H-460 lung adenocarcinoma cells which have been transduced with (Parkin- closed diamond) or without (WT- closed square) the Parkin cDNA. The ordinate represents tumor volume and the abscissa represents time (days).
FIGURES 6A-6C are schematics summarizing allelic loss in the Parkin/FRA6E locus in various histologic subtypes of lung cancer (see Table 3). FIG. 6 A shows the various regions of human chromosome 6, including the 6q25-q27 region in the distal end of the q arm. In FIG. 6B, vertical lines labeled with tumor case numbers represent informative cases analyzed for loss or retention of heterozygosity at 5 markers in the 6q25-q27 region. Black, cross-hatched, and white circles represent LOH, retention of heterozygosity, and noninformative results, respectively. The relative positions of the intragenic markers D6S305 and D6S1599 are indicated in FIG. 6C.
FIGURE 7 is an electrophoretic analysis of Parkin expression in lung tumors and in normal heart and lung tissue by semi-quantitative RT-PCR. LOH data and the
T /NL are shown for each case. NI- Not Informative; HZ- heterozygous; ND- not done.
FIGURE 8 A is a graph comparing cell proliferation in vitro of wild type H460 lung tumor cells ("H460 WT") with cell proliferation in vitro of H460 cells transfected with a lentiviral vector comprising the Parkin gene ("H460 Parkin") or
EGFP ("H460 EGFP"), as measured by MTS assay. The ordinate represents MTS absorbance units and the abscissa represents time (hours).
FIGURE 8B is a graph comparing tumor growth in nude mice implanted with wild type H460 lung tumor cells ("WT") with tumor growth of H460 cells transfected with a lentiviral vector comprising the Parkin gene ("Parkin") or EGFP ("EGFP").
The ordinate represents tumor volume (minimum of 3 mice/group) and the abscissa represents time (days)
Detailed Description of the Invention It has been unexpectedly discovered that the Parkin gene is lost or mutated in several different types of cancers and that addition of a wild-type Parkin nucleic acid or functional Parkin protein into a cancer cell can suppress tumorigenicity in that cell The present invention thus provides methods for the diagnosis and treatment of Parkin-associated disorders. All nucleic acid sequences herein are given in the 5' to 3' direction. Also, all deoxyribonucleotides in a nucleic acid sequence are represented by capital letters (e.g., deoxythymidine is "T"), and ribonucleotides in a nucleic acid sequence are represented by lower case letters (e.g., uridine is "u").
In the practice of the present invention, a Parkin-associated disorder is treated by administering to a subject an isolated Parkin protein, either alone or in combination with other compounds. The Parkin protein completely or partially corrects the loss of proliferation control exhibited by cells associated with a Parkin-associated disorder.
In particular, loss of proliferation control in cancer cells can be completely or partially corrected by administering an isolated Parkin protein, either alone or in combination with other compounds. In one embodiment, loss of proliferation control is prevented in premalignant cancer cells or cells associated with a Parkin-associated disorder that do not exhibit a tumorigenic or neoplastic phenotype, by administering an isolated nucleic acid encoding the Parkin gene or Parkin protein, either alone or in combination with other therapeutic compounds. Biologically active fragments of Parkin can also be used in the present methods. Biologically active Parkin fragments according to the invention can be obtained, for example, by chemical or enzymatic fragmentation of larger natural or synthetic Parkin peptides, or by biological or chemical syntheses as described below.
Biologically active derivatives of Parkin can also be used in the present methods. The techniques for obtaining Parkin derivatives are within the skill in the art and include, for example, standard recombinant nucleic acid techniques, solid phase peptide synthesis techniques and chemical synthetic techniques as described below. Parkin derivatives can also be obtained by using linking groups to join Parkin (especially SEQ ID NO: 2) or Parkin fragments to other peptides. Linking groups suitable for use in the present invention include, for example, cyclic compounds capable of connecting an amino-terminal portion and a carboxyl terminal portion of SEQ ID NO: 2. Techniques for generating derivatives are also described in U.S. patent 6,030,942 the entire disclosure of which is herein incorporated by reference (derivatives are designated "peptoids" in the 6,030,942 patent). Examples of derivatives according to the present invention include, for example, synthetic variants of Parkin. Parkin derivatives also include fusion peptides in which a portion of the fusion peptide has a substantially similar amino acid sequence to SEQ ID NO: 2. Such fusion peptides can be generated by techniques well-known in the art, for example by subcloning nucleic acid sequences encoding SEQ ID NO: 2 and a heterologous peptide sequence into the same expression vector, such that the SEQ ID NO: 2 and the heterologous sequence are expressed together in the same protein. The heterologous sequence can also comprise a peptide leader sequence that directs entry of the expressed protein into a cell. Such leader sequences include "protein transduction domains" or "PTDs," which are discussed in more detail below. Biologically active homologs and analogs of Parkin protein can also be used in the present methods. Parkin analogs preferably comprise a structure, called a pharmacophore, that mimics the physico-chemical and spatial characteristics of Parkin, especially of SEQ ID NO: 2. Parkin analogs can be identified by screening a library of pro-analogs designed by the retrosynthetic, target oriented, or diversity- oriented synthesis strategies described by Schreiber (2000 Science 287:1964-1969), the entire disclosure of which is herein incorporated by reference. Retrosynthetic strategies require the identification of key structural elements in a molecule. These elements are then incorporated into the structure of otherwise distinct pro-analogs generated by organic syntheses. U.S. Patent 6,030,942, in particular Example 4 therein, describes retrosynthetic methods for the design and selection of analogs based on key structural elements of a protein.
Key structural elements of Parkin can be identified, for example, by evaluating the various portions of Parkin for the ability to mimic or inhibit E3 ubiquitin ligase or to inhibit proliferation of cells (see Examples 1-5 below). Alternatively, Parkin key structural elements can be determined using nuclear magnetic resonance (NMR), crystallographic, and/or computational methods which permit the electron density, electrostatic charges or molecular structure of certain portions of Parkin or fragments thereof to be mapped. Preferably, Parkin key structural elements comprise the primary, secondary and tertiary structure of the amino acid sequence of SEQ ID NO: 2.
Pools and subpools of pro-analogs can be generated by automated synthesis techniques performed in parallel, such that all synthesis and resynthesis can be performed in a matter of days. Once generated, pro-analog libraries can be screened for analogs; i.e., compounds exhibiting the ability to mimic or inhibit E3 ubiquitin ligase or to inhibit proliferation of cells (see Examples 1-5 below). Parkin, and biologically active fragments, derivatives, homologs, and analogs of Parkin protein, can be modified to enhance their entry into cells associated with a Parkin-associated disorder. For example, the compounds of the invention can be encapsulated in a liposome prior to being administered. The encapsulated compounds are delivered directly into the abnormally proliferating cells by fusion of the liposome to the cell membrane. Reagents and techniques for encapsulating the present compounds in liposomes are well known in the art, and include, for example, the ProVectin™ Protein Delivery Reagent from Imgenex.
In a preferred embodiment, the peptide compounds of the invention are modified by associating the compounds with a peptide leader sequence known as a
"protein transduction domain" or "PTD." These sequences direct entry of the compound into abnormally proliferating cells by a process known as "protein transduction" (Schwarze et al, 1999, Science 285:1569-1572.
PTDs are well-known in the art, and can comprise any of the known PTD sequences including, for example, arginine-rich sequences such as a peptide of nine to eleven arginine residues optionally in combination with one to two lysines or glutamines as described in Guis et al. (1999, Cancer Res. 59:2577-2580, the disclosure of which is herein incorporated by reference). Preferred are sequences of eleven arginine residues or the NH2-terminal 11 -amino acid protein transduction domain from the human immunodeficiency virus TAT protein. Other suitable leader sequences include, but are not limited to, other arginine-rich sequences; e.g., 9 to 10 arginines, or six or more arginines in combination with one or more lysines or glutamines. Such leader sequences are known in the art; see, e.g., Guis et al. (1999), supra. Preferably, the PTD is designed so that it is cleaved from the compound upon entry into the cell.
A PTD may be located anywhere on the compound that does not disrupt the compound's biological activity. For compounds of the invention comprising a peptide, the PTD is preferably located at the N-terminal end.
Kits and methods for constructing fusion proteins comprising a protein of interest (e.g., Parkin) and a PTD are known in the art; for example the Trans Vector™ system (Q-BIOgene), which employs a 16 amino acid peptide called "Penetratin™" corresponding to the Drosophila antennapedia DNA-binding domain; and the Voyager system (Invitrogen Life Technologies), which uses the 38 kDa VP22 protein from Herpes Simplex Virus- 1.
The compounds of the invention which comprise peptides can be synthesized de novo using conventional solid phase synthesis methods. In such methods, the peptide chain is prepared by a series of coupling reactions in which the constituent amino acids are added to the growing peptide chain in the desired sequence. The use of various N-protecting groups, e.g., the carbobenzyloxy group or the t- butyloxycarbonyl group; various coupling reagents e.g., dicyclohexylcarbodiimide or carbonyldiimidazole; various active esters, e.g., esters of N-hydroxyphthalimide or N- hydroxy-succinimide; and the various cleavage reagents, e.g., trifluoroactetic acid (TFA), HC1 in dioxane, boron tris-(trifluoracetate) and cyanogen bromide; and reaction in solution with isolation and purification of intermediates are methods well- known to those of ordinary skill in the art. A preferred peptide synthesis method follows conventional Merrifield solid phase procedures well known to those skilled in the art. Additional information about solid phase synthesis procedures can be had by reference to Steward and Young, Solid Phase Peptide Synthesis, W.H. Freeman & Co., San Francisco, 1969; the review chapter by Merrifield in Advances in Enzymology 32:221-296, F.F. Nold, Ed., Interscience Publishers, New York, 1969; and Erickson and Merrifield, The Proteins 2:61-64 (1990), the entire disclosures of which are incorporated herein by reference. Crude peptide preparations resulting from solid phase syntheses may be purified by methods well known in the art, such as preparative HPLC. The amino-terminus may be protected according to the methods described for example by Yang et al, (1990 FEBS Lett. 272:61-64), the entire disclosure of which is herein incorporated by reference.
The compounds of the invention which comprise peptides can also be produced by biological synthesis. Biological synthesis of peptides is well known in the art, and includes the transcription and translation of a synthetic nucleic acid encoding a Parkin protein, or a biologically active fragment, derivative, or homolog thereof. Biological syntheses of Parkin, or biologically active fragments, derivatives and homologs thereof can be based on the Parkin nucleic acid sequence (GenBank accession no. AB009973; SEQ ID NO:l) or amino acid sequence (GenBank accession no. BAA25751; SEQ ID NO:2) (Kitada et al, 1998, Nature 392:605-608). The techniques of recombinant DNA teclmology are within the skill in the art. General methods for the cloning and expression of recombinant molecules are described in
Maniatis (Molecular Cloning, Cold Spring Harbor Laboratories, 1982), and in Sambrook (Molecular Cloning, Cold Spring Harbor Laboratories, Second Ed., 1989), and in Ausubel (Current Protocols in Molecular Biology, Wiley and Sons, 1987), the entire disclosures of which are herein incorporated by reference. For example, Parkin and fragments, derivatives, and homologs thereof can be prepared utilizing recombinant DNA techniques, which can comprise combining a nucleic acid encoding the peptide in a suitable vector, inserting the resulting vector into a suitable host cell, recovering the peptide produced by the resulting host cell, and purifying the polypeptide recovered. The nucleic acids encoding Parkin peptides may be operatively linked to one or more regulatory regions. Regulatory regions include promoters, polyadenylation signals, translation initiation signals (Kozak regions), termination codons, peptide cleavage sites, and enhancers. The regulatory sequences used must be functional within the cells into which they are transfected. Selection of the appropriate regulatory region or regions is a routine matter, within the level of ordinary skill in the art.
Suitable promoters include both constitutive promoters and regulated (inducible) promoters, and can be prokaryotic or eukaryotic, depending on the host. Among the prokaryotic (including bacteriophage) promoters useful for practice of this invention are: lac, T3, T7, lambda Pr' PI' and tip promoters. Among the eukaryotic (including viral) promoters useful for practice of this invention are: ubiquitous promoters (e.g. HPRT, vimentin, actin, tubulin), intermediate filament promoters (e.g. desmin, neurofilaments, keratin, GFAP), therapeutic gene promoters (e.g. MDR type, CFTR, factor VIII), tissue-specific promoters (e.g. actin promoter in smooth muscle cells), promoters which respond to a stimulus (e.g. steroid hormone receptor, retinoic acid receptor), tetracycline-regulated transcriptional modulators, cytomegalovirus immediate-early, retroviral LTR, metallothionein, SV-40, El a, and MLP promoters. Tetracycline-regulated transcriptional modulators and CMV promoters are described in WO 96/01313, US 5,168,062 and US 5,385,839, the entire disclosures of which are incorporated herein by reference. Suitable polyadenylation signals that can be used in the present invention include SV40 polyadenylation signals and LTR polyadenylation signals.
The compounds of the invention can be modified with other substances prior to use in the present methods, using techniques known in the art. A modifying substance can be joined, for example, to the compound of the invention by chemical means (e.g., by covalent bond, electrostatic interaction, Van der Waals forces, hydrogen bond, ionic bond, chelation, and the like) or by physical entrapment. For example, the compounds of the invention can be modified with a label (e.g., substances which are magnetic resonance active; radiodense; fluorescent; radioactive; detectable by ultrasound; detectable by visible, infrared or ultraviolet light). Suitable labels include, for example, fluorescein isothiocyanate, peptide chromophores such as phycoerythrin or phycocyanin and the like; bioluminescent peptides such as the luciferases originating from Photinus pyrali; or fluorescent proteins originating from Renilla reniformi.
Compounds of the invention may also be modified with polymeric and macromolecular structures (e.g., liposomes, zeolites, dendrimers, magnetic particles, and metallic beads) or targeting groups (e.g., signal peptide sequences, ligands, lectins, or antibodies). Peptides or peptide fragments can be further modified with end protecting groups at the carboxyl or amino-terminal ends, amino-acid side chain modifying groups, and the like.
Modification of the peptides of the invention may alter their activity, for example by altering characteristics such as in vivo tissue partitioning, peptide degradation rate, or ligase activity. The modifications may also confer additional characteristics to the compound, such as the ability to be detected, manipulated, or targeted.
Methods of modifying the compounds of the invention (in particular the compounds of the invention which comprise peptides) with other substances are well known to those skilled in the art. For example, methods of conjugating fluorescent compounds such as fluorescein isothiocyanate to a peptide are described in Danen et al, Exp. Cell Res., 238:188-86 (1998), the entire disclosure of which is incorporated herein by reference. Methods of radiolabeling peptides with 125I are disclosed by Sambrook et al. in Molecular Clonins: A Laboratory Manual, Cold Spring Harbor Laboratories, Second Ed., (1989), the disclosure of which is incorporated herein by reference.
For example, functional groups which can be covalently linked to the compounds of the invention comprising peptides include amines, alcohols, or ethers. Functional groups covalently linked to the compounds of the invention which comprise peptides, and which can increase the in vivo half-life of the compounds include polyethylene glycols, small carbohydrates such as sucrose, or polypeptides.
In another embodiment of the invention, the half-life in the blood stream of the compounds of the invention is enhanced by the addition of adducts such as sucrose or polyethylene glycol, production of peptide-IgG chimeras. The compounds of the invention which comprise peptides can also be cyclized via cysteine-cysteine linkages, which is known to enhance the biological activities of a variety of peptides.
In one aspect of the invention, a polyethylene glycol adduct is (2-aminoethyl)- O'-(N-diglycolyl-2-aminoethyl)-hexaethyleneglycol In another aspect of the invention, a polyethylene glycol adduct is added in the form of GK[(2-aminoethyl)- O'-(N-diglycolyl-2-aminoethyl)-hexaethyleneglycol]GG, wherein the dipeptide GK increases peptide solubility and the dipeptide GG is used as a spacer between the solid support and peptide chain to improve the ease of peptide synthesis.
The compounds of the invention can be derivatized with functional groups or linked to other molecules to facilitate their delivery to specific sites of action or to potentiate their activity. The compounds of the invention can also be covalently or non-covalently linked to other pharmaceuticals, bioactive agents, or other molecules. Such derivatizations should not significantly interfere with the ubiquitin ligase or other biological properties of the compounds. Carriers and derivatizations of the compounds of the invention should also be designed or chosen so as not to exert toxic or undesirable activities on animals or humans treated with these formulations. In the practice of the invention, Parkin protein is used to inhibit the aberrant growth of cells associated with a Parkin-associated disorder, such as cancer and other proliferative disorders. Without wishing to be bound by any theory, it is believed that cells associated with a Parkin-associated disorder do not express Parkin mRNA or protein, or express mutant or aberrant levels of Parkin, which results in loss of proliferative control in these cells. Thus, the invention provides a method of treating a Parkin-associated disorder in a subject in need of such treatment. The method comprises administering an effective amount of a Parkin protein, or biologically active fragment, derivative, homolog or analog thereof to the subject, such that proliferation of cells associated with a Parkin-associated disorder is inhibited.
In the practice of the invention, Parkin protein activity is increased. In one aspect, activity is increased by increasing the amount of Parkin protein, or a biologically active fragment, derivative, homolog or analog thereof.
As used herein, to "inhibit the proliferation" of a cell associated with a Parkin- associated disorder means to kill the cell, or permanently or temporarily arrest or impede the growth of the cell Inhibition of cell proliferation can be inferred if the number of cells associated with a Parkin-associated disorder in the subject remains constant or decreases after administration of a compound of the invention. An inhibition of proliferation of cells associated with a Parkin-associated disorder can also be inferred if the absolute number of such cells increases, but the rate of tumor growth decreases.
The effect of treatment can be monitored using many cellular, molecular, and clinical techniques, which are known to those of ordinary skill in the art. Where the assay is designed to measure the ability of a compound of the invention to inhibit cell proliferation or tumorigenicity, assays are known in the art which can be used to measure cell proliferation and tumorigenicity in vitro and in vivo. Other methods useful for measuring cell proliferation and tumorigenicity are known to those of skill in the art.
The number of cells associated with a Parkin-associated disorder in a subject's body can be determined by direct measurement, or by estimation from the size of primary or metastatic tumor masses. For example, the number of cells associated with a Parkin-associated disorder in a subject can be readily determined by immunohistological methods, flow cytometry, or other techniques designed to detect the characteristic surface markers of a given cell type.
The size of a tumor mass can be ascertained by direct visual observation, or by diagnostic imaging methods such as X-ray, magnetic resonance imaging, ultrasound, and scintigraphy. Diagnostic imaging methods used to ascertain size of the tumor mass can be employed with or without contrast agents, as is known in the art. The size of a tumor mass can also be ascertained by physical means, such as palpation of the tissue mass or measurement of the tissue mass with a measuring instrument such as a caliper. For prostate tumors, a preferred physical means for determining the size of a tumor mass is the digital rectal exam.
One skilled in the art can readily determine an effective amount of the Parkin protein, or fragments, derivatives, homologs, or analogs thereof, to be administered to a given subject, by taking into account factors such as the size and weight of the subject; the extent of disease penetration; the age, health and sex of the subject; the route of administration; and whether the administration is regional or systemic.
For example, an effective amount of the compounds of the invention can be based on the approximate weight of a tumor mass to be treated. The approximate weight of a tumor mass can be determined by calculating the approximate volume of the mass, wherein one cubic centimeter of volume is roughly equivalent to one gram.
An effective amount of the compounds of the invention based on the weight of a tumor mass can be at least about 10 micrograms/gram of tumor mass. More preferably, the effective amount is at least about 100 micrograms/gram of tumor mass. Particularly preferably, the effective amount is at least about 500 micrograms/gram of tumor mass. It is preferred that an effective amount based on the weight of the tumor mass be injected directly into the tumor.
An effective amount of the compounds of the invention can also be based on the approximate or estimated body weight of a subject to be treated. Preferably, such effective amounts are administered parenterally or enterally, as described below. For example, an effective amount of the compounds of the invention administered to a subject can range from about 5-500 micrograms/kg of body weight, or between about 500-1000 micrograms/kg of body weight, or is greater than about 1000 micrograms/kg of body weight.
One skilled in the art can also readily determine an appropriate dosage regimen for the administration of the compounds of the invention to a given subject. For example, an effective amount of a Parkin protein, or fragments, derivatives, homologs, or analogs thereof, can be administered to the subject once (e.g., as a single injection or deposition). Alternatively, the compounds of the invention can be administered once or twice daily to a subject for a period of from about three to about twenty-eight days, more preferably from about seven to about ten days. In a preferred dosage regimen, the compounds of the invention are administered once a day for seven days. Where a dosage regimen comprises multiple administrations, it is understood that the effective amount of a Parkin protein, or fragments, derivatives, homologs, or analogs thereof, can comprise the total amount of compound administered over the entire dosage regimen. The compounds of the invention can be administered to a subject by any means suitable for delivering the compounds to cells of the subject, for example by any suitable enteral or parenteral administration route. Suitable enteral administration routes for the present methods include oral, rectal, or intranasal delivery. Suitable parenteral administration routes include intravascular administration (e.g. intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature); peri- and intra-tissue injection (e.g., peri-tumoral and intra-tumoral injection, intra-retinal injection, or subretinal injection); subcutaneous injection or deposition including subcutaneous infusion (such as by osmotic pumps); direct application to the tissue of interest, for example by injection, a catheter, or other placement device (e.g., a retinal pellet or a suppository or an implant comprising a porous, non-porous, or gelatinous material); and inhalation. Preferably, the compounds of the invention are administered by injection or infusion. Even more preferably, the compounds are administered locally to the site of the disorder. For the treatment of Parkin-associated disorders which involve solid tumors, the Parkin protein, or a fragment, derivative, analog, or homolog thereof, is preferably administered by direct injection into the tumor. In one embodiment, an effective amount of the Parkin protein, or fragment, derivative or homolog thereof, is administered to a subject by delivering an isolated nucleic acid comprising sequences encoding the Parkin protein, or fragment, derivative or homolog thereof to a cell associated with a Parkin-associated disorder. Transfection methods for eukaryotic cells are well known in the art, and include direct injection of the nucleic acid into the nucleus or pronucleus of a cell; electroporation; liposome transfer or transfer mediated by lipophilic materials; receptor mediated nucleic acid delivery, bioballistic or particle acceleration; calcium phosphate precipitation, and transfection mediated by viral vectors. For example, cells can be transfected with a liposomal transfer compound, e.g., DOTAP (N-[l -(2,3 -dioleoyloxy)propyl]-N,N,N-trimethyl -ammonium methylsulfate, Boehringer-Mannheim) or an equivalent, such as LIPOFECTIN. The amount of nucleic acid used is not critical to the practice of the invention; acceptable results can be achieved with 0.1-100 micrograms of nucleic acid/105 cells. For example, a ratio of about 0.5 micrograms of plasmid vector in 3 micrograms of
DOTAP per 105 cells can be used.
A nucleic acid comprising sequences encoding Parkin, or a biologically active fragment, derivative, or homolog thereof, can be obtained using a number of standard techniques. Such nucleic acids can, for example, be chemically synthesized or recombinantly produced using methods known in the art as described above. The nucleic acid sequence of the Parkin gene is provided in GenBank record accession no. AB009973 (SEQ ID NO:l), the entire disclosure of which is herein incorporated by reference.
Nucleic acid sequences comprising sequences encoding Parkin protein, or biologically active fragments, derivatives, or homologs thereof can be expressed from recombinant circular or linear DNA plasmids using any suitable promoter. Suitable promoters for expressing nucleic acid sequences from a plasmid include the U6 or HI RNA pol III promoter sequences, or the cytomegalovirus promoters. Selection of other suitable promoters is within the skill in the art. The recombinant plasmids suitable for use in the present invention can also comprise inducible or regulatable promoters for expression of nucleic acids in cells associated with a Parkin-associated disorder.
Selection of plasmids suitable for expressing the Parkin gene, methods for inserting nucleic acid sequences for expressing the gene into the plasmid, and methods of delivering the recombinant plasmid to cells associated with a Parkin- associated disorder are within the skill in the art. See, for example Zeng, Y. et al. 2002, Molecular Cell 9:1327-1333; Brummelkamp, T.R. et al 2002, Science 296:550-553; Miyagishi, M. et al. 2002, Nat. Biotechnol. 20:497-500; Paddison, P.J. et al. 2002, Genes Dev. 16:948-958; Lee, N.S. et al. 2002, Nat. Biotechnol. 20:500- 505; and Paul C.P. et al. 2002, Nat. Biotechnol. 20:505-508, the entire disclosures of which are herein incorporated by reference.
In a preferred embodiment, a plasmid according to the invention comprises a sequence encoding the Parkin mRNA under the control of the CMV intermediate- early promoter. As used herein, "under the control" of a promoter means that the nucleic acid sequences encoding Parkin are located 3' of the promoter, so that the promoter can initiate transcription of the Parkin product coding sequences.
A nucleic acid comprising sequences encoding Parkin protein, or biologically active fragments, derivatives, or homologs thereof can also be expressed from recombinant viral vectors. The nucleic acids expressed from the recombinant viral vectors can either be isolated from cultured cell expression systems by standard techniques, or can be expressed directly in cells associated with a Parkin-associated disorder. The use of recombinant viral vectors to deliver the Parkin gene to cancer cells is discussed in more detail below.
The recombinant viral vectors of the invention can comprise any suitable promoter for expressing the nucleic acid sequences in cells associated with a Parkin associated disorder. Suitable promoters include, for example, the U6 or HI RNA pol III promoter sequences, or the cytomegalovirus promoters. Selection of other suitable promoters is within the skill in the art. The recombinant viral vectors suitable for use in the present invention can also comprise inducible or regulatable promoters for expression of Parkin in a cell. Any viral vector capable of accepting and expressing nucleic acid sequences can be used; for example, vectors derived from adenovirus (AV); adeno-associated virus (AAV); retroviruses (e.g., lentiviruses (LV), Rhabdoviruses, murine leukemia virus); herpes virus, and the like. The tropism of the viral vectors can also be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses. For example, an AAV vector of the invention can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like. Selection of recombinant viral vectors suitable for use in the invention, methods for inserting and expressing nucleic acid sequences, methods of delivering the viral vector to cells associated with a Parkin-associated disorder, and recovery of the expressed sequences are within the skill in the art. For example, see Dornburg, R., 1995, Gene Therap. 2:301-310; Eglitis, M.A. 1988, Biotechniques 6:608-614; Miller, A.D. 1990, Hum Gene Therap. 1:5-14; and Anderson, W.F., 1998, Nature 392:25-30, the entire disclosures of which are herein incorporated by reference. Preferred viral vectors are those derived from AV and AAV. A suitable AV vector, a method for constructing the recombinant AV vector, and a method for delivering the vector into target cells, are described in Xia H et al (2002), Nat. Biotech. 20:1006-1010, the entire disclosure of which is herein incorporated by reference. Suitable AAV vectors, methods for constructing the recombinant AV vector, and methods for delivering the vectors into target cells are described in
Samulski R et al (1987), J. Virol 61:3096-3101; Fisher K. J. et al (1996), J. Virol, 70:520-532; Samulski R et al (1989), J. Virol. 63:3822-3826; U.S. Pat. No. 5,252,479; U.S. Pat. No. 5,139,941; International Patent Application No. WO 94/13788; and International Patent Application No. WO 93/24641, the entire disclosures of which are herein incorporated by reference.
In the present methods, an isolated nucleic acid comprising sequences encoding Parkin protein, or a biologically active fragment, derivative, or homolog thereof, can be administered to the subject in conjunction with a delivery reagent. Suitable delivery reagents for administration include the Mirus Transit TKO lipophilic reagent; lipofectin; lipofectamine; cellfectin; or polycations (e.g., polylysine), or liposomes. In a preferred embodiment, liposomes are used to deliver isolated nucleic acids comprising sequences encoding Parkin protein, or a biologically active fragment, derivative, or homolog thereof, to a subject. Liposomes can also increase the blood half-life of the nucleic acids. In the practice of this embodiment of the invention, the compounds of the invention, or nucleic acids comprising sequences encoding a Parkin protein or biologically active fragment, derivative, or homolog thereof, are encapsulated in liposomes prior to administration to the subject.
Liposomes suitable for use in the invention can be formed from standard vesicle-forming lipids, which generally include neutral or negatively charged phospholipids and a sterol such as cholesterol The selection of lipids is generally guided by consideration of factors such as the desired liposome size and half-life of the liposomes in the blood stream. A variety of methods are known for preparing liposomes.
The liposomes encapsulating nucleic acids comprising sequences encoding Parkin can comprise a ligand molecule that targets the liposome to a cell associated with a Parkin-associated disorder, such as a breast, ovary, or lung cancer cell. Ligands which bind to receptors prevalent in such cells, such as monoclonal antibodies that bind to tumor cell antigens are preferred.
The liposomes encapsulating isolated nucleic acids comprising sequences encoding Parkin or a fragment, derivative, or homolog thereof, can also be modified so as to avoid clearance by the mononuclear macrophage system ("MMS") and reticuloendothelial system ("RES"). Such modified liposomes have opsonization- inhibition moieties on the surface or incorporated into the liposome structure. In a particularly preferred embodiment, a liposome of the invention can comprise both opsonization-inhibition moieties and a ligand.
Opsonization-inhibiting moieties for use in preparing the liposomes of the invention are typically large hydrophilic polymers that are bound to the liposome membrane. As used herein, an opsonization inhibiting moiety is "bound" to a liposome membrane when it is chemically or physically attached to the membrane, e.g., by the intercalation of a lipid-soluble anchor into the membrane itself, or by binding directly to active groups of membrane lipids. These opsonization-inhibiting hydrophilic polymers form a protective surface layer which significantly decreases the uptake of the liposomes by the MMS and RES; e.g., as described in U.S. Pat. No. 4,920,016, the entire disclosure of which is herein incorporated by reference.
Opsonization-inhibiting moieties suitable for modifying liposomes are preferably water-soluble polymers with a number-average molecular weight from about 500 to about 40,000 daltons, and more preferably from about 2,000 to about 20,000 daltons. Such polymers include polyethylene glycol (PEG) or polypropylene glycol (PPG) derivatives; e.g., methoxy PEG or PPG, and PEG or PPG stearate; synthetic polymers such as polyacrylamide or poly N-vinyl pyrrolidone; linear, branched, or dendrimeric polyamidoamines; polyacrylic acids; polyalcohols, e.g., polyvinylalcohol and polyxylitol to which carboxylic or amino groups are chemically linked, as well as gangliosides, such as ganglioside GMi. Copolymers of PEG, methoxy PEG, or methoxy PPG, or derivatives thereof, are also suitable. n addition, the opsonization inhibiting polymer can be a block copolymer of PEG and either a polyamino acid, polysaccharide, polyamidoamine, polyethyleneamine, or polynucleotide. The opsonization inhibiting polymers can also be natural polysaccharides containing amino acids or carboxylic acids, e.g., galacturonic acid, glucuronic acid, mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid, alginic acid, carrageenan; aminated polysaccharides or oligosaccharides (linear or branched); or carboxylated polysaccharides or oligosaccharides, e.g., reacted with derivatives of carbonic acids with resultant linking of carboxylic groups. Preferably, the opsonization-inhibiting moiety is a PEG, PPG, or derivatives thereof. Liposomes modified with PEG or PEG-derivatives are sometimes called "PEGylated liposomes."
The opsonization-inhibiting moiety can be bound to the liposome membrane by any one of numerous well-known techniques. For example, an N- hydroxysuccinimide ester of PEG can be bound to a phosphatidyl-ethanolamine lipid- soluble anchor, and then bound to a membrane. Similarly, a dextran polymer can be derivatized with a stearylamine lipid-soluble anchor via reductive amination using Na(CN)BH3 and a solvent mixture such as tetrahydrofuran and water in a 30:12 ratio at 60°C. Liposomes modified with opsonization-inhibiting moieties remain in the circulation much longer than unmodified liposomes. For this reason, such liposomes are sometimes called "stealth" liposomes. Stealth liposomes are known to accumulate in tissues fed by porous or "leaky" microvasculature. Thus, tissue characterized by such microvasculature defects, for example solid tumors, will efficiently accumulate these liposomes; see Gabizon, et al (1988), Proc. Natl Acad. Sci., USA, 18:6949-53. In addition, the reduced uptake by the RES lowers the toxicity of stealth liposomes by preventing significant accumulation of the liposomes in the liver and spleen. Thus, liposomes that are modified with opsonization-inhibition moieties are particularly suited to deliver nucleic acids comprising sequences encoding a Parkin protein, or fragment, derivative, or homolog thereof to cells associated with a Parkin-associated disorder.
In a preferred embodiment, the cells from a subject are transfected with a nucleic acid comprising sequences which encode Parkin or fragments, derivatives, or homologs thereof, and a plasmid expression vector that stably integrates into the cell genome to provide long-term expression of a compound of the invention. Stable integration and expression of transfected nucleic acids can be confirmed by techniques known in the art, such as a Southern blot of genomic DNA using Parkin cDNA (or fragments thereof) as a probe. Stable expression of Parkin mRNA can also be detected by standard Northern blot techniques.
In one embodiment, the cells of the subject are transfected by administering an isolated nucleic acid comprising sequences which encode Parkin or fragments, derivatives, or homologs thereof, and a plasmid expression vector to the subject.
In another embodiment, the cells being transfected have been isolated from the subject. The isolated cells can be a mixture of cells, including normal cells, tumor cells, or cells which are predisposed to developing a Parkin-associated disorder. In one aspect, the cells are separated prior to reimplantation by selecting only cells which have incorporated the isolated nucleic acid comprising sequences which encode Parkin or fragments, derivatives, or homologs thereof, and a plasmid expression vector. In one aspect, the cells are reimplanted to purge or displace remaining Parkin- associated disorder cells or to purge cells predisposed to developing a Parkin- associated disorder. In another aspect of the invention, the cells are reimplanted because there are only a limited number of cells in the tissue from which they were derived, and there is a need to replace the cells which were removed.
For example, in one embodiment, the transfected and reimplanted cells are hematopoietic stem cells from a subject who has been diagnosed with a leukemia or lymphoma. In another embodiment, cells associated with a Parkin-associated disorder, such as breast, ovary or lung cancer cells, are isolated from a subject, transfected with a nucleic acid comprising sequences encoding a Parkin protein, or fragment, derivative, or homolog thereof, and reintroduced into the subject. The invention also provides for the transfection and reimplantation of leukemia or lymphoma cells.
In another embodiment, the cells associated with a Parkin-associated disorder are melanoma, non-Hodgkin's B-lymphoma, Burkitt's lymphoma, and kidney cancer cells. Techniques for isolating, identifying, separating, and culturing cells associated with a Parkin-associated disorder, such as the tumor and cancer cells discussed above, are within the skill in the art.
The isolated cells can be transfected by any suitable technique, as discussed above. After transfection, a portion of the cells can optionally be examined to confirm the presence of appropriate expression levels of the gene products. Once appropriate expression of Parkin has been confirmed, the remaining transfected cells can then be reintroduced into the subject. Transfected cells can be reintroduced into the subject by parenteral methods, including intravenous infusion. Transfected cells can also be reintroduced into the subject by direct injection into a tissue such as bone marrow, or direct injection into a tumor. The transfected cells are preferably reintroduced into the subject in a saline solution or other pharmaceutically acceptable carrier. A suitable number of transfected cells for reintroduction is from about 105 to about 108 cells per kilogram of subject body weight. The number of transfected cells available for reintroduction can be increased by expanding the cells in culture prior to transfection. The compounds comprising an isolated nucleic acid comprising sequences encoding the Parkin protein, or fragment, derivative or homolog of the Parkin sequence can be administered to a subject by any means suitable for delivering the compounds to cells of the subject, for example by any suitable enteral or parenteral administration route. Suitable enteral administration routes for the present methods include oral, rectal, or intranasal delivery. Suitable parenteral administration routes include intravascular administration (e.g. intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature); peri- and intra-tissue injection (e.g., peri-tumoral and intra- tumoral injection, intra-retinal injection, or subretinal injection); subcutaneous injection or deposition including subcutaneous infusion (such as by osmotic pumps); direct application to the tissue of interest, for example by a catheter or other placement device (e.g., a retinal pellet or a suppository or an implant comprising a porous, non-porous, or gelatinous material); and inhalation. Preferably, the compounds of the invention are administered by injection or infusion. Even more preferably, compounds of the invention are delivered locally to the site of the disorder. For the treatment of Parkin-associated disorders which involve solid tumors, the isolated nucleic acid comprising sequences encoding the Parkin protein, or fragment, derivative or homolog of the Parkin sequence is preferably administered by direct injection into the tumor.
One skilled in the art can readily determine an effective amount of an isolated nucleic acid comprising a sequence encoding a Parkin protein, or fragments, derivatives, homologs, or analogs thereof, to be administered to a given subject, by taking into account factors such as the size and weight of the subject; the extent of disease penetration; the age, health and sex of the subject; the route of administration; and whether the administration is regional or systemic. A preferred method of delivering the isolated nucleic acid to the cells associated with a Parkin-associated disorder is by transfection.
Isolated nucleic acids comprising sequences encoding Parkin protein or a biologically active fragment, derivative, or homolog thereof, are preferably formulated as pharmaceutical compositions prior to administering to a subject, according to techniques known in the art. Pharmaceutical compositions of the present invention are characterized as being at least sterile and pyrogen-free. As used herein, "pharmaceutical formulations" include formulations for human and veterinary use. Methods for preparing pharmaceutical compositions of the invention are within the skill in the art, for example as described in Remington's Pharmaceutical Science, 17th ed., Mack Publishing Company, Easton, Pa. (1985), the entire disclosure of which is herein incorporated by reference.
The present pharmaceutical formulations comprise at least one compound of the invention or at least one isolated nucleic acid comprising sequences encoding Parkin or a fragment, derivative, or homolog thereof (e.g., 0.1 to 90% by weight), or physiologically acceptable salts thereof, mixed with a pharmaceutically-acceptable carrier. The pharmaceutical formulations of the invention can also comprise isolated nucleic acids comprising sequences encoding Parkin protein or a biologically active fragment, derivative, or homolog thereof, which are encapsulated by liposomes and a pharmaceutically-acceptable carrier.
Preferred pharmaceutically-acceptable carriers are water, buffered water, normal saline, 0.4% saline, 0,3%) glycine, hyaluronic acid and the like.
Pharmaceutical compositions of the invention can also comprise conventional pharmaceutical excipients and/or additives. Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents. Suitable additives include physiologically biocompatible buffers (e.g., tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (as for example calcium DTP A, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate). Pharmaceutical compositions of the invention can be packaged for use in liquid form, or can be lyophilized.
For solid pharmaceutical compositions of the invention, conventional nontoxic solid pharmaceutically-acceptable carriers can be used; for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and'the like. For example, a solid pharmaceutical composition for oral administration can comprise any of the carriers and excipients listed above and 10-95%, preferably 25%- 75%, of a compound of the invention. A pharmaceutical composition for aerosol (inhalational) administration can comprise 0.01-20%) by weight, preferably 1%-10% by weight, of the compound of the invention encapsulated in a liposome as described above, and a propellant. A carrier can also be included as desired; e.g., lecithin for intranasal delivery.
For in vivo applications, the compounds of the present invention can comprise a pharmaceutically acceptable salt. Suitable acids which are capable of forming such salts with the compounds of the present invention include inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, phosphoric acid and the like; and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, anthranilic acid, cinnamic acid, naphthalene sulfonic acid, sulfanilic acid and the like. Pharmaceutically acceptable carriers include physiologically tolerable or acceptable diluents, excipients, solvents, or adjuvants. The compositions are preferably sterile and nonpyrogenic. Examples of suitable carriers include, but are not limited to, water, normal saline, dextrose, mannitol, lactose or other sugars, lecithin, albumin, sodium glutamate, cysteine hydrochloride, ethanol, polyols (propylene glycol, polyethylene glycol, glycerol, and the like), vegetable oils (such as olive oil), injectable organic esters such as ethyl oleate, ethoxylated isosteraryl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum methahydroxide, bentonite, kaolin, agar-agar and tragacanth, or mixtures of these substances, and the like. The pharmaceutical compositions may also contain minor amounts of nontoxic auxiliary pharmaceutical substances or excipients and/or additives, such as wetting agents, emulsifying agents, pH buffering agents, antibacterial and antifungal agents (such as parabens, chlorobutanol, phenol, sorbic acid, and the like). Suitable additives include, but are not limited to, physiologically biocompatible buffers (e.g., tromethamine hydrochloride), additions (e.g., 0.01 to 10 mole percent) of chelants
(such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (as for example calcium DTPA or CaNaDTPA-bisamide), or, optionally, additions (e.g. 1 to 50 mole percent) of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate). If desired, absorption enhancing or delaying agents (such as liposomes, aluminum monostearate, or gelatin) may be used. The compositions can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. Pharmaceutical compositions according to the present invention can be prepared in a manner fully within the skill of the art.
The invention provides for diagnosing a Parkin-associated disorder, and for screening a subject for a predisposition to develop a Parkin-associated disorder.
Detection of a mutated Parkin gene or protein or aberrant expression of a Parkin gene or protein is an indication that a subject has a Parkin-associated disorder or is predisposed to developing a Parkin-associated disorder.
Methods for detecting levels of Parkin gene expression in cells are within the skill in the art. For example, the absence of a gene, or the presence of inactivating mutations in a gene, can reduce or eliminate expression of that gene. A deletion or mutation in the Parkin gene can be detected by determining the structure or sequence of the gene in tissue from a subject suspected of having a Parkin-associated disorder, and comparing this with the structure or sequence of the Parkin gene in a sample of unaffected tissue from the subject, or in a sample of tissue from a normal control subject. Such a comparison can be made by any suitable technique known in the art.
The presence of Parkin gene deletions or mutations can be detected by standard molecular biology techniques, such as Southern blot hybridization of the genomic DNA from a subject using probes for Parkin genes. Other methods for detecting deletions or mutations in Parkin include PCR and single-stranded conformation polymorphism (SSCP) studies.
Deletion of the Parkin gene can also be inferred from a loss in heterozygosity of chromosomal markers located at 6q25-q27 which are closely linked to Parkin. For example, a loss in heterozygosity in the D6S2067 and D6S1008 microsatellite markers indicates a loss of the Parkin gene. Methods for determining loss of heterozygosity of chromosomal markers are known to those of ordinary skill in the art.
Probes for detecting loss of the entire Parkin gene or fragments of the Parkin gene are derived based on the nucleic acid sequence of the Parkin gene (SEQ ID NO:l; NCBI Accession No. AB009973). Probes can be prepared for the entire sequence or for various parts of the sequence, such as probes corresponding to regions encoding parts of one or more of the twelve exons of the Parkin gene. Probes can also be prepared corresponding to the microsatellite markers D6S411, D6S305, and
D6S1599, which are markers for regions within the Parkin gene. Markers D6S411 and D6S305 are located between exons 7 and 8 of the Parkin gene, and marker
D6S1599 is located between exons 2 and 3 of the Parkin gene.
According to one embodiment of the invention, a mutation is located in at least one of exons 1 to 12. In one aspect, a mutation is between the 3' end of exon 1 and the 5' end of exon 12. In another aspect, a mutation is between the 3' end of exon 2 and the 5' end of exon 10. In yet another aspect, the mutation is a partial deletion of exon 3, a deletion of exons 4 through 9, and a partial deletion in the 5' end of exon 10.
In a further aspect, the mutation is a deletion of exons 2 through 7.
According to the present invention, a mutation in the Parkin gene can be a homozygous deletion. In another aspect, the mutation is a hemizygous deletion. In another embodiment, a mutation is located in a 5' regulatory region of the gene such as in the promoter.
In one embodiment of the invention, the Parkin gene is mutation between microsatellite markers D6S411 and D6S1599. When referring to mutations between microsatellite markers, a mutation can also comprise the satellite markers. In another embodiment of the invention, the mutation is between microsatellite markers D6S411 and D6S305. In yet another embodiment of the invention, the mutation is between microsatellite markers D6S305 and D6S1599.
Parkin gene expression can also be determined directly, for example by reverse transcriptase PCR (RT-PCR) of Parkin mRNA, or by detection of the mRNA by Northern blot analysis. RT-PCR and Northern blotting techniques are within the skill in the art. Various assays also exist for measuring or detecting Parkin protein levels and Parkin protein activity. Assays for determining protein levels are known in the art and include electrophoretic separation and identification, Western blot analysis, peptide digestion, and sequence analysis. Various immunoassays known in the art can be used to measure Parkin protein, fragments, derivatives, or homologs. These assays include competitive and non-competitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassays, gel diffusion precipitin reactions, Western blots, precipitation assays, in situ immunoassays, complement fixation assays, immunofluorescence assays, and immunoelectrophoretic assays.
According to the invention, Parkin protein, its fragments, derivatives, or homologs thereof, can be used as an immunogen to generate antibodies which recognize such an immunogen. Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, Fab fragments, and an Fab expression library. Techniques for preparing various kinds of antibodies are known in the art. The antibodies of the invention are useful in assessing the levels of Parkin protein, its fragments, derivatives, or homologs thereof. The antibodies can be used in methods known in the art relating to localization and activity of the protein sequences of the normal or mutated Parkin protein, for imaging these proteins, and for measuring levels thereof in samples derived from a test subject or from a control sample or subject.
In one embodiment, a primary antibody is detected by detecting a label on a primary antibody which has bound to the desired immunogen. In another embodiment, a secondary antibody, which has bound to a primary antibody, is detected by detecting a label on the secondary antibody. Many assays are known in the art for labeling and detecting primary and secondary antibodies.
In one embodiment of the invention, assays can be performed to determine the amount of biologically active Parkin protein which is present in a cell or sample. Parkin is a ubiquitin ligase and its activity can be measured using assays known in the art. For example, Parkin ubiquitin-protein ligase activity can be assessed by measuring formation of ubiquitinated protein. A cell or tissue of interest can be lysed in 0.5% Nonidet P-40 and then incubated in 50 mM potassium phosphate buffer (pH 7.4) containing Enzyme El (Affmiti Research Products, Exeter, UK), UbcH7 protein (3 μg, Affmiti Research Products), and free ubiquitin (1 μg, Sigma) (Hyun et al, 2002, J. Biol. Chem. 277:28572-28577). The reaction mixtures are then incubated at
37°C for one hour. The level of ubiquitinated protein is assessed by dot blotting with alkaline phosphatase-conjugated anti-ubiquitin antibody (Santa Cruz Biotechnology), which recognizes free ubiquitin and mono-ubiquitinated proteins. After cell lysis, lysates are filtered to remove free ubiquitin. Conjugation is measured using the periodate method and ubiquitination is analyzed by densitometry (Hyun et al, 2002, J.
Biol. Chem. 277:28572-28577).
A subject in need of treatment for a Parkin-associated disorder can be identified by obtaining a sample of cells or tissue associated with a Parkin-associated disorder, such as tumor or neoplastic cells (or cells suspected of being tumor or neoplastic) from the subject, and determining whether the expression of Parkin is reduced or absent in at least a portion of the cells, as compared to cells from normal tissue obtained from the subject. Alternatively, Parkin expression in cells or tissue obtained from a subject can be compared to average expression levels of these genes in cells obtained from a population of normal subjects. A subject in need of treatment for breast, ovarian, lung, or other cancers can be readily identified by a physician using standard diagnostic techniques.
The invention provides for monitoring the progression of a Parkin-associated disorder in a subject. Progression of a Parkin-associated disorder refers to an advance in the course of the disorder. Subjects who can be monitored include subjects being treated for a Parkin-associated disorder and subjects who have been diagnosed with a predisposition for developing a Parkin-associated disorder. In one embodiment, progression of a Parkin-associated disorder in a subject can be monitored by measuring the level of Parkin nucleic acid, Parkin protein, or Parkin protein activity in a sample derived from the subject. A decrease in the level of Parkin nucleic acid, Parkin protein, or Parkin protein activity in the sample, relative to the level present in a sample derived from the subject at an earlier time, indicates that there has been progression the Parkin-associated disorder.
In another embodiment, progression of a Parkin-associated disorder in a subject can be monitored by measuring the level of mutant Parkin nucleic acid, mutant Parkin protein, or activity of a mutant Parkin protein in the subject. The method comprises measuring the level of mutant Parkin nucleic acid, mutant Parkin protein, or activity of mutant Parkin protein in a sample derived from the subject. An increase in the level of mutant Parkin nucleic acid, mutant Parkin protein, or mutant Parkin protein activity in the sample, relative to the level present in a sample derived from the subject at an earlier time, indicates progression of the Parkin-associated disorder.
In accordance with the present invention, as described above or as discussed in the Examples below, there can be employed conventional clinical, chemical, cellular, histochemical, biochemical, molecular biology, microbiology and recombinant DNA techniques which are known to those of skill in the art. Such techniques are explained fully in the literature.
The invention should not be construed to be limited solely to the assays and methods described herein, but should be construed to include other methods and assays as well. One of skill in the art will know that other assays and methods are available to perform the procedures described herein.
Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods. The following working examples therefore, specifically point out the preferred embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure.
Example 1- Loss of Heterozygosity Analysis Materials and Methods Tumor Specimens and Cell Lines. Tumor samples and matching peripheral blood and/or normal adjacent tissue specimens were obtained from patients undergoing cancer surgery, according to Institutional Review Board-approved protocols. Tumor and normal tissue specimens were snap frozen while blood was separated and DNA isolated from lymphocytes. A portion of the tissue specimens was assessed for tumor content by histology, and only tissue with >60% tumor cells were used. All cell lines were purchased from the American Type Culture Collection
(Manassas, VA). Cells were maintained in either McCoy's 5 A Medium containing 10% FBS or DMEM containing 10% FBS (GIBCO, Grand Island, NY), each supplemented with 100 μg/ml Gentamicin (BioWhittaker, Walkersville, MD).
Loss of Heterozygosity (LOH) Analysis. Genomic DNA from matched normal and tumor samples were analyzed for LOH by the amplification of dinucleotide or tetranuclueotide repeats using fluorescently end-labeled primers derived from the chromosome 6q25-q27 region. Primer sequences for each highly polymorphic (>60%) microsatellite marker (Table 1) were obtained from the NCBI database. PCR reactions and fragment analysis were performed as described elsewhere (Ohta et al, 1996 Cell 84:587-597; Inoue et al, 1997 Proc. Natl. Acad. Sci.
USA 94:14584-14589; Mimori et al, 1999 Proc. Natl. Acad. Sci. USA 96:7456- 7461). LOH was defined for those samples that had XLOH values less than 0.7 or allele loss of approximately 40%. Allelic loss was scored by two independent observers and confirmed at least twice for each marker. Mapping of chromosome 6q25-q27 region.
Sequences from BAC/PAC clones mapping to chromosome 6q25-q27 were obtained by searching the National Center for Biotechnology Information (NCBI) database at its website. A 3.5 Mb sequence "contig" was assembled which encompassed a genomic interval defined by 8 microsatellite markers (FIG. 1A and Table 1). The contig encompassed the D6S1581 and D6S1008 interval at 6q25-q27
(FIG. 1 A). No gaps were found to be present within the contig and the localization of each microsatellite marker was verified by sequence alignment. Basic Local Alignment Search Tool (BLAST®) analysis of the assembled contig identified the position of both known and predicted genes relative to the location of each microsatellite marker. Sequence analysis led to the identification of 8 genes aligning to the consensus of this contig, including the previously identified E3 ubiquitin ligase, Parkin. Markers D61599, D6S305, and D6S411 were found to localize within Parkin introns 2 and 7, respectively (FIG. 1 A).
Table 1. Loss of Heterozygosity frequency at the 6q25-q27 locus in breast and ovarian tumors.
Marker LOH % (cases showingLOH/informative cases)
(% Informative cases) Ovarian tumors Breast tumors TOTAL
D6S1581 (93) 33 (6/18) 21 (4/19) 27 (10/37)
D6S1579 (68) 43 (6/14) 8 (1/13) 26 (7/27)
D6S305 (95) 45 (9/20) 56 (10/18) 50 (19/38)
D6S1599 (70) 53 (8/15) 8 (1/13) 32 (9/28)
D6S1008 (65) 8 (1/12) 0 (0/14) 3 (1/26)
Loss of Heterozygosity analysis and identification of a common minimal region of loss at 6q25-q27. Five polymorphic microsatellite markers used to anchor the sequence contig of the 6q25-q27 region (FIG. 1A) were used to test for LOH in 20 breast and 20 ovarian normal/tumor DNA pairs.
Results
Eleven of 20 (55%) breast and 11 of 20 (55%) ovarian samples showed LOH in at least one locus in the region examined (FIG. IB and Table 1). The number of markers at which a single tumor displayed LOH ranged from 1 to 4, while none of the tumors demonstrated LOH at all loci. The percentage of LOH across each of the five markers ranged from 0% (D6S1008) to 56% (D6S305) in breast tumors, 8% (D6S1008) to 53% (D6S1599) in ovarian tumors, and 3% (D6S1008) to 50% (D6S305) in the combined analysis. Tumors showing LOH at one or more loci, but retaining heterozygosity at flanking markers, were used to define a shared minimal region of loss between markers D6S305 and D6S1599 (FIG. IB).
Lower frequencies of LOH were observed in the loci D6S1579 (26%) and D6S1008 (3%), while 10 informative cases exhibiting partial deletions across the D6S1579-D6S1599 interval allowed identification a common minimal region of loss between markers D6S305 (50%) and D6S1599 (32%). Because both of these markers are localized within introns 2 and 7, respectively, of the Parkin gene, the data indicates that the Parkin gene is a TSG. A partial loss in the chromosome 6q25-q27 region was detected in 6 breast and 4 ovarian tumors, with LOH in at least one locus in the D6S305-D6S1599 interval. Ovarian tumors UPN 79 and UPN 272 defined the centromeric and telomeric boundaries of the deleted region, respectively, and case UPN 323 allowed identification of an even smaller common region of LOH around microsatellite marker D6S1599. Results from the LOH analysis of the breast tumors showed a commonly deleted region between markers D6S305 and D6S1599 defined by tumors UPN 425 (centromeric end) and UPN 411 (telomeric end). This region of loss was more precisely defined by sample UPN 395, which demonstrated LOH at marker D6S305 while retaining heterozygosity at the D6S1579 and D6S1599 loci.
Example 2- Parkin Expression in Tumor Cells Materials and Methods
Northern Blot Analysis. Multiple Tissue Northern blots and normal tissue poly(A)+ RNA were purchased from Clontech. The tissues included spleen, thymus, prostate, testis, ovary, small intestine, colon, peripheral blood lymphocytes (PBL), heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas. Poly(A)+ RNA from cultured cell lines was extracted using the MACS mRNA Isolation Kit (Miltenyi Biotec), according to the manufacturer's instructions. Four μg of each poly(A)+ RNA sample was electrophoretically resolved on 0.8% denaturing agarose gels and transferred to a nylon membrane in 20X SSC. Blots were hybridized with a
1.5 kb cDNA probe labeled with [α-32P]dCTP by random priming (Stratagene). A human Parkin gene nucleic acid sequence has been identified (Accession No. AB009973; SEQ ID NO:l), as has the human Parkin peptide sequence (Accession No. BAA25751; SEQ ID NO:2) (Kitada et al, 1998, Nature 392:605-608). Parkin cDNA was prepared by RT-PCR using forward primer ParkFw (5'-
CCAGTGACCATGATAGTGTT-3') (SEQ ID NO:3) and reverse primer ParkORFRw (5'-TGAAGGTAGACACTGGGTAT-3') (SEQ ID NO:4). Pre- hybridization and hybridization were carried out as previously described (Ohta et al, 1996 Cell 84:587-597; Inoue et al, 1997 Proc. Natl. Acad. Sci. USA 94:14584-14589; Mimori et al, 1999 Proc. Natl Acad. Sci. USA 96:7456-7461; Martin, et al, 2003 submitted). All Northern blots were stripped in 0.5% SDS at 100°C and re-probed with a β -actin control probe (Clontech).
Western Blot Analysis. Cell proteins were extracted with RIP A (150 mM NaCl, 1 % Triton-XlOO, 1 % Deoxycholate Acid, 0.1 % SDS) lysis buffer and quantified using the BCA kit (Pierce). Normal human tissue lysates (ovary, breast, and lung) were purchased (DNA Technologies). Fifty μg of cellular proteins from each sample were size fractionated on 12%) Tris-glycine SDS/PAGE gels, and electrotransferred onto nitrocellulose membranes (Biorad). The membranes were blocked overnight in 5% nonfat dried milk in Tris-buffered saline with Tween (TBST) and incubated with a polyclonal Parkin antibody (Cell Signaling) for 1 to 3 hours in blocking solution. Expression was detected using the ECL Western Blotting
Detection Reagents (Amersham Pharmacia) according to the manufacturer's protocol. Subsequently, membranes were stripped and incubated with the MAB-374 antibody for human GAPDH (Chemicon) to verify equal protein loading.
Semi-Quantitative RT-PCR. Total RNA obtained from frozen tumor biopsies was reverse transcribed into cDNA as described above. Five μl of cDNA were amplified in a 25 μl reaction mixture containing 0.04 U of Taq DNA polymerase (Roche), 0.4 mM dNTPs, IX buffer containing 1.5 mM MgCl2 (Roche), 0.18 μM of each primer specific for Parkin (Park Fw/Park659Rw) and 0.03 μM of primers specific for β-actin (Applied Biosystems). PCR amplifications were performed for 25 cycles (94°C for 30", 58°C for 30", and 72°C for 30") followed by one extension cycle of T at 72°C. Primers (ParkFw/Park659Rw) were designed to specifically amplify transcripts of the human Parkin gene. In addition, a set of primers specific for the β-actin gene (Applied Biosystems) was included in each reaction as an internal control. PCR products were separated on 2.0%) agarose gels and transferred by blotting to nylon membranes using standard conditions (Zhang, Y., et al, 2000 Proc. Natl Acad. Sci. USA 97:13354- 13359). Membranes were hybridized with a fragment corresponding to the full length Parkin cDNA labeled with [ -32P]dCTP by random priming using the Prime It II Labeling Kit (Stratagene). In addition, blots were re-hybridized with a β-actin specific probe. Parkin and β-actin RT-PCR products were quantified with the Personal Densitometer SI (Molecular Dynamics) and Image Quant Software (Version
5, Molecular Dynamics). The relative values of Parkin expression were determined by calculating the ratio of normalized expression levels with that of the corresponding normal tissue. Criteria for overexpression or reduced expression were a ratio of above 1.5 or below 0.5, respectively. Parkin Expression Analysis.
Expression levels of Parkin mRNA were analyzed in 24 tumor-derived cell lines and a panel of normal tissues (FIGS. 2A and 2B). Results A major transcript of 4.5 kb was detected in all human tissues examined with the exceptions of thymus and peripheral blood lymphocytes. In addition, two smaller transcripts of 2.0 kb and 4.0 kb were identified in testis and kidney, respectively. mRNA from tumor-derived cell lines exhibited varying levels of Parkin expression, from no detectable expression in 18 out of 24 (75%) cases, to almost normal levels in MDA-MB-468, SK-OV-3, and H-211, relative to each normal tissue. One exception was the lung adenocarcinoma cell line, H-460, where an elevated amount of the Parkin transcript was observed. Due to the recent characterization of the Parkin promoter (Asakawa, S., et al, 2001 Biochem. Biophys. Res. Commun. 286:863-868) and the abnormal epigenetic regulation of gene expression observed in cancer (Jones, P., et al, 1999 Nat. Genet. 21:163-7), the methylation status of the Parkin gene was examined. No correlation with methylation of the Parkin promoter and gene expression was found.
To investigate whether the expression of Parkin mRNA levels correlated with the amount of cellular protein, lysates extracted from tumor-derived cell lines and normal tissues were analyzed by Western blotting (FIG. 2C). All normal tissues exhibited a 52-kDa band corresponding to the predicted Parkin protein. None of the breast, ovarian and lung cell lines analyzed was found to contain this isoform (FIG. 2C).
In addition, Parkin expression was analyzed in a series of ovarian and breast tumors by semi-quantitative RT-PCR (FIG. 2D). Twenty-seven out of 38 (71%) tumor tissues showed decreased or no expression of Parkin transcript relative to normal ovary or breast tissue. Nine out of 38 samples (24%) showed nearly identical levels of expression while 2 out of 38 (5%) cases demonstrated an increased level of expression (Table 2).
Subsequently, analysis of Parkin gene expression in a variety of human cancers, including several tumor-derived cell lines and malignant ovarian and breast tumors, found transcript levels to be reduced or absent in greater than 70% of the samples examined. Mutation analysis of the tumor-derived cell lines identified only a few previously reported polymorphisms. However, aberrant transcripts were found in 3 out of 20 (15%)) ovarian tumor cDNAs. Sequence analysis of these tumor-specific aberrant transcripts revealed two different types of alterations with partial or complete loss of exons 2 through 10 (see Example 3 below and FIG. 3B).
The common region of loss identified in the LOH analysis defined by the microsatellite markers D6S305 and D6S1599 involves Parkin exons 2 through 10, indicating that the tumor-specific aberrant transcripts shown in FIG. 3B are the result of genomic deletions. Translation of each of these altered transcripts, if it occurs, would likely result in a prematurely terminated protein encoding for a Parkin protein that does not contain the RING and IBR functional domains (Shimura, H., et al, 2000 Nat. Genet 25:302-305, Imai, Y., et al, 2000 J. Biol Chem. 275:35661-4).
Table 2. Semi-quantitative RT-PCR analysis of Parkin mRNA expression in breast and ovarian cancer*
Case No. (Breast) 2 B/NB Case No. (Ovary) Tov/Nov
UPN 316 0.1 UPN 58 0.6
UPN 411 ND UPN 62 1.3
UPN 405 0.6 UPN 66 0.3
UPN 73 ND UPN 78 ND
UPN 307 ND UPN 79 ND
UPN 304 0.1 UPN 86 ND
UPN 413 ND UPN 89 0.6
UPN 409 0.5 UPN 93 ND
UPN 407 0.2 UPN 95 4.0
UPN 425 ND UPN 160 3.0
UPN 410 ND UPN 165 0.8
UPN 404 0.1 UPN 217 0.7
UPN 395 0.2 UPN 223 0.9
UPN 392 0.1 UPN 229 1.0
UPN 441 ND UPN 238 ND
UPN 330 0.1 UPN 251 0.2
UPN 196 ND UPN 272 ND
UPN 189 0.3 UPN 276 0.1
UPN 277 0.5
UPN 323 1.0
^Expression levels of Parkin in tumor cDNAs were calculated as described in the materials and methods. ND- not detected; UPN- unique patient number. Example 3: Mutation Analysis Materials and Methods
Mutation Analysis. Total RNA was isolated from 5 x 106 cells or homogenized tumor material using the TRI Reagent (Molecular Research Center) and reverse transcribed with the Superscript First-Strand Synthesis System (Invitrogen), each according to the manufacturer's instructions. Polymerase chain reactions (PCR) were performed (Moretti et al, 1998, Biotechniques 25:716-722). PCR products were resolved on 2% TBE/agarose and gel purified using the Qiagen Gel Extraction Kit (Qiagen) for direct sequencing. Primers designed to amplify three overlapping fragments of the Parkin coding sequence were used for amplification and sequencing.
Primer pairs are as follows: Park Fw/Park659Rw (5'- AACATCATCCCAGCAAGATG-3') (SEQ ID NO:5), Park508Fw (5'- GTCCAGCAGGTAGATCAATC-3') (SEQ ID NO:6)/Parkl046Rw (5'- GTACCGGTTGTACTGCTCTT-3') (SEQ ID NO:7) and Park929Fw (5'- GTTTGTTCACGACCCTCAAC-3') (SEQ ID NO:8)/ParkORFRw. DNA sequencing was carried out as described (Ohta et al, 1996 Cell 84:587-597; Inoue et al, 1997 Proc. Natl Acad. Sci. USA 94:14584-14589; Mimori et al, 1999 Proc. Natl. Acad. Sci. USA 96:7456-7461; Martin, E. S., et al, 2003 submitted) and all sequence analysis and alignments were performed using the SEQUENCER program (Gene Codes Corporation).
RT-PCR followed by direct sequencing of the full-length Parkin cDNA was performed in all of the tumor-derived cell lines and each of the invasive breast tumors and ovarian adenocarcinomas available for analysis. Results Aberrant RT-PCR products (truncated deletions) were identified in 3 out of
20 (15%)) ovarian adenocarcinomas (FIG. 3 A). In each of these cases, the aberrant transcript was accompanied by the wild-type Parkin transcripts which may be derived from normal cells present in the tumor samples. A schematic of normal (wild-type) Parkin full length mRNA and protein is provided in FIG. 3B. Sequence analysis of the aberrant transcripts revealed the absence of sequences between exons
2 and 10, while the expected products did not show any abnormalities. Although the size of the aberrant bands was apparently similar in all the cases analyzed, two different types of altered transcripts were observed. The more common of the two is a combination of a partial deletion of exon 3, a deletion of exons 4 through 9, and a partial deletion in the 5' end of exon 10, identified as "Short Parkin mRNA variant I" in FIG. 3C. The second aberrant transcript contained a deletion of exons 3 through 7, identified as "Short Parkin mRNA variant II" in FIG. 3D. Both alterations result in the disruption of the Parkin open reading frame, causing premature termination of the predicted protein sequence (FIGS. 3B-3D). Mutation analysis revealed no missense mutations.
Example 4: Identification of Hemizygous and Homozygous Deletions in the Parkin Gene Locus
Materials and Methods
Southern blotting. Genomic DNA was extracted from cell or tissue samples according to standard procedures (Joseph Sambrook, D. W. R. 2001 Molecular
Cloning (Cold Spring Harbor Laboratory Press, Cold Spring Harbor)) while normal human genomic DNA was purchased from Roche. Seven micrograms of each sample of genomic DNA were digested overnight with restriction endonucleases EcoRI or Bglll (Roche) and electrophoresed on a 0.7%) agarose gel in IX TBE. Gels were transferred onto Hybond N+ membranes (Amersham Pharmacia), UV cross-linked, and hybridized with either a 1.5 kb Parkin cDNA probe or a Parkin exon 2 specific cDNA probe. The exon 2 specific probe was generated by PCR of normal genomic DNA using the primers Ex2Fw (5'-ATGTTGCTATCACCATTTAAGGG-3') (SEQ ID NO:9) and Ex2Rw (5*-AGATTGGCAGCGCAGGCGGCATG-3') (SEQ ID NO: 10). PCR fragments were gel purified and labeled with [α- P]dCTP as described above. Membranes were pre-hybridized and hybridized in the PerfectHyb-Plus solution (SIGMA), washed, and exposed overnight to X-Omat autoradiographic film (Kodak) at -80°C. Results Initial attempts to amplify the full-length Parkin transcript in the lung adenocarcinoma cell lines Calu-3 and H-1573 were unsuccessful. Subsequently, RT-PCR using 3 overlapping primer sets specific for the 5' and 3' regions of the Parkin coding sequence resulted in the failure to amplify nucleotides 93-659 (data not shown).
To further analyze what appeared to be a deletion at the 5' end of the Parkin genomic structure, primer pairs specific for each Parkin exon were used for PCR.
Products for each exon were detected with the exception of exon 2 in both Calu-3 and H-1573 genomic DNA (FIG. 4A). The deletion of exon 2 was confirmed by Southern analysis (FIG 4B). The absence of the exon 2 specific EcoRI and Bglll fragments indicates that exon 2 is homozygously deleted in these cell lines, thereby resulting in a frameshift mutation causing the predicted premature termination of the
Parkin coding sequence (FIG. 4C).
Without wishing to be bound by any particular theory, the LOH studies described herein indicate homozygous deletions play a role in both the inactivation of Parkin gene expression, as well as in the expression of several aberrant transcripts observed in the malignant ovarian and breast tumors analyzed. In addition, homozygous deletions of Parkin exon 2 have been identified in the Calu-3 and H- 1573 lung adenocarcinomas cell lines (FIGs. 4A and 4B). Parkin expression was absent in these two lung adenocarcinoma tumor-derived cell lines (FIG. 2B). In those samples without the above-mentioned alterations, loss of expression may either depend on unidentified alterations of the genomic structure or alternative epigenetic mechanisms (Jones, P. A. et al, 1999 Nat. Genet. 21 :163-7; Baylin, S. B., et al, 2000 Trends Genet 16:168-174). Although the Parkin gene promoter has been previously described (Asakawa, S., et al, 2001 Biochem. Biophys. Res. Commun. 286:863-868), hypermethylation does not seem to account for the silencing of this gene. Thus, again without wishing to be bound by any theory, the above described experiments indicate that in cancer, Parkin may be targeted by intragenic deletions which contribute to tumor initiation and development. Example 5: Suppression of Tumorigenicity by Parkin Methods
H-460 lung adenocarcinoma cells were transfected with or without a Parkin full-length cDNA using lentiviral provirus and packaging constructs. Polyclonal populations of H-460 cells which had been transduced with or without (WT) the
Parkin cDNA were tested for their ability to form tumors in nude mice. Six-week old female athymic nude (nu/nu) mice were given subcutaneous injections of 1-10 x 106 cells in 0.2 ml of PBS. Cells transduced with or without each lentiviral provirus and packaging constructs were injected into 3-4 mice each and followed individually. Mice were examined two to three times per week for tumor formation at the sites of injection. Tumor growth was monitored by measuring the tumors with linear calipers. Tumor volumes were calculated using the formula v=ab2/2. Results Transfection of a full-length Parkin cDNA into H-460 cells inhibited the ability of the cells to form tumors in vivo, relative to control transduced H-460 cells which did not receive the Parkin cDNA. Representative graphic profiles for the effect of Parkin on tumorigenicity are provide in FIG. 5. Tumor growth was inhibited by as much as 50% in tumor cells transduced with Parkin compared to control H-460 cells not transduced with Parkin. These results indicate that Parkin is a TSG located at human chromosome
6q25-q27, and that its reduced expression and inactivation by hemizygous or homozygous deletion plays a role in carcinogenesis of human tumors, particularly ovarian, lung, and breast tumors.
Example 6: Alterations of Parkin in Lung Cancer
Loss of Heterozygosity (LOH) Analysis. LOH was performed as described above (Example 1) on lung tumor samples of various histologic subtypes. Five polymorphic microsatellite markers from 6q25-6q27 used to define the minimal region of loss in breast and ovarian tumor samples above were tested for LOH in 16 lung normal-tumor DNA pairs. A region spanning about 3 Mb was examined. Seven of sixteen (44%) of the lung tumor samples exhibited LOH in at least one locus. The percentage of LOH for each of the five markers ranged from 9% (D6S1579) to 45% (D6S1599) (FIG. 6B; Table 3). The data are consistent with the data described above for the breast and ovarian cancer cells (Example 1). A high frequency of LOH was also found for the D6S1008 marker. Without wishing to be bound by any particular theory, the data indicate that the LOH region in lung tumor samples may extend beyond the 5' end of Parkin.
Table 3 - LOH frequency at the Parkin locus in lung cancer tumor samples * ample D6S1581 D6S1579 D6S305 D6S1599 D6S1008 Histology
49T NI NI HZ NI HZ Squamous
56T NI NI HZ HZ LOH Unknown
58T HZ LOH LOH LOH HZ Adenocarcinoma
63T NI HZ HZ HZ HZ Poorly diff
64T LOH HZ HZ HZ HZ Squamous
66T HZ HZ HZ HZ HZ Adenocarcinoma
71T NI HZ HZ NI HZ Squamous
75T NI HZ LOH NI HZ Poorly diff.
82T HZ NI HZ ND HZ Adenocarcinoma
83T HZ HZ HZ NI NI Malignant Fibrous
86T HZ HZ HZ LOH LOH Squamous
87T NI HZ LOH LOH LOH Adenocarcinoma
90T HZ HZ HZ LOH LOH Adenocarcinoma
91T HZ HZ HZ NI HZ Adenocarcinoma
92T HZ NI NI HZ NI Squamous
94T HZ NI HZ NI NI Adenocarcinoma
LOH 1/10 (10) 1/11 (9) 3/15 (20) 4/9 (45) 4/13 (31)
Note: * NI- Not Informative; HZ- heterozygous; ND- not done.
Semi-quantitative RT-PCR. Parkin expression was analyzed in a series of lung tumor samples by semi-quantitative RT-PCR. Tissue from three controls (normal) and 9 tumors were analyzed. Total RNA was isolated from homogenized tumor material by using the TRI Reagent (Molecular Research Center, Cincinnati) and was reverse transcribed with the Superscript First-Strand Synthesis System (Invitrogen), each according to the manufacturer's instructions. cDNA was synthesized from 2 μg of total RNA and RT was performed as described above. Two microliters of cDNA was amplified in 25 μl reaction mixture containing 2 units of AmphTaqGold (PE Applied Biosystem), 1.5 mM dNTP mix, IX PCR buffer, 2.5 mM MgCl2 (PE Applied Biosystem), 0.5 μM each primer specific for Parkin (ParkllFw/ParkllRw; see below) and 0.03 μM primer specific for β-actin (Applied Biosystems). PCR cycles included one cycle of 95°C for 10 minutes followed by 35 cycles of 94°C for 30 seconds, 57°C for 30 seconds, 72°C for 30 seconds, and a final extension step of 72°C for 10 minutes in a Perkin-Elmer Gene Amp PCR system 9600. β-actin amplification served as a control for cDNA quality. PCR products were separated on a 1.0%) agarose gel. Parkin and β-actin RT-PCR products were quantified with the Personal Densitometer SI (Molecular Dynamics) and
IMAGEQUANT software, Version 5 (Molecular Dynamics). The relative values of Parkin expression were determined by calculating the ratio of normalized expression levels with that of the corresponding normal tissue. The criteria for overexpression or reduced expression was a ratio of >1.5 or < 0.5, respectively. Three out of nine tumor tissue samples (33%) showed either decreased expression or no expression of Parkin transcripts, relative to normal lung tissue. Five out of nine tumor tissue samples (55%>) showed nearly identical levels of Parkin expression relative to normal tissue. One of the tumor tissue samples (11%) demonstrated an increased level of Parkin expression (FIG. 7). Sample 66T, which retained heterozygosity of the Parkin locus, and sample 86T, which lost heterozygosity of the Parkin locus, both showed a reduction in Parkin gene expression.
Mutation Analysis and Methylation-Specific PCR PCR amplification of Parkin exons using genomic DNA isolated from patient undergoing cancer surgery was performed using standard methods. Six sets of oligonucleotide primers were designed according to the exon and flanking intron sequences. PCR amplification was carried out in 25 μl reactions, containing 30 ng of DNA, 2 units of AmpliTaq Gold (PE Applied Biosystems), 1.5 mM dNTPs mix, IX PCR Buffer, 2.5 mM MgCl2 (PE Applied Biosystems) and 0.5 μM each primer. PCR cycles included one cycle of 95°C for 10 minutes, followed by 35 cycles of 94°C for
30 seconds, 53-56°C for 30 seconds, 72°C for 30 seconds, and a final extension step of 72°C for 10 minutes in a Perkin-Elmer Gene Amp PCR system 9600. PCR products were resolved on TBE-2%> agarose and gel purified by using the Qiagen gel extraction kit (Qiagen, Valencia, CA) for direct sequencing. Primer pairs were as follows: ParkFw (CCAGTGACCATGATAGTGTT; SEQ ID NO:3)/ParkORFRw
(TGAAGGTAGACACTGGGTAT; SEQ ID NO:4); ParkllFw
(CAGAGACCGTGGAGAAAAGG; SEQ ID NO:l l)/ParkIIRw
(CTGCTGGTACCGGTTGTACT) (SEQ ID NO:12). The amplified products were sequenced and all sequence analysis and alignments were performed using the SEQUENCER program (Gene Codes, Ann Arbor, MI).
To analyze methylation levels in the 5' region upstream of Parkin, a 541-bp region, including the first Parkin exon, was amplified. Bisulfite sequencing was performed on the amplified product and PCR products were purified and directly sequenced by standard techniques in order to determine average methylation levels. No differences in the methylation pattern between the normal and tumor
, samples were found.
RT-PCR followed by direct sequencing of the full-length Parkin was performed in lung tumor samples. No point mutations or truncations were found in any of the cases tested.
Effect of restored Parkin expression on proliferation and tumorigenicity of lung tumor cells Methods
Lentiviral vector production and in vitro transduction To study the in vitro and in vivo effects of restored Parkin gene expression, the self-inactivating lentiviral system of gene transfer, essentially as described above, was used to infect the human tumor-derived cell line H460 because this cell line does not express Parkin. The full length Parkin cDNA in frame with a carboxyl-terminal hemagglutinin (HA) epitope tag was generated by PCR and cloned into the BamHI site of the pNaldini.CMV.IRES.EGFP self-inactivating HIV based provirus vector. Lentiviral vector production by transient transfection was performed as described above.
Transient transfections of pNaldini.CMV.IRES.EGFP or pNaldini.CMV.PARKINHA.IRES.EGFP and packaging vectors into 293FT cells (Invitrogen) was performed by the calcium phosphate precipitation method using the ProFection Mammalian Transfection System (Promega) according to the manufacturer's instructions. Viruses were pseudotyped with the vesicular stomatitis virus glycoprotein (VSVG) using the pVSV-G vector (Clontech). Viral supernatants were collected after 48 hours and 72 hours, filtered, and snap-frozen in liquid nitrogen. Titers were determined by infecting 293FT cells with serial dilutions of virus supplemented with polybrene (Sigma) at a final concentration of 8.0 μg/ml. Infectivity was determined by GFP expression of target cells by flow cytometry
(FACSCalibur, Becton Dickinson Immunocytometry Systems) 48 hours after infection. Transduction units (TU) were expressed as a percentage of GFP positive cells relative to the total number of cells analyzed. Typically, conditioned media collected from transfections performed in T-175 flasks (Becton Dickinson) seeded with 5 x 106 293FT cells yielded approximately 1-10 x 107 TU/ml Subsequently, infections of target cells were performed in order to achieve between 90 and 100% GFP positive cells.
Cell Proliferation For cell cycle analysis, H460 wild type cells or H460 cells transfected with the Parkin expression vector or EGFP expression vector were harvested 24 and 48 hours post-transduction, washed in PBS and fixed in ethanol Following RNAse treatment (Roche), cells were stained with 50 μg/ml of propidium iodide (Molecular Probes). All samples were analyzed by flow cytometry (FACSCalibur, Becton Dickinson Immunocytometery Systems) and the FlowJo Version 3.4 Software Package (Tree Star, Inc., San Carlos, CA). Cell proliferation was measured using the Cell Titer 96 Aqueous One Solution Cell Proliferation Assay (MTS) according to the manufacturer's directions (Promega). Infection efficiencies of greater than 90% were observed in H460 cells using recombinant lentiviruses containing Parkin or EGFP alone. Typically, Parkin and
EGFP gene expression levels stabilized 48 hours post infection and continued for several weeks (>12 weeks). No cytotoxic effects or changes in growth characteristics and cell cycle were observed in transfected H460 cells (FIG. 8A).
Tumor cells transduced with virus particles containing Parkin or EGFP alone showed no significant differences in their ability to proliferate in vitro over the course of 96 hours (FIGS. 8A). High levels of ectopic Parkin gene expression were maintained in nearly 100%) of the cells examined by flow cytometry and Western analysis prior to injection.
Tumorigenicity In order to study the in vivo behavior of H460 lung tumor cells with restored Parkin expression, cells infected with either EGFP or Parkin lentiviruses were injected subcutaneously (1-10 x 10 cells in 0.2 mL of PBS) into the flanks of 6 week old, female nude mice. Three to four mice were injected per group. Mice were examined two to three times per week for tumor formation at the sites of injection. Tumors were measured with linear calipers and tumor volumes were calculated (v=ab2/2).
The data show a decreased rate of tumor growth in the animals receiving H460 cells infected with the Parkin-expressing virus. Tumor volume of H460 cells infected with the Parkin-expressing virus is reduced three-four fold relative to the tumor volume of animals injected wild type H460 cells or to H460 cells infected with the
EGFP expressing virus (FIG. 8B).
The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims should be construed to include all such embodiments and equivalent variations.

Claims

CLAIMSWhat is claimed is:
1. A method of treating a Parkin-associated disorder in a subject in need of such treatment, comprising administering to the subject an effective amount of a composition comprising at least one isolated nucleic acid comprising a nucleic acid sequence encoding a Parkin protein, or a biologically active fragment, derivative, or homolog of said Parkin protein.
2. The method of claim 1, wherein the nucleic acid sequence encodes a peptide having the amino acid sequence SEQ ID NO:2.
3. The method of claim 2, wherein the nucleic acid has the sequence SEQ ID NO:l.
4. The method of claim 1, wherein the encoded Parkin protein, or a biologically active fragment, derivative, or homolog thereof, has at least about 50% sequence identity with SEQ ID NO:2.
5. The method of claim 4, wherein the encoded Parkin protein, or a biologically active fragment, derivative, or homolog thereof, has at least about 70% sequence identity with SEQ ID NO:2.
6. The method of claim 5, wherein the encoded Parkin protein, or a biologically active fragment, derivative, or homolog thereof, has at least about 90% sequence identity with SEQ ID NO:2.
7. The method of claim 6, wherein the encoded Parkin protein, or a biologically active fragment, derivative, or homolog thereof, has at least about 95%) sequence identity with SEQ ID NO:2.
8. The method of claim 1 , wherein the subj ect is a human.
9. The method of claim 1, wherein the Parkin-associated disorder is a proliferative disorder.
10. The method of claim 9, wherein the Parkin-associated disorder is selected from the group consisting of ovarian cancer, breast cancer, lung cancer, melanoma, non-Hodgkin's B-lymphoma, acute lymphoblastic leukemia, Burkitt's lymphoma, and kidney cancer.
11. The method of claim 10, wherein the treatment of a Parkin-associated disorder in a subject inhibits tumorigenesis.
12. The method of claim 11, wherein the inhibition of tumorigenesis is the result of inhibition of cell proliferation.
13. The method of claim 12, wherein the inhibition of cell proliferation is the result of cellular senescence.
14. The method of claim 13, wherein the cell is a cell associated with a Parkin-associated disorder.
15. The method of claim 9, wherein the Parkin-associated disorder is non- cancerous.
16. The method of claim 1, wherein the isolated nucleic acid is administered to the subject parenterally or enterally.
17. The method of claim 16, wherein the enteral administration is oral, rectal, or intranasal
18. The method of claim 16, wherein the parenteral administration is selected from the group consisting of intravascular administration, peri- and intra- tissue injection, subcutaneous injection, subcutaneous deposition, subcutaneous infusion, direct application, and inhalation.
19. The method of claim 18, wherein the intravascular administration is selected from the group consisting of intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature.
20. The method of claim 18, wherein the peri- and intra-tissue injection is selected from the group consisting of peri-tumoral injection, intra-tumoral injection, intra-retinal injection, and subretinal injection.
21. The method of claim 18, wherein the subcutaneous injection or infusion comprises infusion by an osmotic pump.
22. The method of claim 18, wherein the direct application comprises application by catheter, retinal pellet, suppository, an implant comprising a porous material, an implant comprising a non-porous material, or a material comprising a gelatinous material.
23. The method of claim 1, wherein the isolated nucleic acid comprises a recombinant plasmid or recombinant viral vector.
24. The method of claim 23, wherein the recombinant plasmid or recombinant viral vector comprises a U6 promoter, an HI promoter, or a cytomegalovirus promoter.
25. The method of claim 23, wherein the recombinant viral vector is an adenovirus vector, an adeno-associated virus vector, a retroviral vector, or a herpes virus vector.
26. The method of claim 25, wherein the retroviral vector is selected from the group consisting of lentiviral vectors, Rhabdoviral vectors, and murine leukemia virus vectors.
27. The method of claim 1, wherein the isolated nucleic acid is administered in conjunction with a lipophilic reagent, lipofectin, lipofectamine, cellfectin, polycations, or liposomes.
28. The method of claim 27, wherein the liposome comprises an opsonization-inhibiting moiety.
29. The method of claim 27, wherein the liposome comprises a ligand which targets the liposome to a cell associated with a Parkin-associated disorder.
30. The method of claim 29, wherein the cell is selected from the group consisting of ovarian cancer cells, breast cancer cells, lung cancer cells, melanoma cells, non-Hodgkin's B-lymphoma cells, acute lymphoblastic leukemia cells, Burkitt's lymphoma cells, and kidney cancer cells.
31. The method of claim 1, wherein the Parkin-associated disorder is a tumor, and the effective amount of the isolated nucleic acid is at least about 10 micrograms/gram of tumor mass.
32. The method of claim 31, wherein the effective amount of an isolated nucleic acid comprising a nucleic acid sequence encoding a Parkin protein, or a biologically active fragment, derivative, or homolog thereof, is at least about 100 micrograms/gram of tumor mass.
33. The method of claim 32, wherein the effective amount of an isolated nucleic acid comprising a nucleic acid sequence encoding a Parkin protein, or a biologically active fragment, derivative, or homolog thereof, is at least about 500 micrograms/gram of tumor mass.
34. The method of claim 1, wherein the effective amount of an isolated nucleic acid comprising a nucleic acid sequence encoding a Parkin protein, or a biologically active fragment, derivative, or homolog thereof, is between about 5-500 micrograms/kg body weight of the subject.
35. The method of claim 1, wherein the effective amount of an isolated nucleic acid comprising a nucleic acid sequence encoding a Parkin protein, or a biologically active fragment, derivative, or homolog thereof, is between about 500- 1000 micrograms/kg body weight of the subj ect.
36. The method of claim 1, wherein the effective amount of an isolated nucleic acid comprising a nucleic acid sequence encoding a Parkin protein, or a biologically active fragment, derivative, or homolog thereof, is at least about 1000 micrograms/kg body weight of the subject.
37. A method of treating a Parkin-associated disorder in a subject in need of such treatment, comprising the steps of:
1) transfecting an isolated nucleic acid comprising a nucleic acid sequence encoding a Parkin protein, or a biologically active fragment, derivative, or homolog thereof, into cells isolated from the subject; and
2) reimplanting the transfected cells into the subject, thereby, treating a Parkin-associated disorder.
38. The method of claim 37, wherein the Parkin-associated disorder is a proliferative disorder.
39. The method of claim 37, wherein the Parkin-associated disorder is selected from the group consisting of ovarian cancer, breast cancer, lung cancer, melanoma, non-Hodgkin's B-lymphoma, acute lymphoblastic leukemia, Burkitt's lymphoma, and kidney cancer.
40. The method of claim 37, wherein expression of the isolated nucleic acid in the transfected cells is confirmed prior to reimplantation of the transfected cells into the subject.
41. The method of claim 37, wherein stable integration of the isolated nucleic acid into the genome of the transfected cell is confirmed prior to reimplantation of the transfected cells into the subject.
42. The method of claim 37, wherein the isolated nucleic acid comprises a recombinant plasmid or recombinant viral vector.
43. The method of claim 42, wherein the isolated nucleic acid comprises the nucleic acid sequence SEQ ID NO:l.
44. The method of claim 42, wherein the Parkin protein has the amino acid sequence of SEQ ID NO:2.
45. The method of claim 42, wherein the recombinant plasmid or recombinant viral vector comprises a U6 promoter, an HI promoter, or a cytomegalovirus promoter.
46. The method of claim 45, wherein the recombinant viral vector is selected from the group consisting of an adenovirus vector, an adeno-associated virus vector, a retroviral vector, and a herpes virus vector.
47. The method of claim 46, wherein the retroviral vector is selected from the group consisting of lentiviral vectors, Rhabdoviral vectors, and murine leukemia virus vectors.
48. The method of claim 37, wherein the transfected cells are selected from the group consisting of ovarian cancer cells, breast cancer cells, lung cancer cells, melanoma cells, non-Hodgkin's B-lymphoma cells, acute lymphoblastic leukemia cells, Burkitt's lymphoma cells, and kidney cancer cells.
49. The method of claim 37, wherein the transfected cells are hematopoietic stem cells.
50. A method of inhibiting proliferation of a cell associated with a Parkin- associated disorder in a subject, comprising administering to the cell an effective amount of a nucleic acid comprising a nucleic acid sequence encoding a Parkin protein, or a biologically active fragment, derivative, or homolog thereof.
51. The method of claim 50, wherein the Parkin-associated disorder is selected from the group consisting of ovarian cancer, breast cancer, lung cancer, melanoma, non-Hodgkin's B-lymphoma, acute lymphoblastic leukemia, Burkitt's lymphoma, and kidney cancer.
52. The method of claim 50, wherein the isolated nucleic acid comprising a nucleic acid sequence encoding a Parkin protein, or a biologically active fragment, derivative, or homolog thereof is a recombinant plasmid or recombinant viral vector.
53. The method of claim 52, wherein the recombinant plasmid or recombinant viral vector comprises a U6 promoter, an HI promoter, or a cytomegalovirus promoter.
54. The method of claim 52, wherein the recombinant viral vector is an adenovirus vector, an adeno-associated virus vector, a retroviral vector, or a herpes virus vector.
55. The method of claim 54, wherein the retroviral vector is selected from the group consisting of lentiviral vectors, Rhabdoviral vectors, and murine leukemia virus vectors.
56. The method of claim 50, wherein the isolated nucleic acid comprising a nucleic acid sequence encoding a Parkin protein, or a biologically active fragment, derivative, or homolog thereof, is administered in conjunction with a delivery reagent selected from the group consisting of a lipophilic reagent, lipofectin, lipofectamine, cellfectin, polycations, and liposomes.
57. The method of claim 56, wherein the liposome comprises an opsonization-inhibiting moiety.
58. The method of claim 56, wherein the liposome comprises a ligand which targets the liposome to a cell associated with a Parkin-associated disorder.
59. The method of claim 58, wherein the cell is selected from the group consisting of ovarian cancer cells, breast cancer cells, lung cancer cells, melanoma cells, non-Hodgkin's B-lymphoma cells, acute lymphoblastic leukemia cells, Burkitt's lymphoma cells, and kidney cancer cells.
60. A pharmaceutical composition for treating a Parkin-associated disorder in a subject, comprising at least one isolated nucleic acid comprising a nucleic acid sequence encoding a Parkin protein, or a biologically active fragment, derivative, or homolog thereof, and a pharmaceutically acceptable carrier.
61. The composition of claim 60, wherein the Parkin protein has the amino acid sequence SEQ ID NO:2.
62. The composition of claim 61, wherein the isolated nucleic acid comprises the nucleic acid sequence SEQ ID NO: 1.
63. A method of treating a Parkin-associated disorder in a subject in need of such treatment, comprising administering to the subject an effective amount of a composition comprising at least one isolated Parkin protein, or a biologically active fragment, derivative, analog, or homolog thereof.
64. The method of claim 63, wherein the Parkin protein, or a biologically active fragment, derivative, or homolog thereof, has at least about 50% sequence homology with SEQ ID NO:2.
65. The method of claim 64, wherein the Parkin protein, or a biologically active fragment, derivative, or homolog thereof, has at least about 70% sequence homology with SEQ ID NO:2.
66. The method of claim 65, wherein the Parkin protein, or a biologically active fragment, derivative, or homolog thereof, has at least about 90% sequence homology with SEQ ID NO:2.
67. The method of claim 66, wherein the Parkin protein, or a biologically active fragment, derivative, or homolog thereof, has at least about 95% sequence homology with SEQ ID NO:2.
68. The method of claim 63, wherein the protein has the sequence SEQ ID NO:2.
69. The method of claim 63, wherein the subject is a human.
70. The method of claim 63, wherein the Parkin-associated disorder is a proliferative disorder.
71. The method of claim 70, wherein the Parkin-associated disorder is selected from the group consisting of ovarian cancer, breast cancer, lung cancer, melanoma, non-Hodgkin's B-lymphoma, acute lymphoblastic leukemia, Burkitt's lymphoma, and kidney cancer.
72. The method of claim 63, wherein the Parkin protein, or a biologically active fragment, derivative, or homolog thereof, is administered to the subject parenterally or enterally.
73. The method of claim 72, wherein the parenteral administration is selected from the group consisting of intravascular administration, peri- and intra- tissue injection, subcutaneous injection, subcutaneous deposition, subcutaneous infusion, direct application, and inhalation.
74. The method of claim 73, wherein the peri- and intra-tissue injection is selected from the group consisting of peri-tumoral injection and intra-tumoral injection.
75. The method of claim 63, wherein the Parkin protein, or a biologically active fragment, derivative, or homolog thereof, is modified with a peptide leader sequence.
76. The method of claim 63, wherein the Parkin protein, or a biologically active fragment, derivative, or homolog thereof, is administered in conjunction with a liposome.
77. A method of inhibiting proliferation of a cell associated with a Parkin- associated disorder in a subject, comprising administering to the cell an effective amount of a Parkin protein, or a biologically active fragment, derivative, analog, or homolog thereof.
78. A pharmaceutical composition for treating a Parkin-associated disorder in a subject, comprising at least one compound comprising: a Parkin protein, or a biologically active fragment, derivative, analog, or homolog thereof; wherein the compound optionally comprises an amino-terminal protecting group or a carboxy-terminal protecting group or both an amino-terminal protecting group and a carboxy-terminal protecting group; and a pharmaceutically acceptable carrier.
79. The composition of claim 78, wherein the compound has the amino acid sequence SEQ ID NO:2.
80. A method of diagnosing a Parkin-associated disorder or screening for a predisposition for developing a Parkin-associated disorder in a subject, comprising measuring the level of Parkin protein in a sample derived from the subject, wherein a lower level of Parkin protein in the sample relative to the level of Parkin protein in a sample from a control subject not having the Parkin-associated disorder or a predisposition for developing the Parkin-associated disorder, indicates the presence of the Parkin-associated disorder or a predisposition for developing the Parkin- associated disorder.
81. A method of diagnosing a Parkin-associated disorder or screening for a predisposition for developing a Parkin-associated disorder in a subject, comprising measuring the level of Parkin nucleic acid in a sample derived from the subject, wherein a lower level of Parkin nucleic acid in the sample relative to the level of
Parkin nucleic acid in a sample from a control subject not having the Parkin- associated disorder or a predisposition for developing the Parkin-associated disorder, indicates the presence of the Parkin-associated disorder or a predisposition for developing a Parkin-associated disorder.
82. A method of diagnosing a Parkin-associated disorder or screening for a predisposition for developing a Parkin-associated disorder in a subject, comprising analyzing a Parkin nucleic acid sequence for a mutation in a sample derived from the subject, wherein detection of one or more mutations in the Parkin nucleic acid sequence in the sample indicates the presence of the Parkin associated-disorder or a predisposition for developing the Parkin-associated disorder.
83. The method of claim 82, wherein the mutation is in at least one Parkin exon selected from the group consisting of exons 1 to 12.
84. The method of claim 82, wherein the mutation is between microsatellite markers D6S411 and D6S1599.
85. The method of claim 82, wherein the mutation is between microsatellite markers D6S411 and D6S305.
86. The method of claim 82, wherein the mutation is between microsatellite markers D6S305 and D6S1599.
87. The method of claim 82, wherein the mutation is between the 3' end of exon 1 and the 5' end of exon 12.
88. The method of claim 87, wherein the mutation is between the 3' end of exon 2 and the 5' end of exon 10.
89. The method of claim 87, wherein the mutation is a partial deletion of exon 3, a deletion of exons 4 through 9, and a partial deletion in the 5' end of exon 10.
90. The method of claim 87, wherein the mutation is a deletion of exons 2 through 7.
91. The method of claim 82, wherein the mutation is selected from the group consisting of a homozygous deletion and a hemizygous deletion.
92. The method of claim 91, wherein the mutation is a homozygous deletion of exon 2.
93. A method of diagnosing a Parkin-associated disorder or screening for a predisposition for developing a Parkin-associated disorder in a subject, comprising measuring the level of Parkin protein activity in a sample derived from the subject, wherein a lower level of Parkin protein activity in the sample relative to the level of Parkin protein activity in a sample from a control subject not having the Parkin- associated disorder or a predisposition for developing the Parkin-associated disorder, indicates the presence of the Parkin-associated disorder.
94. The method of claim 93, wherein the Parkin protein activity is ubiquitin ligase activity.
95. The method of claims 80, 81, 82, or 93 wherein the Parkin-associated disorder is selected from the group consisting of ovarian cancer, breast cancer, lung cancer, melanoma, non-Hodgkin's B-lymphoma, acute lymphoblastic leukemia, Burkitt's lymphoma, and kidney cancer.
96. A method of monitoring progression of a Parkin-associated disorder in a subject, comprising measuring the level of Parkin nucleic acid, Parkin protein, or Parkin protein activity in a sample derived from the subject, wherein a decrease in the level of Parkin nucleic acid, Parkin protein, or Parkin protein activity in the sample, relative to the level present in a sample derived from the subject at an earlier time, indicates progression of the Parkin-associated disorder.
97. A method of monitoring progression of a Parkin-associated disorder in a subject, comprising measuring the level of mutant Parkin nucleic acid, mutant
Parkin protein, or mutant Parkin protein activity in a sample derived from the subject, wherein an increase in the level of mutant Parkin nucleic acid, mutant Parkin protein, or mutant Parkin protein activity in the sample, relative to the level present in a sample derived from the subject at an earlier time, indicates progression of the Parkin- associated disorder.
PCT/US2003/034268 2003-05-02 2003-10-28 Methods and compositions for diagnosis and therapy of parkin-associated disorders WO2004098377A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003286741A AU2003286741A1 (en) 2003-05-02 2003-10-28 Methods and compositions for diagnosis and therapy of parkin-associated disorders

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US46736003P 2003-05-02 2003-05-02
US60/467,360 2003-05-02

Publications (2)

Publication Number Publication Date
WO2004098377A2 true WO2004098377A2 (en) 2004-11-18
WO2004098377A3 WO2004098377A3 (en) 2005-05-06

Family

ID=33435063

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/034268 WO2004098377A2 (en) 2003-05-02 2003-10-28 Methods and compositions for diagnosis and therapy of parkin-associated disorders

Country Status (2)

Country Link
AU (1) AU2003286741A1 (en)
WO (1) WO2004098377A2 (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8349560B2 (en) 2007-06-15 2013-01-08 The Ohio State University Research Method for diagnosing acute lymphomic leukemia (ALL) using miR-222
WO2013113762A1 (en) * 2012-01-31 2013-08-08 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and kits for predicting the risk of having a cutaneous melanoma in a subject
US8859202B2 (en) 2012-01-20 2014-10-14 The Ohio State University Breast cancer biomarker signatures for invasiveness and prognosis
US8946187B2 (en) 2010-11-12 2015-02-03 The Ohio State University Materials and methods related to microRNA-21, mismatch repair, and colorectal cancer
US9085804B2 (en) 2007-08-03 2015-07-21 The Ohio State University Research Foundation Ultraconserved regions encoding ncRNAs
US9249468B2 (en) 2011-10-14 2016-02-02 The Ohio State University Methods and materials related to ovarian cancer
US9481885B2 (en) 2011-12-13 2016-11-01 Ohio State Innovation Foundation Methods and compositions related to miR-21 and miR-29a, exosome inhibition, and cancer metastasis
CN107412727A (en) * 2017-03-16 2017-12-01 北京热休生物技术有限公司 The application of albumen PACRGL and its polypeptide in medicine of the treatment with pre- anti-cancer is prepared
US10758619B2 (en) 2010-11-15 2020-09-01 The Ohio State University Controlled release mucoadhesive systems

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103866017B (en) 2005-08-01 2016-05-25 俄亥俄州立大学研究基金会 Be used for the method and composition based on MicroRNA of diagnosis, prognosis and the treatment of breast cancer
EP1968622B1 (en) 2006-01-05 2014-08-27 The Ohio State University Research Foundation Microrna expression abnormalities in pancreatic endocrine and acinar tumors
US7943318B2 (en) 2006-01-05 2011-05-17 The Ohio State University Research Foundation Microrna-based methods and compositions for the diagnosis, prognosis and treatment of lung cancer
ES2446362T3 (en) 2006-03-20 2014-03-07 The Ohio State University Research Foundation Traces of microRNA during human megakaryocytogenesis
EP2436785B1 (en) 2006-07-13 2013-09-11 The Ohio State University Research Foundation MIR-29a for diagnosing poor survival prognosis colon adenocarcinoma.
ES2374446T3 (en) 2006-09-19 2012-02-16 The Ohio State University Research Foundation EXPRESSION OF TCL1 IN CHRONIC LYMPHOCYTIC LEUKEMIA (LLC) REGULATED BY MIR-29 AND MIR-181.
JP5501766B2 (en) 2006-11-01 2014-05-28 ジ・オハイオ・ステイト・ユニバーシティ・リサーチ・ファウンデイション MicroRNA expression signature to predict survival and metastasis in hepatocellular carcinoma
EP2109687B1 (en) 2007-01-31 2014-06-04 The Ohio State University Research Foundation Micro-rna-based methods for the treatment of acute myeloid leukemia
AU2008262252B2 (en) 2007-06-08 2013-09-12 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods for determining hepatocellular carcinoma subtype and detecting hepatic cancer stem cells
EP2808398A1 (en) 2007-07-31 2014-12-03 The Ohio State University Research Foundation Methods for reverting methylation by targeting DNMT3A and DNMT3B
CN101836112A (en) 2007-08-22 2010-09-15 俄亥俄州立大学研究基金会 Methods and compositions for inducing deregulation of EPHA7 and ERK phosphorylation in human acute leukemias
CN102137927B (en) 2007-10-26 2014-03-12 俄亥俄州立大学研究基金会 Methods for identifying fragile histidine triad (Fhit) interaction and uses thereof
WO2009152300A1 (en) 2008-06-11 2009-12-17 The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services Use of mir-26 family as a predictive marker of hepatocellular carcinoma and responsiveness to therapy
WO2011063382A1 (en) 2009-11-23 2011-05-26 The Ohio State University Materials and methods useful for affecting tumor cell growth, migration and invasion
AU2012225506B2 (en) 2011-03-07 2016-11-17 The Ohio State University Mutator activity induced by microRNA-155 (miR-155) links inflammation and cancer
CN112029738B (en) * 2020-08-18 2022-04-29 浙江省人民医院 Human parkin protein acetylation and application thereof in medicine preparation

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6531456B1 (en) * 1996-03-06 2003-03-11 Avigen, Inc. Gene therapy for the treatment of solid tumors using recombinant adeno-associated virus vectors
US20030077832A1 (en) * 2001-09-21 2003-04-24 Board Of Regents, The University Of Texas System Methods and compositions for detection of breast cancer
US20030082603A1 (en) * 2000-12-18 2003-05-01 Incyte Genomics, Inc. Colon cancer marker

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6531456B1 (en) * 1996-03-06 2003-03-11 Avigen, Inc. Gene therapy for the treatment of solid tumors using recombinant adeno-associated virus vectors
US20030082603A1 (en) * 2000-12-18 2003-05-01 Incyte Genomics, Inc. Colon cancer marker
US20030077832A1 (en) * 2001-09-21 2003-04-24 Board Of Regents, The University Of Texas System Methods and compositions for detection of breast cancer

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
CHOI ET AL.: 'SEPT5_v2 is a parkin-binding protein' MOL. BRAIN RES. vol. 17, no. 2, October 2003, pages 179 - 189 *
KASTAN ET AL.: 'Parc-ing p53 in the Cytoplasm' CELL vol. 112, no. 1, January 2003, pages 1 - 2 *
MARIN ET AL.: 'Parkin and relatives: the RBR family of ubiquitin ligases' PHYSIOLOGICAL GENOMICS vol. 17, no. 3, May 2004, pages 253 - 263 *
NIKOLAEV ET AL.: 'Parc: a cytoplasmic anchor for p53' CELL vol. 112, no. 1, January 2003, pages 29 - 40, XP002904294 *
NIKOLAEV ET AL.: 'Parc: a potential target for cancer therapy' CELL CYCLE vol. 2, no. 3, May 2003, pages 169 - 171 *
WEST AB ET AL.: 'Parkin is not regulated by the unfolded protein response in' NEUROSCI LETT. vol. 341, no. 2, May 2003, pages 139 - 142 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8349560B2 (en) 2007-06-15 2013-01-08 The Ohio State University Research Method for diagnosing acute lymphomic leukemia (ALL) using miR-222
US9085804B2 (en) 2007-08-03 2015-07-21 The Ohio State University Research Foundation Ultraconserved regions encoding ncRNAs
US8946187B2 (en) 2010-11-12 2015-02-03 The Ohio State University Materials and methods related to microRNA-21, mismatch repair, and colorectal cancer
US10758619B2 (en) 2010-11-15 2020-09-01 The Ohio State University Controlled release mucoadhesive systems
US11679157B2 (en) 2010-11-15 2023-06-20 The Ohio State University Controlled release mucoadhesive systems
US9249468B2 (en) 2011-10-14 2016-02-02 The Ohio State University Methods and materials related to ovarian cancer
US9481885B2 (en) 2011-12-13 2016-11-01 Ohio State Innovation Foundation Methods and compositions related to miR-21 and miR-29a, exosome inhibition, and cancer metastasis
US8859202B2 (en) 2012-01-20 2014-10-14 The Ohio State University Breast cancer biomarker signatures for invasiveness and prognosis
US9434995B2 (en) 2012-01-20 2016-09-06 The Ohio State University Breast cancer biomarker signatures for invasiveness and prognosis
WO2013113762A1 (en) * 2012-01-31 2013-08-08 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and kits for predicting the risk of having a cutaneous melanoma in a subject
CN107412727A (en) * 2017-03-16 2017-12-01 北京热休生物技术有限公司 The application of albumen PACRGL and its polypeptide in medicine of the treatment with pre- anti-cancer is prepared
CN107412727B (en) * 2017-03-16 2021-03-26 北京热休生物技术有限公司 Application of complex formed by polypeptide of protein PACRGL and heat shock protein gp96 in preparation of medicine for treating and preventing cancer

Also Published As

Publication number Publication date
AU2003286741A8 (en) 2004-11-26
AU2003286741A1 (en) 2004-11-26
WO2004098377A3 (en) 2005-05-06

Similar Documents

Publication Publication Date Title
WO2004098377A2 (en) Methods and compositions for diagnosis and therapy of parkin-associated disorders
O'Keefe et al. Comparative analysis of prostate‐specific membrane antigen (PSMA) versus a prostate‐specific membrane antigen‐like gene
US6596488B2 (en) Tumor suppressor gene
AU688839B2 (en) Novel apoptosis-modulating proteins, DNA encoding the proteins and methods of use thereof
CA2501602A1 (en) Novel tumor suppressor gene and compositions and methods for making and using the same
EP0938553B1 (en) Dna encoding dp-75 and a process for its use
WO2000014234A1 (en) Prostate specific promoter and regulation of gene expression
AU746135B2 (en) PARG, a GTPase activating protein which interacts with PTPL1
JP4890763B2 (en) Nucleic acids, polypeptides and methods for modulating apoptosis for modulating apoptosis
EP0877758A2 (en) PURIFIED SR-p70 PROTEIN
AU684930B2 (en) DNA encoding CAI resistance proteins and uses thereof
CA2411249C (en) Gasc1 gene
US6897062B1 (en) DNA encoding the prostate-specific membrane antigen-like gene and uses thereof
AU4218900A (en) Dna encoding the prostate-specific membrane antigen-like gene and uses thereof
AU718889B2 (en) deltaP62, its variants, nucleic acid sequences and their uses
JP2000125888A (en) Sialoadhesin family member-3
AU762987B2 (en) Chondrosarcoma associated genes
CA2218197A1 (en) Therapeutic methods for prostate cancer
WO2002012894A9 (en) Kruppel-like factor 6 (klf6), a tumorsuppressor protein, and dia gnostics, therapeutics, and screening based on this protein
JP4112976B2 (en) PCA2501 gene
JP4147058B2 (en) Diagnosis agent for schizophrenia
WO2001000825A2 (en) Human chromosome 15 and 16 bardet-biedl syndrome polynucleotides and polypeptides and methods of use
WO1993024628A2 (en) SEQUENCE OF HUMAN DOPAMINE TRANSPORTER cDNA
JP2000325087A (en) Tsa2306 gene
CA2371828A1 (en) Isolated nucleic acids of the p-hyde family, p-hyde proteins, and methods of inducing susceptibility to induction of cell death in cancer

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP