WO2004092376A1 - Method of designing normally orthogonalized sequences, method of producing nucleic acids being normally orthogonalized sequences and nucleic acids obtained thereby - Google Patents

Abstract

It is intended to provide a method of designing normally orthogonalized sequences, a method of producing nucleic acids which are normally orthogonalized sequences and nucleic acids obtained thereby. Namely, a method of designing normally orthogonalized sequences which comprises: first or preliminarily constructing a plural number of base sequences at random; determining the mean of the melting points thereof; obtaining candidate sequences based on a threshold restricted to a temperature range corresponding to the mean ± 1σ; and obtaining normally orthogonalized sequences from the candidate sequences depending on, as an indication, whether or not being a sequence reacting independently.

Description

 Detail

Method for designing orthonormalized sequence group, method for producing nucleic acid group based on orthonormalized sequence, and nucleic acid obtained by the method

Technical field

 The present invention relates to a method for designing an orthonormalized sequence group, a method for producing a nucleic acid group which is an orthonormalized sequence, and a nucleic acid obtained by the method.

Background art

 Nucleic acid sequence design techniques can be broadly divided into two categories. One is a design method in which the sequence of the genomic DNA or mRNA is targeted and the optimal sequence for detection is selected from the targets. The other is to design an artificial sequence with uniform thermal properties, which was conceived in the study of DNA combining (see, for example, Japanese Patent Application Laid-Open Publication No. 2001-151561). The former is a technique for designing a nucleic acid used to detect a specific gene such as genomic mRNA, and is limited to sequences that hybridize to the specific gene of interest. The design is done. Under such restrictions, for example, primers for PCR have similar melting temperatures (Tm values) and are complementary to each other by a distance of about several hundred bases that can be identified by electrophoresis. Non-target sequences are selected. Patents such as US Pat. No. 5,556,749, Patent No. 3,055,942, Japanese Patent Laid-Open No. 2000-258,568 and Japanese Patent Publication No. 0 0 1 — 2 5 8 5 7 6, USP 6 2 5 1 5 8 8, WO 0/4 6 3 6 3.

In particular, WO 0 Z 4 6 3 6 3 In order to improve the gene specificity as well as the specificity, the specificity is evaluated using the tuple information of other known genes of the target organism, and the Hamming distance is examined to determine whether or not there is a reaction with mismatch. I'm sure. On the other hand, the latter artificial sequence design technology is not intended for gene detection, so there is freedom in sequence design, but it is necessary to design many types of sequences.

 For example, Ad 1 e ma n solves the Hamiltonian path by

A sequence corresponding to the seven vertices was designed, and a solution was obtained by connecting the DNAs of the vertices with DNA representing 14 directional edges connecting the vertices (Ad 1 eman, Science, 26 ο:

10 2 1-2 4 (see 199 4)). In this method, 21 different 20 m er nucleic acids were used in the reaction. However, from the force S, Ad 1 eman solved a very small Hamiltonian path problem with seven vertices, not a problem of realistic size.

It is a Hamiltonian path problem with hundreds of vertices that can be calculated faster than electronic computers. To solve this, we need to design far more hundreds of different types of DNA arrays. If the Tm value of the DNA representing the vertices is not uniform among these D-type sequences, the connection of specific vertices is likely to proceed. If this is not taken, the route will not be used for the reaction, and a calculation error will be generated.

As described above, for the reaction of DNA combing, (1) Tm values are almost uniform, (2) no secondary structure is obtained, and (3) mutual Losno, Implicitization It is necessary to design a nucleic acid set having a sequence. As a design method for this purpose, there is Patent No. 31855853, but it is intended to be used for a specific reaction and has low versatility.

 As described above, the gene detection technology aims to detect without errors while observing the restriction of hybridizing to the sequence of the child. However, SNP (sing1eNuc1eotidePo1ymorPhism), which has recently attracted attention, is required to detect a single nucleotide polymorphism at a position that always contains a specific salt of a gene. Since it is necessary to design a π-prime primer, detection may be difficult depending on the sequence.SNPs are said to exist at a ratio of one in hundreds of bases of a human gene. However, if the number required for detection is all performed in separate reaction solutions, the cost cannot be justified.

 To solve this problem, fluorescent identification beads were used.

Multiplex SNP detection methods such as Illumina's BeadArray ^™ (registered trademark) and the 0 1-zip code method that Barrany et al. Of Cornell University have experimented with have been proposed.

 In addition, the tag sequence of the marker is attached to the IB. Gene protein, and a sequence complementary to the tag sequence is fixed in the microarray to achieve general-purpose detection. Microphone array called Sanole chip J GenFlex ™ Tag Array power SA ffyetri

Released by Company X.

In these methods, a human sequence called a tag or zip code is added to the end of the gene-specific probe sequence, and after detecting the gene on the probe side, the artificial sequence is amplified with a common primer. Quantitative detection is carried out depending on the width. □ cL>, although the purpose is different, Lvnx Γ Μ

 1 herap eutics offers a cloning system called Megaclone. In this method, different tag arrays are provided for each bead, so that closing can be performed more efficiently. .

 The tag zip code arrangement used in the above technology is described in the following patents: Barany et al. Describe Tm values and cross-noise hybrids as shown in WO 01/79548. Based on the technology of selecting a four-base sequence set that takes into account the characteristics of the dissociation and generating a zip-and-sequence by combining them. On the other hand, L y n

The HeraPeutics, as in USP 5, 635, and 400, uses a sequence base set of 3 to 6 bases that is unlikely to cause chromosomal hybridization. Then, a tag sequence of about 24 bases is generated and combined according to the combination. In the method of designing by combining the sequences, the length of the nucleic acid is

However, there is a disadvantage that the number is limited to an integral multiple of the basic array on which the base is based. In other words, those methods could not generate a sequence group having useful thermochemical properties while having a prime length such as a 23 mer or a 29 mer.

 On the other hand, in EP 799 897, a sequence generated according to a standard, such as having at least 8 bases and having the same sequence without limitation in length, is added to the set. Suggest a way.

However, both methods are considered to be arrays that do not have variances in _C Tm values or cross-hybridization problems. Validation is row Not

Disclosure of the invention

 IS subject that Akira is trying to solve

 An object of the present invention is to provide a method for producing a nucleic acid group which is an orthonormalized sequence, a method for producing a nucleic acid group which is an orthonormalized sequence, and a nucleic acid obtained by the method.

 In particular, such a sequence group and such a nucleic acid group have substantially the same melting temperature of their respective base sequences or nucleic acids, and are close to each other. O The next structure is not stable o

 Means for solving the problem

 The present invention provides the following methods as means for achieving the above-mentioned objectives.

In other words, this is a method for designing a group of normal ¾-crossover sequences.First, or in advance, a plurality of base sequences are generated, and the average value of their melting temperatures is determined. And obtaining a candidate sequence based on a threshold limited by ± t ° C of the average value, and orthonormalized sequences from candidate sequences obtained based on whether or not the sequence reacts independently A method for designing a group of normal crossing sequences comprising obtaining a group is provided ^ ₀

BRIEF DESCRIPTION OF THE FIGURES

 FIG. 1 is a block diagram illustrating one example of a digital computer that may be used in accordance with embodiments of the present invention.

FIG. 2 is a flowchart illustrating an example of the method according to one embodiment of the present invention. FIG. 3 is a flowchart showing an example of a design method according to one embodiment of the present invention.

 FIG. 4 is a flowchart showing one example of a design method according to one embodiment of the present invention.

 FIG. 5 is a flowchart showing one example of a design method in one mode of the present invention.

 FIG. 6 is a flowchart showing a part of a design method according to one embodiment of the present invention.

 FIG. 7 is a flowchart showing a part of the design method according to one embodiment of the present invention.

 FIG. 8 is a diagram illustrating an example of a method for examining self-complementarity.

 FIG. 9 is a diagram showing one example of a method for examining self-complementarity-FIG. 10 is a diagram showing one example of a method for examining self-complementarity

 FIG. 11 is a diagram showing an example of a method for confirming the existence of a mouth snow hydration.

 Fig. 12 is a diagram showing an example of a method for confirming the presence of mouth hybridization.

 FIG. 13 is a diagram showing a further example of a method for producing a candidate sequence. Figure 14 shows the orthonormalized array list (1).

 Figure 15 is a continuation of the list of orthonormal arrays (2); (1).

16 is a continuation of the list of orthonormal arrays ( ³ ); (2). Figure 17 is a continuation of the list of orthonormalized arrays (4); ( ³ ). 18 is the continuation of the list of orthonormalized arrays (5); (4). Figure 1 9 is list of orthonormal sequences ^(6); Ru Following ⁵ because of ^(5). Figure 20 is a continuation of the list of orthonormalized arrays (7); ( ⁶ ). Figure 21 is a continuation of the list of orthonormalized arrays ( ⁸ ); ( ⁷ ). Figure 22 shows a normal array for verification using a microarray.

(1).

 Figure 23 shows an orthonormal array for verification using a microarray.

( ² ) Continuation of; (1).

 Figure 24 shows an orthonormalized array for verification using a microarray.

( ³ ) Continuation of ( ² ).

 Figure 25 shows an orthonormalized array for verification using a microarray.

(4) Continuation of; (3).

 Figure 26 shows an orthonormal array for verification using a microarray.

(5) Continuation of; (4). '

 Figure 27 shows an orthonormal array for verification using a microarray.

(6) Continuation of; (5).

 FIG. 28 is a graph showing the result of the batch 1 in Example 2.

 FIG. 29 is a graph showing the result of verification on batch 2 in Example 2.

 FIG. 30 is a graph showing the verification result of the batch 3 in the second embodiment.

 FIG. 31 is a graph showing the verification result of batch 4 in Example 2.

Figure 32 shows the verification results for batch 5 in Example 2. Graph

 FIG. 33 is a graph showing the verification result of the switch 6 in the second embodiment.

 FIG. 34 is a graph showing the result of the verification of the knockout 7 in the second embodiment.

 FIG. 35 is a graph showing the results of verification on the knockout 8 in the second embodiment.

 FIG. 36 is a graph showing the verification result of -yh 9 in the second embodiment.

 FIG. 37 is a graph showing the result of verification on Bakuchi 10 in Example 2.

 FIG. 38 is a graph showing the verification result of the knock 11 in the second embodiment.

 FIG. 39 is a graph showing the results of verification of the first embodiment according to the second embodiment.

 FIG. 40 is a graph showing the verification results of the notch 13 in Example 2.

 FIG. 41 is a graph showing the result of verification of the backlash 14 in the second embodiment.

BEST MODE FOR CARRYING OUT THE INVENTION

 1. Explanation of terms

As used herein, the term "normal" in "orthogonal array" refers to maintaining the normality of thermal properties in multiple arrays, i.e., having a uniform melting temperature within a certain range. And. By maintaining the normality of thermal properties, for example, many distributions It is advantageous to carry out the reaction using the rows together.

The term “orthogonalization” in “orthogonalized array” is to make an array orthogonal, and all sequences included in one orthogonalized array group react independently. That is, the sequences included in one orthonormalized sequence group hardly or do not cause a reaction between {sequences other than the desired combination and the self sequence}. In other words, the sequences included in a group of orthogonalized sequences are less likely to cause cross-hybridization between sequences and undesired hybridization within their own sequences than ever before. Or not.

 As used herein, the term "nucleic acid J" can be any nucleic acid or nucleic acid analog represented by a base sequence. Such nucleic acids include, for example, DNA, RNA, and peptide nucleic acids. is there.

 As used herein, the terms "base sequence J" and "sequence" both refer to the arrangement of bases that make up a particular nucleic acid. Therefore, in this specification, "designing" a sequence J means that it is not always necessary to actually synthesize a nucleic acid having such a sequence. This is to create a sequence using a means and give a target sequence group. For example, given

 -— ,,

The group of arrangements provided can be provided in the form of output on paper or a display, or can be provided in the form recorded on a medium. Such a sequence is also provided as an actually synthesized nucleic acid reflected in the nucleic acid. In this specification, "base sequence"

“Sequence” may be used interchangeably.

Here, the “synthesis” of “nucleic acid” is based on the designed sequence. Indicates that a nucleic acid or nucleic acid analog containing a particular sequence is actually synthesized. -

2. How to design orthonormal arrays

According to one embodiment of the present invention, there is provided a method for designing an orthonormal sequence or a group of orthonormal sequences in which all the base sequences contained therein are orthonormal. The outline is as follows. First, a random array consisting of random arrays is created as a crude array that has not been selected by any of the finalizers. A random array is prepared in a quantity suitable for obtaining the average value, and the average value of these melting temperatures (hereinafter referred to as Tm m) is obtained. Next, the threshold value and the Tm value of the coarse array and z or a random array that is a newly generated coarse array are compared. The temperature range corresponding to the average value of the Tm soil 1 σ is defined as the threshold. A crude sequence having a Tm value falling within a certain range limited by a threshold is selected to obtain a group of candidate nucleotide sequences. Here, the average value of Tm “Temperature range ¾J corresponding to 1 σ of soil” is as described below.o The Tm distribution shows almost normal distribution, and the conversion to standard normal distribution is performed. It is desirable to set the temperature range having a width corresponding to one to the Tm range after this operation, so that about one-third of the whole clears the T condition. Is possible ^5. For example, in the case of 25 mer, approximately

2 ° C corresponds to ± 1σ. Further, even if an exact value of 1 is not used, a value close to the value, for example, a value obtained by rounding off the first decimal place is sufficient. In this way, a set of target nucleotide sequences that established the normality of thermal properties was obtained.ο

Next, each sequence included in the candidate nucleotide sequence group is The orthogonalization is performed by examining whether these are sequences that react independently. This can be done by analyzing the properties and / or structure of each nucleotide sequence included in the candidate nucleotide sequence group. By analyzing the properties and / or structure, the reaction within one sequence or between the sequences in a group is low, or the sequence consists of only those sequences that are not reactive. In this way, select the sequences contained in the target nucleotide sequence group '.

 With the above operation, an orthonormalized array group is obtained. According to the method for designing a group of orthonormalized sequences according to the present invention, an orthonormalization comprising a plurality of sequences that are orthonormalized to each other without actually synthesizing a nucleic acid. It is possible to design Also, according to such a method according to the present invention, it is possible to design an orthonormalized array group including more arrays in a short time. Hereinafter, embodiments of the present invention will be further described.

 According to the present invention, a means for randomly generating a base sequence is an example.

X. may use a well-known random number function, a random number table, a random number generator, and the like. When a random number is used, for example, a base is made to correspond to a numerical value in advance, and a random number function, a random number table, or a numerical value generated by a random number generator may be replaced with a base.

 The practitioner may arbitrarily associate bases with numbers directly.For example, random numbers may be generated by integers, decimal numbers, binary numbers, octal numbers, hexadecimal numbers, or the like. It may depend on how the random number function is called on the program. For example, a more efficient method is to generate a random number with two binary digits (0, 1, 2, 3),

This is a method to correspond to four bases. Also, one generated disturbance The sequence generated in such a way that the method of mapping to one salt is one of the desirable methods is that ヽ four sequences are evenly distributed ヽ Tm values are relatively uniform Become

 Also, the calculation of the Tm value for each generation of a random array is repeatedly performed, and after the generation of the random array, an average value is calculated based on all the obtained T values. After the generation of all random arrays, the Tm values of those arrays may be calculated and the average value may be calculated.One method is to calculate the Tm value each time a random array is generated, and to calculate a new value. The average value for each generation of the random array may be obtained, and the average value may be used when the average value converges sufficiently.

 A plurality of salt sequences created in this way at i 4 are thus referred to as a first coarse sequence group for convenience. The method of determining the Tm value of each sequence included in the first crude sequence group may be based on the length of the GC or salt sequence included in the base sequence, or may be determined empirically or empirically. Alternatively, the Tm value may be determined by using the Nearest Neighbor method known per se, or ¾. An experiment in which the Tm value of the nucleic acid represented by the base sequence was measured, The Tm value of the base sequence to be used as an S may be obtained based on data and / or empirical rules.

 It is preferable that the lengths of the base sequences contained in the first crude sequence group are all the same, but they do not necessarily have to be the same length <and also differ within the range specified by the practitioner in advance The length of the salt sequence created at random may be determined according to the purpose of use, even if the practitioner chooses it at will.

Next, the first crude sequence was determined from the T value of each base sequence obtained. Calculate the mean of the group Tm. The number of sequences included in the first crude sequence group for obtaining the average value, that is, the size of the first crude sequence group is, for example, about 100 or more. About 10

It is not less than 0000, and more preferably not less than about 1000. The average value converges as the size of the coarse array group increases. However, a larger size requires more calculation time. For example, when an average value is calculated for 100 pieces, if the generated array is sufficiently random, the value will be a value very close to the value that converges. Therefore, considering the calculation accuracy of T m (that is, about one decimal place), an average of 100: ^: is sufficient, and 1 0

It is considered that the convergence is almost completed when the number is more than 00. However, even if more than 100,000 occurrences occur, P e n t i u m 3

In the case of 800 MHz, it takes about 1 minute or less, and it takes almost no time, so it is only necessary to perform it once at the beginning. 0 or more may be o

 Next, the average value of the Tm is set as a median value, and a region having a temperature width corresponding to the one before and after the median value is set as a threshold value, and a certain range is set.

 Then, a candidate sequence group consisting of sequences having a Tm value included in a range limited by the temperature range corresponding to the average value ± 1σ is obtained. To obtain the candidate sequence group, the Tm value of the randomly generated base sequence included in the crude sequence group is compared with the threshold, and the sequence that falls within the temperature range corresponding to the average value of 1 σ is determined. Just select it. Alternatively, a group may be formed by excluding sequences that do not fall within the temperature range corresponding to the average value ± 1 unit.

The crude sequence group used to obtain the candidate sequence group is T m The first coarse array group may be the first coarse array group used to calculate the average value, or may be the second coarse array group consisting of a part of the first coarse array group, or the first coarse array group. Sequence group κC, even if it is the second crude sequence group to which additional sequences created by

<A second group of crude sequences consisting of newly randomly generated sequences may be used. For convenience, the term “coarse sequence group” was used to indicate a plurality of coarse sequences, but the sequence used to obtain the candidate sequence group was designed without substantial groups. May be used. For example, the τm value may be calculated simultaneously with the production.

<, Or furthermore, the obtained Tm value may be compared with a threshold value. The lengths of the base sequences included in the second crude sequence group are preferably equal, but not necessarily equal. The length of the base sequence created for the procedure may vary depending on the purpose of use, even if the practitioner chooses it at will. The length may be determined in advance.

In addition, a long sequence obtained by creating a short crude sequence of about X1 bases and about X2 bases s or preferably about Y1 bases and about Y2 bases and combining the generated crude sequences by means described below. It is sufficient to consider uniqueness and achieve orthogonalization. Without limitation, it may be, for example, from about 5 bases to about 10 bases, or preferably from about 10 bases to 20 bases. In addition, if a long sequence is created by combining different sequences, it is desirable to generate all possible sequences, so it would be possible to generate the entire sequence in a realistic time2 The upper limit was set to 0 bases. Also, if you create a long array for a short array, Many ligation sites appeared, and after all, a long sequence was generated, which would be the same as examining a cross-nodule. Therefore, 5 bases were adopted as the lower limit. At the extreme, when one base is linked, it is generated as a long sequence random number.

Same as <and o

 Next, all the sequences contained in the obtained target sequence group are analyzed for their properties or structures. From the results, it is confirmed whether or not each of the base sequences included in the candidate sequence is a sequence that reacts independently, and a target normal orthogonal sequence group is obtained. According to the embodiment of the present invention, in order to confirm whether or not the sequence reacts independently, the following (A) is used.

It is sufficient to analyze at least 1 in (C) ':

 (A) the presence of a self-complementary sequence in the sequence,

 (B) the degree of stability of the secondary structure of the sequence; and

 (c) Existence of mouth spanning between multiple sequences--o

 As a result of this analysis, if any of the following (a) to (c) applies, the sequence is excluded from the candidate sequence group

 (a) a self-complementary sequence exists in the sequence of 1;

 (b) The secondary structure 3 of the sequence 1 [the degree of mouth stability is high,

 (c) There is a cross / idle hybridization between multiple sequences.

The existence of the self-complementary sequence in each sequence can be confirmed for each of the sequences contained in the target sequence group based on the base sequence. And means that there is more than one set of mutually complementary parts in one sequence. Further, the base used as a reference for determining that the sequence is a self-complementary sequence may be arbitrarily determined by the practitioner. For example, it may be determined that a self-complementary sequence is present when a complementary portion having a length of 2 bases or more is present in one base sequence, or it is possible to determine that a self-complementary sequence is present. Bases or more ヽ 5 bases or more,, 6 bases or more, or X or more consecutive bases and a complementary base sequence included therein may be judged to have a self-complementary sequence. In the expression, “XJ is an integer of 2 or more. The number of bases may be selected depending on the use.

 In order to confirm the power of cross hybridization between multiple sequences, a small <and partial interpolation between multiple sequences included in the candidate sequence group was performed. The base length for determining the presence of cross-noid hybridization may be determined by the practitioner in the same manner as the self-complementary sequence.

 The degree of stability of the secondary structure of each sequence can be determined, for example, by empirical or empirical data on what secondary structure it can take when each sequence is present as a nucleic acid. It is possible to determine the degree of height based on it. For example, the degree of stability of the secondary structure of each sequence is calculated using a method known per se, such as intramolecular secondary structure; By comparing with a predetermined threshold value, the degree of stability may be determined.

The above three items, namely (A), (B) and (C) The analysis can be performed on all three items in any order. Alternatively, any of (A) or (B) and (C) may be combined in any order. (A;), (B) and (c) are all performed in the order of (A), (C) and (B) in consideration of efficiency, and (a), (c) and (b) It is preferable to exclude from the candidate sequence group when any of the above results is satisfied.

 For example, if the sequence included in the candidate sequence group is a relatively short sequence, for example, if the sequence is 40 m er to 30 m er or less,

It is preferable to analyze (A) and (C) .A sequence contained in one J candidate sequence group is a relatively long sequence mA.For example, when the sequence is 30 mer or more than 40 mer. In

It is preferable to analyze (A) and (B). However, in any case, the analysis of (A) ヽ (B) and (C) may be all performed.

 In addition, when there is a possibility that two or more sequences obtained as an orthonormalized sequence group may be used by concatenation, the sequences resulting from the concatenation

(Hereinafter referred to as a concatenated sequence) W, at least (A)

It is desirable to analyze the three items (() and / or (c)-. If analysis of the concatenated sequence is performed after analysis of the sequences included in the target sequence group, for example, it is sufficient to analyze (A) and / or (お よ び) and / or (C)

In addition, when it is necessary to use the complementary strand when using the finally obtained orthonormalized sequence, for example, when performing a reaction such as high predication ゃ Ρ CR, The same applies to the cross strands of the complementary strands of the sequences included in the candidate sequence group. It is preferable to perform analysis on redidation.

In the case of, the complementary strand is also (A) as described above.

Pray for (B) and / or (C)

 The frequency distribution of the average value of the Tm of the base sequences generated in the ^ and ^ follows the normal distribution, and the number of candidate sequences that can be found within a certain remark range is the average temperature at the center of the range. We set the Tm value to artificially set the most fe when hitting the target, and randomly created it according to the present invention rather than HX-measuring multiple nucleic acids to approach it. Calculating the average temperature for the sequence will yield more, ie, the largest, set of target sequences. In other words, no matter what algorithm the T m value is calculated for, according to the present invention, the population (ie, the coarsely distributed group) and the candidate sequence group obtained as the / Πη result are ヽ conventional It is possible to obtain a group with more candidates than means, in other words, a larger group

 Furthermore, after creating the largest population, the population is narrowed down based on whether or not it is included in the range based on the threshold value of the temperature range corresponding to the average melting temperature of soil 1σ. By doing so, it is possible to narrow down the candidates very efficiently at first. That is, first, an array is selected in the value calculation with less ΡΊ. π Calculate the characteristics of the noise elimination function ゃ Since the secondary structure calculation is performed, unnecessary calculations are not performed.

 / Ρη tree makes it possible to obtain the desired orthonormalized array group in a short calculation time

3 Shinko at the Digital Computer (i) Orthonormalized array group design method

 —,,,,... The method for designing a group of orthonormalized arrays according to the present invention may be executed on a computer. For example, the method of counting orthonormalized arrays using a digital computer is

(1) The arithmetic means calculates the average of the melting temperatures of the plurality of random arrays, and sets the threshold value. (2) The comparing means sets the average value in (1). (3) from the result of the comparison in (2) above, the threshold value is compared with the melting temperature of the random sequence. Only the sequence is selected, thereby detecting

 ., Mu

By providing the sequence group, (4) the determination means determines whether or not each of the base sequences included in the candidate sequence group given in (3) is a sequence that independently reacts.口 The sequence that is determined not to react independently from the target group is excluded from the candidate sequence group and an orthonormalized sequence group is formed. ·

 Alternatively, a method for designing an orthonormalized sequence group using a digital computer includes the steps of (1) that a random sequence is provided by means for randomly generating a base sequence; The melting temperature of the random sequence given by is given by the arithmetic means, and the melting temperature is stored in the storage means.

(3) An average value of the melting temperatures is given by a calculating means based on a plurality of melting temperatures given by repeating the above (1) and (2); (4) The calculating means gives a threshold based on the average value of the melting temperatures given by the above (3), and the comparing means gives a threshold. Comparing the threshold temperature with the melting temperature of the random sequence provided by the base sequence random generation means, and (5)

As a result of the comparison of (4), it is found that the base sequence having a melting temperature within the range limited by the threshold is stored by the memory operator as the s-spectacle sequence, and (6) 刖 S 5) For the candidate sequence group obtained in (1), the judgment means (A) to (C) below make a judgment in (A) that the sequence has a white self-complementary sequence. And (B) the degree of stability of the primary structure, and (C) whether or not the sequence has a knosipip V dimension; (7) 6) BX measurement of the orthonormalized array group by selecting the sequence to be selected by the selecting unit as the result of the determination in 6) and selecting BX.

 In addition, the orthonormalized array group that has been sifted may be output by output means such as a printer and a display for displaying the array, and may be recorded on a removable medium. May be provided.

 (ii) Digital computer

An example of a digital computer that can be used to implement a design method according to the present invention is shown in FIG. The digital m-computer 1 which can be used in accordance with the present invention has at least a processing unit 2 such as a CPU, a program and a table, and an aid for recording information such as a processing result. It has a storage device 3, a keyboard for inputting information in parallel and an input unit 4 such as a mouse, and an output unit 5 for outputting information to the outside, which are connected to each other. Any general data known per se W

21 You may use a computer

 The auxiliary storage device 3 includes a program for causing the digital computer to execute a method for designing a normal orthogonal array, for example, a program for generating a random array, and an independent program. G: a program to recognize the force, for example, confirm the existence of a self-complementary sequence

 The program for P ', the program for confirming the existence of cross-noisy hybridization, and the calculation of the intramolecular secondary structure free energy Stores programs for judging the level of the enolen regi. The auxiliary storage device 3 includes a table for associating a random number with a base, and a table for associating a numerical value with a determination result in order to determine whether or not the sequence reacts independently. For example, information as desired may be stored.

 The auxiliary storage device 3 of the digital computer includes, for example,

A program for calculating the average value of Tm., A program for creating random sequences, a table for associating random numbers with bases, a program for detecting the judgment of self-complementary sequences, and mouth shaving. A program for judging the presence of redidation, a program for judging the degree of stability of the secondary structure in the molecule, etc. may be stored for each desired file. .

 The above-described processing by the arithmetic means, the comparison means, the selection means, the description means and the determination means, and the base sequence random creation means is executed by the processing unit 2 in the form of a program previously stored in the trapping memory 3 O may be based on sensitive information

In addition, if desired, the digital computer may store the information (Random acces memory) for temporarily storing the image data. The image processing unit further includes an image processing unit that generates an image data according to the instruction of the CPU based on a program or the like. You may do it.

 (i ii) Processing procedure

 Using the features shown in FIG. 2, an example of the general procedure flow of a method for designing an orthonormalized array group using a digital recorder will be described.ο

 (2a) An input to the input unit 15 of the operator gives an instruction to start the design to the device. At this time, the operator may input information on reaction conditions. These pieces of information may be stored in the auxiliary recording device 3 or the RAM.

 (2b) When an instruction to start is issued by the operator, the processing unit 2 executes a program for creating a random array stored in advance in the dp- Instructs the base sequence random generation means to generate a random sequence. Further, the processing unit 2 provides the arithmetic means with a preset auxiliary storage device.

In accordance with the program for calculating the average value of T m of the random sequence benefited from Li′1, the average value of Τ m is calculated, and a threshold is given based on the calculated value. Or instruct it to store in RAM

(2c) When the threshold value is given in 2b, the processing unit 2 sets a preset and auxiliary device 3 in the auxiliary device 3.In accordance with the stored program and program for creating a random array, For the random array generation means, a laser having a range of Tm limited by the threshold given by 2b Instructs to select random sequences. The random array selected according to the conditions is temporarily stored in the RAM as a weather array.

 (2d) When the candidate sequence is generated, the CPU 3 follows a program for ascertaining the existence of the self-trapping sequence stored in the pre-set and assisted B-fe device 3 according to a preset program. In order to judge the existence of the self-complementary sequence in the generated 'random sequence', it is not necessary to judge. The random sequence having no self-complementary sequence is used as a candidate sequence.It is once assisted and stored in device 3 or RAM.2c and 2d are used until a sufficient number of random sequences or prospective sequences are obtained. 'Executed repeatedly

 (2e) When a sufficient number of random arrays and / or target arrays have been generated, the processing unit 2 then proceeds to the cross-noise pre-daily processing set in advance and stored in the auxiliary storage device 3. According to the program for confirming the existence of the

Instruct the system to determine the presence or absence of the mouth hybridization in the candidate sequence stored in B or 'fe¾3 or RAM, and further determine the random sequence in which no mouth swap is present. Instructs storage in auxiliary storage device 3 or RAM as a candidate sequence

(2f) Next, the processing unit 2 performs a calculation of the intramolecular second-order free energy, which is set in advance and is considered by the auxiliary device 3, and follows a program for judging the level of the enenoregi. Therefore, for the judgment means, it was stored in the | supposition 3 or in the RAM. The intramolecular secondary structure free energy to the target array was calculated. In addition, it is not necessary to judge the height according to a table which is set and assisted in advance and correlates the energy stored in the 'I'Ws device 3 with its height. The low random sequence of secondary structure free energy is selected and assisted as a candidate sequence.

= α discarded ·

 Finger 3 or stored in RAM

 (2 g) The processing unit 2 starts from 2 C in accordance with the program.

After the procedure of 2f, the finally selected and remaining candidate sequences are orthonormalized array group ヽ, ie, instruct to output a set of orthonormalized arrays from the desired output means.

 (2) At 2 g, the orthonormalized array group is output from the output means, and the method ends.

In the above, information on the reaction conditions input by the operator in ヽ 2a is based on the length of the random sequence, the number of random sequences, the number of candidate sequences, the type of nucleic acid, and the existence of self-complementary sequences. Criteria for judging, criterion for judging the presence of cinnamon..Criteria for judging the presence of sine, and for judging the level of 4 and / or ⁷ or the intramolecular primary structure Information such as criteria may be <or information such as other conditions. Alternatively, this information may not be entered by the operator at 2a, but may be included in various programs pre-recorded in the auxiliary storage device 3, or may be any number. The conditions associated with the conditions so that selection can be made by combining these conditions.

May be stored as

In the above example, every time a random sequence is generated in 2b, the self-complementary sequence that is bounced to 2d is eliminated, and 2b and 2d are repeated. Although the method has been described, the process may proceed to 2d after all the desired number of random sequences in 2b are created. After 2 d, you may return to 2 b if necessary.

 Procedures may be performed as shown in the example of FIG. That is, the design is started (3a), after calculating the average value of Tm (3b), a random sequence is generated (3c), and the self-complementary sequence is eliminated (3d). Check (3e) the cross-hybridization. The above 3a to 3e are performed by the processing procedure shown in Fig. 2 and described above, and a set of orthonormal arrays is given without considering the molecular-secondary structure free energy ( 3 f)., End (3 g). Such a method is particularly useful when the sequence of the orthonormal array to be obtained is short, and the design time can be shortened.

 The procedure may be as shown in the example in FIG. That is, the design is started (4a), the average value of Tm is calculated (4b), the random sequence is generated (4c), and the self-complementary sequence is not excluded. Then, we check the cross-noid predication (4d), and then examine the free energy of the molecular-secondary structure (4e), and give a set of orthonormal arrays. (4 f) or end (4 g). Each processing may be performed in the same manner as the processing described above.

In the example shown in Fig. 5, after starting the design (5a), calculating the average value of Tm (5b), generating a random array (5c), Elimination (5d), cross-hybridization check (5e), and intramolecular secondary structure freedom The study on energy (5f) and are performed in any order as desired by the implementer, and a set of orthonormal arrays is given (5g).

(5 h)

 In addition, in any of the examples shown in FIG. 2 to FIG. 5, if desired, for example, when the number of candidate sequences becomes smaller than the number of the previously-listed sequences, Returning to random sequence generation may be performed □

 In each of the above examples, when 2 c ゝ 3 c, 4 c and 5 C (hereinafter simply referred to as “c”), the average value of 2 to 5 b (hereinafter referred to as “b” at the end) is calculated. After a threshold value is given to the base, it is selected based on whether or not it has a Tm within a range limited by the threshold value, and a candidate burst is given. For example, random numbers are generated as shown in Fig. 6.

(6c1), and after obtaining a coarse array, selection IJ (6c2) based on the τm value is performed. However, this continuation is, as shown in FIG. 7, a percentage of the random number generated (7 c 1),

(%), Followed by 'Cm value; 1 (7c2). GC% final letter is the GC number included in the random sequence. % Is in a range, for example, 4

0% to 70% A Other than the sequence may be excluded.In other words, to determine the Tm value of a randomly generated random sequence, if the random sequence is selected based on the% of base GC contained in the sequence, Then, sorting by Tm value (7c3) was performed. By performing such a procedure, the design time can be reduced.

Also, a random number is generated to obtain a random array, When a candidate sequence is obtained by screening by value and an orthonormalized sequence is obtained by performing further screening on the candidate sequence, the correspondence between the number obtained by random numbers and bases is one-to-one. Even if it is 1, after all the desired selections have been completed, the values may be replaced with bases to obtain an orthonormalized sequence in the end, i.e., Once you have decided which value corresponds to which base, you may substitute the base at any stage. However, since the τm value and dG value make sense for the base sequence, it is important to consider that a correspondence is always required.

 The above method shows an example of how many powers according to one embodiment of the present invention.Therefore, the method according to the present invention may be variously modified to the above-described example. Additional procedures may be added or omitted as long as it follows the invention

 4 Basic set

 In the following, an example of calculation as a basic set for designing the orthonormalized array group according to the present invention will be described. This Ρ Γ "(" calculation is also applied to a design for digital computer. Can be used in other designs

 (1) Calculation of average melting temperature (that is, central melting temperature) When designing an orthonormalized sequence, the length of the sequence is determined by the nucleic acid to be ultimately obtained or its use Such a reaction may be performed), the synthesis cost and Z or how many types of sequences are required may be determined.

For example, when the orthonormalized sequence according to the present invention is used for DNA computing, one orthonormalized sequence group may be used. Let us express the calculation summary (for example, city in the case of the ヽ ヽ ノ 経 路 経 路 問題 の 問題 問題 計算) and use them to calculate and react. In that case, the nucleic acid consisting of the orthonormalized sequence itself is separated by affinity separation with the nucleic acid of the complementary sequence immobilized on a magnetic bead, or the nucleic acid white consisting of the orthonormalized sequence is converted to a PC.

Considering detection and / or amplification reactions using R primers, nucleic acids corresponding to computational elements, for example,

Naturally, it is sufficient that the length of the DNA is between 15 m er and 30 m er suitable for the primer.

 Generate a random array that is a coarse array, calculate the Tm value of each generated random array, record it, and create a program to execute on a digital computer. The algorithm for calculating the σ Τ m value is the same as the calculation used for generating the candidate sequence later. Expressions may be used. For example, the knowledge of the local community. (1998) J. StaLucia, Jr. "A uniiied view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics." Proc. Natl. Acad. Sci. USA, 95: 1460-1465, (1998 )) May be used for calculation. In this calculation, not only the T m value but also the array of the calculation source is output, and it may be used as an auxiliary for the calculation of the T m value later. Approximately 1 000 pieces are calculated in total, and the average value is calculated. If candidates are generated with the Tm value limited around this average value, most candidate sequences can be generated '.

(2) Generation of random arrays and selection of target arrays The threshold value is set to the Tm value determined in (1) above to obtain a random candidate sequence having a Tm value within the range.For example, generating a random number and substituting it with a base A random sequence, which is a coarser sequence, is created, its Tm value is calculated and compared with a threshold, and a sequence having a melting temperature within the range of the threshold is selected to form a group as a candidate sequence.

 To obtain the Tm value known per se, use the NearestsNeighbor method. In this method, the Tm value is determined by the relationship between adjacent bases, or the Tm value can be calculated approximately from the GC content.

 For example, a random sequence is generated while restricting the GC content to be within a range of 40% to 70%, and the Tm value is calculated for the generated random sequence by, for example, the Nearest Neighbor method. May be calculated. Furthermore, the calculated Tm value is compared with the threshold value, and as a result, those that fall within a predetermined range are output as a horizontal array. Also, for example, in order to generate a random sequence, a self-known Mersenne Twister is used.

, 丄 vlersenne Twister; for example, it is possible to download from Web

http://www.math.keio.ac.jp/~matumoto/mt.html A rlj-independent pseudorandom function such as J may be used.

 (3) Elimination of self-complementary sequences

Candidate sequences with Tm values within a certain range are self-complementary, eg, palindomic sequences such as restriction enzyme recognition sequences (generally also called palindromes). If you have Take the structure. Since the band and the π ^ array can be easily obtained, they are preferably used for checking self-complementarity. A sequence that includes a mixed-mouth mix sequence is included in the candidate sequence group.

 The means for further confirming self-trapping will be described below. For example, if the number of bases in the sequence is odd, compare the sequence from the base at the 5 'end of the nucleic acid sequence to the center base and the sequence from the base to the 3' end base of the nucleic acid sequence. If the sequences are complementary, immediately, if they match, they are determined to have self-capture.

 For example, consider the case of designing a sequence of 25 bases. See FIG. 8 For example, suppose that one random array force S is “atgcatgcatgccatgccatgcat”. This array is divided into the following two parts. From the 5th end to the 13th base from the middle sequence of the 13th base, the partial sequence A is defined as

A partial sequence B from the 14th base to the 3 '. If this partial-sequence A is read while shifting one base by six bases, six kinds of such bases with 25 bases are obtained. One unit read contains six bases, which will be referred to as six tuples.

 For the other half of the sequence from the 14 'salt to the 25th base from the 5' end, first change the orientation of 5, and 3, as described above.

There is no sequence complementary to the 6 types of 6 tuples.- The sequence of> __ is shifted by one base at a time. The random array is judged to be a self-trapping array.The length of the tuple of>-is limited to 6 tuples. Not. In other words, this value may be changed depending on what criteria determine that self-trap is determined.

 In the above example, self-complementarity was determined based on whether there was a sequence that matched six consecutive bases. However, the present invention is not limited to this condition, and the number of bases other than 6 bases, for example, 3 or

The determination may be made based on whether there is a continuous match of 4, 5, 7, 8, 9 or 10 or more consecutive bases. Alternatively, the threshold value may be another condition, for example, the ratio of the complementary base to the length of the sequence to be compared. In other words, it is sufficient to set a certain condition in advance and use it as a threshold to eliminate auto-adoptive sequences.

 Taking the above method as the first example of the method of determining self-complementarity, the following and third methods similarly determine self-complementarity.

 -Can be used to determine

 Figure 9 shows the second example. First, as described above, one array

Divide into two parts, subarrays A and B. This is controlled by shifting from the end to the center, and self-complementarity is determined by the number of consecutive complementary sequences, the number of complementary sequences, or the degree of complementarity. It may be a public notice.

Next, FIG. 10 shows a third method. First, as in the first and second methods described above, one sequence is divided into partial sequences A and B, and the partial sequence B is converted into a complementary sequence. This is shifted one base at a time in the same manner as in the second method, and self-complementarity is determined based on the number of consecutive homologous sequences or the number of homologous sequences, or the degree of homology. What is necessary is just to judge. Such a third method is similar to the first and second methods described above, except that the partial sequence A Check the complementarity of the salt.

 -

V Therefore, if the processing is performed according to the method described above, the plug-in for applying this method using a digital computer is

Ram is more fe <me;

 (4) Cross / bridging check

 Next, a method for confirming the existence of the cross-noble decision 3 will be described.

 For example, when all of the calculations up to (3) above are performed, the resulting sequence is randomly generated, the ヽ T m value is aligned within a certain range, and the intramolecular structure is Next, further calculations were performed to form a set of sequences with low cross-disturbance among multiple sequences.

 In the case of cross-noisy hybridization, the phase capture is also used in a reaction to be performed using an orthonormalized array obtained by the design method of the present invention in the future. In addition, it is necessary to consider the complementary strand of the target sequence as a target of the check.However, as an example, the complementary strand of each candidate sequence is considered.ヽ ブ リ 場 述 べ る ス c---------------------------------------------- is important

 As an example, when calculating an orthonormalized sequence of 30 bases or less, it is considered that no vano-resistor or loop is formed.

(0 There are consecutive L matches of 6 bases or more (ii) More than 60% of the lengths of the j sequences compared matched

If any of the conditions apply, the sequence is deemed to be snooprid. Using this judgment condition, the cross-section y-dimension is examined.

Figure 11 shows an example of the Pit method. As examples of candidate sequences to be targeted, sequences P and Q of 25 bases are shown respectively.o Under the above conditions, there is no gusset with more than 6 bases. Start with 6 bases (Figure 11a) and compare the overlaps of 7 bases (Figure 11b). Next, compare the overlaps of 8 bases (Fig. 11c). 0 In this way, the two sequences are shifted by one base at a time, and the length of the overlapped part is increased to increase all 25 bases. The comparison is performed until the overlaps. After that, while performing the comparison, further shift in the same direction (Fig. 11d, Fig. 11e), and P

5. Shift ¾ and the end of Q to 6 bases until they overlap by 6 bases, and perform the comparison. Ο-like comparison allows you to grasp the state of the cross-hybrid V-diagnosis in the two sequences. You.

 For example, in the case of (b) and (c) in FIG. 11, 7 bases each

Eight bases are in an overlapping state, and both of them are two consecutive bases.

(D) in FIG. 11 shows a state in which 22 bases are overlapped. Six of the base pairs are complementary and each is a continuous 'match' of two bases. In the case of the sequences P and Q, the state of (d) is ヽ The most part is complementary. Further, in this case, the ratio of the complementary site to the total length is 6 2 2 = 0.2. It is about 7, which is less than 60%. Therefore, it does not fall under the condition (ii) described above, “60% or more of the lengths of the compared sequences match”, and cross-hybridization is performed. Is not determined.

 In this way, the overlapping portion is shifted in order, and among all the control states, there is one cross-hybridization condition that satisfies the above condition (i) and / or (ii). Then the random array at that time is removed from the surveillance array.

 Next, FIG. 12 shows an example of verifying the presence of cross-hybridization between two types of sequence R and sequence S and their four complementary sequences IJ. In the figure, the sequence R of the sequence R is indicated by a line above the letter “RJ”, and the phase trap of the sequence S is indicated by a line above the letter “S”. . In the description of the specification, the complementary strand of the sequence R is referred to as “R ,,” ヽ the complementary strand of the sequence S.

Write "S". Considering all combinations (R, S)

 »

^{(R, S J, :),} ( "R", S), RS ,,;.. ( It are four copies of however, need not name to verify all words, the "R ,,, s And "S" are in a phase-neutral relationship, so that when A—T and G—C ぺ are also converted to complementary chains,

A, C-G pairs are formed, and the change in the direction of 5, → 3, when converted to a complementary strand, is also opposite to the two strands that contrast like IPJ. Therefore, ヽ (R, S ) And ("R ,,," S ,,), (R, "S ,,) and (" R ',, S) are the same. That is, the number of complementary strands and the pagoon are the same. Shows the same cross-noisy hybridization situation. Figure 12 shows such an example. In this example, "Attgcc'gj,""R","cggcaat","S," g.tccaat, "3,", "attggac", each of which is an example of 7 bases. The left force indicates (R, S), (R, "S ,,), (" R ", S), (" R "," S "), and below each parenthesis, All corresponding patterns in the combination are shown as (R, S) and

("R S), (R," S ',) and (R, s) compare equal. In this way, the verification of the mouth snoop priming scheme for the complementary strand is as follows: (R, S)

"S") only.

 With the above method, after confirming the presence of a cloning sniffer for a sequence containing no complementary strand and a candidate sequence, it is determined that there is no lip snobbing already present. The presence of the cross-hybridase between the complementary sequence and the complementary sequence may be verified for the selected sequence group. In addition to confirming the presence of all cross-difficient 'Daisysee' ions, the complementary strand may be verified at the time of | BJ. In addition, the verification of the hybridization may be performed for all sequences on a general basis.

The conditions for determining the presence of the crossover force S used in the method according to the embodiment of the present invention are not limited to the above-described example. In the above example, the case where one of (i) and (ii) is satisfied is determined to be the presence of the cross-noisy hybridization force s, but both (i) and (11) If there is a crossover noise You may decide. Alternatively, 6 or more bases of (i) are replaced by 2, 3,

Even if it is set to 4, 5 or more, it is set to 7, 8, 9, 10 or more, or more than that. However, 6 bases or more are preferable from the viewpoint of accuracy and efficiency.If the orthonormal sequence to be designed is long, for example, it is necessary that, for example, 7 bases or more, 8 bases or more are continuous. Is preferred. In addition, in the case of mismatch conditions, for example, in the case of 75 bases or more, it is preferable that the conditions be continuous, for example, 7 bases or more, 8 bases or more.

 In all cases, the condition (ii) is not defined as 60% of the reference sequence, i.e., the sequence having overlaps, but the overlap is more than 10 bases. In this case, the criterion may be changed according to the overlap length to be compared, for example, 60%, and when the number of bases is 10 or less, the total is 6 bases. Alternatively, the ratio may be set by dividing the set ratio by the absolute number of bases to be matched. '

Furthermore, if computer resources can be obtained, a more precise cross-hyperidization may be verified by taking into account a complicated structure such as a bulge loop by a dynamic programming method. In the design method according to the embodiment of the present invention, a new random sequence may be randomly generated and added to the candidate sequence group during any of the steps included in the method and between the steps. . In such cases, verification of the existence of cross-hybridization can be performed, for example, by comparing a new random array with an array in the set of orthonormalized arrays and comparing the new random array to the cross-array. Verify that no snow hybridization (5) Calculation of Free Energy of Intramolecular Secondary Structure The nucleic acid having an orthonormal sequence obtained according to the present invention is used alone as a primer or a hybridization probe. Therefore, if such a nucleic acid is a nucleic acid that easily has an intramolecular structure, the reactivity becomes low, and the PCR amplification efficiency / hybridization efficiency deteriorates. The reaction efficiency increases as the free energy of the secondary structure increases. Therefore, the calculation of the free energy of the secondary structure can be used to select orthonormal arrays. For example, this calculation includes the dynamic programming method of Zucker et al., “Algorithms and Termodynamics for RNA Secondary Structure Prediction: A Practical GudeJ, RNA Biochemistry and Biotechnology, 11-43, J. Barciszewski & BFCClark, eds., NATO ASI Series, Kluwer Academic Publishers, (1999) ”). Also, if an appropriate threshold is given, it is possible to select arrays at this stage. However, this step can be difficult to perform due to the large amount of computation. In addition, it may be difficult to obtain a stable structure because the orthonormalized array itself is short. In such cases, the calculation of the free energy of the secondary structure may be omitted.

 (6) Time required for basic set

The most time-consuming of these processes is the cross-hybridization check. The next time is the calculation of the free energy of the secondary structure. The cross-high pre-didation check is a straightforward As the size of the hybridized sequence increases, the computation time becomes longer, and the newly tested candidate sequence is likely to cause a π-snoob hybridization with the sequence already in the set. . Therefore, the number of array types tends to slow down as the set grows.o

 Since the generation of candidate sequences with a limited Tm value does not become the rate-determining stage of design calculation, they were generated before the completion of the Kiss-No-Snow Hybridization Check. Cross-hybridization-even with a short check process.

Additional candidate sequences may be generated at the end of each mouth hybridization check for a single sequence.

 When designing an extremely short orthonormalized sequence, it is possible that an additional sequence will be generated by chance when an additional candidate sequence is generated.o In order to prevent this, the sequence of already generated sequences must be re-created. You can make a list, check it, and then cross-check it before proceeding.o Also, check the step of comparing this sequence with the existing sequence in the cross-hybridization check. You may put it in front. In addition, if the length of the array is as long as 25 mer, the probability that the same array will be generated is low even if the Tm value is restricted.

There is also a method that does not need to make a comparison with the existing sequences. For example, if a 6-base orthonormal sequence is to be designed, all sequences are only 46-496 types. Therefore, arrays may be generated so that the arrays are not random and are not sequentially overlapped. In that case, an array that does not satisfy the T m value condition is generated, and some calculations are performed. It will not be a problem if it is wasted. Figure 13 shows an example of using such a method. For example, 0 to 40

It is sufficient to generate 10 decimal numbers up to 95 in order, and convert them to quaternary numbers using the algorithm for checking the remainder as shown in Fig.13.o A quaternary 0 is A, 1 is C, If 2 is interpreted to correspond to G and 3 to T, the decimal number 1 becomes 0 000 0 1 in quaternary number, which can be interpreted as the nucleotide sequence AAAAAC. In such a case, according to an embodiment of the present invention, instead of creating a random array in designing an orthonormal array, such a means for generating a sequential array is used. Also good o

 5. F3X total calculation of combined orthonormalized arrays

 The orthonormalized sequence as described above may be used as a relatively long nucleic acid fragment by combining and linking a plurality of sequences at the time of use. In fact, for example, in the experiment of A. d 1 e ma n

'The city corresponding to the DNA is connected and used for (L. Adleman.

Molecular computation of solutions to ι combinatorial problems.

Science, 266 (11): 1021-1024, 1944) o It must be noted here that a new sequence appears at the junction of the orthonormalized sequences. Therefore, when an orthonormal array designed by the above-described method is used, no new gross noise pre-division occurs at the connection part depending on the connection form or the like. Ο For this purpose, for example, the sequence from the connected part where any two sequences included in the orthonormalized sequence group can be connected to the central base of the orthonormalized sequence on both sides is also considered. , Gross profit, cross-noise, hybridization ,

Γ3 c, ■ a tone is preferable o If the concatenation of the sequences does not occur in any two sequences, do not use the combination that causes the open-sound V-dimension If the connection occurs in any two arrays, it is possible to use a lot of orthonormal arrays. Omit the regular H-association sequence o

 6. Orthonormalized sequences and nucleic acids

 >

 According to a further aspect of the present invention, there are provided a base sequence group designed by the method according to the present invention as described above and a nucleic acid synthesized based on the sequence.

 The group of orthonormalized arrays provided by the method according to the embodiment of the present invention may be provided in a form output on paper or a display, or may be provided in a form provided on a medium. Such an arrangement may also be reflected in the nucleic acid. The nucleic acid having such a sequence is chemically synthesized by a nucleic acid synthesizer or the like, or synthesized by other means for synthesizing a nucleic acid known per se. In addition, the type of nucleic acid having such a sequence to be synthesized may be selected as desired by the practitioner.

 The nucleic acid provided according to the embodiment of the present invention may be a nucleic acid represented by a sequence included in the orthonormalized sequence group provided according to the present invention. When used, it is sometimes necessary to use a combination of multiple types of sequences included in the same orthonormal sequence group in one reaction system.o

Examples of orthonormalized arrays provided according to embodiments of the present invention, Fig. 14 Fig. 21 They are SEQ ID No. 1 to SEQ ID No.

2 6 3. All of these arrays are in an orthonormalized array relationship with each other. Therefore, they may be used all at once or any part thereof may be used. In addition, sequences up to SEQ ID NO: 264, and sequence numbers up to 375 are also an example of one thousand orthonormal arrays. Therefore, all of these arrays have a relationship of orthonormalized arrays. Therefore, they may be used all at once, or any one of them may be used.

 Further, examples of the orthonormalized array group provided in accordance with a further embodiment of the present invention include 112 types of SEQ ID NO: 264 to SEQ ID NO: 375. Each of these arrays also has an orthonormalized array relationship with each other. Therefore, all of them may be used at once, or any one of them may be used. '

 In addition, SEQ ID NO: 1 to SEQ ID NO: 375 may be provided as nucleic acids represented by the sequence, and those nucleic acids are also included in the scope of the present invention. .

 According to the embodiment of the present invention as described above, for example, a nucleic acid detection nucleic acid used in a nucleic acid probe-immobilized substrate represented by a DNA chip, a DNA microarray, etc. For use as a probe in a DN, performing many reactions such as nucleic acid amplification and / or hybridization, in parallel and z or repeatedly

A A base sequence group that can be used advantageously when many types of nucleic acids need to be used simultaneously, such as in applications for computing, etc. A method of manufacturing is provided. The use of orthonormalized sequences J has been proposed by Suyama et al. (H. Yoshidaa 1dA. SUyama Solution) 3I SAT bybreadth I irstsearch? Pro C. of 5th Internationa 1 Meetingon DNAB ased C omputers 9-20 (1 9 9 9))) o H.Yoshidaand A. In (199 9), they found that the T m values were equal to solve the combinatorial problem of the 3 SAT problem, and that the two-mer sequence sets were cross-dissociated with each other. However, usually, even if such a set of sequences is designed, if they are connected to each other, a new sequence will be formed at the connected portion, so that the complete hybridization is completely completed. O The design method of Suyama in this document requires that the arrangement at the connection part also be D) The feature is that the HX 50 'is used to make it hard to cause mess, but if the design is made from the beginning with the connection part taken into account, the restrictions on the sequence design become severe. , So we can avoid designing more arrays.

If the application is not limited to DNA computing, it is not always necessary to connect all the sequences, so it is preferable to select the sequence after considering the connection part after designing ο

According to the method according to the embodiment of the present invention, it is possible to improve the drawbacks of the conventional design method as described in the above c, and to obtain a large population as compared with the conventional one which can be applied to a wide range of uses. , Ie, orthonormal array O It is possible to design a nucleic acid group that is

 Further, the method according to the embodiment of the present invention may be a method of an orthonormalized array by a full verification algorithm or a method of designing an orthonormalized array by a sequential addition algorithm. This method is also included in the present m o

 According to the method according to the embodiments of the present invention, the melting temperature (T m) is within a range, and the x-nosie pre-division signal is one time as compared to the signal of the complete match. 0 1/0,

BX. P1 is a column group that is an orthonormal array that is difficult to take a secondary structure. Also, a nucleic acid group synthesized based on the nucleic acid is provided. Example

 Example 1. Orthonormalized array BX P

 25 Orthorectified sequence of 5 bases is prepared. Ϊ¾Χ For the opening condition, the center temperature of the Tm value was set to 60 ° C, and the soil temperature was set to 2 ° C. In addition, the mouth hybridization is calculated based on whether or not 6 or more consecutive matches can be made and / or if 60% of the overlapping sequences with 10 or more bases are matched. c PU is Pentium III 800 0 Η Z ヽ RAM power S 2 G bytes, o S is

This was performed using a computer compiled by gcc using the computer of Linu X kernel 12.2.2.18. The T m value was calculated by the Nearest Neighbor method using the parameters of Santa Lucia. O The free calculation of the internal structure of the self molecule was performed using the ucker's anorego rhythm. By the above calculation, an orthonormalized array group consisting of 2 63 arrays was obtained. The obtained orthonormalized sequence groups are shown in FIGS. 14 to 21 as SEQ ID NOS: 1 to 34, SEQ ID NOS: 35 to SEQ ID NO: 70, and SEQ ID NOs: 71 to SEQ ID NO: 10 respectively. 6, SEQ ID NO: 107 to SEQ ID NO: 142, SEQ ID NO: 143 Chirara SEQ ID: 178, SEQ ID NO: 179 to SEQ ID NO: 214, SEQ ID NO: 215 to SEQ ID NO: 2 50, SEQ ID NO: 251 to SEQ ID NO: 263 are shown. On the right side of the SEQ ID No., the base sequence was written from the 5th end to the 3rd end J1, the dG was written on the right, and the Tm value was shown on the right. Example 2 Verification experiment using microphone array

 (1) Array

Similar to the method described in Example 1 above, these sequences in which 112 additional sequences were designed are shown in FIGS. 22 to 27. On the leftmost of these figures, SEQ ID NO: 264 to SEQ ID NO: 375, which are serial numbers of the sequences used in the present specification, are described. Include the following "n & e J column name 1 Karane beam 1 1 2 or number in a number inヽpresent orthonormal sequences group into the (name) 7 ¹ - Next, the 1 1 2 Each sequence of the species m-sequence is shown in the direction of 5 'to 3', and the rightmost column shows the probe sequence for detecting each sequence used in the following verification. Described in the 3 'direction

In addition, SEQ ID NO: 32 6 is SEQ ID NO: 32, SEQ ID NO: 32 8 is SEQ ID NO: 219, SEQ ID NO: 342 is SEQ ID NO: 175, and SEQ ID NO: 343 is SEQ ID NO: 21 SEQ ID No. 37 2 is SEQ ID No. 16 6, SEQ ID No. 37 3 is SEQ ID No. 24 3, SEQ ID No. 37 4 is SEQ ID No. 37, SEQ ID No. 37 5 is SEQ ID No. 21 0 and This is an equivalent array.

 (2) Microphone array

 Prepare a plate with 8 x 14 quinoles. It is as if a microarray was formed by immobilizing one type of D-D sequence for detecting each of the labels from name 1 to name 112 on each of the plates in this plate. Created 14 microcrorays

 (3) Amplification of S "material

 First, there are 112 types of sequences described in the above (1), that is, name 1 to name 112 (SEQ ID NO: 264 to SEQ ID NO: 375)

Eight types were combined into one nosichi. The sequence included in each batch is as follows.

table 1

Ha, Tsuchiha, Tsuchi 'ヾ Tsuchi!ヾ チ チ チ, ハ ハ, v ヾ, v チ チ ヾ ヾ ヾ ヾ ヾ ヾ ヾ ヾ

1 2 3 4 5 6 7 8 9 10 11 12 13 14

1 2 3 4 5 6 7 8 9 10 11 12 97 105

13 14 15 16 17 18 19 20 21 22 23 24 98 106

25 26 27 28 29 30 31 32 33 34 35 36 99 107

37 38 39 40 41 42 43 44 45 46 47 48 100 108

49 50 51 52 53 54 55 56 57 58 59 60 101 109

61 62 63 64 65 66 67 68 69 70 71 72 102 110

73 74 75 76 77 78 79 80 81 82 83 84 103 111

85 86 87 88 89 90 91 92 93 94 95 96 104 112

As shown in Table 1, one notch includes names 1 13, 37, 49, 61 73 and 85. Two batches include names 2, 14 426, 38, 50, 62, 74 and 86.Batches have names 3, 15 and 2

7, 39 ヽ 51, 63, 75 ぴ 87 are included. Nozzles include the following items: Eight types of sequences are included in the remaining 14 cuts

 After allocating all the sequences to 14 V strands, the following PCR amplification was performed for each batch. O o o o

 Upper τ

The used primer is 配 列 5 with Cy3.

G A T T C G T C G T G T G C C T T T G A C T G T T

(SEQ ID NO: 376) and the sequence 「T

PCR, which is “T GTG G G G G G A A G G C A G T T A A C C A A” (sequence number 377), is a PTC one for each batch.

The procedure was performed using the program described in Table 2 below using 200 DNA Eng 1ne (MJ RESEARCH, Inc.).

 Expression

 Step Temperature Time

 1 94 ° C

 2 94 ° C

 3 60 ° C

 4 72 ° C

 5 GOT O 2 29 t i me s

 6 72. C 0:30

 7 10. C e ver

8 END After the completion of the PCR, each amplification product was extracted from the 14 samples obtained for 14 batches using magnetic beads as follows. Magnetic beads (Dynabeads M-280 Streptavidin, Dynal) were collected in 40 × L fractions, and washed twice with 400 / i L of 2 XB & WB buffer. After washing, the obtained magnetic beads

200 μm of 2XΒ & WBuffer became cloudy. Next, one of the 14 sample sampnoles was added to this suspension for 20%.

0 At L was added and the mixture was stirred at room temperature for 30 minutes. Next, 200 μL

The plate was washed twice with 2 X B & W B U f fer. Further, it was washed once with 200 μL of Mi 11 iQ water. The magnetic beads after washing were collected, suspended in 100 βL of Milli Q water-7 o, and then left standing for 10 minutes while stirring at 94 ° C, and the supernatant was removed. Was recovered quickly, and the amplified nucleic acid fragments were extracted and recovered. The above extraction was performed on 14 samples obtained by PCR on 14 nositi, and 14 types of ssDNA derived from the amplification product were obtained.

 Each of these sSDNAs was added to each of the wells of one microarray per sample in an amount of 44 μL per 1 μl. After performing y-dimensioning, scan using Genexix400 (Laser / PMT = 100/650) and use the software of Quant Array (PerkinElmer (manufacturer)). The fluorescence intensity derived from Cy 3 was quantified by the histogram method using).

The results are shown in Figs. The horizontal axis of each graph indicates the cell number, and the vertical axis indicates the fluorescence intensity.ゥ The number of each well corresponds to the name of each sequence.

 FIG. 2f shows the fluorescence intensity from each quenole obtained after the addition of ssDNA derived from the amplification product of batch 1 to the microarray. As can be seen from the figure, as shown in FIG. 29, the high fluorescence intensity was obtained for the column on which the probe for detecting the sequence contained in batch 1 was immobilized. ^

The fluorescence intensity from each quell obtained after adding ssDNA from the amplification products from 2 to batch 14 to the microarray was shown. Fig. 29 and Fig. 41 also show that the probe for detecting the sequence contained in each of the sticks had a high fluorescence intensity obtained on the solid-phased probe. The effect of the invention in which the orthonormalized arrays according to the invention clearly show that they do not generate crosshive V-dimensions with each other.

 According to the present invention, a method for designing an orthonormalized sequence group including many markers that can be used for a wide range of uses, and a method for synthesizing a nucleic acid according to a sequence designed by such a method. The resulting nucleic acid was provided.

Claims

The scope of the claims

 1. A method of designing an orthonormalized array group,

 (1) From a plurality of randomly generated sequences, determine the average of the melting temperatures of those sequences.

 (2) determining a threshold value based on the average value obtained in (1), and comparing the threshold value with the melting temperature of a randomly generated random sequence;

 (3) selecting only a base sequence having a melting temperature within a certain range limited by the threshold from the result of the comparison in (2) to obtain a candidate sequence group;

 (4) confirming whether or not each base sequence contained in the candidate sequence group obtained in (3) above is a sequence that reacts independently;

 (5) Forming an orthonormalized sequence group by excluding, from the candidate sequence group, sequences determined not to react independently based on the results of the confirmation in (4) above. When, -- --

A method for designing an orthonormalized array group comprising:

 2. A method for designing an orthonormalized sequence group, wherein the confirmation described in (4) above is performed for the sequences included in the candidate sequence group obtained in (3) above.

 (A) the presence of a self-complementary sequence in each sequence and / or

 (B) the degree of stability of the secondary structure of each sequence, and

(C) presence of cross-hybridization between multiple sequences, The method performed by analyzing the.

 3. A method for designing an orthonormalized array group, and the judgment that 刖 (5) does not respond independently is as follows:

 (a) The existence of a self-trapping array in the array of 1

(b) the degree of stability of the secondary structure of sequence 1 is high; and

 (c) If there is a cross predication between multiple sequences,

3. A method according to any one of the preceding claims, characterized in that the method is performed if at least one of the above is true.

 4. A method for designing an orthonormalized array group, wherein the confirmation described in (4) above is performed by:

 (A) Existence of self-complementary sequence to each sequence,

 (B) Degree of secondary structure stability of each sequence, and

 (c) the existence of x-nosie pre-division between multiple sequences,

In the order of (A) to (C), at any stage of (A) to (C), the existence of a self-trapping sequence in the sequence of (a) 1 exists, and (b) the secondary structure of the A high degree of stability, and

 (c) that there is a cross-division between multiple sequences;

The method according to claim 3, wherein, when a result corresponding to the above is obtained, the random sequence obtained such a result is excluded from the group of the catching sequences without performing further analysis.

5. The first group of crude sequences consisting of a plurality of random sequences described in (1) and the second group of crude sequences consisting of random sequences used for comparison in (2) are different groups. The method according to any one of claims 1 to 4

 6. The plurality of random arrangements according to (1);

The method according to any one of claims 1 to 5, wherein the random sequences used for the comparison in (2) are all sequences having the same length.

 7. The first group of coarse arrays consisting of a plurality of random sequences according to (1) is equal to the second group of random arrays consisting of random sequences used for comparison in (2). The method described in.

 8. The range limited by the threshold is a temperature range corresponding to ± 1σ when the distribution of T m at each length is regarded as a normal distribution.

O The method according to any one of Items 1 to 7 of the blue item.

 9. Confirmation of whether or not the sequence reacts independently in the above (4) is performed on the base sequence included in the candidate sequence group obtained in the above (3), and at the same time, The method according to any one of claims 1 to 8, further comprising the step of confirming whether or not the complementary strand is a sequence that independently reacts with all other sequences that should not be a pair. The method described in the section.

 10 0. A method for designing an orthonormalized array group to be executed on a digital computer,

'(1) The arithmetic means calculates the average of the melting temperatures of the plurality of random arrays and sets the threshold value. (2) When the threshold value of BX At at m BB (1) is compared with the melting temperature of the random sequence by the comparing means,

 (3) From the result of the comparison in the above (2), only sequences that fall within a certain range limited by the threshold value are selected by the selection means, thereby giving candidate sequences. And and

 (4) The determination means determines whether or not each of the base sequences contained in the candidate sequence group given in item (3) is a sequence that independently reacts, and from the result, Sequences determined not to react independently are excluded from the fu candidate sequence group to form an orthonormalized sequence group, and

Method for Designing Orthonormalized Arrays with A

 1 1. For the design method of the orthonormalized array group performed in the digital computer,

 (1) Random sequences are provided by means of base sequence random production, and

 (2) The melting temperature of the random sequence given in (1) is given by the arithmetic means, and the melting temperature is stored in the storage means.

 (3) The average value of the melting temperature is given by the arithmetic means based on the plurality of melting temperatures given by the repetition of the notation (1) and the above (2).

 (4) The calculation means gives a threshold value based on the average value of the melting temperatures given in (3), and the comparison means gives the threshold temperature and a random sequence given by the base sequence random creation means. Melting

,

To compare (5) Based on the result of the comparison in the above (4), the base means having a melting temperature within the range limited by the threshold value is set as a candidate sequence by the writing means, and

 (6) For the candidate sequence group stored in BU IB ^ 5), the judgment means judges the following items (A) to (C).

·>-Line la and

 (A) whether the sequence has a self-complementary sequence ~ h ~, and

/ Or

 (B) the degree of stability of the secondary structure, and

 (C) Whether the array has a π-snoopy pre-division

 (7) Based on the result of the judgment in (6), the orthonormalized array group is set by selecting the array to be selected by the selection means.

 -When you measure

How to prepare

 1 2 • By means of base sequence random creation in W1 (1)-Assignment of random sequences generates random numbers and replaces salts & from the generated random numbers according to a predetermined correspondence. The method of claim 11, which is achieved by

 1 3 • Based on the base sequence included in the orthonormalized sequence group designed by the method according to any one of claims 1 to 12, reduce the number of nucleic acids having the base sequence to a minimum. Combine two or more types

·> · A method for producing a nucleic acid group obtained by an orthonormalized sequence comprising and o

1 4 • A nucleic acid produced by the production method according to claim 13 for use by combining a plurality of types of sequences.

15. The nucleic acid according to claim 14, wherein the nucleic acid is a peptide nucleic acid.