WO2004090138A1 - Method for the production of vitamin b12 - Google Patents

Abstract

The invention relates to a method for producing vitamin B12, in which a vector containing a nucleotide sequence according to SEQ ID No. 1 is produced, a microorganism is transformed by means of said vector, and the obtained microorganism is used for producing vitamin B12. The invention further relates to said vector and the microorganisms that are transformed therewith.

Description

 Process for the production of vitamin B12

The present invention relates to a method for producing vitamin B12, wherein a vector containing a nucleotide sequence according to SEQ ID No. 1. is produced, a microorganism is transformed with a corresponding vector and the microorganism thus produced is used for the production of vitamin B12. The invention further relates to the vector mentioned above and the microorganisms transformed therewith.

As early as the 1920s, vitamin B _{12 was} indirectly discovered by its effects on the human body by George Minot and William Murphy (Stryer, L, 1988, In Biochemie, fourth edition, pp. 528-531, Spektrum Akademischer Verlag GmbH, Heidelberg, Berlin, New York). Vitamin B _{12 was} first purified and isolated in 1948, so that eight years later, in 1956, Dorothy Hodgkin's complex three-dimensional crystal structure was elucidated (Hodgkin, DC et al., 1956, Structure of Vitamin B ₁₂ . Nature 176, 325-328 and Nature 178, 64-70). The natural end products of vitamin Bi ₂ biosynthesis are 5 - deoxyadenosylcobalamin (coenzyme B ₁₂ ) and methylcobalamin (MeCbl), while vitamin B ₁₂ by definition stands for cyanocobalamin (CNCbl), which is the form that is mainly manufactured and traded by industry represents. In the present invention, unless specifically stated, vitamin B _{12 stands} for the designation of all three analog molecules.

Various groups of microorganisms are suitable for the biotechnological production of vitamin B12, such as, for example, microorganisms of the genera Bacillus, Pseudomonas, Propionibacterium, Aerobacter, Agrobacterium, Alcaligenes, Azotobacter, Clostridium, Corynebacterium, Flavobacterium, Micromonospora, Mycobacterium, Norcardia, Protaminobacter, Proteus, Rhizobium, Salmonella, Serratia, Streptomyces, Streptococcus or Xanthomonas.

The object of the present invention is to provide an improved microbiological process for the production of vitamin B12, with which an increased yield can be achieved compared to previously known processes.

This object is achieved by the provision of a process for the production of vitamin B12 where a) a vector containing a nucleotide sequence according to SEQ ID No. 1. is produced, b) a microorganism is transformed with a corresponding vector and c) the microorganism thus produced for the production of

Vitamin B12 is used.

Preferred embodiments are a method of the aforementioned type, in which the microorganism belonging to the genus Bacillus, Pseudomonas, Propionibacterium, Aerobacter, Agrobacterium, Alcaligenes, Azotobacter, Clostridium, Corynebacterium, Flavobacterium, Micromonospora, Mycobacterium, Norcardia, Protaminobizoblob, Proteusmonobob Serratia, Streptomyces, Streptococcus or Xanthomonas belongs. A microorganism of the genus Bacillus is preferably used, and particularly preferably the species Bacillus megaterium.

A method for producing vitamin B12 is also advantageous, in which a culture medium containing xylose is used in step 1.c). In a variant, 0.2-1% xylose, preferably 0.2% to 0.7% xylose, particularly preferably 0.5% xylose, can be added to the culture medium per liter of culture medium. It is also advantageous in process step 1.c) to use a culture medium containing cobalt. In a variant of the method according to the invention, the vitamin B-12 content can be increased by adding about 200 to 750 μM, preferably 250 to 500 μM cobalt per liter of culture medium.

The use of a combination of xylose and cobalt in the culture medium used is also included here.

Another embodiment is a method for producing vitamin B12, in which a culture medium containing kanamycin or neomycin is used in step 1.c). The addition of kanamycin is preferred. For example, a final concentration of 0.69 μM is set. The use of a combination of kanamycin, neomycin, xylose and / or cobalt in the culture medium is also included.

Another variant of the method for producing vitamin B12 is a method in which the cbiX gene in the vector is under the control of an inducible promoter. The cbiX gene codes for a cobalt chelatase (Leech et al., 2002, Biochem. Soc. Transac, 30 (4): 610-613). The term cbiX gene coding for a cobalt chelatase is analogous for Bacillus megaterium, Salmonella typhimurium and Pseudomonas denitrificans. In Salmonella, the gene is called cbiK or cbiL. According to the invention, the cbiX gene from Bacillus megaterium is preferred (Leech et al., 2002, Biochem. Soc. Transac, 30 (4): 610-613). The expression of the cbiX gene is controlled from an inducible promoter. The xylose-inducible xylA promoter (Rygus, T. et al., 1991, Appl. Microbiol. Biotechnol. 35: 594-599; Rygus, T. et al., 1992, J. Bacteriol., 174: 3049 to 3055). Vectors are further variants in the process according to the invention for the production of vitamin B12 in which the. cbiX gene under the control of, for example, the inducible Promotors lacZ (Jacob, F. & Monod, J., 1961, J. Mol. Biol., 3: 318-356) tet (Skerra, A., Gene. 151: 131-135) or the T7 system (Moffat , BA & Studier, FW, 1986, J. Mol. Biol. 189: 113-130).

Another variant of the production method according to the invention is a method in which the vector for selecting the successful transformation into a microorganism has at least one neomycin and / or kanamycin resistance cassette (Schmiedel, D., Vary, PS, Jablonski, L. & Hillen, W ., 1997, Appl. Microbiol. Biotechnol. 47, 543-546).

A particularly advantageous embodiment of the production process for vitamin B12 is a process in which the vector can be replicated extrachromosomally in the microorganisms. This means that the vector is freely present in the cell after transformation into the microorganism and is replicated based on a so-called origin of replication of the vector. In an advantageous variant of the present method for producing vitamin B12, a vector is also included which ori _ts a temperature-sensitive origin of replication (Schmiedel, D., Vary, PS, Jablonski, L. & Hillen, W., 1997, Appl. Microbiol. Biotechnol., 47, 543-546). The oripE194ts (Schmiedel, D., Vary, PS, Jablonski, L. & Hillen, W., 1997, Appl. Microbiol. Biotechnol., 47, 543-546) is preferred. The temperature-sensitive origin of replication from pE194ts for B. megaterium permits stable replication of the vector in B. megaterium only below 40 ° C. No replication of the vector takes place above this permissive temperature. The replication of the vector is prevented by a method of temperature shift during the cultivation of a microorganism known to the person skilled in the art, for example from 30 ° C. to 42 ° C. Due to the cultivation of the transforms contained in the vector in medium containing antibiotics, a Selection pressure towards an integration of the vector into the chromosome of the microorganism. Due to the cbiX gene contained in the vector, this integration can take place in a homologous section of the chromosome of a suitable microorganism, preferably Bacillus megaterium, via single crossing-over recombination into the chromosome. A preferred embodiment of the process for the production of vitamin B12 is thus a process in which the vector is integrated into the chromosome of the microorganism and is replicated chromosomally. Ie the vector is subject to chromosomal replication of the genome in the host cell.

The present invention furthermore relates to a vector containing a nucleotide sequence according to SEQ ID No. 1.

This vector has the property that it is freely replicable in a host cell, that is, it is present extrachromosomally and to which it is replicated. The copy number of the vector in the host cell can range from two to several hundred copies, depending on the origin of replication of the vector. The vector can also be specifically integrated into the genome of the host cell, so that it is subject to the control of the chromosomal replication of the host cell. By introducing known DNA sequences of the target locus of the desired integration site into the genome of the host cell, the single-crossing-over recombination event can be specifically controlled. The integration also makes it possible to place chromosomally encoded genes of the host cell under the expression control of an inducible promoter.

The vector according to the invention contains elements for replication in E. coli (origin of replication from pBR322) and in B. megaterium

(Origin of replication from pE194ts and the repF gene). The repF- Gene product is described as a trans-acting factor necessary for replication of the plasmid in Gram-positive bacteria (Villafane et al., 1987, J. Bacteriol., 169: 4822-4829). A further embodiment variant is thus a vector which has a temperature-sensitive origin of replication ori _ts . For example, the oripE194ts (Schmiedel, D., Vary, PS, Jablonski, L. & Hillen, W., 1997, Appl. Microbiol. Biotechnol., 47, 543-546) is preferred. The temperature-sensitive origin of replication from pE194ts for B. megaterium allows stable replication of these plasmids in B. megaterium only below 40 ° C. The plasmid does not replicate above this permissive temperature. As a result, clones in which the plasmid is integrated into the B. megaterium chromosome can be selected by culturing conditions above 40 ° C. (Rygus & Hillen, 1992, J. Bacteriol., 174: 3049-3055).

In a preferred embodiment, the vector has the cbiX gene of the cobl operon (Raux et al., 1998, Biochem. J., 335: 159-166 and Raux et al., 1998, Biochem. J., 335: 167- 173) under the control of an inducible promoter. The cbiX gene codes for a cobalt chelatase (Leech et al., 2002, Biochem. Soc. Transac, 30 (4): 610-613). The term cbiX gene coding for a cobalt chelatase is analogous for Bacillus megaterium, Salmonella typhimurium and Pseudomonas denitrificans. The cbiX gene from Bacillus megaterium is preferred (Leech et al., 2002, Biochem. Soc. Transac, 30 (4): 610-613). Expression of the cbiX gene by the xylose-inducible xylA promoter is preferred (Rygus, T. et al., 1991, Appl. Microbiol. Biotechnol. 35: 594-599; Rygus, T. et al., 1992, J. Bacteriol., 174: 3049-3055). This promoter enables the induction of genes inserted into the multiple cloning site of the vector. This multiple cloning site is located directly downstream of the xylA promoter. Finally, the vector has ampicillin resistance for selection in E. coli and various antibiotic resistance for selection in B. megaterium transformants. In a preferred variant, the vector is characterized in that it has at least one neomycin and / or kanamycin resistance cassette for the selection of successfully transformed microorganism cells.

The individual components of the vector are used according to common recombination and cloning techniques, as described, for example, in Sambrook, J. et al., 1989, In Molecular cloning; a laboratory manual. 2 ^nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York described operatively linked. An operative link is understood to mean the sequential arrangement of, for example, the promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended when expressing the coding sequence. These regulatory nucleotide sequences can be of natural origin or can be obtained by chemical synthesis. To connect the DNA fragments to one another, adapters or linkers can be attached to the fragments.

A vector according to the invention is produced by fusing a suitable inducible promoter with the nucleotide sequence of the cbiX gene using common recombination and cloning techniques, as described, for example, in Sambrook, J. et al., 1989, In Molecular cloning; a laboratory manual. 2 ^nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York described.

The coding region of the cbiX gene was amplified by means of PCR using chromosomal DNA from B. megaterium. Suitable inducible promoters are e.g. B. xylA, lacZ, tet or T7, with the xylose-inducible xylA promoter being preferred. An example of a vector according to the invention is the vector pHBBM2 with a nucleotide sequence according to SEQ ID No. 1.

Because of the cbiX gene contained, the vector according to the invention can be inserted into a homologous section of the chromosome of a suitable one

Microorganism, preferably Bacillus megaterium, via single crossing

Integrate over-recombination into the chromosome. To select this

Integration event, the temperature-sensitive origin is important.

The vector is replicated at 30 ° C. Microorganisms that have taken up the vector by transformation can be selected by neomycin or kanamycin. When the temperature is raised to 42 ° C, the vector can no longer be replicated. This means that only the

Transformants can grow the vector and thus the

Have integrated neomycin resistance into their chromosome. Both neomycin and kanamycin can be used for selection, since both belong to the aminoglycoside family and are very similar in their chemical structure. Kanamycin is preferably used.

The present invention also relates to a genetically modified microorganism which contains a vector

Nucleotide sequence according to SEQ ID No. 1. A possible

The variant is a genetically modified microorganism in which the vector described above can be replicated extrachromosomally.

Another variant is a genetically modified microorganism, in which the vector described above into the chromosome of the

Microorganism is integrated and is replicated chromosomally.

A genetically modified microorganism is preferred which is used for

Species belonging to Bacillus megaterium.

According to the invention, the transformation of plant cells with a vector containing a nucleotide sequence according to SEQ ID is also conceivable

No. 1. In principle, all the usual B. megaterium strains which are suitable as vitamin B12 production strains can be used for the purposes of the present invention. For the purposes of the present invention, vitamin B12 production strains are to be understood as Bacillus megaterium strains or homologous microorganisms which are modified by classic and / or molecular genetic methods in such a way that their metabolic flow is increasingly in the direction of the biosynthesis of vitamin B12 or its derivatives ( metabolic engineering). Interesting starting points for targeted genetic engineering manipulation include branches of the biosynthetic pathways leading to vitamin B-12, through which the metabolic flow can be controlled in the direction of maximum vitamin Bi ₂ production. Targeted modifications of genes involved in the regulation of the metabolic flow also include studies and changes in the regulatory areas before and after the structural genes, such as the optimization and / or the exchange of promoters, enhancers, terminators, ribosome binding sites, etc. Also the improvement of stability the DNA, mRNA or the proteins encoded by them, for example by reducing or preventing degradation by nucleases or proteases, is included according to the invention. For example, in these production strains, one or more genes and / or the corresponding enzymes, which are at key and correspondingly complexly regulated key positions in the metabolic pathway (bottleneck), are changed or even deregulated. The present invention encompasses all known vitamin B12 production strains of the genus Bacillus or homologous organisms. The strains advantageous according to the invention include in particular the strains of B. megaterium DSMZ 32, DSMZ 509 and DSMZ 2894. The strain B. megaterium DSMZ 509 is particularly preferred.

The strain B. megaterium results from the transfer of a vector according to the invention, for example into Bacillus megaterium DSMZ 509

DSMZ 509 :: pHBBM2, in which the vector according to the invention is replicated extrachromosomally. Due to an increased copy number of the cbiX gene by the freely replicable vector in the cell, a corresponding overexpression of the cbiX gene coding for the cobalt chelatase is achieved. By cultivating the genetically modified

Microorganism with the addition of xylose in the culture medium can

Expression of the cbiX gene can be initiated again intensified. That the

Vector can be used for the induced overexpression of the cbiX gene coding for the cobalt chelatase in a host cell, preferably B. megaterium.

When the vector according to the invention is integrated into the genome of B. megaterium DSMZ 509 (via the cbiX gene), the B. megaterium strain results, which is designated HBBM3. It is noteworthy for this strain that it allows inducible overexpression of the cbiX gene and the other (11) genes of the cobl operon that are organized downstream of cbiX. One embodiment of a genetically modified microorganism is thus characterized in that it has an inducible expression of the chromosomally encoded genes cbiX, cbiJ, cbiC, cbiD, cbiET, cbiL, cbiF, cbiG, cbiA, cysG ^A , cbiY and / or btuR of the cobl- Has operons. If the cbiX gene is under the control of the xylA promoter, the gene expression of the cobl operon starting from cbiX can be initiated again by adding xylose to the culture medium. Control of gene expression by inducible promoters, such as. B. xylose, allowed in the course of culturing the genetically modified microorganism depending on the Growth phase of the organism to optimally increase vitamin B12 production.

In a further embodiment of the present invention, in addition to the overexpression of the cbiX genes or the genes of the entire cobl operon based on cbiX, the activity of the encoded enzymes themselves can also be increased or increased by preventing the degradation of the enzyme proteins. Furthermore, genes could be overexpressed that code for enzymes that are altered in their regulation, for example not subject to feedback inhibition by end products.

The present invention furthermore relates to the use of a vector of the above-described embodiments for transforming microorganisms. It is particularly advantageous to use a vector containing a nucleotide sequence according to SEQ ID No. 1. This includes the use of a vector for the inducible expression of at least the cbiX gene of the cobl operon. The use of a vector containing a nucleotide sequence according to SEQ ID No. 1 for the integration of the cbiX gene under the control of an inducible promoter into the chromosomal cobl operon of a host cell is also the subject of the present invention, the cbiX gene and the genes following it in the chromosomal organization of the cobl operon under the control of an inducible promoter. Thus, the use of a vector for the inducible expression of the chromosomally encoded is also. Genes of the cobl operon comprising cbiX are included, the vector being integrated into the genome of the host organism by homologous recombination via the cbiX gene. This therefore includes the use of a vector containing a nucleotide sequence according to SEQ ID No. 1 for the inducible expression of the chromosomally coded genes cbiX, cbiJ, cbiC, cbiD, cbiET, cbiL, cbiF, cbiG, cbiA, cysG ^A , cbiY and / or btuR of the cobl operon.

The present invention also includes the use of a vector of the variants described above for the production of vitamin B12. The present invention also relates to the use of a genetically modified microorganism according to one of the embodiments described above for the production of vitamin B12.

The following examples serve to explain the present invention. However, they have no limiting effect on the invention.

1. Bacterial strains and plasmids

All bacterial strains and vectors used in this work are listed in Tables 1 and 2.

Tab. 1: Bacterial lambs

^* DSMZ: German collection of microorganisms and cell cultures, Braunschweig

Tab. 2: Vectors

2. Media and media supplements

full media

Unless otherwise specified, Luria-Bertani was used with full medium

Broth (LB) as with Sambrook et. al (1989, In Molecular cloning;. A Laboratory Manual 2 ^nd Ed, Cold Spring Harbor Laboratory Press, Cold.

Spring Harbor, New York). For solid media, an additional 15 g agar per liter was added.

minimal media

Mopso minimal medium Mopso (pH 7.0) 50.0 mM

Tricin (pH 7.0) 5.0 mM

MgCI ₂ 520.0 µM

K ₂ S0 ₄ 276.0 μM

FeS0 ₄ 50.0 μM CaCI ₂ 1.0 mM

MnCI ₂ 100.0 μM

NaCI 50.0 mM

KCI 10.0 mM

K ₂ HP0 ₄ 1.3 mM (NH ₄ ) ₆ Mo ₇ 0 ₂₄ 30.0 pM

H ₃ B0 ₃ 4.0 nM

CoCI ₂ 300.0 pM

CuS0 ₄ 100.0 pM

ZnS0 100.0 pM D-glucose 20.2 mM

NH ₄ CI 37.4 mM

Titration reagent was KOH solution. Salmonella typhimurium minimal medium

NaCI 8.6 mM

Na ₂ HP0 ₄ 33.7 mM

KH ₂ PQ ₄ 22.0 mM

NH ₄ CI 18.7 mM

D-glucose 20.2 mM

MgSO ₄ 2.0 mM

CaCI ₂ 0.1 mM

15 g / l agar agar was added for solid media.

additions

Additives such as carbon sources, amino acids, antibiotics or salts were either added to the media and autoclaved together with them, or prepared as concentrated stock solutions in water and sterilized or sterile filtered. The substances were added to the autoclaved and cooled to below 50 ° C media. In the case of light-sensitive substances such as tetracycline, care was taken to incubate in the dark. The final concentrations commonly used were as follows:

ALA 298 µM

Ampicillin 296 μM C Caassaammiinnooaacciiddss 0.025% (w / v)

CoCI ₂ (in aerobic cultures) 250 μM

CoCI ₂ (in anaerobic cultures) 500 μM

Cysteine 285 µM

Erythromycin 6.8 μM G Glluuccoossee 22 M.

Glycerin 217 mM

Kanamycin 0.69 µM

Lysozyme 1 mg / ml

Methionine 335 μM T Teettrraaccyycclliinn ((iinn ffeesstteenn MMeeddiieenn)) 23 μM

Tetracycline (in liquid media) 68 μM

Xylose 33 M

3. Microbiological techniques sterilization

Unless otherwise stated, all media and buffers were steam sterilized for 20 min at 120 ° C and 1 bar overpressure. Temperature-sensitive substances were sterile filtered (pore diameter of the filter 0.2 μm), glassware was heat sterilized at 180 ° C for at least 3 h.

Growth conditions for Bacillus megaterium

Bacteria were removed from a LB agar plate or from a glycerol culture using a sterile inoculation loop and added to the nutrient medium, which contained an antibiotic if required.

Aerobic bacterial cultures were incubated in baffled flasks at 37 ° C and a speed of 250 rpm. The incubation times were varied according to the desired optical densities of the bacterial cultures.

Determination of cell density

The cell density of a bacterial culture was determined by measuring the optical density (OD) at 578 nm, it being assumed that an OD ₅₇₈ of one corresponds to a cell count of 1x10 ⁹ cells.

4. Molecular biological methods

General techniques such as DNA preparation, restriction of DNA, ligation, PCR, sequencing, functional complementation, protein expression etc. are part of common laboratory practice and are described by Sambrook, J. et al. (1989, In Molecular cloning;.. A laboratory manual ^2nd Ed, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York).

Production of competent Escherichia coli cells

To produce competent E. coli cells, 500 ml

Liquid cultures cultivated with LB medium up to an OD ₅₇₈ of 0.5-1. The Culture was cooled on ice and centrifuged (4000 xg; 15 min; 4 ° C). The cell sediment was well resuspended in sterile, deionized water, centrifuged (4000 xg; 8 min; 4 ° C), washed again with sterile, deionized water and centrifuged again (4000 xg; 8 min; 4 ° C). After washing the sediment with 10% (v / v) glycerol solution, centrifugation was carried out (4000 × g; 8 min; 4 ° C.) and the sediment was resuspended in as little as possible 10% (v / v) glycerol solution. The competent E. coli cells were used immediately for the transformation.

Transformation of bacteria by electroporation The transformation was carried out by electroporation using a gene pulser with a connected pulse controller (BioRad). For this purpose, 40 μl of competent E. coli or B. megaterium cells and 1 μg of plasmid DNA were transferred to a transformation cuvette and exposed to a field strength of 12 kV / cm at 25 μF and a parallel resistance of 200 Ω in the Gene Pulser. The parallel resistance and the capacitance in the case of B. megaterium were varied as described in the results section. For the subsequent regeneration, the transformed cells were incubated in a 1 ml LB medium immediately after the transformation, in the case of B. megaterium for one hour at 37 ° C. on a thermal shaker. Various volumes of the batches were then spread out on LB plates with the appropriate addition of antibiotics and incubated at 37 ° C. overnight.

Protoplast transformation of Bacillus megaterium protoplast preparation

50 ml LB medium were inoculated with 1 ml of an overnight culture of B. megaterium and incubated at 37 ° C. At an OD ₅₇₈ of 1, the cells were centrifuged off (10000 × g; 15 min; 4 ° C.) and resuspended in 5 ml of freshly prepared SMMP buffer. After adding Lysozyme in SMMP buffer, the suspension was incubated for 60 min at 37 ° C and protoplast formation was checked under the microscope. After harvesting the cells by centrifugation (3000 xg; 8 min; Rt), the cell sediment was carefully resuspended in 5 ml SiVIMP buffer and the centrifugation and washing step was carried out a second time. After adding 10% (v / v) glycerol, the protoplast suspension could now be portioned and frozen at -80 ° C.

Transformation 500 μl of the protoplast suspension were mixed with 0.5 to 1 μg DNA in SMMP buffer and 1.5 ml PEG-P solution was added. After incubation at Rt for 2 min, 5 ml of SMMP buffer were added, mixed gently and the suspension centrifuged (3000 x g; 5 min; Rt). Immediately afterwards, the supernatant was removed and the barely visible sediment was resuspended in 500 μl SMMP buffer. The suspension was incubated at 37 ° C. for 90 min with gentle shaking. Then 50-200 μl of the transformed cells were mixed with 2.5 ml of cR5 top agar and placed on LB agar plates which contained the antibiotics suitable for the selection. Transformed colonies became visible after one day incubation at 37 ° C.

Required solutions:

SMMP buffer Antibiotic Medium No. 3 (Difco) 17.5 g / l

Sucrose 500.0 mM

Na maleinate (pH 6.5) 20.0 mM

MgCI ₂ 20.0 mM titration reagent was NaOH solution.

PEG-P solution

PEG 6000 40.0% (w / v)

Sucrose 500.0 mM

Na maleinate (pH 6.5) 20.0 mM MgCl ₂ 20.0 mM The titration reagent was NaOH solution. cR5 top agar

Sucrose 300.0 mM

Pug (pH 7.3) 31.1 mM

NaOH 15.0 mM

L-proline 52.1 mM

D-glucose 50.5 mM

K ₂ SO ₄ 1.3 mM

MgCl ₂ x 6 H ₂ O 45.3 mM

313.0 µM

CaC 13.8 mM

Agar 4.0% (w / v)

Casaminoacids 0.2% (w / v)

Yeast extract 10.0% (w / v)

The titration reagent was NaOH solution.

DNA amplification by means of polymerase chain reaction (PCR) To amplify the desired DNA fragments from the B. megaterium chromosome, 20 μl PCR reaction batches were carried out. 2 μl of 10-fold PCR buffer, 20 ng of chromosomal DNA from B. megaterium, 0.2 μl of 50 mM MgCl ₂ solution and 1 μl of dATP, dCTP, dGTP and dTTP mix of 10 mM each were used per batch. To this end, 20 pmol of the two primers were added, made up to 20 μl with sterile water and covered with a drop of mineral oil in order to avoid evaporation. After quantitative denaturation for 5 min at 96 ° C., 0.5 U Taq polymerase were finally added and the PCR started (hot start).

Usually used temperature program of the PCR

The theoretical hybridization temperature was calculated using the following equation:

T _M = 69.3 ° C + 0.41 ^o C - (% _GC ) - ^^ n

Here (% GC) stands for the GC content of the primers in percent and n for the number of bases. As a correction, 1 ° C was deducted per percent mismatch. The polymerization time depended on the length of the PCR product to be amplified. The Taq DNA polymerase used for most PCR reactions polymerizes at about 1000 bp per minute.

Purification of PCR amplificates

For the purification of PCR amplificates, the entire PCR batch was separated electrophoretically using an agarose gel. After staining for ethidium bromide, the DNA fragment of interest was cut out of the agarose gel and the DNA was purified using a peQLab DNA agarose gel extraction kit (E.Z.N.A. gel extraction kit) from the company PeQLab.

Recombinant protein production Overexpression of genes in Bacillus megaterium 150 ml LB medium were inoculated with 1.5 ml of a recombinant B. megaterium overnight culture and incubated aerobically at 37 ° C. The bacteria were selected by the respective antibiotic. After an OD _δ78 of 0.3 was reached, the xyl promoter of the expression plasmid was induced by adding 0.5% (w / v) xylose. Before induction and at certain times after induction, a sample of 3 OD ₅₇₈ equivalents was taken. The samples taken were centrifuged (12000 xg; 3 min; Rt) and the sedimented cells were resuspended in 40 μl digestion buffer. The suspension was then incubated at 37 ° C. for 30 min. 5 μl of SDS-PAGE sample buffer were added to 20 μl of the digestion and, after boiling for 15 minutes in a water bath, centrifuged at 15,000 rpm for 30 min (8000 × g; 10 min; Rt). The supernatant was analyzed by SDS-PAGE.

Required solutions: digestion buffer

EDTA (pH 6.5) 20.0 mM

Na ₃ PO ₄ 100.0 mM

Lysozyme 5 mg / ml titration reagent was H ₃ PO ₄ solution.

Construction of the vectors pHBintE, pHBintT. pHBintN pHBintE The starting plasmids were pWH1967E (Schmiedel et al., 1997, Appl. Microbiol. Biotechnol., 47: 543-546) and pMM1520 (Malten, 2002, diploma thesis at the Technical University Carolo-Wilhelmina in Braunschweig, Braunschweig). The two plasmids were first cut with Pstl and Hindill. The complete batch was then applied to an agarose gel and the fragments of interest eluted. The 4198 bp fragment of pWH1967E contained the gene for erythromycin resistance, the repF gene, the temperature-sensitive origin of replication from pE194ts for B. megaterium and DNA for about the C-terminal half of the ampicillin resistance-mediating beta-lactamase.

The 1485 bp fragment of pMM1520 contained the xylA promoter from B. megaterium, a multiple cloning site directly upstream of the promoter, the origin of replication from pBR322 for E. coli and the DNA for the N-terminal half of the beta-lactamase, the so in Target vector restores ampicillin resistance. The cohesive ends of the two fragments were ligated. This type of cloning is extremely advantageous since only the correctly ligated target vector is complete

Resistance gene for E. coli has. The plasmid obtained in this way was given the name pHBintE, E standing for the erythromycin resistance in B. megaterium.

pHBintT

Starting from pHBintE, the DNA region mediating erythromycin resistance was first cut out of pHBintE and replaced by a corresponding DNA sequence mediating tetracycline resistance (tet). For this purpose, the tetracycline resistance gene from the vector pMM1520 was amplified by means of PCR and subsequent primers. An Nsil interface was integrated in the forward and a HindII interface in the reverse primer (underlined).

Forward 5 '- AAGCATGCATCAGGGTTATTGTCTCATGAGCGG - 3' Reverse 5 '- AAAAAAGCTTCCTTGATGACACAGAAGAAGGCG - 3'

The DNA fragment containing the tet gene was then purified on an agarose gel and the DNA was eluted. pHBintE and the amplified tet fragment were cut, purified and ligated with the restriction enzymes Nsil (Mph1103l) and HindIII. The resulting plasmid was called pHBintT. The integrity of the cloned DNA was checked by complete DNA sequence determination.

pHBintN

The plasmids pHBintT and pWH1967K (Schmiedel et al., 1997, Appl. Microbiol. Biotechnol., 47: 543-546) were used to produce the vector pHBintN with a neomycin resistance gene. To do this, the DNA for the larger N-terminal part of the tetracycline resistance mediating protein from pHBintT with Ncol and Hindlll cut out. The neömycin resistance gene (neo) contained in pWH1967K was amplified by means of PCR and the primers listed below and, after cutting with Ncol and HindIII, ligated with the cut pHBintT. Here, an Ncol interface was integrated in the forward and a HindII interface in the reverse primer (underlined). In addition, the integrity of the ononized DNA was checked by complete DNA sequence determination.

Forward 5 '- GGATCCATGGGTCGACTCTAGAGCTTGGG - 3'

Reverse 5 '- CCACAAGCTTGTCATCGTTCAAAATGGTATGCG - 3'

The new plasmid pHBintN thus has the same properties as pHBintE or pHBintT, except that Bacillus transformants can be selected with this integrative vector for neomycin instead of erythromycin or tetracycline.

Construction of the vector pHBBm2

For this purpose, the cbiX gene was first amplified by means of PCR. As

Chromosomal B. megaterium DNA was used as template. Since the sequence of the cbiX gene from B. megaterium is known (Leech et al., 2002, Biochem. Soc. Transac, 30 (4): 610-613), primers could be derived, which are listed below. A six-base restriction site (Spei and Xmal) and four additional bases were added to the sequence homologous to the B. megaterium gene for the primers.

Representation of the PCR primers for the amplification of the cbiX gene by PCR. A Spel interface was integrated in the forward and an Xmal interface in the reverse primer (underlined). Forward 5 '- AGATACTAGTGAAATGGGAGGACATTATATG - 3' Reverse 5 '- ACAACCCGGGCATTTTAGCTCGCCGACC - 3'

To clone the vector pHBBm2, pHBintN and the PCR-amplified cbiX fragment were cut with Spei (Beul) and X times. In pHBintN, the two restriction sites are located behind the xylA promoter in the multiple cloning site. The cohesive ends resulting from the restriction were finally ligated to the integration vector pHBBm2. With the ligation mixture, competent E. coli DH10B were transformed by electroporation and spread on LB plates with ampicillin addition and incubated at 37 ° C. overnight.

To check the plasmid construction of pHBBm2, plasmid mini-preps were carried out. The extracted plasmid DNA was cut with Xmal and Spei (Beul) for control. These two enzymes cut pHBBm2 into 6413 bp and 931 bp fragments. An agarose gel from the restriction mixture showed the expected fragments and documents the successful cloning of pHBBm2. A schematic representation of the cloning strategy is shown in FIG. 1. In addition, the integrity of the cloned DNA was checked by complete DNA sequence determination.

The integration vector pHBBm2 contains ampicillin and neomycin resistance for selection in E. coli or in B. megaterium from pHBintN. The replication origin from pBR322 is used for replication in E. coli and the temperature-sensitive origin of replication from pE194ts in B. megaterium.

Sequencing pHBBm2 also revealed an error in the published sequence of the cbiX gene (Leech et al., 2002, Biochem. Soc. Transac, 30 (4): 610-613): CbiX contains two additional amino acids, also through a

Amino acid sequence comparison of cbiX genes from different bacteria could be shown (Figures 2 and 3).

Chromosomal integration of pHBBM2 in Bacillus megaterium

The integration vector pHBBm2, since it has a homologous section to the B. megaterium chromosome due to the cbiX insertion, can integrate into the chromosome via single crossing-over recombination (FIG. 4).

The temperature-sensitive origin of replication from pE194ts is important for the selection of this integration event. B. megaterium DSM509 transformants, which have taken up the plasmid by protoplast transformation, can be selected by resistance to the antibiotics neomycin or kanamycin. When the temperature is raised to 42 ° C, the plasmid can no longer be freely replicated and must either integrate into the chromosome or be lost. This means that only those transformants can grow that have integrated the plasmid and thus the neomycin resistance in their chromosome. Both neomycin and kanamycin can be used for selection, since both belong to the aminoglycoside family, are very similar in their chemical structure and are therefore converted by the resistance-mediating enzyme. In order to integrate pHBBM2 into the chromosome, an LB culture of the transformant B. megaterium DSM509-pHBBM2 with 5 μg / ml erythromycin and 0.23% xylose was incubated under aerobic conditions at 30 ° C. After approx. 12 h, the temperature was raised to 42 ° C., so that the plasmid could no longer be replicated. After a further 12 h, inoculation was carried out in new LB medium and incubation was continued at 42 ° C. Cultivation was carried out over a total of 3 days, with inoculation on new medium after every 12 hours. After that time showed there was good growth of the LB medium, which indicated the integration of the plasmid into the chromosome. The integration itself takes place via a single crossing-over mechanism between the chromosomally localized cbiX and the homologous cbiX gene of the pHBBM2 plasmid. The xylsose-inducible xylA promoter is installed upstream of the cbiX gene after integration into the chromosome (FIG. 4). The new B. megaterium strain created with the integration of the pHBBM2 plasmid was called HBBm3. In addition to cbiX, HBBmS can also be used to overexpress the 11 genes of the cobl operon that are located behind cbiX in the chromosome (FIG. 5).

5. Determination of Vitamin Bι? Concentrations Two different methods were used for quantitative vitamin Bι ₂ determination. Firstly, the determination was made based on the growth rate of

S. typhimurium metE cysG double mutants, on the other hand with the RIDASCREEN ^® FAST Vitamin B ₁₂ ELISA test from r-biopharm in microtiter plate format.

Vitamin Bg determination with S. tvphimurium metE cvsG double mutants Samples of B. megaterium cultures were taken in different growth phases. After determining the OD ₅₇₈ , the cells were separated from the medium by centrifugation (4000 × g; 15 min; 4 ° C.). The cell sediments obtained and the media removed were then freeze-dried.

S. typhimurium metE cysG double mutants (AR 3612; Raux et al., 1996, J. Bacteriol., 178: 753-767) were incubated overnight on minimal medium containing methionine and cysteine at 37 ° C., scratched from the plate and at 40 ml of isotonic NaCI solution washed. After centrifugation, the cell sediment was resuspended in isotonic saline. The washed bacterial culture was carefully mixed with 400 ml 47-48 ° C warm, medium medium agar containing cysteine.

10 μl of the B. megaterium samples resuspended in deionized, sterile water and boiled for 15 minutes in a water bath were added to the cooled plates and incubated at 37 ° C. for 18 hours. The diameter of the grown Salmonella colonies are then proportional to the content of vitamin Bι _{2 of} the applied B. megaterium samples. By comparison with a calibration curve, made from the addition of 0.01, 0.1, 1, 10 and 40 pmol vitamin Bι ₂ , the content of vitamin B ₁₂ in the examined samples was inferred. This method quickly allows the detection of small amounts of vitamin B-ι ₂ in biological materials, but is associated with a relatively large standard deviation.

Vitamin Bι? Determination with the ELISA test principle:

It is based on an antigen-antibody reaction. For this purpose, the wells of a microtiter plate are coated with specific antibodies against vitamin B-ι ₂ . After the addition of enzyme-labeled vitamin B-ι ₂ (enzyme conjugate) and sample solutions or vitamin Bi ₂ standard solutions, free and enzyme-labeled vitamin B-ι ₂ compete for the vitamin B ₁₂ antibody binding sites (competitive enzyme immunoassay). The Bi ₂ -coupled enzyme is a peroxidase. Unbound enzyme-labeled vitamin B ₁₂ is then removed again in a washing step. Evidence is provided by adding SubstraW chromogen solution (tetramethylbenzidine / urea peroxide). Bound enzyme conjugate converts the chromogen into a blue end product. The addition of the stop reagent leads to a color change from blue to yellow. The measurement is carried out photometrically at 450 nm. As the amount of vitamin B12 in the sample increases, fewer and fewer enzyme-coupled B ₁₂ are bound by the antibodies , the absorbance of the solution is inversely proportional to the vitamin Bi ₂ concentration in the sample.

Implementation: 2 ml samples were taken from the B. megaterium liquid culture to be measured at different times of growth and the OD578 was determined. The cells were separated from the medium by subsequent centrifugation (4000 × g; 5 min; 4 ° C.), the supernatant was discarded and the sediment was freeze-dried. Now the required reagents (standards, enzyme conjugate and wash buffer concentrate) of the test kit were brought to room temperature and prepared and diluted as described in the associated instructions. The samples were prepared immediately before the test. For this purpose, the freeze-dried cells were resuspended in 0.5 ml of sterile, deionized water. The addition of 50 μl lysozyme solution (1 mg / ml), subsequent incubation (30 min; 37 ° C; shaking at 300 rpm), ultrasound (5 min) and boiling (3 min; 100 ° C) made a quantitative Cell disruption reached. The samples were then cooled to room temperature with ice and centrifuged (4000 x g; 5 min; 15 ° C). The supernatant was removed and diluted 1: 5 with the sample dilution buffer.

Now it was possible to pipette 50 μl of the diluted samples or the diluted vitamin Bi ₂ standards into the cavities of the microtiter plate. After the addition of 50 μl of the diluted enzyme conjugate, the mixture was mixed (shaking function in the microtiter plate reader) and incubated (15 min; RT). Following the incubation, the wells were emptied by tapping the microtiter plate and washed with 250 μl wash buffer per well. The cavities were emptied again by tapping and the washing step was repeated twice. Equitemporally, two drops of stop reagent were added per cavity, mixed and incubated for 10 min at room temperature in the dark. After Equitemporal addition of two drops of the stop reagent per cavity, the absorbance at 450 nm was measured in the Packard microtiter plate reader. The percentage absorbance was calculated as follows for evaluation:

Absorbance standard or sample _ _ _n _. ,. , , , 100 = absorbance in%

Absorbance zero standard

A calibration line could now be determined by plotting the absorbance in% over log (ppb). Using the straight line equation, the dilution factor and the known cell density (OD578), the vitamin B ₂ content of the samples in μg / L and μg / (LxOD5 ₇ s) could then be specified.

6. Coproporphyrin HI determination by fluorescence spectroscopy. 2 ml samples were taken from the B. megaterium liquid culture to be measured at different times of growth and the OD was determined for ₅ s. The cells were separated from the medium by subsequent centrifugation (4000 × g; 5 min; 4 ° C.), the supernatant was discarded and the sediment was freeze-dried.

Immediately before a measurement, the samples were resuspended in 1 ml of sterile, deionized water and then the optical densities were exactly adjusted by dilution with water. 1 ml of these adjusted samples were now mixed with 50 μl lysozyme (1 mg / ml) and incubated at 37 ° C. for 30 min in a shaker at 300 rpm. The samples were then placed in an ultrasound bath for 10 min and then centrifuged at 4000 xg for 3 min. The fluorescence measurement was now carried out with the supernatant. The following settings were made: Start: 430 nm

End: 680 nm

Excitation: 409 nm

Ex Slit 12 nm

Em Slit: 12 nm

Scan speed: 200 nm / min

Coproporphyrin III can be recognized in the fluorescence spectrum by its maxima at 590 nm and 620 nm.

7. Aerobic growth and overexpression of cbiX and the cobl operon in Bacillus megaterium DSM509-pHBBm2 and HBBm3

The B. megaterium strains HBBm3 and DSM509 with pHBBm2 were cultivated in LB medium to which 0.4 μg / ml kanamycin was added at 42 ° C. (DSM509-pHBBm2 at 30 ° C.) under aerobic conditions. Since the overexpressed cobalt chelatase CbiX catalyzes an increased incorporation of cobalt in sirohydrochlorin in both strains, additional growth studies were carried out with the addition of 250 μM CoCI ₂ , which rule out cobalt limitation and make the suspected catalytic effect of CbiX more detectable. All cultures were induced at an OD ₅₇₈ of 0.3 with 0.5% xylose. B. megaterium HBBm3 shows no significant difference between growth with and without addition of cobalt. Both cultures reach a maximum OD ₅₇₈ of 2.3. With this maximum OD ₅₇₈ , however, they are significantly below the maximum OD ₅₇₈ of 7.2 of the parent strain DSM509. The reduced growth indicates an activity of the integrated pHBBm2. The cultures of B. megaterium DSM509 with freely replicable pHBBm2 show a clear difference between growth with and without C0CI2. Interestingly, the culture with the addition of cobalt achieves a higher OD ₅₇₈ (2.8) than without C0CI2 (OD ₅₇₈ = 2.3). This speaks for the activity of the cobalt chelatase CbiX, since an increased cobalt insertion into the tetrapyrroles of the vitamin B ₁₂ synthetic pathway should lead to a reduced concentration of the cobalt which is toxic for the bacteria in the cell.

8. Vitamin B? Production from Bacillus megaterium DSM509-pHBBm2 and HBBm3

The B. megaterium strains HBBm3 and DSM509 with pHBBm2 were cultivated in LB medium to which 0.4 μg / ml kanamycin was added at 42 ° C. (DSM509-pHBBm2 at 30 ° C.) under aerobic conditions. Cultures with and without addition of cobalt were examined. 5 hours after induction, the samples were checked for their vitamin B ₁₂ content using the ELISA vitamin Bi ₂ test. The evaluation of the ELISA test is shown in Figure 1 and Figure 2.

Both the overexpression of the cobl operon of the HBBm3 cultures (5 and 6) and the overexpression of the cbiX gene in the DSM509-pHBBm2 cultures (3 and 4) lead to an increase in vitamin B ₁₂ contents compared to the parent strain DSM509 (1 and 2).

It can be seen from FIG. 1 that in cultures without addition of cobalt (1, 3, 5) there is an increase in the vitamin B ₂ content from 0.04 μg / LxOD ₅₇₈ in the starting strain (1) to 0.45 μg LxODs ₇₈ HBBmS (5) comes. This corresponds to an increase by a factor of 11. Interestingly, the same increase results for the DSM509-pHBBm2 cultures (3) (0.43 μg / LxOD ₅ 7δ), although only the cobalt chelatase has been overexpressed here.

If you next consider the vitamin Bi ₂ contents of the cultures with 250 μM CoCI ₂ (2, 4, 6), you will notice a general increase in vitamin Bj ₂ contents in all cultures. It is interesting that the transformed strains show a higher vitamin B ₂ increase compared to the cultures without addition of cobalt due to the overexpressed cobalt chelatase than is the case with the parent strain DSM509. The vitamin Bi ₂ content of the parent strain DSM509 (1) increases by a factor of 4 when cobalt was added to 0.16 μg / LxOD ₅₇ 8 (2). DSM509-pHBBm2 (4; 0.82 μg / LxOD ₅₇₈ ) and HBBm3 (6; 0.79 μg / LxOD ₅₇₈ ) both show a factor 5 increase compared to the starting strain with 250 μM C0CI ₂ (2). This means that the increase in vitamin B ₂ levels in the transformants cannot be explained solely by the effect of the addition of cobalt. This means that the cbiX overexpression causes an increase in the vitamin B-ι ₂ production of the B. megaterium transformants.

If one also looks at the vitamin values in μg / L that are important for industrial production (Figure 2), the result is similar to the values in μg / LxOD ₅ 78- Overall, however, the vitamin B ₂ increases are lower because the Transformants showed significantly worse growth than the parent strain. This reduces the high vitamin B12 increases per cell (μg / LxODs ₇₈ ) due to the lower number of cells per liter of medium. Nevertheless, the B. megaterium transformant DSM509 with pHBBm2 with added cobalt has a vitamin B-12 content of 1.59 μg / L. This corresponds to an increase by a factor of 3 compared to the parent strain DSM509 with 250 μM C0CI ₂ (0.56 μg / L).

For a better overview, all vitamin Bi ₂ contents of Figures 1 and 2 are summarized in Table 3. Table 3:

Legend to the figures

In the following the present invention will be explained with reference to the figures.

Figure 1 shows a schematic representation of the cloning strategy of the plasmid pHBBm2. The cbiX fragment amplified by PCR and the vector pHBintN were cut with Spei (Beul) and Xmal and the resulting cohesive ends ligated to the integration vector pHBBm2. CbiX comes under the control of the xylA promoter (black).

FIG. 2 shows a comparison of the DNA sequences of the cbiX gene from Bacillus megaterium (NEU.seq) sequenced in the present application with the previously known cbiX gene (ALT.seq) from Bacillus megaterium (Leech et al., 2002, Biochem Soc Transac, 30 (4): 610-613).

FIG. 3 shows a partial comparison of the amino acid sequence derived from the cbiX gene (NEU. Pro) sequenced in the present application with the amino acid sequence (ALT.pro) of the previously known cbiX gene from Bacillus megaterium (Leech et al., 2002, Biochem. Soc. Transac, 30 (4): 610-613) and other known amino acid sequences of the protein.

FIG. 4 shows a schematic representation of an integration event of pHBBm2 via single crossing-over recombination in the B. megaterium chromosome. After integration, the cbiX gene with the subsequent genes of the operon is under the control of the xylA promoter, which can thus be induced by means of xylose. Highlighted in white: genes of the B. megaterium chromosome. Black background: genes of the plasmid DNA. FIG. 5 shows a schematic representation of the cobl operon from B. megaterium (Raux et al., 1998 a, b). By integrating a xylose inducible promoter (xylA promoter from B. megaterium) in front of the cbiX gene, an overexpression of the following genes in the operon is to be made possible. The suspected vitamin Bi ₂ feedback inhibition by cbiW and cbiHeo is avoided

Figure 6 shows the vitamin Bι ₂ production of the B. megaterium strains DSM509, DSM509-pHBBm2 and HBBm3. All strains were cultured in LB medium under aerobic growth conditions. The filled bars show the vitamin Bi ₂ contents of cultures without added cobalt. The striped bars show the vitamin B ₂ contents of cultures with 250 μM CoCI ₂ addition. The content of vitamin B ₁₂ per cell mass is given in μg / LxODs7 ₈ after 5 h of xylose induction. 1 and 2: OSM509

3 and 4: DSM509-pHBBm2 5 and 6: HBBm3

Figure 7 shows the vitamin Bι production of the B. megaterium strains DSM509, DSM509-pHBBm2 and HBBm3. All strains were cultured in LB medium under aerobic growth conditions. The filled bars show the vitamin B ₂ contents of cultures without the addition of cobalt. The striped bars show the vitamin Bi ₂ contents of cultures with 250 μM CoCI addition. It is the content of vitamin B-ι in μg per liter of bacteria culture given after 5 h of xylose induction. 1 and 2: DSM509 3 and 4: DSM509-pHBBm2 5 and 6: HBBmS

Claims

Expectations:

1. Process for the production of vitamin B12 where a) a vector containing a nucleotide sequence according to SEQ ID No. 1. is produced, b) a microorganism is transformed with a corresponding vector and c) the microorganism thus produced is used for the production of vitamin B12.

2. The method according to claim 1, characterized in that the microorganism belongs to the genus Bacillus, Pseudomonas or Propionibacterium.

3. The method according to claim 1 or 2, characterized in that the microorganism belongs to the species Bacillus megaterium.

4. The method according to any one of claims 1 to 3, characterized in that a culture medium containing xylose is used in step 1.c).

5. The method according to any one of claims 1 to 4, characterized in that a culture medium containing cobalt is used in step 1.c).

6. The method according to any one of claims 1 to 5, characterized in that in step 1.c) a culture medium containing kanamycin or neomycin is used.

7. The method according to any one of claims 1 to 6, characterized in that in the vector, the cbiX gene is under the control of an inducible promoter.

8. The method according to any one of claims 1 to 7, characterized in that in the vector, the cbiX gene is under the control of the xylose-inducible xylA promoter.

9. The method according to any one of claims 1 to 8, characterized in that the vector for selection at least one

Neomycin and / or Kanamycin resistance cassette.

10. The method according to any one of claims 1 to 9, characterized in that the vector has a temperature-sensitive origin of replication ori _ts .

11. The method according to any one of claims 1 to 10, characterized in that the vector is replicable extrachromosomally in the microorganisms.

12. The method according to any one of claims 1 to 11, characterized in that the vector is integrated into the chromosome of the microorganism and is replicated chromosomally.

13. Vector containing a nucleotide sequence according to SEQ ID No. 1.

14. Vector according to claim 13, characterized in that the cbiX gene is under the control of an inducible promoter.

15. Vector according to one of claims 13 or 14, characterized in that the cbiX gene is under the control of the xylose-inducible xylA promoter.

16. Vector according to one of claims 13 to 15, characterized in that it has at least one neomycin and / or kanamycin resistance cassette for selection.

17. Vector according to one of claims 13 to 16, characterized in that it is a temperature-sensitive

Origin of replication ori _ts .

18. Genetically modified microorganism containing a vector according to any one of claims 13-17.

19. Genetically modified microorganism according to claim 18, characterized in that the vector according to one of claims 13-17 is replicable extrachromosomally.

20. Genetically modified microorganism according to one of claims 18 or 19, characterized in that the vector according to one of claims 13-17 is integrated into the chromosome of the microorganism and is replicated chromosomally.

21. Genetically modified microorganism according to one of claims 18 to 20, characterized in that it belongs to the species Bacillus megaterium.

22. Use of a vector according to one of claims 13 to 17 for the transformation of microorganisms.

23. Use of a vector according to one of claims 12 to 15 for the production of vitamin B12.

24. Use of a genetically modified microorganism according to one of claims 18 to 21 for the production of vitamin B12.