WO2004097023A1

WO2004097023A1 - Plants with pathogen resistance

Info

Publication number: WO2004097023A1
Application number: PCT/GB2004/001038
Authority: WO
Inventors: Marc Knight; Maike Rentel
Original assignee: Isis Innovation Ltd
Priority date: 2003-04-25
Filing date: 2004-03-11
Publication date: 2004-11-11

Abstract

We describe transgenic plant cells and transgenic plants which have been engineered to become resistant to biotic stress, particularly but not exclusively, said plants are resistant to wounding as a consequence of pathogen attack. We also disclose a stress responsive promoter which responds to wounding and is predominantly root specific.

Description

PLANTS WITH PATHOGEN RESISTANCE

The invention relates to transgenic plant cells and transgenic plants which have been engineered to become resistant to biotic stress, particularly but not exclusively, said plants are resistant to pathogen attack.

The damage inflicted to crops by insects and other plant pathogens, (e.g. nematodes, viruses, fungi and bacteria) has resulted in considerable economic losses and decreases in yield. Man has employed various methods to combat these pathogens, typically by the use of controlling agents such as insecticides, bactericides antivirals and anti-fungals. In most cases the pesticides are organic chemical molecules which have to be applied topically at the place where the pathogen attacks the organism in need of protection. In the case of plants this means spraying the chemical onto the crop, applying during watering of the plants, or incorporating it into the soil. The use of chemicals also has cost implications for the farmer.

An alternative would be for plants to make a biopesticide (i.e. a pesticide in planta). To this extent proteinaceous pesticides are advantageous, because they can be expressed in plants through recombinant DNA technology, without the need for specific enzymes or substrates and they are expected to be short-lived in the environment and thus much less damaging to it. However very few of these biopesticides are effective at broadly controlling pathogen attack.

There is a desire to discover alternative means to control plant pathogens which does not require the use of chemicals which are potentially harmful to both the environment and to animals which consume plant material which has been treated in this way and which have a broad spectrum of application in controlling many different types of pathogen.

A further alternative approach is to genetically engineer plant species so that they are resistant to infection by the above mentioned pathogens. Plants are unable to avoid pathogens by moving to a more favourable environment. Plants have therefore evolved defence mechanisms to provide protection from pathogen invasion. The mechanisms include physical barriers and inducible responses to pathogen attack which involve systemic signalling molecules which mobilise endogenous plant defence mechanisms.

In plants, as in animals, active oxygen species (AOS) signals in the form of an oxidative burst, are able to act as signalling events, leading to specific responses. Such responses include diverse processes such as responses to oxygen deprivation, ABA-induced guard cell closure and root hair growth (Liam Doolan, personal communication). However, very little is know about the signalling components acting downstream of AOS to mediate these responses.

In order to specifically identify protein kinase genes acting downstream of AOS during signalling in Arabidopsis we performed a differential display of kinase- encoding cDNA sequences, amplified by PCR with degenerate primers complementary to sequences conserved in kinases (data not shown). One such gene identified in this way, contained a coding region corresponding to a putative ser/thr kinase and named OX1, for 'OXIDATIVE SIGNAL-INDUCIBLEV kinase.

The OX1 gene consists of 1308 bp with a single 118 bp intron (accession number At3g25250). The predicted protein has a molecular weight of 47.6 kDa and contains a conserved eukaryotic protein kinase domain (hmmpfam (HMMER2.1.1)) of 12 subdomains, including a ser/thr kinase active site signature (prosite_scan) (Figure 3). The 12 kinase subdomains are located in the N-terminal 1000 bp of the gene, followed by a 280 bp C-terminus without homology to known sequences. A BLAST search of the OX1 nucleotide sequence revealed similarity to a number of protein kinases, with the highest ranking entry showing -80 % identity in the kinase domain region but lacking 108 bp at the C-terminus (Figure 3). This homologue of OX1 was named OX2. On the protein level, the two genes are to 72 % identical (266 out of 369 amino acids). The closest identified homologues in other plant species are a putative kinase from potato (T07670) and a protein kinase from rice (B30322) with 36 % amino acid identity (137 out of 380 and 136 out of 372 amino acids, respectively).

As described above, AOS signalling in plants may occur in response to wounding, pathogen attack, cold, drought, heat, anoxia (hereinreferred to as biotic stress) during certain stages of development. In order to determine which physiological role OXl played, we examined the expression of this gene temporally and spatially in response to a variety of such treatments using northern analysis. It was found that expression of OXl occurs particularly in response to wounding, and treatment with cellulase. A fast but transient increase in OXl levels was caused by wounding whereas H₂O and cellulase triggered sustained induction of OXl.

Spatial patterns of expression in response to these 2 treatments was measured using a Q /promoter::Gt/S reporter gene fusion construct. GUS staining of the OXl promoter: :GUS fusion lines after cellulase treatment showed that the promoter was activated across the entire surface of the cotyledons. On the other hand, wounding with a sharp razor blade increased GUS levels only along the edge of the wounded tissue and along the severed vascular tissues, consistent with regions expected to produce hydrogen peroxide. Control (untreated) seedlings did not show any staining.

As a second complementary approach designed to determine the physiological role of OXl we isolated an oxl null mutant line from the Wisconsin T-DNA insertion using PCR-based screening (data not shown). The isolated line contains a T-DNA insertion in the coding sequence between the first and second conserved kinase domains. This yields a truncated protein lacking the catalytic site and is therefore expected to be non-functional. The presence of a single T-DNA insertion in the mutant line was verified by TALL-PCR data not shown.

To yield information as to which AOS signalling pathway OXl was likely to operate in, we performed a microarray experiment at the NASC Affymetrix Facility (Nottingham, UK) comparing mRNA levels between oxl and Ws-2 in response to hydrogen peroxide treatment (data not shown). Transcript levels of several genes involved in the pathogen response were reduced in oxl, e.g. ECSl, a gene previously shown to be up-regulated in response to infection with an incompatible strain of Xanthomonas campestris and PR1. The reduced expression of such pathogenesis- related genes indicated a potential role for OXl in pathogen signalling, involving AOS.

To d irectly t est t his h ypothesis, w e m easured t he e xpression ofECSl and PRl in response to challenge with a virulent pathogen. ECSl was strongly induced in response to infection with the virulent P. parasitica parasitica strain Emco5, but to a much lower degree in the oxl null mutant when compared to the wild-type. Similarly, up-regulation of the PATHOGENESIS-RELATED PROTEIN1 (PR-1) gene was also reduced in oxl. Thus, the OXl gene is required for full induction of several pathogen- inducible genes, indicating a role for OXl in pathogen-triggered signalling.

This hypothesis i s supported by the finding that the OXl promoter is activated by infection with virulent isolates of P. parasitica: OXl promoter: :GUS fusion lines exhibited GUS expression along growing fungal hyphae in the adjacent layer of 2 to 4 cells and in cells penetrated by fungal haustoria. Final confirmation for the necessity of OXl for resistance to the virulent pathogen was obtained by comparing the infectivity of the oxl null mutant compared to wild type. Assessment of the extent of fungal sporulation demonstrated that the oxl s eedlings display enhanced susceptibilty to the virulent P. parasitica isolate Emco5. Resistance to the avirulent isolate Emoy2 was not removed in the oxl mutant (data not shown).

hi addition to the stress induced expression of OXl in the aerial parts of the plant, the

OXl promoter is always active in roots and often to a particularly high level in root hairs and therefore OXl may also be important during both stress response and root hair development. This is confirmed by the observation that in an oxl-τmll mutant root hair growth is significantly retarded in the mutant background when compared to wild-type.

Thus, the OXl gene is required for basal resistance but is not essential in gene-for- gene resistance mechanisms and also influences root hair development.

According to an aspect of the invention there is provided a transgenic plant cell in which the genome of said plant is modified such that the enzyme activity of a serine/threonine kinase is altered when compared to a non-transgenic reference cell of the same species wherein said plant cell is resistant to biotic stress.

In a preferred embodiment of the invention said cell is modified such that the serine/threonine kinase enzyme activity of a polypeptide encoded by a nucleic acid molecule selected from the group consisting of: i) a nucleic acid molecule comprising a nucleic acid sequence represented in Figure 1 or 2; ii) a nucleic acid molecule which hybridises to the sequence represented in Figure 1 or 2 and which encodes a serine/threonine kinase; and iii) a nucleic acid molecule which differs from the nucleic acid molecules of (i) and (ii) in codon usage due to degeneracy in the genetic code, is modulated.

In a preferred embodiment of the invention said nucleic acid hybridises under stringent hybridisation conditions to the sequences represented in Figure 1 or 2.

Stringent hybridisation/washing conditions are well known in the art. For example, nucleic acid hybrids that are stable after washing in O.lx SSC,0.1% SDS at 60°C. It is well known in the art that optimal hybridisation conditions can be calculated if the sequence of the nucleic acid is known. For example, hybridisation conditions can be determined by the GC content of the nucleic acid subject to hybridisation. Please see Sambrook et al (1989) Molecular Cloning; A Laboratory Approach. A common formula for calculating the stringency conditions required to achieve hybridisation between nucleic acid molecules of a specified homology is:

T_m = 81.5° C + 16.6 Log [Na⁺] + 0.41[ % G + C] -0.63 (%formamide)

Typically, hybridisation conditions uses 4 - 6 x SSPE (20x SSPE contains 175.3g NaCl, 88.2g NaH₂PO₄ H₂O and 7.4g EDTA dissolved to 1 litre and the pH adjusted to 7.4); 5-10x Denhardts solution (50x Denhardts solution contains 5g Ficoll (type 400, Pharmacia), 5g polyvinylpyrrolidone abd 5g bovine serum albumen; lOOμg- l.Omg/ml sonicated salmon/herring DNA; 0.1-1.0% sodium dodecyl sulphate; optionally 40-60% deionised formamide. Hybridisation temperature will vary depending on the GC content of the nucleic acid target sequence but will typically be between 42°- 65° C.

i a preferred embodiment of the invention said modulation is an increase in enzyme activity when compared to a non-transgenic reference cell of the same species. Preferably the phenotype of said cell is increased resistance to biotic stress, preferably wounding as a consequence of physical damage caused by plant pathogens or the environment.

Preferably said activity is increased by at least about 2-fold above a basal level of activity. More preferably said activity is increased by at least about 5 fold; 10 fold; 20 fold, 30 fold, 40 fold, 50 fold. Preferably said activity is increased by between at least 50 fold and 100 fold. Preferably said increase is greater than 100-fold.

In a further preferred embodiment of the invention said nucleic acid molecule is over- expressed in root tissue, preferably root hairs.

It will be apparent that means to increase the activity of a polypeptide encoded by a nucleic acid molecule are known to the skilled artisan. For example, and not by limitation, increasing the gene dosage by providing a cell with multiple copies of said gene. Alternatively or in addition, a gene(s) may be placed under the control of a powerful promoter sequence or an inducible promoter sequence to elevate expression of mRNA encoded by said gene. The modulation of mRNA stability is also a mechanism used to alter the steady state levels of an mRNA molecule, typically via alteration to the 5' or 3' untranslated regions of the mRNA.

According to a further aspect of the invention there is provided a vector comprising a nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of: i) a nucleic acid molecule consisting of a nucleic acid sequence represented in Figure 1 or 2; ii) a nucleic acid molecule which hybridises to the sequence represented in Figure 1 or 2 and which encodes a serine/threonine kinase; and iii) a nucleic acid molecule which differs from the nucleic acid molecules of (i) and (ii) in codon usage due to degeneracy in the genetic code characterised in that said vector is adapted for the increased expression of said nucleic acid molecule.

Suitable vectors can be constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. For further details see, for example, Molecular Cloning: Laboratory Manual: 2^nd edition, Sambrook et al. 1989, Cold Spring Habor Laboratory Press or Current Protocols in Molecular Biology, Second Edition, Ausubel et al. Eds., John Wiley & Sons, 1992.

Specifically included are shuttle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eukaryotic (e.g. higher plant, mammalian, yeast or fungal cells). Preferably the nucleic acid in the vector is under the control of, and operably linked to an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial, (e.g. bacterial), or plant cell. The vector may be a bi-functional expression vector which functions in multiple hosts, hi the case of Oxl and Ox 2 genomic DNA this may contain its own promoter or other regulatory elements and in the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell.

By "promoter" is meant a nucleotide sequence upstream from the transcriptional initiation site and which contains all the regulatory regions required for transcription. Suitable promoters include constitutive, tissue-specific, inducible, developmental or other promoters for expression in plant cells comprised in plants depending on design. Such promoters include viral, fungal, bacterial, animal and plant-derived promoters capable of functioning in plant cells.

Constitutive promoters include, for example CaMV 35S promoter (Odell et al. (1985) Nature 313, 9810-812); rice actin (McElroy et al. (1990) Plant Cell 2: 163- 171); ubiquitin (Christian et al. (1989) Plant Mol. Biol. 18 (675-689); pEMU (Last et al. (1991) Theor Appl. Genet. 81: 581-588); MAS (Velten et al. (1984) EMBO J. 3. 2723-2730); ALS promoter (U.S. Application Seriel No. 08/409,297), and the like. Other constitutive promoters include those in U.S. Patent Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680, 5,268,463; and 5,608,142.

Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter may be a chemical-inducible promoter, where application of the chemical induced gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical-inducible promoters are known in the art and include, but are not limited to, the maize hι2-2 promoter, which is activated b y b enzenesulfonamide h erbicide s afeners, the m aize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR- la promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid- responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88: 10421-10425 and McNellis et al. (1998) Plant J. 14(2): 247-257) and tetracycline-inducible and tetracycline- repressible p romoters (see, for example, Gatz et al. ( 1991) Mol. Gen. Genet. 227: 229-237, and US Patent Nos. 5,814,618 and 5,789,156, herein incorporated by reference.

Where enhanced expression in particular tissues is desired, tissue-specific promoters can be utilised. Tissue-specific promoters include those described by Yamamoto et al. (1997) Plant J. 12(2): 255-265; Kawamata et al. (1997) Plant Cell Physiol. 38(7): 792-803; Hansen et al. (1997) Mol. Gen. Genet. 254(3): 337-343; Russell et al. (1997) Transgenic Res. 6(2): 157-168; Rinehart et al. (1996) Plant Physiol. 112(3): 1331-1341; Van Camp et al. (1996) Plant Physiol. 112(2): 525-535; Canevascni et al. (1996) Plant Physiol. 112(2): 513-524; Yamamoto et al. (1994) Plant Cell Physiol. 35(5): 773-778; Lam (1994) Results Probl. Cell Differ. 20: 181-196; Orozco et al. (1993) Plant Mol. Biol. 23(6): 1129-1138; Mutsuoka et al. (1993) Proc. Natl. Acad. Sci. USA 90 (20): 9586-9590; and Guevara-Garcia et al (1993) Plant J. 4(3): 495-50.

"Operably linked" means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter. In a preferred aspect, the promoter is an inducible promoter or a developmentally regulated promoter.

Particular of interest in the present context are nucleic acid constructs which operate as plant vectors. Specific procedures and vectors previously used with wide success in plants are d escribed by Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148. Suitable vectors may include plant viral- derived vectors (see e.g. EP-A-194809).

If desired, selectable genetic markers may be included in the construct, such as those that confer selectable phenotypes such as resistance to antibodies or herbicides (e.g. kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate).

Plants transformed with a DNA construct of the invention may be produced by standard techniques known in the art for the genetic manipulation of plants. DNA can be introduced into plant cells using any suitable technology, such as a disarmed Ti-plasmid vector carried by Agrobacterium exploiting its natural gene transferability (EP-A-270355, EP-A-0116718, NAR 12(22):8711-87215 (1984), Townsend et al, US Patent No. 5,563,055); particle or microprojectile bombardment (US Patent No. 5,100,792, EP-A-444882, EP-A-434616; Sanford et al, US Patent No. 4,945,050; Tomes et al. (1995) "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment", in Plant Cell, Tissue and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin); and McCabe et al. (1988) Biotechnology 6: 923-926); microinjection (WO 92/09696, WO 94/00583, EP 331083, EP 175966, Green et al. 91987) Plant Tissue and Cell Culture, Academic Press, Crossway et al. (1986) Biotechniques 4:320-334); electroporation (EP 290395, WO 8706614, Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606; DΗalluin et al. 91992). Plant Cell 4:1495-1505) other forms of direct DNA uptake (WO 9012096, US Patent No. 4,684,611, Paszkowski et al. (1984) EMBO J. 3:2717- 2722); liposome-mediated DNA uptake (e.g. Freeman et al (1984) Plant Cell Physiol, 29:1353); or the vortexing method (e.g. Kindle (1990) Proc. Nat. Acad. Sci. USA 87:1228). Physical methods for the transformation of plant cells are reviewed in Oard (1991) Biotech. Adv. 9:1-11. See generally, Weissinger et al. (1988) Ann. Rev. Genet. 22:421-477; Sanford et al. (1987) Particulate Sciences and Technology 5:27- 37; Christou et al. (1988) Plant Physiol. 87:671-674; McCabe et al. (1988) Bio/Technology 6:923-926; Finer and McMullen (1991) In Vitro Cell Dev. Biol. 27P:175-182; Singh et al. (1988) Theor. Appl. Genet. 96:319-324; Datta et al. (1990) Biotechnology 8:736-740; Klein et al. (1988) Proc. Natl. Acad. Sci. USA 85: 4305- 4309; Klein et al. (1988) Biotechnology 6:559-563; Tomes, US Patent No. 5,240,855; Buising et al. US Patent Nos. 5,322, 783 and 5,324,646; Klein et al. (1988) Plant Physiol 91: 440-444; Fromm et al (1990) Biotechnology 8:833-839; Hooykaas-Von Slogteren et al. 91984). Nature (London) 311 :763-764; Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA 84:5345-5349; De Wet et al. (1985) in The Experimental Manipulation of Ovule Tissues ed. Chapman et al. (Longman, New York), pp. 197-209; Kaeppler et al. (1990) Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor. Appl. Genet. 84:560-566; Li et al. (1993) Plant Cell Reports 12: 250-255 and Christou and Ford (1995) Annals of Botany 75: 407- 413;Osjoda et al. (1996) Nature Biotechnology 14:745-750, all of which are herein incorporated by reference.

Agrobacterium transformation is widely used by those skilled in the art to transform dicotyledonous species. Recently, there has b een substantial progress towards the routine production of stable, fertile transgenic plants in almost all economically relevant monocot plants (Toriyama et al. (1988) Bio/Technology 6: 1072-1074; Zhang et al. (1988) Plant Cell rep. 7379-384; Zhang et al. (1988) Theor. Appl. Genet. 76:835-840; Shimamoto et al. (1989) Nature 338:274-276; Datta et al. (1990) Bio/Technology 8: 736-740; Christou et al. (1991) Bio/Technology 9:957-962; Peng et al (1991) International Rice Research Institute, Manila, Philippines, pp.563-574; Cao et al. (1992) Plant Cell Rep. 11: 585-591; Li et al. (1993) Plant Cell Rep. 12: 250-255; Rathore et al. (1993) Plant Mol. Biol. 21:871-884; Fromm et al (1990) Bio/Technology 8:833-839; Gordon Kamm et al. (1990) Plant Cell 2:603-618; D'Halluin et al. (1992) Plant Cell 4:1495-1505; Walters et al. (1992) Plant Mol. Biol. 18:189-200; Koziel et al. (1993). Biotechnology 11194-200; Vasil, I.K. (1994) Plant Mol. Biol. 25:925-937; Weeks et al (1993) Plant Physiol. 102:1077-1084; Somers et al. (1992) Bio/Technology 10:1589-1594; WO 92/14828. In particular, Agrobacterium mediated transformation is now emerging also as an highly efficient transformation method in monocots. (Hiei, et al. (1994) The Plant Journal 6:271- 282). See also, Shimamoto, K. (1994) Current Opinion in Biotechnology 5:158-162; Vasil, et al. (1992) Bio/Technology 10:667-674; Vain, et al. (1995) Biotechnology Advances 13(4):653-671; Vasil, et al. (1996) Nature Biotechnology 14: 702).

Microprojectile bombardment, electroporation and direct DNA uptake are preferred where A grobacterium is inefficient or ineffective. Alternatively, a combination of different techniques maybe employed to enhance the efficiency of the transformation process, e.g. bombardment with Agrobacterium-coat d microparticles (EP-A- 486234) or microprojectile bombardment to induce wounding followed by co- cultivation with Agrobacterium (EP-A-486233).

According to a further aspect of the invention there is provided a plant comprising a plant cell according to the invention.

In a preferred embodiment of the invention there is provided a plant selected from the group consisting of: corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.), flax (Linum usitatissimum), alfalfa (Medicago sativa), rice (Oryza sativa), rye

(Secale cerale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower

(Helianthus annus), wheat (Tritium aestivum), soybean (Glycine max), tobacco

(Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (lopmoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Anana comosus), citris tree (Citruy spp.) cocoa (Theobroma cacao), tea (Camellia senensis), banana (Musa spp.), avacado (Persea americana), fig (Ficus casica), guava (Psidiwn guajava), mango (Mangifer indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia inter grifolia), almond

(Prunus amygdάlus), sugar beets (Beta vulgaris), oats, barley, vegetables.

Preferably, plants of the present invention are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley, pea), and other root, tuber or s eed crops. Important seed crops are oil-seed rape, sugar beet, maize, sunflower, soybean,sorghum, and flax (linseed). Horticultural plants to which the present invention may be applied may include lettuce, endive, and vegetable brassicas including cabbage, broccoli, and cauliflower. The present invention may be applied in tobacco, cucurbits, carrot, strawberry, sunflower, tomato, pepper. Also included are ornamental plants.

Grain plants that provide seeds of interest include oil-seed plants and leguminous plants. Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, etc. Oil-seed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc. Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava been, lentils, chickpea, etc.

According to a yet further aspect of the invention there is provided a seed comprising a cell according to the invention.

According to a further aspect of the invention there is provided a method to modulate root hair growth comprising the steps of: i) providing a cell according to the invention; ii) regenerating said cell into a plant; and optionally iii) monitoring the root hair growth.

In a preferred method of the invention said root hair growth is increased when compared to a non-transgenic reference plant of the same species.

According to a yet further aspect of the invention there is provided nucleic acid molecule comprising a promoter sequence derived from a plant serine/threonine kinase gene wherein said promoter sequence is inducible by biotic stress.

In a preferred embodiment of the invention said serine/threonine kinase gene is Ox 1 or Ox 2. Preferably said nucleic acid molecule comprises a nucleic acid sequence comprising about +1 (+ 1 is the first nucleotide base of the coding sequence as shown in Figure 1 or 2) to -1600 of the genomic sequence of Ox 1 or Ox 2. The geno ic sequence of Ox 1 can be found at At3g25250 (www.ncbi.nlm.nih.gov/).

In a preferred embodiment of the invention said promoter sequence directs expression predominantly in root tissue, preferably root hairs.

According to a further aspect of the invention there is provided a vector comprising a promoter according to the invention. Preferably said promoter is operably linked to a second nucleic acid molecule wherein said second nucleic acid molecule encodes an agent.

hi a preferred embodiment of the invention said agent is an anti-pathogen agent. Preferably said agent is selected from the group consisting of: an anti-nematode agent; an anti-fungal agent; an anti- viral agent; or an anti-bacterial agent.

In a further preferred embodiment of the invention said agent is a polypeptide.

According to a yet further aspect of the invention there is provided a transgenic plant transformed with a nucleic acid or vector according to the invention.

In a preferred embodiment of the invention said agent is expressed in root tissue, preferably in root hairs.

According to a further aspect of the invention there is provided a method to generate a plant with increased resistance to biotic stress comprising: i) providing a cell according to the invention; ii) regenerating said cell into a plant; and optionally iii) monitoring the response of said plant to at least one biotic stress. hi a preferred method of the invention said plant has altered pathogen resistance. Preferably said plant has increased pathogen resistance.

hi a preferred method of the invention said resistance is to a fungal pathogen, preferably of the genus Peronospora spp e.g. P. parastica.

hi a further preferred method of the invention said resistance is to a nematode parasite.

The genera Heterodera and Globodera are cyst nematodes and are important crop pests. They include H. glycines, (soybean cyst nematode) H. schachtii (beet cyst nematode), H. avenae (cereal cyst nematode) and potato cyst nematodes G. rostochiensis and G. pallida. Root-knot nematodes particularly the genus Meloidogyne, damage a wide range of crops. Examples are species M. javanica, M. hapla, M. arenaria and M. incognita. There are many other economically important nematodes. B oth t he above g roups p roduce s wollen s edentary females a s d o o ther economic genera including Rotylenchulus, Nacobbus, and Tylenchulus. Other economic nematodes remain mobile as adult females and many of these cause damage to a wide range of crops. Examples include species of Ditylenchus, Radopholous, Pratylenchus, Helicotylenchus and Hirschmanniella. Others do not always enter plants but feed from them as ectoparasites. Examples include Aphelenchoides, Anguina Criconemoides, Criconema Hemicycliophora, Hemicriconemoides, Paratylenchus and Belonolaimus. Among the ectoparasites the genera Xiphinema, Longidorus, Paralongidorus, Trichodorus and Paratrichodrus have distinctive importance.

In a further preferred method of the invention said pathogen is a virus.

In a yet further preferred method of the invention said pathogen is a bacterium.

hi a yet further preferred method of the invention said pathogen is an insect. An embodiment of the invention will now be described by example only and with reference to the following figures and examples:

Figure 1 represents the nucleic acid sequence of Ox 1;

Figure 2 represents the nucleic acid sequence of Ox 2;

Figure 3 illustrates (a) Alignment of the OXl and OX2 protein sequences. OXl and OX2 protein sequences were aligned in ClustalW (http://www.ebi.ac.uk/clustalw/) and shaded in Boxshade (htφ://www.ch.embnet.org/software/BOX_form.html). Black boxes represent identical amino acids whereas grey shading indicates amino acids with similar properties. Dottted lines indicate gaps. Roman numerals above the sequence refer to the 12 domains conserved across the protein kinase family (Hanks and Quinn, 1991). The site of the T-DNA insertion is indicated by an arrow, (b) OXl is induced in response to H O ;

Figure 4 illustrates a) Northern analysis was carried out as described in {Knight, 1998 #379}. 7 day old Col-0 seedlings were transferred into cellulase (Cell.) (Onozuka R-10, Yakult Ltd, Tokyo) were added to final concentrations of 10 mM or 0.01 % (w/v), respectively, or seedlings were wounded (W) with tweezers until approximately 25 % of the cotyledon surface was damaged. Control samples (C) remained in H₂O. Samples were frozen after 0.5, 1 or 3 hours. OXl and β-TUBULLN (TUB) -specific probes were labelled with ³²P and hybridised to total RNA blotted onto nylon membrane, i) - iv) 7 day old Col-0 seedlings transformed with the OXlpromoter::GUS construct (see Methods) were incubated in b) H₂O or c) 0.1 % (w/v) cellulase solution. In iii) and iv), cotyledons were cut across the surface with a sharp razor blade. After 3 hours, tissues were stained for GUS expression. Images were taken with a Nikon Coolpix 990 digital camera mounted on a Leica DM R microscope; Figure 5 illustrates reduced gene induction by infection with virulent P. parasitica in the oxl mutant Northern analysis was carried out as described in {Knight, 1998 #379}.10 day old Ws-2 wild-type (wt) and oxl seedlings were sprayed with H₂O (-) or a spore suspension of the virulent P. parasitica isolate EmcoS (+), containing 5 x 10⁴ spores / ml. Growth conditions were adjusted to allow infection of the plants (GLAZEBROOK7TORRES?). Seedlings were frozen 2, 5 or 7 days after spraying. ECSl, PR-1 and β-TUBULIN (TUB) -specific probes were labelled with ³²P and hybridised to total RNA blotted onto nylon membrane;

Figure 6 illustrates OXl is induced at sites of P. parasitica growth and is required for basal resistance a) and b): 4 week old Col-0 seedlings transformed with the OXl promoter:: GUS construct (see Methods) were infected with the virulent P. parasitica isolate Maks 9. Leaves were detached from the plant 7 days after infection and stained for GUS expression. Infected leaves show OXl::GUS induction in several cell layers along the fungal hyphae (1) and cells containing fungal haustoria (2). Similar results were obtained for leaves infected with the isolate Emco5. Images were taken with a Nikon Coolpix 990 digital camera mounted on a Leica DM R microscope, c) The level of fungal infection was assessed by determining the extent of fungal sporulation 5 days post infection (see Methods). Error bars represent standard error of 8 samples.

Materials and Methods

Q /promoter::G^;t/S reporter gene construct

A 1610 bp fragment containing the promoter and the first 2 nucleotides of the OXl coding sequence was amplified from genomic DNA by PCR with the primers GCGCGGATCCCGCTGGGATAATCTCAAAGG and

CGCGCTGCAGATAATGTCGACGTTAGTTAAC, and cloned into the pDH51 plasmid {Pietrzak, 1986 #467} containing the GUS reporter gene (gift of Dr Joy Boyce, University of Oxford). The OXlpromoter::GUS fragment including a CaMV terminator sequence was subsequently excised by restriction with BamHI and Kpnl and ligated into the binary vector pBLN19, cut with the same enzymes {Bevan, 1984 #476}. The resulting plasmid was transformed into Agrobacterium tumefaciens, strain C58C1 {Deblaere, 1985 #516}. Col-0 plants were transformed by the dipping method { Clough, 1 998 #263}. All experiments were carried out on 5 independent transformed lines.

Assessment of P. parasitica sporulation

150 - 300 mg tissue (cotyledons and small leaves) from separate plugs were removed, weighed and 200 μl H O was added. After vortexing for 30 s, spores were counted on a haemocytometer. The mean of ten squares (each 0.1 mm³ suspension) was recorded per sample and several samples were scored twice to ensure accuracy. The resultant count was divided by the weight of the tissue (mg).

Claims

1. A plant cell which is genetically modified such that the serine/threonine kinase enzyme activity of a polypeptide encoded by a nucleic acid molecule selected from the group consisting of: i) a nucleic acid molecule comprising a nucleic acid sequence represented in Figure 1 or 2; ii) a nucleic acid molecule which hybridises to the sequence represented in Figure 1 or 2 and which encodes a serine/threonine kinase; and iii) a nucleic acid molecule which differs from the nucleic acid molecules of (i) and (ii) in codon usage due to degeneracy in the genetic code, is modulated.

2. A cell according to Claim 1 wherein said nucleic acid hybridises under stringent hybridisation conditions to the sequences represented in Figure 1 or 2.

3. A cell according to Claim 1 or 2 wherein said modulation is an increase in enzyme activity above a basal level of activity when compared to a non-transgenic reference cell of the same species.

4. A cell according to Claim 3 wherein said activity is increased by at least about 2-fold above a basal level.

5. A cell according to Claim 3 or 4 wherein said activity is increased by at least about 5 fold; 10 fold; 20 fold, 30 fold, 40 fold, or 50 fold.

6. A cell according to Claim 3 wherein said activity is increased by between at least 50 fold to 100 fold.

7. A cell according to Claim 3 wherein said increase is greater than 100-fold.

8. A plant comprising a plant cell according to any of Claims 1-7.

9. A seed comprising a cell according to any of Claims 1-7.

10. A method to modulate root hair growth comprising the steps of: i) providing a cell according to any of Claims 1-7; ii) regenerating said cell into a plant; and optionally iii) monitoring the root hair growth.

11. A method according to Claim 10 wherein said root hair growth is increased when compared to a non-transgenic reference plant of the same species.

12. A vector comprising a nucleic acid molecule consisting of a nucleic acid sequence selected from the group consisting of: i) a nucleic acid molecule consisting of a nucleic acid sequence represented in Figure 1 or 2; ii) a nucleic acid molecule which hybridises to the sequence represented in Figure 1 or 2 and which encodes a serine/threonine kinase; and iii) a nucleic acid molecule which differs from the nucleic acid molecules of (i) and (ii) in codon usage due to degeneracy in the genetic code characterised in that said vector is adapted for the increased expression of said nucleic acid molecule which encodes said serine/threonine kinase.

13. A nucleic acid molecule comprising a promoter sequence derived from a plant serine/threonine kinase gene wherein said promoter sequence is inducible by biotic stress.

14. A nucleic acid molecule according to Claim 13 wherein said serine/threonine kinase gene is Ox 1 or Ox 2.

15. A nucleic acid molecule according to Claim 14 wherein said promoter comprises a nucleic acid sequence comprising about +1 to -1600 of the genomic sequence of Ox: 1 or Ox 2.

16. A vector comprising a promoter according to any of Claims 13-15.

17. A vector according to Claim 16 wherein said promoter is operably linked to a second nucleic acid molecule wherein said second nucleic acid molecule encodes an agent.

18. A vector according to Claim 17 wherein said agent is an anti-pathogen agent.

19. A vector according to Claim 17 wherein said agent is selected from the group consisting of: an anti-nematode agent; an anti-fungal agent; an anti-viral agent; or an anti-bacterial agent.

20. A vector according to any of Claims 17-19 wherein said agent is a polypeptide.

21. A method to generate a plant with increased resistance to biotic stress comprising: i) providing a cell according to any of Claims 1 -7; ii) regenerating said cell into a plant; and optionally iii) monitoring the response of said plant to at least one biotic stress.

22. A method according to Claim 21 wherein said plant has increased pathogen resistance.

23. A method according to Claim 22 wherein said resistance is to a fungal pathogen.

24. A method according to Claim 22 wherein said resistance i s to a nematode parasite.

25. A method according to Claim 22 wherein said pathogen is a virus.

26. A method according to Claim 22 wherein said pathogen is a bacterium.

27. A method according to Claim 22 wherein said pathogen is an insect.